Enhancing Apoptosis and Ferroptosis: Synergistic Effects of Sorafenib and Dasatinib Nano-systems in Overcoming Drug Resistance in MULV-4 Cell lines | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Enhancing Apoptosis and Ferroptosis: Synergistic Effects of Sorafenib and Dasatinib Nano-systems in Overcoming Drug Resistance in MULV-4 Cell lines Mohammad Eini, Hamid Babavalian, Ali Salimi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5294691/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Sorafenib, a tyrosine kinase inhibitor used in hepatic and hematologic malignancies, often leads to drug resistance in cancer cells over time. This study explores the synergistic effects of sorafenib, dasatinib, and their respective PCL-based nano-systems in overcoming resistance mechanisms. The research reveals an orchestrated modulation of gene expression, upregulating pro-apoptotic genes like Bax and downregulating anti-apoptotic genes such as GPX4, NRF2, and SLC7A11, resulting in cancer cell death. These treatments enhance apoptosis, elevate ROS levels, reduce GPX4 activity, and inhibit colony formation, suggesting a dual induction of ferroptosis and apoptosis pathways. The study underscores the potential of nanocarriers in enhancing the efficacy of sorafenib and dasatinib against resistant cancer cells, providing insights into the molecular mechanisms underlying their anti-cancer effects. ALL MULV-4 PCL sorafenib Dasatinib Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction: Acute lymphoblastic leukemia (ALL) is a prevalent hematologic malignancy originating from lymphoid precursor cells. Patients experience complications due to an abnormal increase in white blood cells and malfunction of these cells. ALL is categorized into B-ALL and T-ALL based on the cell lineage involved(1). B-ALL has made significant advancements in diagnosis and treatment, particularly with the use of tyrosine kinase inhibitors (TKIs) to extend survival in Philadelphia chromosome-positive patients. However, a considerable portion of B-ALL cases lack the Philadelphia chromosome, leading to a varied prognosis(2, 3). This study investigates the potential of the sorafenib - dasatinib combination (PCL) to target the NRF2 signaling pathway and overcome sorafenib resistance. Ferroptosis, a type of iron-dependent cell death induced by reactive oxygen species and lipid peroxidation, has emerged as a promising therapeutic target for cancer(4). Studies have shown that ferroptosis can induce tumor cell death and inhibit tumor growth. NRF2, a key regulator of oxidative stress, has been implicated in promoting cancer resistance to both apoptosis and ferroptosis. Increased NRF2 levels have been observed even in the absence of genetic mutations, suggesting the involvement of alternative signaling molecules in its aberrant activation.(5) Sorafenib, a chemotherapeutic agent utilized in the treatment of various cancers, has been found to suppress the NRF2 transcription factor, thereby increasing oxidative stress and promoting the generation of reactive oxygen species, ultimately leading to ferroptosis(6). Recent research suggests that sorafenib specifically targets the SLC7A11 channel, inducing ferroptosis within cells(7). While sorafenib is effective in treating liver and kidney malignancies, the development of sorafenib resistance poses a challenge. Strategies to overcome sorafenib resistance include second-line tyrosine kinase inhibitors, combination therapies, and utilizing nano-systems for drug delivery. Dasatinib, a potent BCR-ABL inhibitor, has demonstrated efficacy in treating Philadelphia chromosome-positive acute lymphoblastic leukemia (Ph + ALL). Studies have shown that dasatinib treatment results in the downregulation of several NRF2 target genes, suggesting a potential connection between tyrosine kinases, NRF2 signaling, and ferroptosis. Furthermore, dasatinib has been observed to induce complete hematologic and cytogenetic remissions in B-ALL patients, although these remissions are often temporary. Dasatinib significantly impacts NRF2 nuclear localization, leading to a decreased ratio of nuclear to cytoplasmic NRF2 fluorescence intensity(8). The investigation into the potential impact of tyrosine kinase inhibitors, such as dasatinib, on NRF2 signaling in the management of B-ALL, particularly in relation to ferroptosis, represents a compelling avenue for further scientific inquiry. A comprehensive understanding of the interactions among tyrosine kinases, NRF2 signaling, and ferroptosis could offer valuable insights for the development of targeted therapeutics for B-ALL patients, especially those lacking the Philadelphia chromosome. In response to the challenges associated with sorafenib drug resistance, this study illustrates the reversal of resistance by the synergistic effects of dasatinib in combination with sorafenib facilitated by drug nanocarriers. This innovative approach presents a promising strategy for overcoming drug resistance, potentially restoring sensitivity in refractory cases. 2. Material and methods 2.1 Sorafenib and dasatinib loading on the PCL and physicochemical Characterization In sorafenib and dasatinib (Sobhan-Iran) Nano-complex synthesis, Polycaprolactone (Sigma-USA) (PCL) was dissolved in chloroform through vigorous mixing, while sorafenib and dasatinib was dissolved in dimethyl sulfoxide (DMSO). Consequently, the sorafenib and dasatinib solution was gradually introduced to PCL at a temperature of 40º C. Following 48–72 hours, the solution underwent freeze-drying to remove excess moisture before being re-dissolved in DMSO and be stored at -20º C. In order to evaluate the physical characteristics and potential applications of Nano particles, the synthesized PCL-sorafenib, PCL-dasatinib and PCL-sorafenib-dasatinib nano complex underwent analysis using scientific techniques including Fourier transform infrared (FTIR), Dynamic Light Scattering (DLS), and Thermogravimetric analysis (TGA). 2.2 Cell culture and treatment The MULV-4 -is a human B cell precursor leukemia cell line- were obtained from the Pasteur Institute of Iran, Tehran. The cells were cultured at a temperature of 37°C in an environment containing 5% CO2, using RPMI 1640 culture media (Gibco, USA) supplemented with 10% fetal bovine serum (FBS; BioSera, France), 1% penicillin/streptomycin (Gibco, USA). The MULV-4 cell line was treated with sorafenib (1-100 µM), dasatinib (1-100 µM), PCL-sorafenib (1-1000 nM)- PCL-dasatinib (1-1000nM) and PCL-sorafenib-dasatinib (0.1–100 nM). Untreated cell was conducted as control group. 2.3 Establishing MULV-4 cell lines with acquired resistance to sorafenib MULV-4 cells may become resistant to sorafenib treatment after some time. To investigate the effects of sorafenib resistance, MULV-4 cells were treated with 0.1 to 25 µM sorafenib for 8 weeks, so that the drug dose was increased after every 6 days. Unlike the MULV-4 cell lines, After 8 weeks the MULV-4 resistant cells doesn't affect with 25 µM sorafenib. 2.4 Cell growth and viability assay using MTT The trypan blue dye (Gibco-UK) exclusion technique was employed to analyze cell viability and growth kinetics in this study. The number of viable cells per milliliter was determined using a hemocytometer by counting cells under a light microscope with an equal volume of cell suspension and 5% trypan blue solution. For the 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide (Betacell-Iran) (MTT) test, a 96-well plate with a flat-bottomed microtiter format was used. Each well received 100 µL of complete growth media, and different concentrations of dasatinib, sorafenib-dasatinib, PCL-sorafenib, PCL-dasatinib and PCL-sorafenib-dasatinib were added in triplicate. The wells were seeded with 100 µL of MULV-4 cells/mL and incubated in a CO2 incubator for 24 hours. Then 10 µL MTT solution was added to each well and incubated for 4 hours. To dissolve the developed formazan, each well was treated with 100 µL DMSO. The plate reader recorded the absorbance at wavelengths of 570 and 630 nm, and cell viability was calculated compare to control group. 