Genetic Insights and Therapeutic Potential for Colorectal cancer: Mutation Analysis of KRAS Gene and Efficacy of Oleuropein-Conjugated Iron Oxide Nanoparticles

Genetic Insights and Therapeutic Potential for Colorectal cancer: Mutation Analysis of KRAS Gene and Efficacy of Oleuropein-Conjugated Iron Oxide Nanoparticles | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genetic Insights and Therapeutic Potential for Colorectal cancer: Mutation Analysis of KRAS Gene and Efficacy of Oleuropein-Conjugated Iron Oxide Nanoparticles Sedigheh Mehdinejad, Maryam Peymani, Ali Salehzadeh, Mohammad Zaefizadeh This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3857699/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract This study aimed to address the challenges of treating advanced stages of colon cancer (CRC) by exploring potential therapeutic options. The research focused on the genetic aspects of CRC, specifically the mutation rate of the KRAS gene, along with other genes like TTN , APC , MUC16 , and TP53, using the TCGA dataset. Additionally, the study investigated the efficacy of Oleuropein, a polyphenolic compound found in olives, in combating CRC by using iron oxide nanoparticles coated with glucose and conjugated with Oleuropein. The study characterized the physicochemical properties of the nanoparticles and the cytotoxic effects of the nanoparticles were evaluated on CRC and normal fibroblast cell lines, demonstrating significantly higher cytotoxicity against CRC cells compared to normal cells. Furthermore, the study analyzed gene expression changes using the GSE124627 dataset to understand the influence of KRAS alterations. It identified numerous upregulated and downregulated genes in KRAS-overexpressing samples, suggesting their involvement in critical cancer-related pathways. These findings suggest that KRAS -influenced genes could serve as potential therapeutic targets for CRC treatment. The study also examined the expression levels of identified genes in CRC samples compared to normal samples. Among the upregulated genes, 22 showed significant increases in cancer samples, while 14 downregulated genes exhibited decreased expression in both KRAS-influenced and cancer samples. Cox regression analysis identified specific upregulated genes, including ANKZF1 , SNAI1 , PPFIA4 , SIX4 , and NOTUM , associated with poor prognosis. Kaplan-Meier analysis further confirmed the correlation between increased expression of these genes and higher patient mortality rates. In conclusion, this study provided valuable insights into the genetic aspects of CRC and potential therapeutic strategies. The use of Oleuropein-conjugated iron oxide nanoparticles showed promising cytotoxic effects on colon cancer cells. These findings contribute to advancing our understanding of CRC and offer potential targets for further investigation and the development of novel therapeutic approaches. Apoptosis Iron oxide KRAS pathway Oleuropein Therapeutic targets Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Due to late diagnosis and insufficient efficiency of current therapeutic options, colon cancer remains the fifth deathly cancer, worldwide, that causes almost 1.15 million annual new cases and 0.6 million deaths [ 1 ]. The disease is usually diagnosed at its advanced stages when a colon tumor has been developed to several micro-metastatic tumors that are hardly treated [ 2 ]. Therefore, finding new solutions for timely identification and effective treatment of such severe and fatal disease is the goal of many research studies. Targeting the metabolic mediators that are involved in the initiation and progression of cancer can be considered a new approach in the fight against cancer. Kirsten rat sarcoma (KRAS) is an oncogene that is responsible for the activation of the mitogen-activated protein kinase (MAPK) pathway [ 3 ]. Mutation in this oncogene is highly associated with the initiation, metastasis, and invasiveness of colorectal tumors [ 4 ]. In addition, it was found that KRAS mutation is one of the most important predictive markers in determining resistance to some anticancer drugs [ 5 ]. Due to the critical role of this oncogene in the progression, invasiveness, and drug resistance of colon cancer, targeting downstream metabolic mediators of the KRAS pathway can be proposed as an option for studies in the field of colon cancer control and treatment. The use of nanotechnology products in the field of cancer diagnosis and treatment has received much attention. Due to their large effective surface and small size, these particles can reach tumor tissues in the body and exert the desired anticancer effects. Also, nanoparticles can be considered as a platform to design multi-agent pharmaceutical compounds [ 6 ]. The use of iron oxide nanoparticles has been widely considered in the field of cancer diagnosis and treatment. Due to their acceptable stability and biocompatibility as well as their magnetic properties, these particles can be used as a tool in the field of targeted drug delivery to cancer tissues [ 7 ]. Oleuropein is a polyphenol compound that is primarily found in olives and has antioxidant, anti-inflammatory, cardioprotective, neuroprotective, and hepatoprotective effects [ 8 ]. It is also considered as a potentially active anticancer agent. Several in-vitro and in-vivo studies revealed that Oleuropein can reduce the viability and proliferation of cancer cells [ 9 – 10 ]. Treating colon cancer cell lines with Oleuropein caused cell cycle arrest and upregulation of proapoptotic genes that resulted in apoptosis induction and inhibition of colon cancer cells [ 8 – 10 ]. Therefore, it can be assumed that conjugating Oleuropein to magnetic nanoparticles can provide more effective anticancer effects against colon cancer cells. Based on this hypothesis, the current study investigates the cytotoxic effects of Iron oxide nanoparticles coated with Glucose and conjugated with Oleuropein (Fe 3 O 4 @Glu-Oleuropein) NPs on colon cancer cell line and evaluates the expression of some candidate genes associated with the KRAS pathway to elucidate the anticancer mechanism of the synthesized NPs. This study aims to investigate the mutation rate of the KRAS gene in CRC and explore the expression changes of KRAS -influenced genes in relation to patient prognosis. Additionally, the study aims to evaluate the cytotoxic effects of Oleuropein-conjugated iron oxide nanoparticles on colon cancer cells, with the objective of identifying potential therapeutic strategies for the treatment of CRC. 2. Materials and Methods 2.1Data sources For the purpose of investigating the mutation rate of KRAS in colorectal cancer (CRC), TCGA data was utilized. In the first stage, the mutation data of genes (maf file) was downloaded using the TCGAbiolinks package through the mutect2 pipeline. Subsequently, the maftools package was used to identify the mutation rates and their types in CRC samples from the TCGA database. To identify genes that could undergo KRAS -associated expression changes, a study with the accession number GSE124627 from the GEO database was utilized. In this study, the expression levels of wild-type KRAS and the (G12D) mutation were increased using expression vectors in the H1299 cell line, and the gene expression changes were examined compared to the empty vector group using the RNAseq method. The data from this study was downloaded in raw format (HTseq-Counts), and initial preprocessing was performed, including the removal of genes with zero or near-zero expression (CPM less than 10 in 70% of the samples) using the edgeR package. In the next stage, the data was normalized using the TMM method, and finally, all the data was transformed to a logarithmic scale based on 2. The resulting expression matrix was used for all subsequent analyses. Additionally, to examine the expression levels of candidate genes in CRC samples compared to normal samples, the transcriptomic data (RNAseq) available in the TCGA database (TCGA-COAD) was used. For the initial preprocessing of the TCGA data, in the first stage, genes with zero or near-zero expression based on the CMP criterion (less than 10) in 70% of the samples were removed. Then, the data was normalized using the TMM method, and the data was transformed to a logarithmic scale based on 2. The resulting expression matrix was used for all analyses, including differential expression between groups and investigating the correlation of candidate genes with patient prognosis. The TCGA-COAD data included 480 tumor samples at different stages and 41 normal samples. 2.2 Exploring gene expression changes associated with KRAS in CRC In order to identify genes that can undergo KRAS -associated expression changes, the GSE124627 data was utilized, and the differential expression between samples in the KRAS and G12D overexpression groups was calculated compared to the samples in the empty vector group. Additionally, to investigate the expression changes of candidate genes in CRC, the differential expression between cancer samples and normal samples was calculated. For this purpose, based on the clinical data, the RNAseq data obtained from the TCGA database was divided into two groups: normal and cancer. To identify signaling pathways associated with candidate genes, the Enrichr database ( https://maayanlab.cloud/Enrichr/ ) and the MsigDB repository were used. 2.3 Association between candidate gene expression and patient prognosis in CRC The TCGA-COAD clinical data was used to examine the association between the expression of candidate genes and patient prognosis in CRC. Initial preprocessing steps were performed on the clinical data, including the removal of normal samples, the removal of samples with a survival time of 1 or NA, and the removal of samples with a death status but no tumor at the time of death. To investigate the association between the expression of candidate genes and patient prognosis, initially, the expression of all candidate genes was extracted for samples that met the mentioned clinical criteria. Then, the expression of each gene was transformed into a Z-score across all samples, and the univariate Cox regression test was used to examine the association between the expression of candidate genes and patient prognosis. Additionally, the Kaplan-Meier (K-M) curve was used to validate the results obtained. For this purpose, the median expression of candidate genes in all tumor samples was used as the cutoff, and the samples were divided into two groups: high expression and low expression. 2.4 Synthesis of nanoparticles To synthesize Iron oxide NPs, at first, FeCl 3 .6H 2 O (7.57 g) and FeCl 2 .4H 2 O (3.17 g) were dissolved in deionized water, and the mixture was heated for one hour at 80°C. Next, 40 ml of a concentrated NH 3 solution was added and the mixture was heated at 80°C by applying a low flow of N 2 gas. After the formation of Fe 3 O 4 NPs, the particles were collected, repeatedly washed with water and ethanol, and finally dried at 70°C/ 8 hours [ 11 ]. In the next step, Fe 3 O 4 NPs were coated with Glucose as follows: one gram of Fe 3 O 4 NPs and 0.5 g of D-glucose were added to deionized water, and the suspension was subjected to sonication for 30 min, and then, heated at 180°C for three h. Finally, the Fe 3 O 4 @Glu NPs were collected by centrifuging the mixture at (6000 rpm), washed, and dried at 60°C for five 5 h. In the final step, Fe 3 O 4 @Glu NPs were conjugated with Oleuropein as follows: one gram of Fe 3 O 4 @Glu and 0.1 g of Oleuropein were suspended evenly in deionized water, and the suspension was shaken overnight. Finally, the conjugated NPs collected, washed, and freeze-dried. 2.5 Characteristics of Fe 3 O 4 @Glu NPs FT-IR analysis was used to study of chemical bonds of Fe 3 O 4 , Fe 3 O 4 @Glu, Oleuropein, and Fe 3 O 4 @Glu-Oluropein NPs. The analysis was performed by a Nicolet IR-100 FT-IR device, and in a range of 500–4000 cm − 1 . An XRD analysis was also performed on Fe 3 O 4 @Glu NPs (Co-Ka X-radiation, k = 1.79 Å) to investigate the crystal structure of the particles. Scanning Electron Microscope (SEM) (TESCAN Mira3) and Transmission Electron Microscope (TEM) (Zeiss EM-900) imaging investigated the size range, morphology, and aggregation level of the synthesized Fe 3 O 4 @Glu NPs. Furthermore, the magnetic property and thermal stability of Fe 3 O 4 @Glu NPs was studied by VSM (LBKFB magnetometer, Daghigh Kavir Kashan, Iran) and TGA (Rheometric Scientific STA 1500, USA) assays, respectively. The zeta potential and hydrodynamic size of the particles were studied by a zeta sizer (Malvern Instruments Ltd, 6.32) and EDS-mapping analysis (TESCAN Mira3) was used to evaluate the elemental purity of the nanoproduct. 