Protective effect of carotid endarterectomy: inducing ischemic tolerance in brain tissue after stroke | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Protective effect of carotid endarterectomy: inducing ischemic tolerance in brain tissue after stroke Rastislav Mucha, Marek Furman, Alexandra Urbanova, Ivan Kopolovets, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7597075/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Feb, 2026 Read the published version in Journal of Molecular Neuroscience → Version 1 posted 10 You are reading this latest preprint version Abstract Stroke is a serious disease, ranking among the leading causes of mortality and permanent disability in EU countries. The ischemic cascade, triggered by the blockage of oxygenated blood supply to brain tissue, leads to excitotoxicity, oxidative stress, inflammation, and eventually, cell death. Current research highlights the promising neuroprotective effects of conditioning, which induces ischemic tolerance (IT). Thus, the main objective of this study is to analyse selected genes affected by ischemic stroke and the neuroprotective response to ischemic stroke, with a focus on ischemia and ischemic tolerance in peripheral blood. We investigated changes in gene expression indicative of cerebral ischemia during carotid endarterectomy (CEA), a procedure that involves the temporary occlusion of the arteria carotis interna . To assess the influence of CEA on IT induction, we performed a whole-transcriptome analysis of peripheral blood cells isolated from symptomatic, asymptomatic, and oximetric patients. The presence of gene expression changes in genes selectively identified through whole-transcriptome analysis was subsequently statistically verified. Using quantitative qRT-PCR, we monitored gene expression changes in SLC2A14, TRPM7, UGP2, PLLP, ND4L, HMSD, SESN3, DPY19L4, UBE3A , and PCDH9 . The results suggest that CEA affected the expression of all monitored genes, with statistically significant differences between groups, indicating the activation of distinct ischemic tolerance cascades in different patient groups. These findings may contribute to a better understanding and characterising of the molecular mechanisms underlying ischemic tolerance. brain stroke ischemic tolerance gene expression blood human Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Highlights - Whole transcriptome expression changes were identified in stroke - A potential method of neuroprotection activation after stroke was identified - Potential blood-based markers of stroke and neuroprotection were identified Introduction Stroke is now the second most prevalent cause of mortality in the European Union, following ischemic heart disease, with its incidence increasing by 26.1% since 1995. Together, stroke and ischemic heart disease have caused 15.2 million deaths per year (15–15.6 million) [ 1 ]. Moreover, 47.4 million disability-adjusted life years (DALYs) were recorded in 2013 [ 2 ]. In addition, an increase in incidence is expected [ 3 ]. Over 50% of stroke survivors require assistance from others to carry out their daily tasks. Stroke places a significant financial burden on caregivers and healthcare systems. In Europe, stroke-related expenses exceed 38 billion euros per year [ 4 ]. The mechanisms of ischemia are complex and form the so-called ischemic cascade. The ischemic cascade can be broadly described as cellular bioenergetic failure resulting from focal hypoperfusion of the brain's neural tissue, followed by excitotoxicity, oxidative stress, blood-brain barrier dysfunction, microvascular damage, haemostatic activation, post-ischemic inflammation, and ultimately, cell death of neurons, glial cells, and endothelial cells [ 5 ]. Given this complexity, therapies targeting individual ischemic mechanisms have not been effective so far. Therefore, attention has shifted to endogenous neuroprotective mechanisms and their ability to induce ischemic tolerance. This process, known as conditioning, begins with stimulation that triggers the production of effector molecules, which either alter gene expression or modify existing proteins. These changes result in an ischemic-tolerant phenotype. Ischemic tolerance (IT) refers to a state in which cells exhibit resistance to the harmful effects of ischemia, leading to a reduced rate of cell death caused by ischemia-reperfusion (IR) injury. Cells exposed to metabolic stress or sublethal ischemia become temporarily