2.5 RNA extraction and qRT-PCR In accordance with the manufacturer's instructions, the RNA Extraction Kit (GeneAll Hybrid R-Korea) was used to extract total RNA from the MULV-4 cells. The amount of RNA was measured using spectrophotometry at wavelengths of 260 and 280 nanometer (Nanodrope, EPOCH, USA). 1 ng of total RNA was used to create complementary DNA (cDNA) using oligo dT primer and MMLV reverse transcriptase. The relative expression of GPX4, P53, NRF2, NRAS, KRAS, BCL2, Cas3, Cas8, Cas9 and SLC7A11 was evaluated using qRT-PCR on a StepOne real-time PCR technique (Applied Biosystems). The cDNA samples were mixed with the amplicon SYBR Green master mix (Amplicon A325402-25 2X qRT-PCR Master Mix Green-High Rox) and designed primers (Table 1 ). The diffenences in mRNA levels in the targeted genes were computed using the 2 −ΔΔ CT method approach with triplicate amplifications. The real-time PCR protocol involved an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds. Subsequently, a melt curve analysis was performed to assess the specificity of the amplified products. Table 1 primer sequence used in qRT-PCR Primer name Forward Reverse NRF2 CAGCGACGGAAAGAGTATG CACTGGTTTCTGACTGGATG GPX4 CCTTTGCCGCCTACTGAAG CACGTTGGTGACGATGCAC CAS3 ACCAGTGGAGGCCCACTTCT GCATGGCACAAAGCCACTGG CAS8 GTGGATAGGCCTGTGACGAA TGAGGGAGGCCAGATCTTCA Bcl2 CCGCTACCGCCGCGACTTC AAACAGAGGCCGCATGCTG NRAS AAAGCGCACTGACAATCC TTCGCCTGTCCTCATGTATTG KRAS CTTGTGGTAGTTGGAGCTGG TTGACCTGCTGTGTCGAGAAT SLC7A11 CATCTCCAAAGGAGGTTAC TGCCAATGATAATGGAGACTC B-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT 2.6 Apoptosis and cell cycle assay by flow cytometry Following a 24-hour treatment, MULV-4 cells were harvested and double stained with FITC-conjugated Annexin V (Sigma-USA) and propidium iodide (PI). The emissions of Annexin V and PI were measured using the FL-1 (530/30 nm) and FL-3 (585/540 nm) channels (Coulter Elite), respectively. Data from approximately 10,000 cells in list mode were recorded on logarithmic scales for each sample and analyzed using FlowJo. For cell cycle detection, treated cell were fixed by ethanol 70% for 24 hours and only PI (Sigma-USA) staining was performed. 2.7 ROS production assay DCFH-DA (Teb Pazhohan Razi – Iran) was employed for the assessment of intracellular ROS production. DCFH-DA, while uncharged, is assimilated by cells and subsequently broken down by nonspecific esterase enzymes, resulting in the formation of DCFH, which carries a charge. ROS then oxidize DCFH to form highly fluorescent DCF. Following 24 hours of incubation with various drugs, the cells were exposed to DCFH-DA. Subsequently, the cells underwent two rounds of cold PBS washes before being resuspended. Finally, the fluorescence intensities of the samples were determined using a fluorescence spectrophotometer with excitation at 485 nm and emission at 530 nm. 2.8 Radical scavenging activity (RSA) In order to assess the impact of sorafenib, dasatinib and their nano complex on reducing antioxidative capacity, a scientific approach was employed. Initially, an equal number of cells were prepared using the same lysis method, which involved sonication in cold PBS. Next, 10 µL of each cell lysate were combined with 250 µL of a 1×10 − 3 M 2, 2-diphenyl-1-picrylhydrazyl (DPPH) solution in a 96-well microplate. The plate was then shielded from light and left at room temperature for 15 minutes. Subsequently, the UV absorbance of each sample was measured at a wavelength of 515 nm. The DPPH scavenging activity of the samples was expressed as a percentage relative to the control 2.9 GPX function assay GPX is an enzyme that plays a role in the mechanism of action of sorafenib. In order to ascertain the function of GPX, MULV-4 cells were subjected to varying doses of treatment and the GPX function was measured using a colorimetry-based protocol. The treated cells washed with PBS then 200 microliters of assay buffer were added and homogenized. The solution is then centrifuged for 15 minutes at 9000 rpm and 4ºC. The supernatant is separated, and 40µL of R1 solution is added and incubated for 15 minutes at room temperature. Then, 10 µL of R2 solution is added, and the optical absorption is measured at 340 nanometers. The GPX4 activity is measured according to the standard carve. 2.10 Colony forming assay Various pharmaceutical compounds were employed in the cellular treatment regimen for the CFA (Cell Functional Assay) assessment. Specifically, a total of 10 4 treated cells were introduced onto a 6 well plate subsequent to the combination of 2X RMPI-1640 medium and Nobel agar (Sigma). The culture medium was refreshed tri-weekly. After a period of 21 days, each well was administered 0.5 ml of 0.005% MTT and after 3 hours the colony was counted of each well and colony size were measured. 2.11 Statistical analysis Statistical analysis was performed using GraphPad Prism 9 software (GraphPad Software, USA). Significance tests were conducted using either one-way or two-way ANOVA, with a significance level set at P < 0.05. Data are represented as the mean ± standard error of the means (SEM). 3 Results 3.1 MTT Results Utilizing the MTT assay, sorafenib-resistant MULV-4 cells were treated with Dasatinib (15 µM), sorafenib/dasatinib (2.5–1 µM) PCL-sorafenib (150 nM), PCL-dasatinib (100 nM), and PCL-sorafenib/Dasatinib (20 nM), resulting in a 50% induction of apoptosis in the cell population. Notably, the most effective combination therapy was observed with PCL-sorafenib/Dasatinib at lower doses, exhibiting optimal effects on cell viability. These findings underscore the potential of PCL-sorafenib/Dasatinib combination therapy to induce apoptosis in sorafenib-resistant cells, highlighting the ability of sorafenib within the PCL nano-complex to overcome sorafenib resistance. 3.2 Ferroptotic and apoptotic genes expression The results demonstrated a significant downregulation GPX4, SLC7A11 and NRF2 as ferroptotic genes, so in all treatment groups, the most significant gene downregulation was observed in cells treated with the combination of PCL-sorafenib/dasatinib. Similarly, to ferroptotic genes, there was a significant upregulation in the apoptotic genes expression, including Bad, Bax, and Caspase-3, was observed. In contrast, the BCL2 as an antiapoptotic gene was found to be diminished in all treated groups, particularly in PCL-sorafenib/dasatinib treated cells. Furthermore, the expression of the ferroptotic regulator NRF2 was significantly increased in sorafenib-resistant cells, suggesting a potential mechanism for the development of sorafenib resistance through the modulation of ferroptotic regulatory genes. 3.3 Apoptosis and cell cycle arrest Results revealed that treatment of MULV-4 sorafenib-resistant cells with PCL-sorafenib led to a significant increase in the apoptotic cells percentage, reaching 49.7% compared to just 4% in the control group. Additionally, cell cycle analysis of PCL-sorafenib treated cells at 150 nM demonstrated a marked reduction in viable cells, reflected in a G1/S ratio of 10.46 versus 0.53 in the control group. Moreover, treated cells with the PCL-sorafenib/dasatinib resulted in an even higher apoptotic rate of 61.6% and a G1/S ratio of 21.1 relative to the control group. These findings indicate that the PCL-sorafenib/dasatinib combination is the most effective treatment for inducing apoptotic and cell cycle effects in MULV-4 cells, even at lower concentrations. 3.4 ROS assay Results from the reactive oxygen species (ROS) assay indicated that treatment of MULV-4 cells with sorafenib, dasatinib, and their combination with PCL resulted in an increase in cytosolic ROS levels. Notably, cells treated with PCL-sorafenib/dasatinib exhibited a two-fold elevation in ROS levels compared to the control group. This finding suggests that the treatment leads to the accumulation of ROS in the cytosol, which may contribute to cellular damage and potentially induce ferroptosis in sorafenib-resistant cells. 3.5 GPX4 activity assay The findings demonstrate that PCL-sorafenib treated cells shown significant reduction in GPX4 enzyme activity, reflecting the direct effect of sorafenib on this particular enzyme. In the treatment groups comprising dasatinib, sorafenib/dasatinib, PCL-sorafenib, PCL-dasatinib, and PCL-sorafenib/dasatinib, GPX4 activity decreased by factors of 4.3, 2.3, 5.1, and 3, respectively (Fig. 5 ). 