2.6 MTT assay The cytotoxic effect of Fe 3 O 4 @Glu-Oluropein NPs on colon cancer cells (SW480) and normal human cells (HEK293) cell lines and also the effect of oxaliplatin, as a standard anticancer drug, on colon cancer cell line was studied by MTT (2-(4,5-dimethythiazol-2-yl) -2,5-diphenyltetrazolium bromide) assay. The cell lines were purchased from the Pasteur’s Institute of Iran and cell propagation was done in Dulbecco’s modified Eagle medium (DMEM) medium supplemented with fetal bovine serum and penicillin-streptomycin. Monolayers of the cells were grown in 96-well plates and then, treated with different concentrations of Fe 3 O 4 @Glu-Oluropein NPs or oxaliplatin (0 to 500µg/ml). The plates were incubated at 37°C for 24 h, then, the medium was removed, and 200 µl of the MTT solution was added. After incubation for four hours at 37°C, the content of wells was aspirated and 200 µl of DMSO was added. The plates were stored at room temperature for 30 min and the optical absorption of the wells was measured at 570 nm (Bio-Rad, Hercules, microplate reader). The 50% inhibitory concentration (IC 50 ) of the NPs was calculated by GraphPad Prism software (version 9.5.1, USA), and the percentage of inhibited cells as was calculated according to the following formula [ 12 – 13 ]: $$Inhibition \left(\text{%}\right)=\frac{Abs of control-Abs of Test}{Abs of control}\times 100$$ 2.7 Flow cytometry Flow cytometry analysis was used to quantify the percentage of apoptotic cells. To perform the assay, colon cancer cells were exposed to IC 50 concentration of Fe 3 O 4 @Glu-Oleuropein for 24 h and then, subjected to a flow cytometry analysis. At first, Fe 3 O 4 @Glu-Oleuropein treated and control cells were stained by propidium iodide and Annexin V (Roche, Germany) and then, analyzed by a flow cytometry instrument (ZE5, BIO-RAD, USA). 2.8 Gene expression assay The effect of Fe 3 O 4 @Glu-Pleuropein on the expression of some candidate genes associated with the KRAS pathway was studied by a real-time PCR assay. The relative expression of the SNAI1 , ANKZF , and PPFIA4 genes was quantified using primers that are presented in Table 1 . In brief, colon cancer cells were treated with the nanoparticles for 24 h at their 50% inhibitory concentration. Extraction of total RNA was performed using the TriZol reagent (Sigma-Aldrich) and after DNaseI treatment, cDNA synthesis was performed using the SinaClone cDNA synthesis kit (Iran). Amplification of the fragments from Fe 3 O 4 @Glu-Oleuropein treated and control groups were done using an SYBR-Green real-time PCR assay kit (Dena Zist, Iran). Finally, the expression of studied genes in treated cells relative to the control group was calculated by the 2 −ΔΔCT method [ 14 ]. Table 1 Sequence of the primers used in this work Primer Sequence (5’-3’) References SNAI1 1 -F CCTGTCTGCGTGGGTTTTTG This study SNAI1 -R ACCTGGGGGTGGATTATTGC ANKZF1 -F GAGGAGCCTTCCACACAGTC This study ANKZF1 -R AGCACTCCAACATCTCCAGC PPFIA4 -F PPFIA4 -R AGAGAATTGCAGCCCTCACC CCAGCTCCTGGTTCTTCTCC This study GAPDH -F CCCACTCCTCCACCTTTGAC [ 11 ] GAPDH -R CATACCAGGAAATGAGCTTGACAA 2.9 Hoechst staining The possible nuclear damage and apoptotic changes caused by exposure of colon cancer cells to Fe 3 O 4 @Glu-Oleuropein NPs were studied by the Hoechst staining. In brief, the SW480 cells were treated with the nanoparticles for 24 h, and next, were stained with the Hoechst 33258 solution. Finally, the cells were washed with PBS and examined under a fluorescent microscope (Incell Analyser 2000, USA). 2.10 Statistical analyses All initial preprocessing steps on the data were performed using the R programming language (v4.1). False discovery rate (FDR) was used to assess the statistical significance level, and an FDR < 0.05 was considered significant for all analyses. GraphPad Prism (v8.4) was used for plotting graphs, and Cytoscape (v7.9) was used for creating co-expression networks. For laboratory analysis, statistical differences between Fe 3 O 4 @Glu-Oleuropein NPs treated and control groups were analyzed by one-way ANOVA using the SPSS.16.0 software. The assays were performed in three replicates and a p -value of less than 0.05 was considered statistically significant. 3. Results 3.1 The significance of KRAS alterations in CRC: insights from mutation analysis and gene expression profiling In order to investigate the importance of KRAS in CRC, the mutation rate of this gene in CRC was examined based on TCGA data. As shown in our recent study [ 15 ], five genes, including TTN , APC , MUC16 , TP53 , and KRAS , had the highest mutation rates among the genes in TCGA data. The results demonstrated that the mutation rate in the KRAS gene in CRC samples was over 40%, with the majority of mutations being of the missense type. These findings suggest that KRAS and its associated genes can be key factors in the development and progression of CRC. Furthermore, to identify genes that may be influenced by KRAS alterations, the study GSE124627 was utilized. The differential expression results revealed that 180 genes showed significant and substantial increase in expression (LogFC > 1, FDR < 0.01) in KRAS -overexpressing samples compared to the control group (Fig. 1 A). On the other hand, 76 genes were identified to have a significant decrease in expression (LogFC < -1, FDR < 0.01) (Fig. 1 A). To confirm whether the identified genes are involved in the KRAS-related pathway, online database data were used and the identified genes were identified [ 16 ]. The enrichment analysis for the upregulated 183 genes demonstrated their involvement in pathways such as glycolysis, mTORC1, inflammation, EM T , and KRAS signaling (Fig. 1 B, FDR < 0.01). Conversely, the downregulated 76 genes were found to be involved in pathways related to angiogenesis, apoptosis, and DNA repair (Fig. 1 C). As these results showed, some increased genes were related to KRAS signaling pathway. Also, pathways such as glycolysis, EMT, and mTORC1 can also be affected by the KRAS pathway, and the genes related to these pathways are increased in CRC [ 17 ]. These results indicate that genes influenced by KRAS play a role in major cancer-associated pathways, and this category of genes can be potential therapeutic targets in relation to KRAS mutations. 3.2 KRAS-Association gene expression changes in CRC: impact on patient survival and therapeutic opportunities For further insight into the identified genes from the previous stage in CRC, the expression levels of 180 upregulated genes by KRAS and 76 downregulated genes in CRC samples compared to normal samples were examined based on TCGA data. Our investigations demonstrated that among the 180 upregulated genes, 22 genes showed significant increase in expression (with logFC > 1 and FDR < 0.01) in cancer samples compared to normal samples (Fig. 2 A). On the other hand, 14 genes were identified that exhibited decreased expression both under the influence of KRAS and in cancer samples compared to normal samples (with logFC<-1 and FDR < 0.01) (Fig. 2 A). These findings indicate that KRAS-influenced genes undergo noticeable changes in expression in CRC. Next, the association between the expression of the identified genes and the survival rate of the studied patients was investigated. The Cox regression analysis results showed that among the 22 upregulated genes, increased expression of ANKZF1 , SNAI1 , PPFIA4 , SIX4 , and NOTUM was associated with poor prognosis (Table 2 , HR > 1, FDR < 0.01). On the other hand, none of the downregulated genes were associated with the mortality rate of the patients. To confirm the obtained results, Kaplan-Meier curves were used for the genes ANKZF1 , SNAI1 , PPFIA4 , SIX4 , and NOTUM . The Kaplan-Meier results demonstrated that increased expression of ANKZF1 , SNAI1 , PPFIA4 , SIX4 , and NOTUM was associated with higher mortality rate of patients (Fig. 2 B-F, logRank < 0.05). These results indicate that KRAS -influenced genes not only undergo significant changes in expression in CRC but also their expression alterations can be associated with the mortality rate of patients. For further laboratory analyses and validations, we selected three genes, namely ANKZF1 , SNAI1 , and PPFIA4 , which have been less studied in CRC. Table 2 Cox regression test results for identified genes Univariate HR P value 95% CI ANKZF1 expression (High vs. Low) 1.42 0.02 1.04–1.96 SNAI1 expression (High vs. Low) 1.46 0.01 1.07–1.98 PPFIA4 expression (High vs. Low) 1.59 0.003 1.16–2.16 SIX4 expression (High vs. Low) 1.64 0.0002 1.24–2.16 NOTUM expression (High vs. Low) 1.4 0.03 1.02–1.92 3.3 Characterization of nanoparticles FT-IR analysis of Fe 3 O 4 , Fe 3 O 4 @Glu, Oleuropein, and Fe 3 O 4 @Glu-Oleuropein was presented in Fig. 3 A. According to the results, in the spectrum for Fe 3 O 4 nanoparticles, two absorption peaks were observed at 420, and 580 cm − 1 which are respectively caused by Fe-O bonds related to Fe 2+ and Fe 3+ ions located in octahedral positions and Fe 3+ ion located in a tetrahedron. This finding supports the formation of the Fe 3 O 4 structure. Considering the spectrum b related to Fe 3 O 4 @Glucose composite, the peaks at 813, 898, and 1606 cm − 1 are corresponding to C-H, N-H, and C = C bonds, respectively, and the peaks at 436 and 587 cm − 1 are related to the presence of Fe 3 O 4 NPs. In addition, two peaks at 2018 and 3634 cm − 1 , that are related to C-O and O-H stretching bonds, were observed. In the spectrum related to Fe 3 O 4 @Glu-Oleuropein, two peaks, related to the C-H bond, at 765 and 825 cm − 1 , and two peaks at 1123 and 1397 cm − 1 , related to the C-N and C-O bonds, were found. Furthermore, the peaks related to the N-H, O = C, and O-H bonds were observed at 1601, 1706, and 3453 cm − 1 , respectively. In the Fe 3 O 4 @Glu-Oleuropein spectrum, the peaks related to Fe-O and Oleuropein were observed that confirms the synthesis and conjugation of the composite. Based on the XRD spectrum, the peaks that are observed at 2θ of 30 to 40 degrees are related to iron oxide nanoparticles that are in agreement with references [ 18 ]. Furthermore, the presence of the peaks in 2θ of 30–40 degrees and the presence of a peak in 2θ of 55–65 degrees, the presence of iron oxide NPs and Oleuropein is confirmed [ 19 ]. Overall, the XRD spectrum shows that the amorphous synthesized structure was synthesized properly. The results were presented in Fig. 3 B. Electron microscopy imaging of Fe 3 O 4 @Glu-Oleuropein showed that the particles were synthesized in a size range of 28–50 nm, were spherical, and with a low level of aggregation. The SEM and TEM images were presented in Fig. 3 C and 43D. The thermogravimetric assay revealed that the synthesized nanoparticles were stable enough at temperatures of less than 150°C and had no considerable weight loss. The thermal stability chart of Fe 3 O 4 @Glu-Oleuropein was displayed in Fig. 3 E. The magnetic property of the particles was confirmed by VSM analysis and the highest recorded magnetization was 1.85emu/g (Fig. 4 A). The surface charge and hydrodynamic size of Fe 3 O 4 @Glu-Oleuropein were 18.6 mV and 163nm, respectively (Fig. 4 B and 4 C). According to the EDS-map analysis, Fe 3 O 4 @Glu-Oleuropein consisted of C, O, and Fe atoms that indicate the elemental purity of the synthesized NPs (Fig. 4 D). 3.4 Cytotoxic effect Cytotoxic effect of Fe 3 O 4 @Glu-Oleuropein on colon cancer and human normal cells was studied by the MTT assay. According to the results, Fe 3 O 4 @Glu-Oleuropein had considerable cytotoxicity for colon cancer cells with an IC 50 of 105µg/mL, while the IC 50 of the NPs for normal human cell line was 251µg/ml. In addition, the IC 50 of oxaliplatin for the colon cancer cell line was 49µg/mL. Overall; the nanoparticles were more toxic for colon cancer cells than for normal human cell line. The results were displayed in Fig. 5 A. 3.5 Flow cytometry study The frequency of cell apoptosis in Fe 3 O 4 @Glu-Oleuropein-treated and control colon cancer cells were studied by flow cytometry analysis. The results showed that the frequency of early and late apoptosis in control cells were 0.18 and 0.33%, while the population of the cells with early and late apoptosis in NPs treated cells raised to 12.47 and 10.31%, respectively. The results were displayed in Fig. 5 B. 3.6 Hoechst staining To characterize possible nuclear damage from exposure to Fe 3 O 4 @Glu-Oleuropein, Hoechst staining was performed. According to the results, treating colon cancer cells with the NPs led to the appearance of proapoptotic features and nuclear damage, including chromatin fragmentation, and the appearance of apoptotic bodies. In contrast, no considerable nuclear damage was found in control cells (Fig. 5 C). 3.7 Gene expression The effect of Fe 3 O 4 @Glu-Oleuropein on the expression of some candidate genes related to the KRAS pathway, including the SNAI1 , ANKZF , and PPFIA4 was evaluated by real-time PCR. According to the results, upon treating colon cancer cells with the synthesized NPs the relative expression of the PPFIA4 , ANKZF1 , and SNAI1 genes reduced by 0.59, 0.44, and 0.36 folds, respectively (Fig. 5 D). 