resistant to a subsequent otherwise lethal level of stress [ 6 ]. Ischemic conditioning, as an effective non-pharmacological strategy for reducing IR injury, was first demonstrated in 1986 in the field of cardiology on a dog's heart [ 7 ]. The neuroprotective mechanism of reperfusion injury in conditioning involves the suppression of pathophysiological pathways that occur during ischemia. As a result, conditioning offers an innovative approach to neuroprotection by targeting multiple cellular and molecular processes, including apoptosis, inflammation, oxidative stress, brain oedema, hemodynamics, and neurorepair [ 8 , 9 ]. Carotid endarterectomy (CEA) is a surgical procedure used to remove atherosclerotic plaque. Performing this procedure requires the temporary occlusion of the carotid artery. Subsequently, during CEA, the brain is supplied with blood only through one of the carotid arteries. In some cases, CEA can lead to a decrease in brain tissue oxygenation above 20%, which may symptomatically manifest in patients as a mild ischemic attack. These symptoms spontaneously resolve within 2 to 7 days. Such a stimulus activates a cellular response (a cascade of reactions inducing ischemic tolerance), which is reflected in changes at the gene expression level and the subsequent de novo synthesis of effector proteins. In experimental animal models of ischemic stroke, it has been shown that a certain gene expression profile after ischemia occurs in both peripheral blood and brain nerve tissue [ 10 ]. Peripheral blood appears to be a good choice as a source of RNA [ 11 ]. Clear similarities in gene expression in both blood and brain were found in a study of ischemic stroke performed by focal occlusion of the middle cerebral artery (MCA), in a model of monkey Macaca mulatta . The brain structures of this species are significantly similar to those of the human brain. In this analysis, it was found that 493 upregulated and as many as 2,156 downregulated genes overlap, with this overlap in gene expression in both brain nerve tissue and blood reached a statistically significant level for both upregulated and downregulated gene groups [ 12 ]. The aim of this work was to identify the effect of CEA on the process of IT induction based on transcriptomic analysis of peripheral blood cells and subsequently study the changes in the expression of selected genes in the transcriptome of peripheral blood cells of patients influenced by CEA as a potential neuroprotective post-conditioning in humans. Material and Methods 2.1 Composition of the test cohorts The set of test cohorts chosen for our research analysis consisted of a total of 22 volunteers, of whom 20 were patients and 2 were healthy individuals.. Each participant was properly informed about the goal and course of the study. They voluntarily agreed to participate in this biomedical study, as confirmed by signing the informed consent form. In addition, each participant voluntarily provided data on their medical history for the purposes of the study. Preoperative (before CEA) and postoperative (2 days after CEA) neurological examinations were performed for each participant. To assess the severity of stenosis, imaging techniques such as ultrasonography (USG), MRI angiography, digital subtraction angiography (DSA), and CT angiography were used. The degree of internal carotid artery stenosis for each patient was evaluated using at least two imaging techniques. The size of the ischemic lesion for each patient who had suffered an ischemic stroke prior to CEA was measured either with MRI or a native CT brain scan. CEA was recommended for all patients in accordance with current clinical guidelines. The study participants were divided into four groups: Asymptomatic Group (Asym) – a cohort of 8 asymptomatic patients, meaning patients recommended for CEA based on current clinical guidelines, without symptomatic manifestations of stroke. Symptomatic Group (Sym) – a cohort of 8 symptomatic patients, meaning patients recommended for CEA based on current clinical guidelines for those who underwent CEA between 7 and 180 days after the onset of neurological symptoms of ischemic stroke. Oximetric Group (Oxim) – 4 patients (both Sym and Asym) in whom a decrease in saturation detected by transcranial Doppler of more than 20% was observed during CEA Negative Control (Negat) – the control group consisted of 2 healthy volunteers (ages 27 and 49) without a history of acute or chronic