3.6 Colony formation assay (CFA) CFA results demonstrated that PCL-sorafenib significantly decreased the number of cell colonies formed. In the other treatment groups, both the quantity and size of colonies were markedly reduced, suggesting that sorafenib, dasatinib, and their combination with PCL exert effects on cell proliferation. This results in cell cycle arrest and subsequent inhibition of cellular proliferation. 3.7 DPPH The results from the DPPH assay revealed elevated levels of oxidants and reduced levels of antioxidants in the treated cells in all of treated groups, that suggests that sorafenib and dasatinib, through modulation of GPX4 and ROS levels in the cytosol, can diminish antioxidant levels, consequently inducing cellular damage and apoptosis. 4 Discussion Sorafenib is an established therapeutic agent for renal and hepatocellular carcinoma, as well as certain hematologic malignancies, including acute myeloid leukemia (AML). However, prolonged administration of sorafenib can induce drug resistance in cancer cells, making them less responsive to its therapeutic effects. Our findings indicate that sorafenib, dasatinib, and their combination with polymeric micelles (PCL) significantly upregulate pro-apoptotic genes such as Bax and Bad, while downregulating anti-apoptotic genes (BCL-2) and anti-ferroptotic genes (GPX4, NRF2, and SLC7A11), ultimately leading to increased cancer cell death. Furthermore, these treatments enhance apoptosis, elevate levels of reactive oxygen species (ROS) and cellular oxidants, reduce GPX4 activity, diminish colony formation, lower intracellular antioxidant capacity, and concurrently activate both ferroptosis and apoptosis pathways. Resistance to sorafenib can arise in cancer cells due to alterations in the expression of anti-ferroptotic and pro-apoptotic genes, which diminishes the drug’s efficacy over time. Research has shown that the upregulation of the NRF2 gene, resulting from changes in its interaction with KEAP1, leads to the increased expression of anti-ferroptotic genes such as SLC7A11 and GPX4, thereby contributing to sorafenib resistance and the evasion of ferroptosis. Modifying treatment regimens and incorporating second-line agents like dasatinib may provide a strategy to overcome sorafenib resistance; however, these agents carry risks of adverse effects that could lead to secondary resistance and potential harm. Currently, the use of nanocarriers represents a promising strategy to address drug resistance and reduce the necessary dosage of therapeutic agents. Our results demonstrate that the application of nanocarriers in sorafenib and dasatinib nano-systems effectively mitigates sorafenib resistance, resulting in the apoptotic death of MULV-4 cancer cells at significantly lower concentrations. Toxicity assay of this drugs on MULV-4 sorafenib resistance cells, shown that cells which develop resistance to sorafenib exhibit insensitivity to the drug due to the acquisition of resistance mechanisms and changes in genomic expression profiles. In this study, the utilization of a nano-complex formulation of sorafenib, in combination with the co-administration of dasatinib, has demonstrated significant efficacy in inducing apoptosis in cancer cells. The findings indicate that the sorafenib-dasatinib nanocomplex displays enhanced effectiveness against sorafenib-resistant cells, as evidenced by an IC50 value of 20 nM for the PCL-sorafenib/dasatinib formulation in the sorafenib-resistant MULV-4 cell line. Gene expression analysis using quantitative reverse transcription polymerase chain reaction (qRT-PCR) revealed a consistent pattern across all treatment groups, characterized by the downregulation of GPX4, SLC7A11, NRF2, and BCL2 genes, alongside the upregulation of BAX, BAD, Caspase-3 (Cas3), and Caspase-8 (Cas8). Notably, the group treated with sorafenib and dasatinib exhibited the most significant changes in the expression levels of the Cas3 and Cas8 genes, whereas the PCL-sorafenib/dasatinib treatment group demonstrated the most pronounced alterations in the expression of all genes examined, with the exception of Cas3 and Cas8. Consistent with findings from [Author Name]'s study, the results demonstrate that sorafenib, dasatinib, and their respective nanocarriers possess the capability to induce cell cycle arrest by impeding the MAPK signaling pathway during the G1 phase, thereby inhibits cell proliferation(9). The precise mechanism underlying the inhibitory effects of sorafenib and dasatinib on the cell cycle remains elusive; however, prior research has indicated a substantial reduction in the expression of NRAS and KRAS genes following sorafenib treatment, suggesting the suppression of cell signaling pathways and the cessation of cancer cell proliferation in the G1 phase(10). The downregulation of signaling molecules like RAS disrupts signal transduction within the cytosol, ultimately leading to cellular demise. Upon internalization into the cell, sorafenib and dasatinib elicit an elevation in cytosolic oxidative stress levels, leading to cell death through the modulation of cellular antioxidant pathways. The findings indicate that sorafenib and dasatinib enhance reactive oxygen species (ROS) levels and oxidative stress within the cytosol by impeding the expression and functionality of GPX4(11, 12). Specifically, sorafenib demonstrates a notable reduction in GPX activity; however, the precise mechanism by which this decrease occur whether through downregulation of GPX4 gene expression or direct enzyme inhibition by sorafenib and dasatinib remains unclear. Results from ROS and GPX4 activity assays reveal a twofold increase and a 1.7-fold decrease, respectively, in the NSD treatment group, underscoring the impact of the combined treatment on oxidative stress and GPX4 activity levels. The results from colony formation assay (CFA) showed that colony size and count were diminished in the treated cells. Similarly to our results a recent study showed significant reduction in the self-renewal capacity of both MCF7 and MDA-MB-231 cells following sorafenib treatment (10, 13). However, Dasatinib, Nano-Sorafenib treated cell, no significant decrease in colony numbers was observed. This lack of impact is attributed to the reduction in the effective dose of sorafenib and dasatinib, which diminished its effect on the colonization of treated cells. The study's key findings show that PCL-Sorafenib-Dasatinib had the most significant impact on colony numbers. In conclusion, the study elucidates the intricate mechanisms underlying the development of drug resistance to sorafenib in MULV-4 cells and highlights the potential of combined treatments involving sorafenib, dasatinib, and their nano-formulations to overcome resistance. The orchestrated modulation of gene expression, with upregulation of pro-apoptotic genes and downregulation of anti-apoptotic and anti-ferroptotic genes, leads to enhanced apoptosis and disruption of cellular antioxidant pathways. These treatments induce cell death by altering ROS levels, diminishing GPX4 activity, and inhibiting colony formation, ultimately triggering ferroptosis and apoptosis pathways. The findings underscore the promise of nanocarriers in enhancing the efficacy of sorafenib and dasatinib against resistant cancer cells, offering insights into novel therapeutic strategies to combat drug resistance in malignancies. Declarations Acknowledgment: Thanks to the Deputy of research & innovation of baghiatallah University of Medical Sciences for financing the project (Grant Number: 402000061). Funding: Deputy of research & innovation of baghiatallah University of Medical Sciences(Grant number: 402000061) Financial interest: The authors declare they have no financial interests. Conflict of interest: The authors declare no conflict of interest. Ethical approval The ethics committee of Birjand University of Medical Sciences generated ethical acceptance. Contributions' authors All authors contributed to the study's conception and design. Material preparation, data collection, and analysis were performed by Mohammad Eini, Hamid Babavalian and Ali Salimi. Mohammad Eini wrote the first draft of the manuscript and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. References 1. [Available from: Available from:https://www.cancer.org/cancer/acute-lymphocytic-leukemia/about/key-statistics.html. 2. Zhang Y, Gao Y, Zhang H, Zhang J, He F, Hnízda A, et al. PDGFRB mutation and tyrosine kinase inhibitor resistance in Ph-like acute lymphoblastic leukemia. Blood, The Journal of the American Society of Hematology. 