4. Discussion Colon cancer is known as a serious and hard-to-treat disease that is usually detected in the late stages and as a result, causes many deaths worldwide [ 20 ]. The treatment of this disease, especially in its advanced stages, is a serious challenge in the field of cancer treatment, and current chemotherapy drugs generally lack sufficient efficiency for effective treatment. Therefore, new researches are focusing on the design of new drugs and targeted drug delivery to cancer tissues in order to achieve more efficient treatments. The study aimed to enhance our knowledge of the impact of KRAS alterations in CRC and explore potential therapeutic opportunities targeting KRAS -influenced genes. The findings of this study provide valuable insights into the significance of KRAS alterations in CRC through mutation analysis and gene expression profiling. The high mutation rate of the KRAS gene observed in CRC samples emphasizes its importance in the development and progression of the disease. The majority of mutations were of the missense type, indicating potential functional implications of these alterations. This highlights the need to further understand the role of KRAS and its associated genes in CRC. The gene expression analysis revealed a set of genes influenced by KRAS alterations. The upregulated genes were found to be involved in crucial cancer-related pathways, including glycolysis, inflammation, epithelial-mesenchymal transition (EMT), and KRAS signaling. These pathways are known to play essential roles in cancer development and progression. Therefore, the identified upregulated genes hold promise as potential therapeutic targets for CRC, as their dysregulation may contribute to tumor growth and survival. Conversely, the downregulated genes were associated with pathways related to angiogenesis, apoptosis, and DNA repair. The decreased expression of these genes in both KRAS -influenced samples and cancer samples suggests their involvement in tumor suppression mechanisms. Restoring the expression of these downregulated genes could potentially serve as a therapeutic strategy to inhibit tumor growth and enhance treatment response in CRC. Furthermore, the analysis of the expression levels of the identified genes in CRC samples compared to normal samples revealed significant changes in gene expression. Among the upregulated genes, several genes including ANKZF1 , SNAI1 , PPFIA4 , SIX4 , and NOTUM exhibited increased expression and were associated with poor prognosis. The Kaplan-Meier analysis confirmed that increased expression of these genes correlated with higher mortality rates in CRC patients. Based on in-vitro and in-vivo studies, oleuropein, a polyphenolic compound in olives, has shown good anticancer properties against several cancer cells, including colon cancer. In addition, iron oxide nanoparticles are known as suitable candidates for targeted drug delivery due to their small size, biocompatibility, and magnetic properties. Therefore, in this study, the cytotoxic effect of Fe 3 O 4 @Glu-Oleuropein NPs against colon cancer cells and the expression of some candidate genes of the KRAS pathway were investigated. Physicochemical examination of synthesized nanoparticles indicates that iron oxide nanoparticles are well synthesized, coated with glucose, and conjugated with Oleuropein. Also, the nanoparticles have good thermal stability and their accumulation is prevented due to having an acceptable surface charge. Also, the nanoparticles are free of impurities and have magnetic properties that make them efficient for drug delivery under an external magnetic force. Investigating the cytotoxic effects of Fe 3 O 4 @Glu-Oleuropein NPs by MTT assay showed that the nanoparticles at concentrations greater than 31.25µg/mL had toxic effects on the studied cells. Although based on the IC 50 value, the nanoparticles had significantly higher toxic effects on cancer cells compared to normal cell line. The higher sensitivity of cancer cells can be related to their metabolic characteristics and nutritional requirements. Such cells generally have a high proliferation rate and therefore have a higher nutrient uptake, compared to normal cells. Accordingly, one of the primary reasons for the higher sensitivity of these cells to Fe 3 O 4 @Glu-Oleuropein can be related to the higher permeability of their surface envelopes in order to absorb more nutrients. In addition, since glucose has been used to coat iron oxide nanoparticles and considering that this molecule is one of the most important nutrients required by human cells, especially cancer cells, this can increase the penetration rate of nanoparticles into cancer cells and as a result cause their higher sensitivity compared to normal cells. The cytotoxic effects of Fe 3 O 4 @Glu-Oleuropein can be related to its components, including iron oxide nanoparticles and Oleuropein. Previous studies have well demonstrated the anticancer properties of Oleuropein and associated the anticancer effects of Oleuropein with the interruption of apoptosis regulatory proteins, activation of caspases, and also inducing the cell cycle arrest [ 8 – 10 , 21 ]. Therefore, according to the observation of the cytotoxic effects of synthesized nanoparticles against colon cancer cells, their cytotoxic effects can be primarily related to the anticancer activity of Oleuropein. In addition, previous studies have reported the anticancer properties of iron oxide nanoparticles. Most of these studies have related the cytotoxic effects of iron oxide nanoparticles to the production of reactive oxygen species and the subsequent damage to the cytoplasmic membrane and internal components of the cell [ 22 – 23 ]. Therefore, in addition to the Oleuropein, the anticancer effects of Fe 3 O 4 @Glu-Oleuropein can be also related to the cytotoxic activity of iron oxide. Flow cytometry study on colon cancer cells showed that exposure to nanoparticlesFe 3 O 4 @Glu-Oleuropein significantly increased the percentage of apoptotic cells. Considering the apoptogenic properties of Oleuropein and the possible cell damage caused by the induction of oxidative stress by iron oxide nanoparticles, apoptosis induction can be considered as one of the expected consequences of exposure of colon cancer cells to the synthesized nanoparticles, which is consistent with previous studies [ 8 , 21 ]. In agreement with these results, the Hoechst staining test showed the occurrence of apoptotic features including chromatin fragmentation, chromatin condensation, and the appearance of apoptotic bodies, which indicates the induction of apoptosis by Fe 3 O 4 @Glu-Oleuropein NPs in colon cancer cells. Evaluating the relative expression of some candidate genes related to the KRAS pathway showed that the expression level of all studied genes in colon cancer cells exposed to Fe 3 O 4 @Glu-Oleuropein significantly decreased. KRAS mutation is a frequent event in colon cancer and is associated with tumor metastasis, drug resistance, and invasiveness [ 18 ]. The oncogenic KRAS has a unique function to suppress p53 mediated cell apoptosis through the activation of Snail protein. It was reported that Snail could directly bind to the DNA binding domain of p53 and diminish the tumor-suppressive function of p53 [ 18 ]. In this study, we found that treating colon cancer cells with Fe 3 O 4 @Glu-Oleuropein significantly reduced the expression of the SNAI1 , the gene encoding for Snail protein, by 0.36 folds. Due to the critical role of p53 in apoptosis induction, downregulation of the SNAI1 gene indicates apoptosis-inducing property of the nanoparticles, which is in agreement with other findings. Moreover, ANKZF1 gene is known as a new potential marker for colon cancer. High expression of the ANKF1 gene has been reported at advanced stages of colon cancer, suggesting its critical role in the progression of colon cancer. In addition, high expression of this gene has been associated with poor response to chemotherapy drugs and also poor survival of colon cancer [ 19 ]. Therefore, changes in the expression of the ANKZF1 can be considered a reliable predictor index in order to check the treatment process. Our results showed that treating colon cancer cells with Fe 3 O 4 @Glu-Oleuropein significantly decreased the expression of the ANKZF1 gene, indicating its therapeutic potential against colon cancer. Moreover, we found that the PPFIA4 gene was also down-regulated in nanoparticle-treated cells. PTPRF Interacting Protein Alpha 4 (PPFIA4) is involved in the glycolysis of the tumor microenvironment, which facilitates the proliferation and migration of tumor cells in colon cancer and thus, has an important role in the progression and invasiveness of the disease [ 24 – 25 ]. In general, the reduction of the expression of the genes involved in the KRAS pathway by Fe 3 O 4 @Glu-Oleuropein showed that these nanoparticles, by interfering with the genetic pathways of colon cancer cells, may play a role in reducing the proliferation, survival, and invasiveness of tumor tissues. These findings highlight the clinical relevance of KRAS -influenced genes and their potential as prognostic markers in CRC. 5. Conclusion In conclusion, this study shed light on the significance of KRAS alterations in CRC and their potential implications for treatment strategies. Also, Fe 3 O 4 @Glu-Oleuropein NPs can be considered as an anticancer agent to reduce the survival rate and proliferation of colon cancer cells. These findings contribute to our understanding of CRC genetics and provide a basis for further investigations and the development of innovative therapeutic approaches in the battle against CRC. Declarations Acknowledgment: The authors would like to thank to Mr. Mohamad Mahdevar for his help in bioinformatics section. Funding: Not Applicable. Consent for publication: Not Applicable. Competing interests: Authors express no conflict of interest. Data availability: All data generated or analyzed during this study are included in this published article. Ethics approval and consent to participate: Not applicable. Approval for human experiments: Not Applicable. Consent to participate : Not Applicable. Author Contribution: A.S., S.M. and M.P.: Conceptualization . A.S., S.M., M.Z. and M.P.: Methodology . A.S. and M.P.: Formal analysis and investigation . A.S., S.M. and M.P.: Writing Original Draft Preparation . S.M.: Resources . A.S., M.Z. and M.P.: Supervision References Sung, H., Ferlay, J., Siegel, R. L., Laversanne, M., Soerjomataram, I., Jemal, A., & Bray, F. (2021). Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians , 71 (3), 209-249. https://doi.org/10.3322/caac.21660 Mishra, J., Drummond, J., Quazi, S. H., Karanki, S. S., Shaw, J. J., Chen, B., & Kumar, N. (2013). Prospective of colon cancer treatments and scope for combinatorial approach to enhanced cancer cell apoptosis. Critical reviews in oncology/hematology , 86 (3), 232-250. https://doi.org/10.1016/j.critrevonc.2012.09.014 Santarpia, L., Myers, J. N., Sherman, S. I., Trimarchi, F., Clayman, G. L., & El‐Naggar, A. K. (2010). Genetic alterations in the RAS/RAF/mitogen‐activated protein kinase and phosphatidylinositol 3‐kinase/Akt signaling pathways in the follicular variant of papillary thyroid carcinoma. Cancer , 116 (12), 2974-2983. https://doi.org/10.1002/cncr.25061 Knickelbein, K., & Zhang, L. (2015). Mutant KRAS as a critical determinant of the therapeutic response of CRC. Genes & diseases , 2 (1), 4-12. https://doi.org/10.1016/j.gendis.2014.10.002 Misale, S., Yaeger, R., Hobor, S., Scala, E., Janakiraman, M., Liska, D., ... & Bardelli, A. (2012). Emergence of KRAS mutations and acquired resistance to anti-EGFR therapy in CRC. Nature , 486 (7404), 532-536. https://doi.org/10.1038/nature11156 Zhang, H., Wang, G., & Yang, H. (2011). Drug delivery systems for differential release in combination therapy. Expert opinion on drug delivery , 8 (2), 171-190. https://doi.org/10.1517/17425247.2011.547470 Kievit, F. M., & Zhang, M. (2011). Surface engineering of iron oxide nanoparticles for targeted cancer therapy. Accounts of chemical research , 44 (10), 853-862. https://doi.org/10.1021/ar2000277 Shamshoum, H., Vlavcheski, F., & Tsiani, E. (2017). Anticancer effects of oleuropein. Biofactors , 43 (4), 517-528. . https://doi.org/10.1002/biof.1366 Fernández-Arroyo, S., Gómez-Martínez, A., Rocamora-Reverte, L., Quirantes-Piné, R., Segura-Carretero, A., Fernández-Gutiérrez, A., & Ferragut, J. A. (2012). Application of nanoLC-ESI-TOF-MS for the metabolomic analysis of phenolic compounds from extra-virgin olive oil in treated colon-cancer cells. Journal of pharmaceutical and biomedical analysis , 63 , 128-134. https://doi.org/10.1016/j.jpba.2012.01.033 Cárdeno, A., Sánchez-Hidalgo, M., Rosillo, M. A., & de la Lastra, C. A. (2013). Oleuropein, a secoiridoid derived from olive tree, inhibits the proliferation of human CRC cell through downregulation of HIF-1α. Nutrition and cancer , 65 (1), 147-156. https://doi.org/10.1080/01635581.2013.741758 Fekri Kohan, S., Zamani, H. & Salehzadeh, A. (2023). Antibacterial potential and cytotoxic activity of iron oxide nanoparticles conjugated with thymol (Fe3O4@Glu-Thymol) on breast cancer cells and investigating the expression of BAX , CASP8 , and BCL-2 genes. Biometals (2023). https://doi.org/10.1007/s10534-023-00516-7 Hosseinkhah, M., Ghasemian, R., Shokrollahi, F., Mojdehi, S. R., Noveiri, M. J. S., Hedayati, M., ... & Salehzadeh, A. (2021). Cytotoxic Potential of Nickel Oxide Nanoparticles Functionalized with Glutamic Acid and Conjugated with Thiosemicarbazide (NiO@ Glu/TSC) Against Human Gastric Cancer Cells. Journal of Cluster Science , 1-9. DOI: 10.1007/s10876-021-02124-2 Kumari, R., Saini, A. K., Kumar, A., & Saini, R. V. (2020). Apoptosis induction in lung and prostate cancer cells through silver nanoparticles synthesized from Pinus roxburghii bioactive fraction. JBIC Journal of Biological Inorganic Chemistry , 25 (1), 23-37. https://doi.org/10.1007/s00775-019-01729-3 Pfaffl, M. W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res . 29: e45. https://doi.org/10.1093/nar/29.9.e45. Niyaki, Z. M., Salehzadeh, A., Peymani, M., & Zaefizadeh, M.