diseases and therefore without the need for medication. The average age of the participating patients was 71 years, and efforts were made to ensure that the distribution of age and gender was similar across all patient groups. The duration of carotid artery occlusion during the surgical procedure, recorded by the Invos device, was also documented in the anesthesiology surgical record. For patients included in the tested groups the following exclusion criteria were applied: history of oncological or any embolic disease, autoimmune diseases, history of thrombosis or other types of ischemic events excluding stroke, acute and chronic kidney or liver diseases, acute or chronic infections, coagulation disorders, ischemic lesions (if larger than 3 cm). As an exclusion factor for the asymptomatic group, we also included stroke that occurred more than 6 months ago. Table 1 Clinical characteristic of the patients Patient groups Symptomatic Asymptomatic Oximetric Total Number of patients 8 8 4 20 Age (years) 75 68 71 71 Sex (male/female) 50% 40% 50% 45% Hypertension 8 8 4 20 Heart disease 5 5 2 12 Renal insufficiency 0 0 0 0 Pulmonary diseases 1 0 0 1 Diabetes mellitus 2 2 1 5 Smokers 2 2 1 5 Clamping time (minutes) 14 15 16 15 Oximetry decline (%) 14 15 26 18 Overview of patients included in the study cohorts and clinical characteristics for each of them All patients received exactly the same postoperative care according to the same protocol, which included antibiotic treatment, low molecular weight heparin (0.05 ml per 10 kg body weight every 12 hours), and an antiplatelet agent (75 mg of clopidogrel once daily). During this postoperative care, patients also continued taking their chronic medications. No comorbidities or medications were recorded that could have affected the gene analysis results or that were not evenly represented across the patient groups. Each patient included in our study underwent the reverse type of surgical procedure known as carotid endarterectomy (CEA). The implementation of CEA as well as the blood sample collection took place at the Department of Anesthesiology and Intensive Care of the Eastern Slovak Institute of Cardiovascular Diseases, Inc., Kosice, Slovakia (VUSCH, Inc.) and also at the Department of Vascular Surgery of VUSCH, Inc., Blood samples of a total volume of 5 ml for the purposes of biomedical research were collected from patients with the assistance of nurses, alongside routine blood draws and preoperative examinations. The Ethics Committee of VUSCH, Inc., after reviewing the purpose and methodology of the study, decided on July 30, 2018, to grant approval for the proposed project. 1.1 Microarray analysis Whole-transcriptome microarray analysis of representative samples of isolated, purified, and decontaminated human mRNA was performed using Human Clariom-S plates (Affymetrix) designed for human samples. Post-processing analysis of the measured data was conducted using Power Tools software (Affymetrix). The data were summarized and normalized using the SST-RMA (Signal Space Transformation-Robust Multichip Analysis) method implemented in Affymetrix® Power Tools (APT). The results were exported with SST-RMA analysis at the gene level, and a differential gene expression (DEG) analysis was performed. The statistical significance of expression level data was determined using "fold change." For the set of differentially expressed genes (DEG), hierarchical cluster analysis was performed using complete linkage and Euclidean distance as a measure of similarity. Gene enrichment and functional annotation analyses for generating a list of significant probes were conducted using Gene Ontology ( http://geneontology.org ) and KEGG ( http://kegg.jp ). All data analyses and visualizations of differentially expressed genes were performed using R 3.3.2 ( www.r-project.org ). 