2018;131(20):2256-61. 3. Shiraz P, Payne KJ, Muffly L. The current genomic and molecular landscape of Philadelphia-like acute lymphoblastic leukemia. International Journal of Molecular Sciences. 2020;21(6):2193. 4. Li J, Cao F, Yin H-l, Huang Z-j, Lin Z-t, Mao N, et al. Ferroptosis: past, present and future. Cell death & disease. 2020;11(2):88. 5. Kanwugu ON, Glukhareva TV. Activation of Nrf2 pathway as a protective mechanism against oxidative stress-induced diseases: Potential of astaxanthin. Archives of Biochemistry and Biophysics. 2023:109601. 6. Peng W, Zhu Z, Yang Y, Hou J, Lu J, Chen C, et al. N2L, a novel lipoic acid-niacin dimer, attenuates ferroptosis and decreases lipid peroxidation in HT22 cells. Brain Research Bulletin. 2021;174:250-9. 7. Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. cell. 2012;149(5):1060-72. 8. Fauziya, Gupta A, Nadaf A, Ahmad S, Hasan N, Imran M, et al. Dasatinib: a potential tyrosine kinase inhibitor to fight against multiple cancer malignancies. Medical Oncology. 2023;40(6):173. 9. Zhang Y, Li G, Liu X, Song Y, Xie J, Li G, et al. Sorafenib inhibited cell growth through the MEK/ERK signaling pathway in acute promyelocytic leukemia cells. Oncology Letters. 2018;15(4):5620-6. 10. Dattachoudhury S, Sharma R, Kumar A, Jaganathan BG. Sorafenib inhibits proliferation, migration and invasion of breast cancer cells. Oncology. 2020;98(7):478 − 86. 11. Seiler A, Schneider M, Förster H, Roth S, Wirth EK, Culmsee C, et al. Glutathione peroxidase 4 senses and translates oxidative stress into 12/15-lipoxygenase dependent-and AIF-mediated cell death. Cell metabolism. 2008;8(3):237 − 48. 12. Yuan S, Wei C, Liu G, Zhang L, Li J, Li L, et al. Sorafenib attenuates liver fibrosis by triggering hepatic stellate cell ferroptosis via HIF-1α/SLC7A11 pathway. Cell Proliferation. 2022;55(1):e13158. 13. Bondì ML, Botto C, Amore E, Emma MR, Augello G, Craparo EF, et al. Lipid nanocarriers containing sorafenib inhibit colonies formation in human hepatocarcinoma cells. International journal of pharmaceutics. 2015;493(1–2):75–85. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5294691","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":368573851,"identity":"b5b9a35d-4c08-4ea6-b2f6-e90eb90ef197","order_by":0,"name":"Mohammad Eini","email":"","orcid":"","institution":"Baqiyatallah University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Eini","suffix":""},{"id":368573852,"identity":"1a2520a1-c901-4b42-b691-c61fce22a527","order_by":1,"name":"Hamid Babavalian","email":"","orcid":"","institution":"Baqiyatallah University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Hamid","middleName":"","lastName":"Babavalian","suffix":""},{"id":368573853,"identity":"51a47122-e085-4dd6-a00c-c54cf1a73e2f","order_by":2,"name":"Ali Salimi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+ElEQVRIie2PsQrCMBCGUwQdu0nEoa9wIGQq7YO4RAJ1ieDoIKVOjq6Cz+DqHA04iV0LXZo3KLg4OJgGXYRW3QTzDclx3Md/h5DF8pO0EoHgURdTX7/OQjQrjlGwqSlEj84bpXqfijR/o+It94tDNo1jtytVQSENtkupU+b+sE6B0yiRHCTubaIBUMjZTncEOkaTpE5BRhEYct7GlUKEVpxE1ireSlVKjMOcd64UzoykqllBmUlpYejztj5fBCR7kwKZSZG9dR4N9GKMEt0RtOEWb8Xkhd9i190wVZazICTpWBXl3K9f7JWRmaSfjleE3wxbLBbLf3AHycVmwJW338QAAAAASUVORK5CYII=","orcid":"","institution":"Baqiyatallah University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Ali","middleName":"","lastName":"Salimi","suffix":""}],"badges":[],"createdAt":"2024-10-19 13:08:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5294691/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5294691/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":68182501,"identity":"49198c60-3595-424c-9d45-dc41e777fdda","added_by":"auto","created_at":"2024-11-04 12:26:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":43800,"visible":true,"origin":"","legend":"\u003cp\u003eAnti-tumor Effect of sorafenib, dasatinib, sorafenib/dasatinib, PCL-sorafenib, PCL-dasatinib PCL-sorafenib/dasatinib on MULV-4 cell viability. cells were treated with dasatinib (a), sorafenib/dasatinib (b), PCL-sorafenib (c), PCL-dasatinib (d), PCL-sorafenib/dasatinib(f). The cell viability of the treated cells was decreased significantly compare to control group. (**** P\u0026lt;0.0001)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5294691/v1/555ab879c812d0b270e9921c.png"},{"id":68182503,"identity":"81c68856-45cb-4bad-9721-ee9a6591e89a","added_by":"auto","created_at":"2024-11-04 12:26:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":56995,"visible":true,"origin":"","legend":"\u003cp\u003eEffect sorafenib, dasatinib, sorafenib/dasatinib, PCL-sorafenib, PCL-dasatinib PCL-sorafenib/dasatinib on MULV4 cell apoptotic and ferroptotic gene expressions were determined using RT-PCR. Cell treated with different IC50 dose and the expression level of NRF2, GPX4, SLC7A11 (a), Bad, Bax, Cas3, Cas8 (b), BCL2 (c), were determined with RT-PCR and FC was calculated using 2\u003csup\u003e-ΔΔCT\u003c/sup\u003e. (**** p\u0026lt;0.0001)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5294691/v1/07e7c345d498ef5a4b5ef77a.png"},{"id":68182840,"identity":"a41f2c76-4d1d-4672-9a7a-46b64a80f488","added_by":"auto","created_at":"2024-11-04 12:34:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":22168,"visible":true,"origin":"","legend":"\u003cp\u003edepicts the activity assay conducted to measure the activity of GPX4. The assay utilized varying concentrations of NADPH. The findings revealed a decrease in GPX4 function across all groups, except for the sorafenib and PCL-Da treated groups.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5294691/v1/6a2c48e381b78a6558ecdcaf.png"},{"id":68182506,"identity":"46af91b4-0084-4e0d-9fef-560d93745a5a","added_by":"auto","created_at":"2024-11-04 12:26:55","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":347368,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of Dasatinib, PCL sorafenib, PCLdasatinib and thier co-treatment on MULV-4 cell apoptosis by PI and annexin V. cells were treated with Dasatinib (a), So/Da (b), PCL-So (c) PCL-Da (d), PCL-So/Da (e), and control (f). The cell viability of the treated cells by using PI and annexin V was decreased significantly compare to control group (f). the percentage of apoptotic cell were 38.7% (a), 46.6% (b), 49.7% (c), 16.8% (d) , 62.6% (e), and 4% (f).Effect of of Dasatinib, PCL sorafenib, PCLdasatinib and thier co-treatment on MULV-4, cell cycle and proliferation (g).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5294691/v1/516b11f9f0d72c1c0c3032d6.png"},{"id":68182505,"identity":"2e5e8ef0-a9e1-4c26-8ccd-5a287da1da2d","added_by":"auto","created_at":"2024-11-04 12:26:54","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":29423,"visible":true,"origin":"","legend":"\u003cp\u003edepicts the results of the reactive oxygen species (ROS) assay. The concentration of ROS was determined using various ROS detection techniques, which illustrated an elevation in ROS generation in all experimental groups except for the sorafenib treated group.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5294691/v1/7fe508298f7de99790d2b79f.png"},{"id":68182841,"identity":"413089b5-c7a6-43fc-8422-255b292d52e7","added_by":"auto","created_at":"2024-11-04 12:34:54","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":50662,"visible":true,"origin":"","legend":"\u003cp\u003eColony Forming Assay was conducted to assess the impact of treatment. In subfigure (a), the size of the colonies was measured following the treatment. In subfigure (b), the total number of colonies was counted.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5294691/v1/d238fb0c8801310d9812fd33.png"},{"id":68182507,"identity":"98fe857d-977d-4f8b-84e0-d9e86825c14a","added_by":"auto","created_at":"2024-11-04 12:26:55","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":30829,"visible":true,"origin":"","legend":"\u003cp\u003eDPPH assay in sorafenib, dasatinib, So/Da PCL-So, PCL-Da, PCL-So/Da MULV-4 treated cells. The DPPH were increased significantly in all of the treated cells were expect of sorafenib treated cells.