(2023). Exploring the Therapeutic Potential of Fe3O4@ Glu-Oleuropein Nanoparticles in Targeting KRAS Pathway-Regulating lncRNAs in Colorectal Cancer Cells. Biological trace element research . https://doi.org/10.1007/s12011-023-03892-w Fritsche-Guenther, R., Zasada, C., Mastrobuoni, G., Royla, N., Rainer, R., Roßner, F., ... & Kempa, S. (2018). Alterations of mTOR signaling impact metabolic stress resistance in colorectal carcinomas with BRAF and KRAS mutations. Scientific reports , 8 (1), 9204. https://doi.org/10.1038/s41598-018-27394-1 Charitou, T., Srihari, S., Lynn, M. A., Jarboui, M. A., Fasterius, E., Moldovan, M., ... & Lynn, D. J. (2019). Transcriptional and metabolic rewiring of colorectal cancer cells expressing the oncogenic KRAS G13D mutation. British journal of cancer , 121 (1), 37-50. https://doi.org/10.1038/s41416-019-0477-7 Lee, S. H., Lee, S. J., Jung, Y. S., Xu, Y., Kang, H. S., Ha, N. C., & Park, B. J. (2009). Blocking of p53-Snail binding, promoted by oncogenic K-Ras, recovers p53 expression and function. Neoplasia , 11 (1), 22-IN6. https://doi.org/10.1593/neo.81006 Zhou, X., Shang, Y. N., Lu, R., Fan, C. W., & Mo, X. M. (2019). High ANKZF1 expression is associated with poor overall survival and recurrence-free survival in colon cancer. Future Oncology , 15 (18), 2093-2106. https://doi.org/10.2217/fon-2018-0920 Shirmohamadi, M., Eghbali, E., Najjary, S., Mokhtarzadeh, A., Kojabad, A. B., Hajiasgharzadeh, K., ... & Baradaran, B. (2020). Regulatory mechanisms of microRNAs in CRC and CRC stem cells. Journal of cellular physiology , 235 (2), 776-789. https://doi.org/10.1002/jcp.29042 Giner, E., Recio, M. C., Ríos, J. L., Cerdá‐Nicolás, J. M., & Giner, R. M. (2016). Chemopreventive effect of oleuropein in colitis‐associated CRC in c57bl/6 mice. Molecular nutrition & food research , 60 (2), 242-255. https://doi.org/10.1002/mnfr.201500605 Khan, M. I., Mohammad, A., Patil, G., Naqvi, S. A. H., Chauhan, L. K. S., & Ahmad, I. (2012). Induction of ROS, mitochondrial damage and autophagy in lung epithelial cancer cells by iron oxide nanoparticles. Biomaterials , 33 (5), 1477-1488. https://doi.org/10.1016/j.biomaterials.2011.10.080 Ahamed, M., Alhadlaq, H. A., Khan, M. M., & Akhtar, M. J. (2013). Selective killing of cancer cells by iron oxide nanoparticles mediated through reactive oxygen species via p53 pathway. Journal of nanoparticle research , 15 , 1-11. https://doi.org/10.1007/s11051-012-1225-6 Sun, Q., Wang, H., Xiao, B., Xue, D., & Wang, G. (2022). Development and Validation of a 6-Gene Hypoxia-Related Prognostic Signature For Cholangiocarcinoma. Frontiers in Oncology , 12 . https://doi.org/10.3389/fonc.2022.954366 Xu, F., Xu, H., Li, Z., Huang, Y., Huang, X., Li, Y., ... & Lin, L. (2021). Glycolysis-based genes are potential biomarkers in thyroid cancer. Frontiers in Oncology , 11 , 534838. https://doi.org/10.3389/fonc.2021.534838 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 22 Jan, 2024 Reviews received at journal 19 Jan, 2024 Reviewers agreed at journal 18 Jan, 2024 Reviewers invited by journal 18 Jan, 2024 Submission checks completed at journal 15 Jan, 2024 Editor assigned by journal 15 Jan, 2024 First submitted to journal 12 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3857699","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":267138512,"identity":"65da6c81-8542-4341-8559-d5c9accf8427","order_by":0,"name":"Sedigheh Mehdinejad","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"prefix":"","firstName":"Sedigheh","middleName":"","lastName":"Mehdinejad","suffix":""},{"id":267138513,"identity":"58fe81c1-0a25-4d08-b5cb-8c3218062c61","order_by":1,"name":"Maryam Peymani","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"prefix":"","firstName":"Maryam","middleName":"","lastName":"Peymani","suffix":""},{"id":267138514,"identity":"2832eeca-b711-4cde-9a63-65cac328ec37","order_by":2,"name":"Ali Salehzadeh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDUlEQVRIie3Sv0oDMRzA8V8IOKV74K7cK0RucFH7KgkBpwqC4GLBSCFdKrdGFPoKeQNzHNRFnTOIeHTtUlwUW/DwHw7NIU4O+Qwh/OBLfkMAouhfwgo3J1IUO/c+oB9zEk7QV7LBPxP864Qw+JkEZaPydHaw3O0WyXjhXvRDll0UDp4HkG6p9Qm7EcPcEJmfX97a8kwfbtr7CtB4CiR1gQSETgjFwvp96zqaI0slQEcBoaHFinr0StiJuPL9x3KleW9iJKBVSwJeaEx4JSztQ9W8IpSXgNteYb4eJsRd58bvsSq949J62VymtGUxWT6R5XG3MHK2mB/xnYkRdT0fbPeCi63lvv9AFEVR9CdvWDpcw5h+DC4AAAAASUVORK5CYII=","orcid":"","institution":"Islamic Azad University","correspondingAuthor":true,"prefix":"","firstName":"Ali","middleName":"","lastName":"Salehzadeh","suffix":""},{"id":267138515,"identity":"88c43783-a570-4f0e-bf7f-cd3b30e0c17e","order_by":3,"name":"Mohammad Zaefizadeh","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Zaefizadeh","suffix":""}],"badges":[],"createdAt":"2024-01-12 17:14:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3857699/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3857699/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49766089,"identity":"880c7221-3bc5-4e20-9f3d-998bf8a6d200","added_by":"auto","created_at":"2024-01-17 16:59:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":86139,"visible":true,"origin":"","legend":"\u003cp\u003eAssociation of \u003cem\u003eKRAS\u003c/em\u003e-Influenced Genes with Key Malignancy-Related Pathways. (A) Volcano plot displaying significant expression changes of genes influenced by increased KRAS expression based on the GSE124627 study. (B) Enrichment results for all upregulated genes influenced by \u003cem\u003eKRAS\u003c/em\u003e overexpression using data from MsigDb. (C) Pathways associated with downregulated genes are indicated.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3857699/v1/f19a4e3372c5fbc6f3e91fd9.png"},{"id":49766962,"identity":"e2e091f2-8de5-41a7-b3e3-71c83cc1997b","added_by":"auto","created_at":"2024-01-17 17:07:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":130433,"visible":true,"origin":"","legend":"\u003cp\u003eProfound Expression Changes of \u003cem\u003eKRAS\u003c/em\u003e-Influenced Genes in Colorectal Cancer.\u003cstrong\u003e \u003c/strong\u003e(A) Heatmap representing all genes that undergo expression changes influenced by \u003cem\u003eKRAS\u003c/em\u003eand significant differential expression in cancer samples compared to normal samples based on TCGA data. (B-F) Association of expression levels of \u003cem\u003eKRAS\u003c/em\u003e-related genes with patient mortality rates based on TCGA data, using gene expression medians as cutoffs.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3857699/v1/28613c3584dc61d09c784ce7.png"},{"id":49766963,"identity":"82f74a87-b642-41f0-8b76-cbaac1b5616f","added_by":"auto","created_at":"2024-01-17 17:07:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":273000,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of Synthesized Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein Nanoparticles. A) FT_IR spectra of a) Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e, b) Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu, c) Oleuropein, and d) Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs. The peaks associated with each bond were marked in the picture. The spectrogram shows the proper synthesis and conjugation of the nanoparticles. B) The XRD spectrum shows that the amorphous synthesized structure was synthesized properly. C) TEM and D) SEM imaging showed that the Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs were spherical, with low aggregation and size range of 28-50 nm. E) TGA analysis of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein shows that the NPs have good thermal stability at the temperatures of less than 150 °C.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3857699/v1/e44ff79d53aa7a891570ced0.png"},{"id":49766087,"identity":"798bc780-23b9-4e89-82a3-82d47a489b8c","added_by":"auto","created_at":"2024-01-17 16:59:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":142217,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of Fe3O4@Glu-Oleuropein Nanoparticles\u003cstrong\u003e.\u003c/strong\u003e A) Magnetization curve of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs. The magnetic saturation was 1.85emu/g. B) The zeta potential of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs was -18.6 mV. C) DLS analysis. The Z-average was 163 r.nm. D) EDS-mapping assay revealed that the synthesized Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs contained C, Fe, and O atoms, and no elemental impurity was observed.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3857699/v1/74175d29efa6d0aef70ec6f3.png"},{"id":49766961,"identity":"9eb38312-ae0c-4740-a1a1-56f23a313c1b","added_by":"auto","created_at":"2024-01-17 17:07:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":199099,"visible":true,"origin":"","legend":"\u003cp\u003eAnticancer Effects of Fe3O4@Glu-Oleuropein Nanoparticles. A) MTT assay showed that the IC\u003csub\u003e50\u003c/sub\u003e of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein for normal human cells and colon cancer cell line were 251 and 105 µg/ml. Furthermore, the IC\u003csub\u003e50\u003c/sub\u003e of Oxaliplatin, as standard anticancer drug, for colon cancer cells was 49µg/ml. B) Flowcytometry analysis showed that Treating with the NPs considerably increased the population of apoptotic cells. Q1: necrotic cells, Q2: late apoptosis, Q3: early apoptosis, and Q4: live cells. C) Hoechst staining assay of control and Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein treated cells showed morphological nuclear changes, chromatin fragmentation, and apoptotic bodies could be observed in NPs treated cancer cells. D) The effect of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs on the expression of\u0026nbsp; \u003cem\u003eSNAI1\u003c/em\u003e, \u003cem\u003eANKZF1\u003c/em\u003e, and \u003cem\u003ePPFIA4 \u003c/em\u003egenes\u003cem\u003e revealed that \u003c/em\u003ethe \u003cem\u003eSNAI1\u003c/em\u003e, \u003cem\u003eANKZF1\u003c/em\u003e, and \u003cem\u003ePPFIA4 \u003c/em\u003ereduced by 0.36, 0.44, and 0.59 folds, respectively.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3857699/v1/e78237868f72e1ea2339addf.png"},{"id":49767409,"identity":"23fea8cd-e20f-4b94-9b87-7645844dec56","added_by":"auto","created_at":"2024-01-17 17:15:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1355403,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3857699/v1/516a3ee0-749d-4632-a457-37ca0ab31604.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genetic Insights and Therapeutic Potential for Colorectal cancer: Mutation Analysis of KRAS Gene and Efficacy of Oleuropein-Conjugated Iron Oxide Nanoparticles","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eDue to late diagnosis and insufficient efficiency of current therapeutic options, colon cancer remains the fifth deathly cancer, worldwide, that causes almost 1.15\u0026nbsp;million annual new cases and 0.6\u0026nbsp;million deaths [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The disease is usually diagnosed at its advanced stages when a colon tumor has been developed to several micro-metastatic tumors that are hardly treated [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Therefore, finding new solutions for timely identification and effective treatment of such severe and fatal disease is the goal of many research studies.\u003c/p\u003e \u003cp\u003eTargeting the metabolic mediators that are involved in the initiation and progression of cancer can be considered a new approach in the fight against cancer. Kirsten rat sarcoma (KRAS) is an oncogene that is responsible for the activation of the mitogen-activated protein kinase (MAPK) pathway [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Mutation in this oncogene is highly associated with the initiation, metastasis, and invasiveness of colorectal tumors [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In addition, it was found that \u003cem\u003eKRAS\u003c/em\u003e mutation is one of the most important predictive markers in determining resistance to some anticancer drugs [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Due to the critical role of this oncogene in the progression, invasiveness, and drug resistance of colon cancer, targeting downstream metabolic mediators of the \u003cem\u003eKRAS\u003c/em\u003e pathway can be proposed as an option for studies in the field of colon cancer control and treatment.\u003c/p\u003e \u003cp\u003eThe use of nanotechnology products in the field of cancer diagnosis and treatment has received much attention. Due to their large effective surface and small size, these particles can reach tumor tissues in the body and exert the desired anticancer effects. Also, nanoparticles can be considered as a platform to design multi-agent pharmaceutical compounds [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The use of iron oxide nanoparticles has been widely considered in the field of cancer diagnosis and treatment. Due to their acceptable stability and biocompatibility as well as their magnetic properties, these particles can be used as a tool in the field of targeted drug delivery to cancer tissues [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOleuropein is a polyphenol compound that is primarily found in olives and has antioxidant, anti-inflammatory, cardioprotective, neuroprotective, and hepatoprotective effects [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. It is also considered as a potentially active anticancer agent. Several \u003cem\u003ein-vitro\u003c/em\u003e and \u003cem\u003ein-vivo\u003c/em\u003e studies revealed that Oleuropein can reduce the viability and proliferation of cancer cells [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Treating colon cancer cell lines with Oleuropein caused cell cycle arrest and upregulation of proapoptotic genes that resulted in apoptosis induction and inhibition of colon cancer cells [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Therefore, it can be assumed that conjugating Oleuropein to magnetic nanoparticles can provide more effective anticancer effects against colon cancer cells. Based on this hypothesis, the current study investigates the cytotoxic effects of Iron oxide nanoparticles coated with Glucose and conjugated with Oleuropein (Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein) NPs on colon cancer cell line and evaluates the expression of some candidate genes associated with the \u003cem\u003eKRAS\u003c/em\u003e pathway to elucidate the anticancer mechanism of the synthesized NPs.