1.1 Isolation and Processing of Blood Samples, mRNA Isolation, Reverse Transcription to cDNA, and Primer Design Peripheral whole blood was collected into Eppendorf tubes containing an anticoagulant solution, and plasma and blood cells were then separated by centrifugation for 15 minutes at 3500 g at 4ºC. The individual fractions were stored at -80ºC. Phosphate buffer (PBS), composed of 137 mmol/L NaCl, 10 mmol/L Na₂HPO₄·2H₂O + KH₂PO₄, and 2.7 mmol/L KCl, with a pH of 7.4, was used to dilute whole blood cells in a 1:1 ratio. The diluted sample was lysed using TRIzol reagent (Thermo Fisher, USA), and total RNA was extracted with chloroform and isopropanol (propan-2-ol). To eliminate any potential genomic DNA contamination of mRNA, the lysate was treated with DNase I (RNase-free enzyme, Thermo Fisher Scientific, USA). The High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA) was used to reverse transcribe RNA to cDNA according to the manufacturer’s instructions. Primer design was performed in silico using the Geneious software (Biomatters, Ltd., New Zealand). The designed forward and reverse primer sequences are listed in Table 2 . Table 2 Primers for qRT-PCR quantification used in the study Gene Forward primer [bp] Revers primer [bp] Annealing temperature [◦C] Amplified sequence [bp] 18S GACCATAAACGATGCCGACT GTGAGGTTTCCCGTGTTGAG 60 190 ADM TTGGACTTTGCGGGTTTTGC TTTCGGAACTGCGAGGAAGT 60 200 CDKN1A TTGTCGCTGTCTTGCACTCT CCTGACCCACAGCAGAAGAA 60 200 GADD45G ATGAAGATGACGACCGGGAC TAGCGACTTTCCCGGCAAAA 60 271 IL6 CAGGAACGAAAGTCAACTCCA ATCAGTCCCAAGAAGGCAACT 60 94 TM4SF1 TGTGCTATGGGAAGTGTGCA TTTATTTGTTTTTGTTTTTT 60 819 SLC2A14 ACCCCAGCTCTGATCTTTGC GCCACAGACAAGGACCAGAG 58,6 185 UGP2 GGCAAACTGAGACTGGTGGA ATGACATTCAGGCCTCCATCC 58,6 200 PLLP GTCTTCCCTCCCTGCATTTCA CCCATGTGCCTAGTCAGCAA 69 180 DPY19L4 TAGTCCCAGCTACTCCGAGG GTCTGGCATTTGGGAGGCTA 60 190 TRPM7 TGTCTTGGTGGGGCATGGTG CTGACCTTGTGATCCGCCCA 67 220 ND4L CGCTCACACCTCATATCCTCCC CGTAGTCTAGGCCATATGTGTTGGA 60 202 SESN3 TTGACACAACCATGCTGCGC TGAGTGTTTGAACTGCCGCCA 62,3 200 HMSD ATCAACCCCCTTGCAGCCAG TAGCAAACCCGGCAACCTCTG 60 215 UBE3A TGTCACCGAATGGCCACAGC CGTGCAGGCTTCATTTCCACAG 61,5 PCDH9 CGCTGTCGCCATGCATCAAG CCGGCAGGCTTATTGTCCCA 67 214 Forward and reverse primer sequences along with qPCR reaction parameters: annealing temperature (primer binding) and the length of the amplified sequence during the qRT-PCR reaction in base pairs [bp] 1.2 Quantitative real-time PCR (qRT-PCR) The cDNA concentrations were diluted to the level recommended by the manufacturer of the qRT-PCR mastermix used (Power SYBRTM Green PCR Master Mix, Applied Biosystems, USA). The recorded Ct values of individual genes were normalized according to the Ct values of the housekeeping gene used as the reference for the given sample. Subsequently, the ΔCt values for specific genes were calculated. The housekeeping gene used was 18S. The PCR reaction was performed on the Bio-Rad CFX96™ Real-Time PCR Detection System, with the software used for evaluating Ct values being CFX Maestro qPCR Analysis Software (Bio-Rad). The normalized ΔCt value for a specific gene in the sample was obtained by calculation: ΔCt(gene x) = /Ct(gene x)/ – /Ct( 18S )/ Ct – Cycle threshold ΔCt - The normalized value of a specific gene x in the sample - Housekeeping gene 18S - Housekeeping gene The resulting values of the overall expression change of the studied gene relative to the negative samples of the control groups (ΔΔCt(gene x)) were calculated as the difference in ΔCt(gene x) values between the tested groups (test) vs. their negative samples of the control group (ctrl). ΔΔCt(gene x) = ΔCt(gene x test) – ΔCt(gene x ctrl) ΔCt - The normalized value of a specific gene x in the sample ΔΔCt - The final value of the overall expression change The gene expression level (fold difference (fd)) was calculated based on the following equation: fd = 2 -ΔΔCt ΔΔCt - The final value of the overall expression change The final values of RNA expression change were obtained based on calculation: RNA (expression change rate) = log2 (fd) fd – fold change 1.2 Statistical evaluation For calculating the variance of ΔCt(gene x) values in the set of individuals, we used the mathematical formula for standard deviation (s): $$\:s=\sqrt{\frac{1}{N-1}*{\sum\:}_{i=1}^{N}{\left(xi-\overline{x}\right)}^{2}}$$ s - standard deviation N - Number of individuals in the tested group 𝑥𝑖 - The ΔCt(gene x) value for a specific sample \(\:\overline{x}\) - The average value of ΔCt(gene x) from the entire tested group The standard deviation was calculated as a 95% confidence interval. For the calculation, we used the online software Standard Deviation Calculator (calculator.net). Using the t-test, we calculated the size of the difference between the sample means in relation to their variability, with a threshold value and statistical significance (P) based on the chosen significance level (0.05 to 0.001): P > 0,05 - Insignificant, P 0,05 − 0,01 (*) - Marginally significant, P 0,01 − 0,001 (**) - Moderately significant, P < 0,001 (***) - Highly significant 2. Theory/calculation We