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5294691/v1/9db9fb21a7eb8da79abfce03.png"},{"id":68610340,"identity":"30f95bc0-6600-4ade-96b7-a11eacac1773","added_by":"auto","created_at":"2024-11-09 09:46:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":927127,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5294691/v1/254167d7-644e-466d-b01e-213791a6def6.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Enhancing Apoptosis and Ferroptosis: Synergistic Effects of Sorafenib and Dasatinib Nano-systems in Overcoming Drug Resistance in MULV-4 Cell lines","fulltext":[{"header":"1. Introduction:","content":"\u003cp\u003eAcute lymphoblastic leukemia (ALL) is a prevalent hematologic malignancy originating from lymphoid precursor cells. Patients experience complications due to an abnormal increase in white blood cells and malfunction of these cells. ALL is categorized into B-ALL and T-ALL based on the cell lineage involved(1). B-ALL has made significant advancements in diagnosis and treatment, particularly with the use of tyrosine kinase inhibitors (TKIs) to extend survival in Philadelphia chromosome-positive patients. However, a considerable portion of B-ALL cases lack the Philadelphia chromosome, leading to a varied prognosis(2, 3). This study investigates the potential of the sorafenib - dasatinib combination (PCL) to target the NRF2 signaling pathway and overcome sorafenib resistance.\u003c/p\u003e \u003cp\u003eFerroptosis, a type of iron-dependent cell death induced by reactive oxygen species and lipid peroxidation, has emerged as a promising therapeutic target for cancer(4). Studies have shown that ferroptosis can induce tumor cell death and inhibit tumor growth. NRF2, a key regulator of oxidative stress, has been implicated in promoting cancer resistance to both apoptosis and ferroptosis. Increased NRF2 levels have been observed even in the absence of genetic mutations, suggesting the involvement of alternative signaling molecules in its aberrant activation.(5)\u003c/p\u003e \u003cp\u003eSorafenib, a chemotherapeutic agent utilized in the treatment of various cancers, has been found to suppress the NRF2 transcription factor, thereby increasing oxidative stress and promoting the generation of reactive oxygen species, ultimately leading to ferroptosis(6). Recent research suggests that sorafenib specifically targets the SLC7A11 channel, inducing ferroptosis within cells(7). While sorafenib is effective in treating liver and kidney malignancies, the development of sorafenib resistance poses a challenge. Strategies to overcome sorafenib resistance include second-line tyrosine kinase inhibitors, combination therapies, and utilizing nano-systems for drug delivery.\u003c/p\u003e \u003cp\u003eDasatinib, a potent BCR-ABL inhibitor, has demonstrated efficacy in treating Philadelphia chromosome-positive acute lymphoblastic leukemia (Ph\u0026thinsp;+\u0026thinsp;ALL). Studies have shown that dasatinib treatment results in the downregulation of several NRF2 target genes, suggesting a potential connection between tyrosine kinases, NRF2 signaling, and ferroptosis. Furthermore, dasatinib has been observed to induce complete hematologic and cytogenetic remissions in B-ALL patients, although these remissions are often temporary. Dasatinib significantly impacts NRF2 nuclear localization, leading to a decreased ratio of nuclear to cytoplasmic NRF2 fluorescence intensity(8).\u003c/p\u003e \u003cp\u003eThe investigation into the potential impact of tyrosine kinase inhibitors, such as dasatinib, on NRF2 signaling in the management of B-ALL, particularly in relation to ferroptosis, represents a compelling avenue for further scientific inquiry. A comprehensive understanding of the interactions among tyrosine kinases, NRF2 signaling, and ferroptosis could offer valuable insights for the development of targeted therapeutics for B-ALL patients, especially those lacking the Philadelphia chromosome. In response to the challenges associated with sorafenib drug resistance, this study illustrates the reversal of resistance by the synergistic effects of dasatinib in combination with sorafenib facilitated by drug nanocarriers. This innovative approach presents a promising strategy for overcoming drug resistance, potentially restoring sensitivity in refractory cases.\u003c/p\u003e"},{"header":"2. Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Sorafenib and dasatinib loading on the PCL and physicochemical Characterization\u003c/h2\u003e \u003cp\u003eIn sorafenib and dasatinib (Sobhan-Iran) Nano-complex synthesis, Polycaprolactone (Sigma-USA) (PCL) was dissolved in chloroform through vigorous mixing, while sorafenib and dasatinib was dissolved in dimethyl sulfoxide (DMSO). Consequently, the sorafenib and dasatinib solution was gradually introduced to PCL at a temperature of 40\u0026ordm; C. Following 48\u0026ndash;72 hours, the solution underwent freeze-drying to remove excess moisture before being re-dissolved in DMSO and be stored at -20\u0026ordm; C. In order to evaluate the physical characteristics and potential applications of Nano particles, the synthesized PCL-sorafenib, PCL-dasatinib and PCL-sorafenib-dasatinib nano complex underwent analysis using scientific techniques including Fourier transform infrared (FTIR), Dynamic Light Scattering (DLS), and Thermogravimetric analysis (TGA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Cell culture and treatment\u003c/h2\u003e \u003cp\u003eThe MULV-4 -is a human B cell precursor leukemia cell line- were obtained from the Pasteur Institute of Iran, Tehran. The cells were cultured at a temperature of 37\u0026deg;C in an environment containing 5% CO2, using RPMI 1640 culture media (Gibco, USA) supplemented with 10% fetal bovine serum (FBS; BioSera, France), 1% penicillin/streptomycin (Gibco, USA). The MULV-4 cell line was treated with sorafenib (1-100 \u0026micro;M), dasatinib (1-100 \u0026micro;M), PCL-sorafenib (1-1000 nM)- PCL-dasatinib (1-1000nM) and PCL-sorafenib-dasatinib (0.1\u0026ndash;100 nM). Untreated cell was conducted as control group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Establishing MULV-4 cell lines with acquired resistance to sorafenib\u003c/h2\u003e \u003cp\u003eMULV-4 cells may become resistant to sorafenib treatment after some time. To investigate the effects of sorafenib resistance, MULV-4 cells were treated with 0.1 to 25 \u0026micro;M sorafenib for 8 weeks, so that the drug dose was increased after every 6 days. Unlike the MULV-4 cell lines, After 8 weeks the MULV-4 resistant cells doesn't affect with 25 \u0026micro;M sorafenib.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Cell growth and viability assay using MTT\u003c/h2\u003e \u003cp\u003eThe trypan blue dye (Gibco-UK) exclusion technique was employed to analyze cell viability and growth kinetics in this study. The number of viable cells per milliliter was determined using a hemocytometer by counting cells under a light microscope with an equal volume of cell suspension and 5% trypan blue solution. For the 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide (Betacell-Iran) (MTT) test, a 96-well plate with a flat-bottomed microtiter format was used. Each well received 100 \u0026micro;L of complete growth media, and different concentrations of dasatinib, sorafenib-dasatinib, PCL-sorafenib, PCL-dasatinib and PCL-sorafenib-dasatinib were added in triplicate. The wells were seeded with 100 \u0026micro;L of MULV-4 cells/mL and incubated in a CO2 incubator for 24 hours. Then 10 \u0026micro;L MTT solution was added to each well and incubated for 4 hours. To dissolve the developed formazan, each well was treated with 100 \u0026micro;L DMSO. The plate reader recorded the absorbance at wavelengths of 570 and 630 nm, and cell viability was calculated compare to control group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 RNA extraction and qRT-PCR\u003c/h2\u003e \u003cp\u003eIn accordance with the manufacturer's instructions, the RNA Extraction Kit (GeneAll Hybrid R-Korea) was used to extract total RNA from the MULV-4 cells. The amount of RNA was measured using spectrophotometry at wavelengths of 260 and 280 nanometer (Nanodrope, EPOCH, USA). 