\u003c/p\u003e \u003cp\u003eThis study aims to investigate the mutation rate of the \u003cem\u003eKRAS\u003c/em\u003e gene in CRC and explore the expression changes of \u003cem\u003eKRAS\u003c/em\u003e-influenced genes in relation to patient prognosis. Additionally, the study aims to evaluate the cytotoxic effects of Oleuropein-conjugated iron oxide nanoparticles on colon cancer cells, with the objective of identifying potential therapeutic strategies for the treatment of CRC.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1Data sources\u003c/h2\u003e \u003cp\u003eFor the purpose of investigating the mutation rate of \u003cem\u003eKRAS\u003c/em\u003e in colorectal cancer (CRC), TCGA data was utilized. In the first stage, the mutation data of genes (maf file) was downloaded using the TCGAbiolinks package through the mutect2 pipeline. Subsequently, the maftools package was used to identify the mutation rates and their types in CRC samples from the TCGA database. To identify genes that could undergo \u003cem\u003eKRAS\u003c/em\u003e-associated expression changes, a study with the accession number GSE124627 from the GEO database was utilized. In this study, the expression levels of wild-type KRAS and the (G12D) mutation were increased using expression vectors in the H1299 cell line, and the gene expression changes were examined compared to the empty vector group using the RNAseq method. The data from this study was downloaded in raw format (HTseq-Counts), and initial preprocessing was performed, including the removal of genes with zero or near-zero expression (CPM less than 10 in 70% of the samples) using the edgeR package. In the next stage, the data was normalized using the TMM method, and finally, all the data was transformed to a logarithmic scale based on 2. The resulting expression matrix was used for all subsequent analyses. Additionally, to examine the expression levels of candidate genes in CRC samples compared to normal samples, the transcriptomic data (RNAseq) available in the TCGA database (TCGA-COAD) was used. For the initial preprocessing of the TCGA data, in the first stage, genes with zero or near-zero expression based on the CMP criterion (less than 10) in 70% of the samples were removed. Then, the data was normalized using the TMM method, and the data was transformed to a logarithmic scale based on 2. The resulting expression matrix was used for all analyses, including differential expression between groups and investigating the correlation of candidate genes with patient prognosis. The TCGA-COAD data included 480 tumor samples at different stages and 41 normal samples.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Exploring gene expression changes associated with KRAS in CRC\u003c/h2\u003e \u003cp\u003eIn order to identify genes that can undergo \u003cem\u003eKRAS\u003c/em\u003e-associated expression changes, the GSE124627 data was utilized, and the differential expression between samples in the \u003cem\u003eKRAS\u003c/em\u003e and \u003cem\u003eG12D\u003c/em\u003e overexpression groups was calculated compared to the samples in the empty vector group. Additionally, to investigate the expression changes of candidate genes in CRC, the differential expression between cancer samples and normal samples was calculated. For this purpose, based on the clinical data, the RNAseq data obtained from the TCGA database was divided into two groups: normal and cancer. To identify signaling pathways associated with candidate genes, the Enrichr database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://maayanlab.cloud/Enrichr/\u003c/span\u003e\u003cspan address=\"https://maayanlab.cloud/Enrichr/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and the MsigDB repository were used.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Association between candidate gene expression and patient prognosis in CRC\u003c/h2\u003e \u003cp\u003eThe TCGA-COAD clinical data was used to examine the association between the expression of candidate genes and patient prognosis in CRC. Initial preprocessing steps were performed on the clinical data, including the removal of normal samples, the removal of samples with a survival time of 1 or NA, and the removal of samples with a death status but no tumor at the time of death. To investigate the association between the expression of candidate genes and patient prognosis, initially, the expression of all candidate genes was extracted for samples that met the mentioned clinical criteria. Then, the expression of each gene was transformed into a Z-score across all samples, and the univariate Cox regression test was used to examine the association between the expression of candidate genes and patient prognosis. Additionally, the Kaplan-Meier (K-M) curve was used to validate the results obtained. For this purpose, the median expression of candidate genes in all tumor samples was used as the cutoff, and the samples were divided into two groups: high expression and low expression.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Synthesis of nanoparticles\u003c/h2\u003e \u003cp\u003eTo synthesize Iron oxide NPs, at first, FeCl\u003csub\u003e3\u003c/sub\u003e.6H\u003csub\u003e2\u003c/sub\u003eO (7.57 g) and FeCl\u003csub\u003e2\u003c/sub\u003e.4H\u003csub\u003e2\u003c/sub\u003eO (3.17 g) were dissolved in deionized water, and the mixture was heated for one hour at 80\u0026deg;C. Next, 40 ml of a concentrated NH\u003csub\u003e3\u003c/sub\u003e solution was added and the mixture was heated at 80\u0026deg;C by applying a low flow of N\u003csub\u003e2\u003c/sub\u003e gas. After the formation of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e NPs, the particles were collected, repeatedly washed with water and ethanol, and finally dried at 70\u0026deg;C/ 8 hours [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In the next step, Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e NPs were coated with Glucose as follows: one gram of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e NPs and 0.5 g of D-glucose were added to deionized water, and the suspension was subjected to sonication for 30 min, and then, heated at 180\u0026deg;C for three h. Finally, the Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu NPs were collected by centrifuging the mixture at (6000 rpm), washed, and dried at 60\u0026deg;C for five 5 h.\u003c/p\u003e \u003cp\u003eIn the final step, Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu NPs were conjugated with Oleuropein as follows: one gram of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu and 0.1 g of Oleuropein were suspended evenly in deionized water, and the suspension was shaken overnight. Finally, the conjugated NPs collected, washed, and freeze-dried.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Characteristics of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu NPs\u003c/h2\u003e \u003cp\u003eFT-IR analysis was used to study of chemical bonds of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e, Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu, Oleuropein, and Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oluropein NPs. The analysis was performed by a Nicolet IR-100 FT-IR device, and in a range of 500\u0026ndash;4000 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. An XRD analysis was also performed on Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu NPs (Co-Ka X-radiation, k\u0026thinsp;=\u0026thinsp;1.79 \u0026Aring;) to investigate the crystal structure of the particles. Scanning Electron Microscope (SEM) (TESCAN Mira3) and Transmission Electron Microscope (TEM) (Zeiss EM-900) imaging investigated the size range, morphology, and aggregation level of the synthesized Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu NPs. Furthermore, the magnetic property and thermal stability of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu NPs was studied by VSM (LBKFB magnetometer, Daghigh Kavir Kashan, Iran) and TGA (Rheometric Scientific STA 1500, USA) assays, respectively. The zeta potential and hydrodynamic size of the particles were studied by a zeta sizer (Malvern Instruments Ltd, 6.32) and EDS-mapping analysis (TESCAN Mira3) was used to evaluate the elemental purity of the nanoproduct.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 MTT assay\u003c/h2\u003e \u003cp\u003eThe cytotoxic effect of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oluropein NPs on colon cancer cells (SW480) and normal human cells (HEK293) cell lines and also the effect of oxaliplatin, as a standard anticancer drug, on colon cancer cell line was studied by MTT (2-(4,5-dimethythiazol-2-yl) -2,5-diphenyltetrazolium bromide) assay. The cell lines were purchased from the Pasteur\u0026rsquo;s Institute of Iran and cell propagation was done in Dulbecco\u0026rsquo;s modified Eagle medium (DMEM) medium supplemented with fetal bovine serum and penicillin-streptomycin. Monolayers of the cells were grown in 96-well plates and then, treated with different concentrations of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oluropein NPs or oxaliplatin (0 to 500\u0026micro;g/ml). The plates were incubated at 37\u0026deg;C for 24 h, then, the medium was removed, and 200 \u0026micro;l of the MTT solution was added. After incubation for four hours at 37\u0026deg;C, the content of wells was aspirated and 200 \u0026micro;l of DMSO was added. The plates were stored at room temperature for 30 min and the optical absorption of the wells was measured at 570 nm (Bio-Rad, Hercules, microplate reader). The 50% inhibitory concentration (IC\u003csub\u003e50\u003c/sub\u003e) of the NPs was calculated by GraphPad Prism software (version 9.5.1, USA), and the percentage of inhibited cells as was calculated according to the following formula [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]:\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$Inhibition \\left(\\text{%}\\right)=\\frac{Abs of control-Abs of Test}{Abs of control}\\times 100$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Flow cytometry\u003c/h2\u003e \u003cp\u003eFlow cytometry analysis was used to quantify the percentage of apoptotic cells. To perform the assay, colon cancer cells were exposed to IC\u003csub\u003e50\u003c/sub\u003e concentration of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein for 24 h and then, subjected to a flow cytometry analysis. At first, Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein treated and control cells were stained by propidium iodide and Annexin V (Roche, Germany) and then, analyzed by a flow cytometry instrument (ZE5, BIO-RAD, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Gene expression assay\u003c/h2\u003e \u003cp\u003eThe effect of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Pleuropein on the expression of some candidate genes associated with the \u003cem\u003eKRAS\u003c/em\u003e pathway was studied by a real-time PCR assay. The relative expression of the \u003cem\u003eSNAI1\u003c/em\u003e, \u003cem\u003eANKZF\u003c/em\u003e, and \u003cem\u003ePPFIA4\u003c/em\u003e genes was quantified using primers that are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. In brief, colon cancer cells were treated with the nanoparticles for 24 h at their 50% inhibitory concentration. Extraction of total RNA was performed using the TriZol reagent (Sigma-Aldrich) and after DNaseI treatment, cDNA synthesis was performed using the SinaClone cDNA synthesis kit (Iran). Amplification of the fragments from Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein treated and control groups were done using an SYBR-Green real-time PCR assay kit (Dena Zist, Iran). Finally, the expression of studied genes in treated cells relative to the control group was calculated by the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequence of the primers used in this work\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReferences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSNAI1\u003c/b\u003e\u003cem\u003e1\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGTCTGCGTGGGTTTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSNAI1\u003c/b\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCTGGGGGTGGATTATTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eANKZF1\u003c/b\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGGAGCCTTCCACACAGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eANKZF1\u003c/b\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCACTCCAACATCTCCAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePPFIA4\u003c/b\u003e-F\u003c/p\u003e \u003cp\u003e\u003cb\u003ePPFIA4\u003c/b\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAGAATTGCAGCCCTCACC\u003c/p\u003e \u003cp\u003eCCAGCTCCTGGTTCTTCTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGAPDH\u003c/b\u003e -F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCACTCCTCCACCTTTGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGAPDH\u003c/b\u003e -R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATACCAGGAAATGAGCTTGACAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Hoechst staining\u003c/h2\u003e \u003cp\u003eThe possible nuclear damage and apoptotic changes caused by exposure of colon cancer cells to Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs were studied by the Hoechst staining. In brief, the SW480 cells were treated with the nanoparticles for 24 h, and next, were stained with the Hoechst 33258 solution. Finally, the cells were washed with PBS and examined under a fluorescent microscope (Incell Analyser 2000, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Statistical analyses\u003c/h2\u003e \u003cp\u003eAll initial preprocessing steps on the data were performed using the R programming language (v4.1). False discovery rate (FDR) was used to assess the statistical significance level, and an FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered significant for all analyses. GraphPad Prism (v8.4) was used for plotting graphs, and Cytoscape (v7.9) was used for creating co-expression networks. For laboratory analysis, statistical differences between Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs treated and control groups were analyzed by \u003cem\u003eone-way ANOVA\u003c/em\u003e using the SPSS.16.0 software. The assays were performed in three replicates and a \u003cem\u003ep\u003c/em\u003e-value of less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.1 The significance of KRAS alterations in CRC: insights from mutation analysis and gene expression profiling\u003c/h2\u003e \u003cp\u003eIn order to investigate the importance of \u003cem\u003eKRAS\u003c/em\u003e in CRC, the mutation rate of this gene in CRC was examined based on TCGA data. As shown in our recent study [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], five genes, including \u003cem\u003eTTN\u003c/em\u003e, \u003cem\u003eAPC\u003c/em\u003e, \u003cem\u003eMUC16\u003c/em\u003e, \u003cem\u003eTP53\u003c/em\u003e, and \u003cem\u003eKRAS\u003c/em\u003e, had the highest mutation rates among the genes in TCGA data. The results demonstrated that the mutation rate in the \u003cem\u003eKRAS\u003c/em\u003e gene in CRC samples was over 40%, with the majority of mutations being of the missense type. These findings suggest that \u003cem\u003eKRAS\u003c/em\u003e and its associated genes can be key factors in the development and progression of CRC.