hypothesize that carotid endarterectomy (CEA) induces specific changes in gene expression within the transcriptome of peripheral blood cells, which are associated with the mechanisms of induced tolerance (IT) and may indicate the activation of post-ischemic neuroprotection in patients undergoing CEA. Intervention in cerebral perfusion through CEA may trigger biological responses similar to ischemic preconditioning. It is further hypothesized that these responses are reflected at the gene expression level in peripheral blood, allowing for non-invasive monitoring of the activation of potentially protective mechanisms. Transcriptomic analysis may reveal gene expression signatures related to neuroprotection, inflammatory response, oxidative stress, or apoptosis—key pathways commonly implicated in induced tolerance and postconditioning. Results 3.1 Whole transcriptome analysis Using microarray whole transcriptome analysis, we identified the occurrence of 791 genes with a significant change in expression levels > ± 2 compared to the negative control within the Sym group, with 523 genes being specific to this group and not overlapping with other groups. The total number of genes with a significant change in expression levels > ± 2 compared to the negative control in the Asym group was identified as 688 genes, with 422 genes being specific to this group and not overlapping with others. For the Oxim group, the total number of genes with a significant change in expression levels > ± 2 compared to the negative control was 637, with 359 genes being specific to this group and not overlapping with others (Fig. 1 ). 1.1 Gene analysis This part of the study focused on analysing changes in gene expression levels selected based on the results of the previous whole-transcriptome microarray analysis of representative samples from individual patient test groups undergoing CEA, who had experienced a stroke at varying time intervals before CEA. Based on the expression levels of individual genes within the groups, we identified the genes with the highest expression changes compared to the negative control for each group. In our selection process, we also considered the involvement of these genes in molecular signalling pathways related to ischemic brain tissue damage or, conversely, to tolerance mechanisms against such damage. The genes selected according to the above-mentioned criteria are listed in Table 3 . Table 3 Genes selected for a detailed analysis of expression level changes Patient groups Upregulated gene Downregulated gene Symptomatic SLC2A14 (Sym) UGP2 TRPM7 UBE3A PCDH9 Asymptomatic PLLP UBE3A (Asym) ND4L PCDH9 Oximetric HMSD UBE3A (Oxim) SESN3 PCDH9 DPY19L4 Based on the results of the whole transcriptome analysis of gene expression changes in representative patient samples, we selected the genes with the greatest difference in expression levels compared to the negative control for each group. Upregulated genes exhibited a significantly increased expression level, whereas downregulated genes showed a significant decrease in expression. Sym – symptomatic patients; Asym – asymptomatic patients; Oxim – patients with a decrease in oximetry of more than 20% during CEA We primarily focused on observing changes caused by a decrease in oximetry of more than 20% during CEA. The results were normalized against the negative control and compared with Sym and Asym patients also after CEA. 1.1.1 Expression of genes selectively analysed in the Symptomatic group The increased expression level of SLC2A14 compared to the negative control was observed in the Asym and Oxim groups in a marginally significant form, whereas in the Sym group, we observed a statistically significant decrease in SLC2A14 expression compared to the negative control (Figs. 2 and 6 ). An increase in TRPM7 expression compared to the negative control was observed only in the Asym group, though it was not significant. However, a significant decrease in TRPM7 expression compared to the negative control was observed in both the Sym and Oxim groups, with a higher level of statistical significance in the Sym group (Fig. 2 ). The expression level of UGP2 increased compared to the negative control in all tested groups. The least pronounced change was observed in the Sym group. A statistically more significant increase in UGP2 expression was observed in the Asym group. The most substantial increase in expression was recorded in the Oxim group, where the statistical significance reached P < 0.01 (Figs. 2 and 6 ). 