1 ng of total RNA was used to create complementary DNA (cDNA) using oligo dT primer and MMLV reverse transcriptase. The relative expression of GPX4, P53, NRF2, NRAS, KRAS, BCL2, Cas3, Cas8, Cas9 and SLC7A11 was evaluated using qRT-PCR on a StepOne real-time PCR technique (Applied Biosystems). The cDNA samples were mixed with the amplicon SYBR Green master mix (Amplicon A325402-25 2X qRT-PCR Master Mix Green-High Rox) and designed primers (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The diffenences in mRNA levels in the targeted genes were computed using the 2 \u003csup\u003e\u0026minus;ΔΔ CT\u003c/sup\u003e method approach with triplicate amplifications. The real-time PCR protocol involved an initial denaturation step at 95\u0026deg;C for 10 minutes, followed by 40 cycles of denaturation at 95\u0026deg;C for 30 seconds, annealing at 60\u0026deg;C for 30 seconds, and extension at 72\u0026deg;C for 30 seconds. Subsequently, a melt curve analysis was performed to assess the specificity of the amplified products.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eprimer sequence used in qRT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNRF2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCGACGGAAAGAGTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACTGGTTTCTGACTGGATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGPX4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTTTGCCGCCTACTGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACGTTGGTGACGATGCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCAS3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCAGTGGAGGCCCACTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCATGGCACAAAGCCACTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCAS8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGGATAGGCCTGTGACGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAGGGAGGCCAGATCTTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBcl2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGCTACCGCCGCGACTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAACAGAGGCCGCATGCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNRAS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAAGCGCACTGACAATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCGCCTGTCCTCATGTATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKRAS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTGTGGTAGTTGGAGCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGACCTGCTGTGTCGAGAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSLC7A11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATCTCCAAAGGAGGTTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCCAATGATAATGGAGACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGTACGTTGCTATCCAGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCTTAATGTCACGCACGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Apoptosis and cell cycle assay by flow cytometry\u003c/h2\u003e \u003cp\u003eFollowing a 24-hour treatment, MULV-4 cells were harvested and double stained with FITC-conjugated Annexin V (Sigma-USA) and propidium iodide (PI). The emissions of Annexin V and PI were measured using the FL-1 (530/30 nm) and FL-3 (585/540 nm) channels (Coulter Elite), respectively. Data from approximately 10,000 cells in list mode were recorded on logarithmic scales for each sample and analyzed using FlowJo. For cell cycle detection, treated cell were fixed by ethanol 70% for 24 hours and only PI (Sigma-USA) staining was performed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 ROS production assay\u003c/h2\u003e \u003cp\u003eDCFH-DA (Teb Pazhohan Razi \u0026ndash; Iran) was employed for the assessment of intracellular ROS production. DCFH-DA, while uncharged, is assimilated by cells and subsequently broken down by nonspecific esterase enzymes, resulting in the formation of DCFH, which carries a charge. ROS then oxidize DCFH to form highly fluorescent DCF. Following 24 hours of incubation with various drugs, the cells were exposed to DCFH-DA. Subsequently, the cells underwent two rounds of cold PBS washes before being resuspended. Finally, the fluorescence intensities of the samples were determined using a fluorescence spectrophotometer with excitation at 485 nm and emission at 530 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Radical scavenging activity (RSA)\u003c/h2\u003e \u003cp\u003eIn order to assess the impact of sorafenib, dasatinib and their nano complex on reducing antioxidative capacity, a scientific approach was employed. Initially, an equal number of cells were prepared using the same lysis method, which involved sonication in cold PBS. Next, 10 \u0026micro;L of each cell lysate were combined with 250 \u0026micro;L of a 1\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e M 2, 2-diphenyl-1-picrylhydrazyl (DPPH) solution in a 96-well microplate. The plate was then shielded from light and left at room temperature for 15 minutes. Subsequently, the UV absorbance of each sample was measured at a wavelength of 515 nm. The DPPH scavenging activity of the samples was expressed as a percentage relative to the control\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 GPX function assay\u003c/h2\u003e \u003cp\u003eGPX is an enzyme that plays a role in the mechanism of action of sorafenib. In order to ascertain the function of GPX, MULV-4 cells were subjected to varying doses of treatment and the GPX function was measured using a colorimetry-based protocol. The treated cells washed with PBS then 200 microliters of assay buffer were added and homogenized. The solution is then centrifuged for 15 minutes at 9000 rpm and 4\u0026ordm;C. The supernatant is separated, and 40\u0026micro;L of R1 solution is added and incubated for 15 minutes at room temperature. Then, 10 \u0026micro;L of R2 solution is added, and the optical absorption is measured at 340 nanometers. The GPX4 activity is measured according to the standard carve.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Colony forming assay\u003c/h2\u003e \u003cp\u003eVarious pharmaceutical compounds were employed in the cellular treatment regimen for the CFA (Cell Functional Assay) assessment. Specifically, a total of 10\u003csup\u003e4\u003c/sup\u003e treated cells were introduced onto a 6 well plate subsequent to the combination of 2X RMPI-1640 medium and Nobel agar (Sigma). The culture medium was refreshed tri-weekly. After a period of 21 days, each well was administered 0.5 ml of 0.005% MTT and after 3 hours the colony was counted of each well and colony size were measured.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Statistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was performed using GraphPad Prism 9 software (GraphPad Software, USA). Significance tests were conducted using either one-way or two-way ANOVA, with a significance level set at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Data are represented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the means (SEM).\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.1 MTT Results\u003c/h2\u003e \u003cp\u003eUtilizing the MTT assay, sorafenib-resistant MULV-4 cells were treated with Dasatinib (15 \u0026micro;M), sorafenib/dasatinib (2.5\u0026ndash;1 \u0026micro;M) PCL-sorafenib (150 nM), PCL-dasatinib (100 nM), and PCL-sorafenib/Dasatinib (20 nM), resulting in a 50% induction of apoptosis in the cell population. Notably, the most effective combination therapy was observed with PCL-sorafenib/Dasatinib at lower doses, exhibiting optimal effects on cell viability. These findings underscore the potential of PCL-sorafenib/Dasatinib combination therapy to induce apoptosis in sorafenib-resistant cells, highlighting the ability of sorafenib within the PCL nano-complex to overcome sorafenib resistance.