\u003c/p\u003e \u003cp\u003eFurthermore, to identify genes that may be influenced by \u003cem\u003eKRAS\u003c/em\u003e alterations, the study GSE124627 was utilized. The differential expression results revealed that 180 genes showed significant and substantial increase in expression (LogFC\u0026thinsp;\u0026gt;\u0026thinsp;1, FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.01) in \u003cem\u003eKRAS\u003c/em\u003e-overexpressing samples compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). On the other hand, 76 genes were identified to have a significant decrease in expression (LogFC \u0026lt; -1, FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). To confirm whether the identified genes are involved in the KRAS-related pathway, online database data were used and the identified genes were identified [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe enrichment analysis for the upregulated 183 genes demonstrated their involvement in pathways such as glycolysis, mTORC1, inflammation, EM\u003cem\u003eT\u003c/em\u003e, and \u003cem\u003eKRAS\u003c/em\u003e signaling (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Conversely, the downregulated 76 genes were found to be involved in pathways related to angiogenesis, apoptosis, and DNA repair (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). As these results showed, some increased genes were related to KRAS signaling pathway. Also, pathways such as glycolysis, EMT, and mTORC1 can also be affected by the KRAS pathway, and the genes related to these pathways are increased in CRC [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThese results indicate that genes influenced by \u003cem\u003eKRAS\u003c/em\u003e play a role in major cancer-associated pathways, and this category of genes can be potential therapeutic targets in relation to KRAS mutations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.2 KRAS-Association gene expression changes in CRC: impact on patient survival and therapeutic opportunities\u003c/h2\u003e \u003cp\u003eFor further insight into the identified genes from the previous stage in CRC, the expression levels of 180 upregulated genes by \u003cem\u003eKRAS\u003c/em\u003e and 76 downregulated genes in CRC samples compared to normal samples were examined based on TCGA data. Our investigations demonstrated that among the 180 upregulated genes, 22 genes showed significant increase in expression (with logFC\u0026thinsp;\u0026gt;\u0026thinsp;1 and FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.01) in cancer samples compared to normal samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). On the other hand, 14 genes were identified that exhibited decreased expression both under the influence of KRAS and in cancer samples compared to normal samples (with logFC\u0026lt;-1 and FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). These findings indicate that KRAS-influenced genes undergo noticeable changes in expression in CRC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, the association between the expression of the identified genes and the survival rate of the studied patients was investigated. The Cox regression analysis results showed that among the 22 upregulated genes, increased expression of \u003cem\u003eANKZF1\u003c/em\u003e, \u003cem\u003eSNAI1\u003c/em\u003e, \u003cem\u003ePPFIA4\u003c/em\u003e, \u003cem\u003eSIX4\u003c/em\u003e, and \u003cem\u003eNOTUM\u003c/em\u003e was associated with poor prognosis (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, HR\u0026thinsp;\u0026gt;\u0026thinsp;1, FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.01). On the other hand, none of the downregulated genes were associated with the mortality rate of the patients. To confirm the obtained results, Kaplan-Meier curves were used for the genes \u003cem\u003eANKZF1\u003c/em\u003e, \u003cem\u003eSNAI1\u003c/em\u003e, \u003cem\u003ePPFIA4\u003c/em\u003e, \u003cem\u003eSIX4\u003c/em\u003e, and \u003cem\u003eNOTUM\u003c/em\u003e. The Kaplan-Meier results demonstrated that increased expression of \u003cem\u003eANKZF1\u003c/em\u003e, \u003cem\u003eSNAI1\u003c/em\u003e, \u003cem\u003ePPFIA4\u003c/em\u003e, \u003cem\u003eSIX4\u003c/em\u003e, and \u003cem\u003eNOTUM\u003c/em\u003e was associated with higher mortality rate of patients (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB-F, logRank\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results indicate that \u003cem\u003eKRAS\u003c/em\u003e-influenced genes not only undergo significant changes in expression in CRC but also their expression alterations can be associated with the mortality rate of patients. For further laboratory analyses and validations, we selected three genes, namely \u003cem\u003eANKZF1\u003c/em\u003e, \u003cem\u003eSNAI1\u003c/em\u003e, and \u003cem\u003ePPFIA4\u003c/em\u003e, which have been less studied in CRC.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCox regression test results for identified genes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eUnivariate\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e95% CI\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eANKZF1\u003c/em\u003e expression\u003c/p\u003e \u003cp\u003e(High vs. Low)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.04\u0026ndash;1.96\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSNAI1\u003c/em\u003e expression\u003c/p\u003e \u003cp\u003e(High vs. Low)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.07\u0026ndash;1.98\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePPFIA4\u003c/em\u003e expression\u003c/p\u003e \u003cp\u003e(High vs. Low)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.16\u0026ndash;2.16\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSIX4\u003c/em\u003e expression\u003c/p\u003e \u003cp\u003e(High vs. Low)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.24\u0026ndash;2.16\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eNOTUM\u003c/em\u003e expression\u003c/p\u003e \u003cp\u003e(High vs. Low)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.02\u0026ndash;1.92\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Characterization of nanoparticles\u003c/h2\u003e \u003cp\u003eFT-IR analysis of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e, Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu, Oleuropein, and Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein was presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA. According to the results, in the spectrum for Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e nanoparticles, two absorption peaks were observed at 420, and 580 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e which are respectively caused by Fe-O bonds related to Fe\u003csup\u003e2+\u003c/sup\u003e and Fe\u003csup\u003e3+\u003c/sup\u003e ions located in octahedral positions and Fe\u003csup\u003e3+\u003c/sup\u003e ion located in a tetrahedron. This finding supports the formation of the Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e structure. Considering the spectrum b related to Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glucose composite, the peaks at 813, 898, and 1606 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e are corresponding to C-H, N-H, and C\u0026thinsp;=\u0026thinsp;C bonds, respectively, and the peaks at 436 and 587 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e are related to the presence of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e NPs. In addition, two peaks at 2018 and 3634 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, that are related to C-O and O-H stretching bonds, were observed. In the spectrum related to Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein, two peaks, related to the C-H bond, at 765 and 825 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, and two peaks at 1123 and 1397 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, related to the C-N and C-O bonds, were found. Furthermore, the peaks related to the N-H, O\u0026thinsp;=\u0026thinsp;C, and O-H bonds were observed at 1601, 1706, and 3453 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, respectively. In the Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein spectrum, the peaks related to Fe-O and Oleuropein were observed that confirms the synthesis and conjugation of the composite.\u003c/p\u003e \u003cp\u003eBased on the XRD spectrum, the peaks that are observed at 2θ of 30 to 40 degrees are related to iron oxide nanoparticles that are in agreement with references [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Furthermore, the presence of the peaks in 2θ of 30\u0026ndash;40 degrees and the presence of a peak in 2θ of 55\u0026ndash;65 degrees, the presence of iron oxide NPs and Oleuropein is confirmed [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Overall, the XRD spectrum shows that the amorphous synthesized structure was synthesized properly. The results were presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB. Electron microscopy imaging of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein showed that the particles were synthesized in a size range of 28\u0026ndash;50 nm, were spherical, and with a low level of aggregation. The SEM and TEM images were presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and 43D. The thermogravimetric assay revealed that the synthesized nanoparticles were stable enough at temperatures of less than 150\u0026deg;C and had no considerable weight loss. The thermal stability chart of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein was displayed in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe magnetic property of the particles was confirmed by VSM analysis and the highest recorded magnetization was 1.85emu/g (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The surface charge and hydrodynamic size of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein were 18.6 mV and 163nm, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). According to the EDS-map analysis, Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein consisted of C, O, and Fe atoms that indicate the elemental purity of the synthesized NPs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Cytotoxic effect\u003c/h2\u003e \u003cp\u003eCytotoxic effect of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein on colon cancer and human normal cells was studied by the MTT assay. According to the results, Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein had considerable cytotoxicity for colon cancer cells with an IC\u003csub\u003e50\u003c/sub\u003e of 105\u0026micro;g/mL, while the IC\u003csub\u003e50\u003c/sub\u003e of the NPs for normal human cell line was 251\u0026micro;g/ml. In addition, the IC\u003csub\u003e50\u003c/sub\u003e of oxaliplatin for the colon cancer cell line was 49\u0026micro;g/mL. Overall; the nanoparticles were more toxic for colon cancer cells than for normal human cell line. The results were displayed in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Flow cytometry study\u003c/h2\u003e \u003cp\u003eThe frequency of cell apoptosis in Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein-treated and control colon cancer cells were studied by flow cytometry analysis. The results showed that the frequency of early and late apoptosis in control cells were 0.18 and 0.33%, while the population of the cells with early and late apoptosis in NPs treated cells raised to 12.47 and 10.31%, respectively. The results were displayed in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Hoechst staining\u003c/h2\u003e \u003cp\u003eTo characterize possible nuclear damage from exposure to Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein, Hoechst staining was performed. According to the results, treating colon cancer cells with the NPs led to the appearance of proapoptotic features and nuclear damage, including chromatin fragmentation, and the appearance