1.1.2 Expression of genes selectively analysed in the Asymptomatic group The most pronounced increase in PLLP expression compared to the negative control was observed in the Asym group, with a milder increase also observed in the Oxim group. In both groups, the results were statistically significant in comparison to the negative control (P < 0.01). In contrast, in the Sym group, the PLLP expression was significantly decreased when compared to the negative control (P < 0.01) (Figs. 3 and 6 ). An increase in ND4L expression compared to the negative control was observed in the Asym and Oxim groups, with a more pronounced increase recorded in the Oxim group. A slight decrease in ND4L expression compared to the negative control was observed in the Sym group. The statistical significance of the results was set at P < 0.01 for all groups (Figs. 3 and 6 ). 1.1.3 Expression of genes selectively analysed in the Oximetric group An increase in HMSD expression compared to the negative control was observed in both the Asym and Oxim groups, with a more pronounced and statistically significant increase in the Oxim group (P < 0.05). In the Sym group, the measured HMSD expression level was similar to the negative control and, therefore, not statistically significant (Figs. 4 and 6 ). An increased expression level of SESN3 compared to the negative control was observed in all groups, with the most statistically significant increase observed in the Oxim group (P < 0.001), a less pronounced increase in the Asym group (P < 0.01), and without statistically significant change in SESN3 expression observed in the Sym group (Figs. 4 and 6 ). A significant increase in DPY19L4 expression compared to the negative control occurred in a milder form in the Asym group (P < 0.01) and in a more pronounced form in the Oxim group (P < 0.01). A decrease in DPY19L4 expression compared to the negative control was observed in the Sym group (P < 0.001) (Figs. 4 and 6 ). 1.1.4 Selectively analysed downregulated genes common to all groups A decrease in UBE3A expression compared to the negative control was observed in the Sym and Asym groups, with the result in the Sym group being statistically more significant. In the Oxim group, a slight, statistically insignificant increase in UBE3A expression compared to the negative control was observed (Figs. 5 and 6 ). A decrease in PCDH9 expression compared to the negative control was observed in all tested groups. The most pronounced decrease in expression was recorded in the Asym group, a less pronounced decrease in the Oxim group, and the least pronounced decrease in the Sym group. The level of statistical significance decreased in the same order, from the most significant result in the Asym group with a statistical significance of P < 0.01 to the Sym group, which showed no statistical significance (Figs. 5 and 6 ). Discussion For the whole transcriptome microarray analysis on representative samples from each tested cohort, our study used the Human Clariom-S chip from Affymetrix, which contains over 20,000 probes of well-annotated genes that bind to specific mRNA sequences. This allows for the simultaneous analysis of a large number of genes and their expression in one experiment. From the Venn diagram of the microarray analysis results, we can see that when compared to the negative control, hundreds of genes were identified as specifically expressed in our tested cohorts out of the more than 20,000 genes. When comparing overlaps between the individual groups, only tens of genes were involved. Since the microarray analysis only involved representative samples, a rational selection of the most suitable gene candidates was performed for subsequent, more detailed qRT-PCR analysis within broader statistical patient groups. The specific selectively chosen genes and their quantitative identification of expression changes were performed by group, based on the results of the microarray analysis. The genes induced in the microarray analysis results specific to the Symptomatic group are SLC2A14 , TRPM7 , and UGP2 . SLC2A14 encodes the protein GLUT14, a member of the glucose transporter (GLUT) family, which is involved in the transport of deoxyglucose and dehydroascorbic acid. This gene is expressed in various tissues, including brain tissue and blood [ 13 ]. Changes in the expression levels of SLC2A14 have excellent diagnostic potential for determining the presence