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Ferroptotic and apoptotic genes expression\u003c/h2\u003e \u003cp\u003eThe results demonstrated a significant downregulation GPX4, SLC7A11 and NRF2 as ferroptotic genes, so in all treatment groups, the most significant gene downregulation was observed in cells treated with the combination of PCL-sorafenib/dasatinib. Similarly, to ferroptotic genes, there was a significant upregulation in the apoptotic genes expression, including Bad, Bax, and Caspase-3, was observed. In contrast, the BCL2 as an antiapoptotic gene was found to be diminished in all treated groups, particularly in PCL-sorafenib/dasatinib treated cells. Furthermore, the expression of the ferroptotic regulator NRF2 was significantly increased in sorafenib-resistant cells, suggesting a potential mechanism for the development of sorafenib resistance through the modulation of ferroptotic regulatory genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Apoptosis and cell cycle arrest\u003c/h2\u003e \u003cp\u003eResults revealed that treatment of MULV-4 sorafenib-resistant cells with PCL-sorafenib led to a significant increase in the apoptotic cells percentage, reaching 49.7% compared to just 4% in the control group. Additionally, cell cycle analysis of PCL-sorafenib treated cells at 150 nM demonstrated a marked reduction in viable cells, reflected in a G1/S ratio of 10.46 versus 0.53 in the control group. Moreover, treated cells with the PCL-sorafenib/dasatinib resulted in an even higher apoptotic rate of 61.6% and a G1/S ratio of 21.1 relative to the control group. These findings indicate that the PCL-sorafenib/dasatinib combination is the most effective treatment for inducing apoptotic and cell cycle effects in MULV-4 cells, even at lower concentrations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.4 ROS assay\u003c/h2\u003e \u003cp\u003eResults from the reactive oxygen species (ROS) assay indicated that treatment of MULV-4 cells with sorafenib, dasatinib, and their combination with PCL resulted in an increase in cytosolic ROS levels. Notably, cells treated with PCL-sorafenib/dasatinib exhibited a two-fold elevation in ROS levels compared to the control group. This finding suggests that the treatment leads to the accumulation of ROS in the cytosol, which may contribute to cellular damage and potentially induce ferroptosis in sorafenib-resistant cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.5 GPX4 activity assay\u003c/h2\u003e \u003cp\u003eThe findings demonstrate that PCL-sorafenib treated cells shown significant reduction in GPX4 enzyme activity, reflecting the direct effect of sorafenib on this particular enzyme. In the treatment groups comprising dasatinib, sorafenib/dasatinib, PCL-sorafenib, PCL-dasatinib, and PCL-sorafenib/dasatinib, GPX4 activity decreased by factors of 4.3, 2.3, 5.1, and 3, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Colony formation assay (CFA)\u003c/h2\u003e \u003cp\u003eCFA results demonstrated that PCL-sorafenib significantly decreased the number of cell colonies formed. In the other treatment groups, both the quantity and size of colonies were markedly reduced, suggesting that sorafenib, dasatinib, and their combination with PCL exert effects on cell proliferation. This results in cell cycle arrest and subsequent inhibition of cellular proliferation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.7 DPPH\u003c/h2\u003e \u003cp\u003eThe results from the DPPH assay revealed elevated levels of oxidants and reduced levels of antioxidants in the treated cells in all of treated groups, that suggests that sorafenib and dasatinib, through modulation of GPX4 and ROS levels in the cytosol, can diminish antioxidant levels, consequently inducing cellular damage and apoptosis.\u003c/p\u003e \u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eSorafenib is an established therapeutic agent for renal and hepatocellular carcinoma, as well as certain hematologic malignancies, including acute myeloid leukemia (AML). However, prolonged administration of sorafenib can induce drug resistance in cancer cells, making them less responsive to its therapeutic effects. Our findings indicate that sorafenib, dasatinib, and their combination with polymeric micelles (PCL) significantly upregulate pro-apoptotic genes such as Bax and Bad, while downregulating anti-apoptotic genes (BCL-2) and anti-ferroptotic genes (GPX4, NRF2, and SLC7A11), ultimately leading to increased cancer cell death. Furthermore, these treatments enhance apoptosis, elevate levels of reactive oxygen species (ROS) and cellular oxidants, reduce GPX4 activity, diminish colony formation, lower intracellular antioxidant capacity, and concurrently activate both ferroptosis and apoptosis pathways. Resistance to sorafenib can arise in cancer cells due to alterations in the expression of anti-ferroptotic and pro-apoptotic genes, which diminishes the drug\u0026rsquo;s efficacy over time. Research has shown that the upregulation of the NRF2 gene, resulting from changes in its interaction with KEAP1, leads to the increased expression of anti-ferroptotic genes such as SLC7A11 and GPX4, thereby contributing to sorafenib resistance and the evasion of ferroptosis. Modifying treatment regimens and incorporating second-line agents like dasatinib may provide a strategy to overcome sorafenib resistance; however, these agents carry risks of adverse effects that could lead to secondary resistance and potential harm. Currently, the use of nanocarriers represents a promising strategy to address drug resistance and reduce the necessary dosage of therapeutic agents. Our results demonstrate that the application of nanocarriers in sorafenib and dasatinib nano-systems effectively mitigates sorafenib resistance, resulting in the apoptotic death of MULV-4 cancer cells at significantly lower concentrations.\u003c/p\u003e \u003cp\u003eToxicity assay of this drugs on MULV-4 sorafenib resistance cells, shown that cells which develop resistance to sorafenib exhibit insensitivity to the drug due to the acquisition of resistance mechanisms and changes in genomic expression profiles. In this study, the utilization of a nano-complex formulation of sorafenib, in combination with the co-administration of dasatinib, has demonstrated significant efficacy in inducing apoptosis in cancer cells. The findings indicate that the sorafenib-dasatinib nanocomplex displays enhanced effectiveness against sorafenib-resistant cells, as evidenced by an IC50 value of 20 nM for the PCL-sorafenib/dasatinib formulation in the sorafenib-resistant MULV-4 cell line.\u003c/p\u003e \u003cp\u003eGene expression analysis using quantitative reverse transcription polymerase chain reaction (qRT-PCR) revealed a consistent pattern across all treatment groups, characterized by the downregulation of GPX4, SLC7A11, NRF2, and BCL2 genes, alongside the upregulation of BAX, BAD, Caspase-3 (Cas3), and Caspase-8 (Cas8). Notably, the group treated with sorafenib and dasatinib exhibited the most significant changes in the expression levels of the Cas3 and Cas8 genes, whereas the PCL-sorafenib/dasatinib treatment group demonstrated the most pronounced alterations in the expression of all genes examined, with the exception of Cas3 and Cas8.\u003c/p\u003e \u003cp\u003eConsistent with findings from [Author Name]'s study, the results demonstrate that sorafenib, dasatinib, and their respective nanocarriers possess the capability to induce cell cycle arrest by impeding the MAPK signaling pathway during the G1 phase, thereby inhibits cell proliferation(9). The precise mechanism underlying the inhibitory effects of sorafenib and dasatinib on the cell cycle remains elusive; however, prior research has indicated a substantial reduction in the expression of NRAS and KRAS genes following sorafenib treatment, suggesting the suppression of cell signaling pathways and the cessation of cancer cell proliferation in the G1 phase(10). The downregulation of signaling molecules like RAS disrupts signal transduction within the cytosol, ultimately leading to cellular demise.\u003c/p\u003e \u003cp\u003eUpon internalization into the cell, sorafenib and dasatinib elicit an elevation in cytosolic oxidative stress levels, leading to cell death through the modulation of cellular antioxidant pathways. The findings indicate that sorafenib and dasatinib enhance reactive oxygen species (ROS) levels and oxidative stress within the cytosol by impeding the expression and functionality of GPX4(11, 12). Specifically, sorafenib demonstrates a notable reduction in GPX activity; however, the precise mechanism by which this decrease occur whether through downregulation of GPX4 gene expression or direct enzyme inhibition by sorafenib and dasatinib remains unclear. Results from ROS and GPX4 activity assays reveal a twofold increase and a 1.7-fold decrease, respectively, in the NSD treatment group, underscoring the impact of the combined treatment on oxidative stress and GPX4 activity levels.