of apoptotic bodies. In contrast, no considerable nuclear damage was found in control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.7 Gene expression\u003c/h2\u003e \u003cp\u003eThe effect of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein on the expression of some candidate genes related to the \u003cem\u003eKRAS\u003c/em\u003e pathway, including the \u003cem\u003eSNAI1\u003c/em\u003e, \u003cem\u003eANKZF\u003c/em\u003e, and \u003cem\u003ePPFIA4\u003c/em\u003e was evaluated by real-time PCR. According to the results, upon treating colon cancer cells with the synthesized NPs the relative expression of the \u003cem\u003ePPFIA4\u003c/em\u003e, \u003cem\u003eANKZF1\u003c/em\u003e, and \u003cem\u003eSNAI1\u003c/em\u003e genes reduced by 0.59, 0.44, and 0.36 folds, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eColon cancer is known as a serious and hard-to-treat disease that is usually detected in the late stages and as a result, causes many deaths worldwide [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The treatment of this disease, especially in its advanced stages, is a serious challenge in the field of cancer treatment, and current chemotherapy drugs generally lack sufficient efficiency for effective treatment. Therefore, new researches are focusing on the design of new drugs and targeted drug delivery to cancer tissues in order to achieve more efficient treatments. The study aimed to enhance our knowledge of the impact of \u003cem\u003eKRAS\u003c/em\u003e alterations in CRC and explore potential therapeutic opportunities targeting \u003cem\u003eKRAS\u003c/em\u003e-influenced genes. The findings of this study provide valuable insights into the significance of \u003cem\u003eKRAS\u003c/em\u003e alterations in CRC through mutation analysis and gene expression profiling. The high mutation rate of the \u003cem\u003eKRAS\u003c/em\u003e gene observed in CRC samples emphasizes its importance in the development and progression of the disease. The majority of mutations were of the missense type, indicating potential functional implications of these alterations. This highlights the need to further understand the role of \u003cem\u003eKRAS\u003c/em\u003e and its associated genes in CRC. The gene expression analysis revealed a set of genes influenced by \u003cem\u003eKRAS\u003c/em\u003e alterations. The upregulated genes were found to be involved in crucial cancer-related pathways, including glycolysis, inflammation, epithelial-mesenchymal transition (EMT), and \u003cem\u003eKRAS\u003c/em\u003e signaling. These pathways are known to play essential roles in cancer development and progression. Therefore, the identified upregulated genes hold promise as potential therapeutic targets for CRC, as their dysregulation may contribute to tumor growth and survival. Conversely, the downregulated genes were associated with pathways related to angiogenesis, apoptosis, and DNA repair. The decreased expression of these genes in both \u003cem\u003eKRAS\u003c/em\u003e-influenced samples and cancer samples suggests their involvement in tumor suppression mechanisms. Restoring the expression of these downregulated genes could potentially serve as a therapeutic strategy to inhibit tumor growth and enhance treatment response in CRC. Furthermore, the analysis of the expression levels of the identified genes in CRC samples compared to normal samples revealed significant changes in gene expression. Among the upregulated genes, several genes including \u003cem\u003eANKZF1\u003c/em\u003e, \u003cem\u003eSNAI1\u003c/em\u003e, \u003cem\u003ePPFIA4\u003c/em\u003e, \u003cem\u003eSIX4\u003c/em\u003e, and \u003cem\u003eNOTUM\u003c/em\u003e exhibited increased expression and were associated with poor prognosis. The Kaplan-Meier analysis confirmed that increased expression of these genes correlated with higher mortality rates in CRC patients.\u003c/p\u003e \u003cp\u003eBased on \u003cem\u003ein-vitro\u003c/em\u003e and \u003cem\u003ein-vivo\u003c/em\u003e studies, oleuropein, a polyphenolic compound in olives, has shown good anticancer properties against several cancer cells, including colon cancer. In addition, iron oxide nanoparticles are known as suitable candidates for targeted drug delivery due to their small size, biocompatibility, and magnetic properties. Therefore, in this study, the cytotoxic effect of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs against colon cancer cells and the expression of some candidate genes of the \u003cem\u003eKRAS\u003c/em\u003e pathway were investigated. Physicochemical examination of synthesized nanoparticles indicates that iron oxide nanoparticles are well synthesized, coated with glucose, and conjugated with Oleuropein. Also, the nanoparticles have good thermal stability and their accumulation is prevented due to having an acceptable surface charge. Also, the nanoparticles are free of impurities and have magnetic properties that make them efficient for drug delivery under an external magnetic force. Investigating the cytotoxic effects of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs by MTT assay showed that the nanoparticles at concentrations greater than 31.25\u0026micro;g/mL had toxic effects on the studied cells. Although based on the IC\u003csub\u003e50\u003c/sub\u003e value, the nanoparticles had significantly higher toxic effects on cancer cells compared to normal cell line. The higher sensitivity of cancer cells can be related to their metabolic characteristics and nutritional requirements. Such cells generally have a high proliferation rate and therefore have a higher nutrient uptake, compared to normal cells. Accordingly, one of the primary reasons for the higher sensitivity of these cells to Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein can be related to the higher permeability of their surface envelopes in order to absorb more nutrients. In addition, since glucose has been used to coat iron oxide nanoparticles and considering that this molecule is one of the most important nutrients required by human cells, especially cancer cells, this can increase the penetration rate of nanoparticles into cancer cells and as a result cause their higher sensitivity compared to normal cells.\u003c/p\u003e \u003cp\u003eThe cytotoxic effects of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein can be related to its components, including iron oxide nanoparticles and Oleuropein. Previous studies have well demonstrated the anticancer properties of Oleuropein and associated the anticancer effects of Oleuropein with the interruption of apoptosis regulatory proteins, activation of caspases, and also inducing the cell cycle arrest [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Therefore, according to the observation of the cytotoxic effects of synthesized nanoparticles against colon cancer cells, their cytotoxic effects can be primarily related to the anticancer activity of Oleuropein.\u003c/p\u003e \u003cp\u003eIn addition, previous studies have reported the anticancer properties of iron oxide nanoparticles. Most of these studies have related the cytotoxic effects of iron oxide nanoparticles to the production of reactive oxygen species and the subsequent damage to the cytoplasmic membrane and internal components of the cell [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Therefore, in addition to the Oleuropein, the anticancer effects of Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein can be also related to the cytotoxic activity of iron oxide.\u003c/p\u003e \u003cp\u003eFlow cytometry study on colon cancer cells showed that exposure to nanoparticlesFe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein significantly increased the percentage of apoptotic cells. Considering the apoptogenic properties of Oleuropein and the possible cell damage caused by the induction of oxidative stress by iron oxide nanoparticles, apoptosis induction can be considered as one of the expected consequences of exposure of colon cancer cells to the synthesized nanoparticles, which is consistent with previous studies [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn agreement with these results, the Hoechst staining test showed the occurrence of apoptotic features including chromatin fragmentation, chromatin condensation, and the appearance of apoptotic bodies, which indicates the induction of apoptosis by Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs in colon cancer cells.\u003c/p\u003e \u003cp\u003eEvaluating the relative expression of some candidate genes related to the \u003cem\u003eKRAS\u003c/em\u003e pathway showed that the expression level of all studied genes in colon cancer cells exposed to Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein significantly decreased. \u003cem\u003eKRAS\u003c/em\u003e mutation is a frequent event in colon cancer and is associated with tumor metastasis, drug resistance, and invasiveness [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The oncogenic \u003cem\u003eKRAS\u003c/em\u003e has a unique function to suppress p53 mediated cell apoptosis through the activation of Snail protein. It was reported that Snail could directly bind to the DNA binding domain of p53 and diminish the tumor-suppressive function of p53 [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In this study, we found that treating colon cancer cells with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein significantly reduced the expression of the \u003cem\u003eSNAI1\u003c/em\u003e, the gene encoding for Snail protein, by 0.36 folds. Due to the critical role of p53 in apoptosis induction, downregulation of the \u003cem\u003eSNAI1\u003c/em\u003e gene indicates apoptosis-inducing property of the nanoparticles, which is in agreement with other findings. Moreover,\u003c/p\u003e \u003cp\u003e \u003cem\u003eANKZF1\u003c/em\u003e gene is known as a new potential marker for colon cancer. High expression of the \u003cem\u003eANKF1\u003c/em\u003e gene has been reported at advanced stages of colon cancer, suggesting its critical role in the progression of colon cancer. In addition, high expression of this gene has been associated with poor response to chemotherapy drugs and also poor survival of colon cancer [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Therefore, changes in the expression of the \u003cem\u003eANKZF1\u003c/em\u003e can be considered a reliable predictor index in order to check the treatment process. Our results showed that treating colon cancer cells with Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein significantly decreased the expression of the \u003cem\u003eANKZF1\u003c/em\u003e gene, indicating its therapeutic potential against colon cancer.\u003c/p\u003e \u003cp\u003eMoreover, we found that the \u003cem\u003ePPFIA4\u003c/em\u003e gene was also down-regulated in nanoparticle-treated cells. PTPRF Interacting Protein Alpha 4 (PPFIA4) is involved in the glycolysis of the tumor microenvironment, which facilitates the proliferation and migration of tumor cells in colon cancer and thus, has an important role in the progression and invasiveness of the disease [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In general, the reduction of the expression of the genes involved in the KRAS pathway by Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein showed that these nanoparticles, by interfering with the genetic pathways of colon cancer cells, may play a role in reducing the proliferation, survival, and invasiveness of tumor tissues. These findings highlight the clinical relevance of \u003cem\u003eKRAS\u003c/em\u003e-influenced genes and their potential as prognostic markers in CRC.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn conclusion, this study shed light on the significance of \u003cem\u003eKRAS\u003c/em\u003e alterations in CRC and their potential implications for treatment strategies. Also, Fe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e@Glu-Oleuropein NPs can be considered as an anticancer agent to reduce the survival rate and proliferation of colon cancer cells. These findings contribute to our understanding of CRC genetics and provide a basis for further investigations and the development of innovative therapeutic approaches in the battle against CRC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgment:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank to Mr.\u0026nbsp;Mohamad Mahdevar\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003efor his help in bioinformatics section.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors express no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eApproval for human experiments:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e:\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA.S., S.M. and M.P.:\u003cstrong\u003e\u0026nbsp;Conceptualization\u003c/strong\u003e. A.S., S.M., M.Z. and M.P.: \u003cstrong\u003eMethodology\u003c/strong\u003e. A.S. and M.P.: \u003cstrong\u003eFormal analysis and investigation\u003c/strong\u003e. A.S., S.M. and M.P.: \u003cstrong\u003eWriting Original Draft Preparation\u003c/strong\u003e. S.M.: \u003cstrong\u003eResources\u003c/strong\u003e. A.S., M.Z. and M.P.:\u003cstrong\u003eSupervision\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSung, H., Ferlay, J., Siegel, R. L., Laversanne, M., Soerjomataram, I., Jemal, A., \u0026amp; Bray, F. (2021). Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. \u003cem\u003eCA: a cancer journal for clinicians\u003c/em\u003e, \u003cem\u003e71\u003c/em\u003e(3), 209-249. https://doi.org/10.3322/caac.21660\u003c/li\u003e\n\u003cli\u003eMishra, J., Drummond, J., Quazi, S. H., Karanki, S. S., Shaw, J. J., Chen, B., \u0026amp; Kumar, N. (2013). Prospective of colon cancer treatments and scope for combinatorial approach to enhanced cancer cell apoptosis. \u003cem\u003eCritical reviews in oncology/hematology\u003c/em\u003e, \u003cem\u003e86\u003c/em\u003e(3), 232-250. https://doi.org/10.1016/j.critrevonc.2012.09.014\u003c/li\u003e\n\u003cli\u003eSantarpia, L., Myers, J. N., Sherman, S. I., Trimarchi, F., Clayman, G. L., \u0026amp; El‐Naggar, A. K. (2010). Genetic alterations in the RAS/RAF/mitogen‐activated protein kinase and phosphatidylinositol 3‐kinase/Akt signaling pathways in the follicular variant of papillary thyroid carcinoma. \u003cem\u003eCancer\u003c/em\u003e, \u003cem\u003e116\u003c/em\u003e(12), 2974-2983. https://doi.org/10.1002/cncr.25061\u003c/li\u003e\n\u003cli\u003eKnickelbein, K., \u0026amp; Zhang, L. (2015). Mutant KRAS as a critical determinant of the therapeutic response of CRC. \u003cem\u003eGenes \u0026amp; diseases\u003c/em\u003e, \u003cem\u003e2\u003c/em\u003e(1), 4-12. https://doi.org/10.1016/j.gendis.2014.10.002\u003c/li\u003e\n\u003cli\u003eMisale, S., Yaeger, R., Hobor, S., Scala, E., Janakiraman, M., Liska, D., ... \u0026amp; Bardelli, A. (2012). Emergence of KRAS mutations and acquired resistance to anti-EGFR therapy in CRC. \u003cem\u003eNature\u003c/em\u003e, \u003cem\u003e486\u003c/em\u003e(7404), 532-536. https://doi.org/10.1038/nature11156\u003c/li\u003e\n\u003cli\u003eZhang, H., Wang, G., \u0026amp; Yang, H. (2011). Drug delivery systems for differential release in combination therapy. \u003cem\u003eExpert opinion on drug delivery\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(2), 171-190. https://doi.org/10.1517/17425247.2011.547470\u003c/li\u003e\n\u003cli\u003eKievit, F. M., \u0026amp; Zhang, M. (2011). Surface engineering of iron oxide nanoparticles for targeted cancer therapy. \u003cem\u003eAccounts of chemical research\u003c/em\u003e, \u003cem\u003e44\u003c/em\u003e(10), 853-862. https://doi.org/10.1021/ar2000277\u003c/li\u003e\n\u003cli\u003eShamshoum, H., Vlavcheski, F., \u0026amp; Tsiani, E. (2017). Anticancer effects of oleuropein. \u003cem\u003eBiofactors\u003c/em\u003e, \u003cem\u003e43\u003c/em\u003e(4), 517-528. . https://doi.org/10.1002/biof.1366\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez-Arroyo, S., G\u0026oacute;mez-Mart\u0026iacute;nez, A., Rocamora-Reverte, L., Quirantes-Pin\u0026eacute;, R., Segura-Carretero, A., Fern\u0026aacute;ndez-Guti\u0026eacute;rrez, A., \u0026amp; Ferragut, J. A. (2012). Application of nanoLC-ESI-TOF-MS for the metabolomic analysis of phenolic compounds from extra-virgin olive oil in treated colon-cancer cells. \u003cem\u003eJournal of pharmaceutical and biomedical analysis\u003c/em\u003e, \u003cem\u003e63\u003c/em\u003e, 128-134. https://doi.org/10.1016/j.jpba.2012.01.033\u003c/li\u003e\n\u003cli\u003eC\u0026aacute;rdeno, A., S\u0026aacute;nchez-Hidalgo, M., Rosillo, M. A., \u0026amp; de la Lastra, C. A. (2013). Oleuropein, a secoiridoid derived from olive tree, inhibits the proliferation of human CRC cell through downregulation of HIF-1\u0026alpha;. \u003cem\u003eNutrition and cancer\u003c/em\u003e, \u003cem\u003e65\u003c/em\u003e(1), 147-156. https://doi.org/10.1080/01635581.2013.741758\u003c/li\u003e\n\u003cli\u003eFekri Kohan, S., Zamani, H. \u0026amp; Salehzadeh, A. (2023). Antibacterial potential and cytotoxic activity of iron oxide nanoparticles conjugated with thymol (Fe3O4@Glu-Thymol) on breast cancer cells and investigating the expression of \u003cem\u003eBAX\u003c/em\u003e, \u003cem\u003eCASP8\u003c/em\u003e, and \u003cem\u003eBCL-2\u003c/em\u003e genes. Biometals (2023). https://doi.org/10.1007/s10534-023-00516-7\u003c/li\u003e\n\u003cli\u003eHosseinkhah, M., Ghasemian, R., Shokrollahi, F., Mojdehi, S. R., Noveiri, M. J. S., Hedayati, M., ... \u0026amp; Salehzadeh, A. (2021). Cytotoxic Potential of Nickel Oxide Nanoparticles Functionalized with Glutamic Acid and Conjugated with Thiosemicarbazide (NiO@ Glu/TSC) Against Human Gastric Cancer Cells. \u003cem\u003eJournal of Cluster Science\u003c/em\u003e, 1-9. DOI: 10.1007/s10876-021-02124-2\u003c/li\u003e\n\u003cli\u003eKumari, R., Saini, A. K., Kumar, A., \u0026amp; Saini, R. V. (2020). Apoptosis induction in lung and prostate cancer cells through silver nanoparticles synthesized from Pinus roxburghii bioactive fraction. \u003cem\u003eJBIC Journal of Biological Inorganic Chemistry\u003c/em\u003e, \u003cem\u003e25\u003c/em\u003e(1), 23-37. https://doi.org/10.1007/s00775-019-01729-3\u003c/li\u003e\n\u003cli\u003ePfaffl, M. W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. \u003cem\u003eNucleic Acids Res\u003c/em\u003e. 29: e45. https://doi.org/10.1093/nar/29.9.e45. \u003c/li\u003e\n\u003cli\u003eNiyaki, Z. M., Salehzadeh, A., Peymani, M., \u0026amp; Zaefizadeh, M.(2023). Exploring the Therapeutic Potential of Fe3O4@ Glu-Oleuropein Nanoparticles in Targeting KRAS Pathway-Regulating lncRNAs in Colorectal Cancer Cells. \u003cem\u003eBiological trace element research\u003c/em\u003e. https://doi.org/10.1007/s12011-023-03892-w\u003c/li\u003e\n\u003cli\u003eFritsche-Guenther, R., Zasada, C., Mastrobuoni, G., Royla, N., Rainer, R., Ro\u0026szlig;ner, F., ... \u0026amp; Kempa, S. (2018). Alterations of mTOR signaling impact metabolic stress resistance in colorectal carcinomas with BRAF and KRAS mutations. \u003cem\u003eScientific reports\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(1), 9204. https://doi.org/10.1038/s41598-018-27394-1\u003c/li\u003e\n\u003cli\u003eCharitou, T., Srihari, S., Lynn, M. A., Jarboui, M. A., Fasterius, E., Moldovan, M., ... \u0026amp; Lynn, D. J. (2019). Transcriptional and metabolic rewiring of colorectal cancer cells expressing the oncogenic KRAS G13D mutation. \u003cem\u003eBritish journal of cancer\u003c/em\u003e, \u003cem\u003e121\u003c/em\u003e(1), 37-50. https://doi.org/10.1038/s41416-019-0477-7\u003c/li\u003e\n\u003cli\u003eLee, S. H., Lee, S. J., Jung, Y. S., Xu, Y., Kang, H. S., Ha, N. C., \u0026amp; Park, B. J. (2009). Blocking of p53-Snail binding, promoted by oncogenic K-Ras, recovers p53 expression and function. \u003cem\u003eNeoplasia\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(1), 22-IN6. https://doi.org/10.1593/neo.81006\u003c/li\u003e\n\u003cli\u003eZhou, X., Shang, Y. N., Lu, R., Fan, C. W., \u0026amp; Mo, X. M. (2019). High ANKZF1 expression is associated with poor overall survival and recurrence-free survival in colon cancer. \u003cem\u003eFuture Oncology\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(18), 2093-2106. https://doi.org/10.2217/fon-2018-0920\u003c/li\u003e\n\u003cli\u003eShirmohamadi, M., Eghbali, E., Najjary, S., Mokhtarzadeh, A., Kojabad, A. B., Hajiasgharzadeh, K., ... \u0026amp; Baradaran, B. (2020). Regulatory mechanisms of microRNAs in CRC and CRC stem cells. \u003cem\u003eJournal of cellular physiology\u003c/em\u003e, \u003cem\u003e235\u003c/em\u003e(2), 776-789. https://doi.org/10.1002/jcp.29042\u003c/li\u003e\n\u003cli\u003eGiner, E., Recio, M. C., R\u0026iacute;os, J. L., Cerd\u0026aacute;‐Nicol\u0026aacute;s, J. M., \u0026amp; Giner, R. M. (2016). Chemopreventive effect of oleuropein in colitis‐associated CRC in c57bl/6 mice. \u003cem\u003eMolecular nutrition \u0026amp; food research\u003c/em\u003e, \u003cem\u003e60\u003c/em\u003e(2), 242-255. https://doi.org/10.1002/mnfr.201500605\u003c/li\u003e\n\u003cli\u003eKhan, M. I., Mohammad, A., Patil, G., Naqvi, S. A. H., Chauhan, L. K. S., \u0026amp; Ahmad, I. (2012). Induction of ROS, mitochondrial damage and autophagy in lung epithelial cancer cells by iron oxide nanoparticles. \u003cem\u003eBiomaterials\u003c/em\u003e, \u003cem\u003e33\u003c/em\u003e(5), 1477-1488. https://doi.org/10.1016/j.biomaterials.2011.10.080\u003c/li\u003e\n\u003cli\u003eAhamed, M., Alhadlaq, H. A., Khan, M. M., \u0026amp; Akhtar, M. J. (2013). Selective killing of cancer cells by iron oxide nanoparticles mediated through reactive oxygen species via p53 pathway. \u003cem\u003eJournal of nanoparticle research\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e, 1-11. https://doi.org/10.1007/s11051-012-1225-6\u003c/li\u003e\n\u003cli\u003eSun, Q., Wang, H., Xiao, B., Xue, D., \u0026amp; Wang, G. (2022). Development and Validation of a 6-Gene Hypoxia-Related Prognostic Signature For Cholangiocarcinoma. \u003cem\u003eFrontiers in Oncology\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e. https://doi.org/10.3389/fonc.2022.954366\u003c/li\u003e\n\u003cli\u003eXu, F., Xu, H., Li, Z., Huang, Y., Huang, X., Li, Y., ... \u0026amp; Lin, L. (2021). Glycolysis-based genes are potential biomarkers in thyroid cancer. \u003cem\u003eFrontiers in Oncology\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e, 534838. https://doi.org/10.3389/fonc.2021.534838\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"naunyn-schmiedebergs-archives-of-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nsap","sideBox":"Learn more about [Naunyn-Schmiedeberg's Archives of Pharmacology](https://www.springer.com/journal/210)","snPcode":"210","submissionUrl":"https://submission.nature.com/new-submission/210/3","title":"Naunyn-Schmiedeberg's Archives of Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Apoptosis, Iron oxide, KRAS pathway, Oleuropein, Therapeutic targets","lastPublishedDoi":"10.21203/rs.3.rs-3857699/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3857699/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study aimed to address the challenges of treating advanced stages of colon cancer (CRC) by exploring potential therapeutic options. The research focused on the genetic aspects of CRC, specifically the mutation rate of the \u003cem\u003eKRAS\u003c/em\u003e gene, along with other genes like \u003cem\u003eTTN\u003c/em\u003e, \u003cem\u003eAPC\u003c/em\u003e, \u003cem\u003eMUC16\u003c/em\u003e, and TP53, using the TCGA dataset. Additionally, the study investigated the efficacy of Oleuropein, a polyphenolic compound found in olives, in combating CRC by using iron oxide nanoparticles coated with glucose and conjugated with Oleuropein. The study characterized the physicochemical properties of the nanoparticles and the cytotoxic effects of the nanoparticles were evaluated on CRC and normal fibroblast cell lines, demonstrating significantly higher cytotoxicity against CRC cells compared to normal cells. Furthermore, the study analyzed gene expression changes using the GSE124627 dataset to understand the influence of KRAS alterations. It identified numerous upregulated and downregulated genes in KRAS-overexpressing samples, suggesting their involvement in critical cancer-related pathways. These findings suggest that \u003cem\u003eKRAS\u003c/em\u003e-influenced genes could serve as potential therapeutic targets for CRC treatment. The study also examined the expression levels of identified genes in CRC samples compared to normal samples. Among the upregulated genes, 22 showed significant increases in cancer samples, while 14 downregulated genes exhibited decreased expression in both KRAS-influenced and cancer samples. Cox regression analysis identified specific upregulated genes, including \u003cem\u003eANKZF1\u003c/em\u003e, \u003cem\u003eSNAI1\u003c/em\u003e, \u003cem\u003ePPFIA4\u003c/em\u003e, \u003cem\u003eSIX4\u003c/em\u003e, and \u003cem\u003eNOTUM\u003c/em\u003e, associated with poor prognosis. Kaplan-Meier analysis further confirmed the correlation between increased expression of these genes and higher patient mortality rates. In conclusion, this study provided valuable insights into the genetic aspects of CRC and potential therapeutic strategies. The use of Oleuropein-conjugated iron oxide nanoparticles showed promising cytotoxic effects on colon cancer cells. These findings contribute to advancing our understanding of CRC and offer potential targets for further investigation and the development of novel therapeutic approaches.\u003c/p\u003e","manuscriptTitle":"Genetic Insights and Therapeutic Potential for Colorectal cancer: Mutation Analysis of KRAS Gene and Efficacy of Oleuropein-Conjugated Iron Oxide Nanoparticles","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-17 16:59:02","doi":"10.21203/rs.3.rs-3857699/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-01-22T07:24:20+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-01-19T19:11:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"75d5df94-c28c-4c22-aa70-a0be96119a8b","date":"2024-01-18T12:50:54+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-18T12:25:49+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-15T05:55:22+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-15T05:55:22+00:00","index":"","fulltext":""},{"type":"submitted","content":"Naunyn-Schmiedeberg's Archives of Pharmacology","date":"2024-01-12T17:00:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"naunyn-schmiedebergs-archives-of-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nsap","sideBox":"Learn more about [Naunyn-Schmiedeberg's Archives of Pharmacology](https://www.springer.com/journal/210)","snPcode":"210","submissionUrl":"https://submission.nature.com/new-submission/210/3","title":"Naunyn-Schmiedeberg's Archives of Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"98c91fdc-36a0-4713-a5c9-e977610f5757","owner":[],"postedDate":"January 17th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-05-22T13:06:08+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-17 16:59:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3857699","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3857699","identity":"rs-3857699","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}