of ischemic stroke, as recent studies have identified SLC2A14 as a gene involved in the iron-dependent form of regulated cell death associated with ischemic stroke [ 14 ]. An increase in the expression level of SLC2A14 is observed in our results for the Oximetric group. This suggests that in patients from the Oximetric group, a cascade of iron-dependent regulated cell death associated with ischemic stroke is triggered. A possible connection is indicated with transient, milder symptoms of ischemic stroke, which are common in the Oximetric group after CEA. However, a more moderate increase in SLC2A14 expression is also observed in the Asymptomatic group, where no symptomatic manifestations of ischemic stroke occur after CEA. Therefore, our research did not confirm a correlation between the increase in SLC2A14 expression and symptomatic manifestations of ischemic stroke. The only group where a decrease in SLC2A14 expression is observed after CEA is the Symptomatic group. We hypothesize that this decrease is a consequence of a previous ischemic stroke, leading to the activation of a protective ischemic tolerance cascade caused by natural preconditioning. TRPM7 is a calcium-permeable ion channel and also an enzyme that plays a key role in several biological processes, including axon development and the regulation of cells in response to hypoxia and ischemia. TRPM7 provides a link between the metabolic state of cells and intracellular calcium homeostasis in neurons due to its sensitivity to fluctuations in intracellular Mg-ATP levels. This protein plays a crucial role in ischemic and hypoxic neuronal cell death [ 15 , 16 ]. Potential mediators of cell death following TRPM7 activation are considered to be calcium/calmodulin-dependent protein kinase II (CaMKII) and the phosphatase calcineurin. In vivo experiments in mice have shown a significant reduction in brain tissue damage and improvements in both short-term and long-term functions after hypoxic-ischemic brain injury following the administration of the specific TRPM7 blocker, waixenicin A [ 17 ]. Our results indicate a decrease in the expression levels of TRPM7 in both the oximetric and symptomatic patient groups. The reduced expression of this gene is associated with a neuroprotective effect on brain tissue, which we can likely attribute to a previously experienced ischemic stroke in the symptomatic group, followed by tolerance induced by natural preconditioning. In the oximetric group, the decrease is likely associated with short-term mild hypoxia caused by a drop in oximetry levels of more than 20% during CEA, which triggers the body's defence mechanism to induce ischemic tolerance. In the asymptomatic group, which has not previously experienced any ischemic event, CEA did not cause any significant change in the expression levels of the TRPM7 gene compared to negative control samples. Therefore, we believe that if a patient has not previously experienced ischemic stroke, the CEA procedure itself, without complications such as a drop in oximetry by more than 20%, is not a sufficient stimulus to trigger ischemic tolerance in the form of a decrease in TRPM7 expression levels. The enzyme uridine diphosphate-glucose pyrophosphorylase (UGP2) is involved in cell proliferation and survival. Microarray analyses have revealed that in atherosclerotic plaques in humans, the expression level of this gene is reduced. An increase in UGP2 expression in endothelial cells leads to a decrease in reactive oxygen species (ROS) levels, cleaved caspase-3 expression, and apoptosis rates. These findings suggest that UGP2 may have a protective effect on endothelial cells and could be an important regulator of cell viability and apoptosis [ 18 ]. UGP2 is also the only enzyme that catalyses the conversion of glucose 1-phosphate to UDP-glucose, which is an important molecule in anabolic pathways. This reaction is a key step in the synthesis of glucose 6-phosphate and the subsequent formation of glycogen, glycolysis, and other metabolic processes that are essential for cellular energy and function. Inhibition of UGP2 thus leads to a significant reduction in perfusion recovery and vessel density after hypoxia [ 19 ]. Our results indicate a significant increase in the expression level of UGP2 in the oximetric group and, to a lesser extent, in the asymptomatic group of patients. We hypothesize that the significant increase in the oximetric group is triggered by a drop in oxygen