\u003c/p\u003e \u003cp\u003eThe results from colony formation assay (CFA) showed that colony size and count were diminished in the treated cells. Similarly to our results a recent study showed significant reduction in the self-renewal capacity of both MCF7 and MDA-MB-231 cells following sorafenib treatment (10, 13). However, Dasatinib, Nano-Sorafenib treated cell, no significant decrease in colony numbers was observed. This lack of impact is attributed to the reduction in the effective dose of sorafenib and dasatinib, which diminished its effect on the colonization of treated cells. The study's key findings show that PCL-Sorafenib-Dasatinib had the most significant impact on colony numbers.\u003c/p\u003e \u003cp\u003eIn conclusion, the study elucidates the intricate mechanisms underlying the development of drug resistance to sorafenib in MULV-4 cells and highlights the potential of combined treatments involving sorafenib, dasatinib, and their nano-formulations to overcome resistance. The orchestrated modulation of gene expression, with upregulation of pro-apoptotic genes and downregulation of anti-apoptotic and anti-ferroptotic genes, leads to enhanced apoptosis and disruption of cellular antioxidant pathways. These treatments induce cell death by altering ROS levels, diminishing GPX4 activity, and inhibiting colony formation, ultimately triggering ferroptosis and apoptosis pathways. The findings underscore the promise of nanocarriers in enhancing the efficacy of sorafenib and dasatinib against resistant cancer cells, offering insights into novel therapeutic strategies to combat drug resistance in malignancies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment:\u0026nbsp;\u003c/strong\u003eThanks to the Deputy of research \u0026amp; innovation\u0026nbsp;of baghiatallah University of Medical Sciences for financing the project (Grant Number: 402000061).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDeputy of research \u0026amp; innovation\u0026nbsp;of baghiatallah University of Medical Sciences(Grant number: 402000061)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFinancial interest:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare they have no financial interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ethics committee of Birjand University of Medical Sciences generated ethical acceptance.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u0026apos; authors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study\u0026apos;s conception and design. Material preparation, data collection, and analysis were performed by\u0026nbsp;Mohammad Eini, Hamid Babavalian and Ali Salimi. \u0026nbsp;Mohammad Eini wrote the first draft of the manuscript and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003e1. [Available from: Available from:https://www.cancer.org/cancer/acute-lymphocytic-leukemia/about/key-statistics.html.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e2. Zhang Y, Gao Y, Zhang H, Zhang J, He F, Hn\u0026iacute;zda A, et al. PDGFRB mutation and tyrosine kinase inhibitor resistance in Ph-like acute lymphoblastic leukemia. Blood, The Journal of the American Society of Hematology. 2018;131(20):2256-61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e3. Shiraz P, Payne KJ, Muffly L. The current genomic and molecular landscape of Philadelphia-like acute lymphoblastic leukemia. International Journal of Molecular Sciences. 2020;21(6):2193.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e4. Li J, Cao F, Yin H-l, Huang Z-j, Lin Z-t, Mao N, et al. Ferroptosis: past, present and future. Cell death \u0026amp; disease. 2020;11(2):88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e5. Kanwugu ON, Glukhareva TV. Activation of Nrf2 pathway as a protective mechanism against oxidative stress-induced diseases: Potential of astaxanthin. Archives of Biochemistry and Biophysics. 2023:109601.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e6. Peng W, Zhu Z, Yang Y, Hou J, Lu J, Chen C, et al. N2L, a novel lipoic acid-niacin dimer, attenuates ferroptosis and decreases lipid peroxidation in HT22 cells. Brain Research Bulletin. 2021;174:250-9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e7. Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. cell. 2012;149(5):1060-72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e8. Fauziya, Gupta A, Nadaf A, Ahmad S, Hasan N, Imran M, et al. Dasatinib: a potential tyrosine kinase inhibitor to fight against multiple cancer malignancies. Medical Oncology. 2023;40(6):173.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e9. Zhang Y, Li G, Liu X, Song Y, Xie J, Li G, et al. Sorafenib inhibited cell growth through the MEK/ERK signaling pathway in acute promyelocytic leukemia cells. Oncology Letters. 2018;15(4):5620-6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e10. Dattachoudhury S, Sharma R, Kumar A, Jaganathan BG. Sorafenib inhibits proliferation, migration and invasion of breast cancer cells. Oncology. 2020;98(7):478\u0026thinsp;\u0026minus;\u0026thinsp;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e11. Seiler A, Schneider M, F\u0026ouml;rster H, Roth S, Wirth EK, Culmsee C, et al. Glutathione peroxidase 4 senses and translates oxidative stress into 12/15-lipoxygenase dependent-and AIF-mediated cell death. Cell metabolism. 2008;8(3):237\u0026thinsp;\u0026minus;\u0026thinsp;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e12. Yuan S, Wei C, Liu G, Zhang L, Li J, Li L, et al. Sorafenib attenuates liver fibrosis by triggering hepatic stellate cell ferroptosis via HIF-1α/SLC7A11 pathway. Cell Proliferation. 2022;55(1):e13158.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e13. Bond\u0026igrave; ML, Botto C, Amore E, Emma MR, Augello G, Craparo EF, et al. Lipid nanocarriers containing sorafenib inhibit colonies formation in human hepatocarcinoma cells. International journal of pharmaceutics. 2015;493(1\u0026ndash;2):75\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"ALL, MULV-4, PCL, sorafenib, Dasatinib","lastPublishedDoi":"10.21203/rs.3.rs-5294691/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5294691/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSorafenib, a tyrosine kinase inhibitor used in hepatic and hematologic malignancies, often leads to drug resistance in cancer cells over time. This study explores the synergistic effects of sorafenib, dasatinib, and their respective PCL-based nano-systems in overcoming resistance mechanisms. The research reveals an orchestrated modulation of gene expression, upregulating pro-apoptotic genes like Bax and downregulating anti-apoptotic genes such as GPX4, NRF2, and SLC7A11, resulting in cancer cell death. These treatments enhance apoptosis, elevate ROS levels, reduce GPX4 activity, and inhibit colony formation, suggesting a dual induction of ferroptosis and apoptosis pathways. The study underscores the potential of nanocarriers in enhancing the efficacy of sorafenib and dasatinib against resistant cancer cells, providing insights into the molecular mechanisms underlying their anti-cancer effects.\u003c/p\u003e","manuscriptTitle":"Enhancing Apoptosis and Ferroptosis: Synergistic Effects of Sorafenib and Dasatinib Nano-systems in Overcoming Drug Resistance in MULV-4 Cell lines","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-04 12:26:49","doi":"10.21203/rs.3.rs-5294691/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4e565201-a831-43cd-a229-182c9e504707","owner":[],"postedDate":"November 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-11-09T09:38:30+00:00","versionOfRecord":[],"versionCreatedAt":"2024-11-04 12:26:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5294691","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5294691","identity":"rs-5294691","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.