saturation of more than 20% during CEA, which likely stimulated a reduction in ROS levels and apoptosis, as well as perfusion recovery after hypoxia influenced by the presence of UGP2 and the neuroprotective cascades it mediates. This neuroprotective effect was observed at a lower intensity in the asymptomatic group as well. Since this group has never experienced ischemic stroke, we assume that the stimulus induced by CEA alone, without complications of oxygen saturation drop above 20%, was sufficient to trigger the neuroprotective response leading to ischemic tolerance. In the symptomatic group of patients, the increase in UGP2 expression was only observed at a very mild, statistically insignificant level. This may be due to the aftermath of a previous ischemic stroke in this group, which likely caused an increased level of ischemic tolerance induced by natural preconditioning. We assume that if the saturation drop during CEA does not exceed 20%, it is not a sufficient stimulus to significantly activate neuroprotective cascades in this group of patients. The genes induced in the results of the microarray analysis specific to the Asymptomatic group in our study are PLLP and ND4L . Plasmalipin (PLLP) is a membrane protein found in the myelin sheath as its main component. PLLP also plays an important role in the development and optimal function of the nervous system. It is also involved in intracellular transport, lipid raft formation, and Notch signalling. PLLP expression is characteristic of cells that form the nervous system, gastrointestinal tract, and kidneys, with the highest levels of PLLP observed in epithelial, CNS, and PNS cells. PLLP plays a critical role in the biogenesis of the myelin membrane and myelination, and is involved in the development and maintenance of the nervous system throughout life. Mechanisms associated with nerve regeneration after injury may also include PLLP. A direct correlation has been observed between the intensity of remyelination and the expression of PLLP mRNA and protein [ 20 , 21 ]. Our results indicate a significant increase in the expression level of PLLP in the asymptomatic group and, to a lesser extent, in the oximetric group of patients. We assume that the marked increase in the asymptomatic group is triggered by the surgical procedure CEA, which, as a stress stimulus, activated the upregulation of genes involved in remyelination processes and brain tissue regeneration. Since the increased expression of PLLP in the oximetric group did not exceed the levels observed in the asymptomatic group, we assume that this acute activation of a standby mode is not related to the degree of oxygen saturation drop of more than 20%, but rather to the CEA procedure itself. In contrast, in the symptomatic group, we observed a decrease in PLLP expression, which may be associated with the phenomenon of natural preconditioning, which symptomatic patients experienced after overcoming ischemic stroke, which induced ischemic tolerance. In these patients, some pathways are expressed more than in healthy individuals, while others are suppressed. Since we observe a decrease in neuroprotective remyelination cascades managed by PLLP activation, we assume that this cascade was suppressed during natural preconditioning. ND4L is a gene that encodes a mitochondrial protein (NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 4L), which is a subunit of mitochondrial complex I. Complex I is involved in the electron transport chain, which plays a key role in cellular energy production. ND4L, as a subunit of complex I, plays an important role in electron transfer within this complex. Its proper function is essential for the efficient operation of the electron transport chain and the subsequent production of ATP [ 22 ]. The connection between ND4L and ischemic stroke occurs through epigenetic mechanisms such as DNA methylation. Overall DNA methylation levels are generally increased after ischemia, associated with heightened activity of DNA methyltransferases (DNMTs). Increased DNA methylation following ischemic injury leads to transcriptional repression of many genes, which exacerbates brain damage. In contrast, DNA demethylation after ischemic injury is associated with recovery processes following a stroke, such as neurogenesis, angiogenesis, gliogenesis, axon growth, and synaptic plasticity. These processes are characterized by an increase in the mRNA levels of genes related to mitochondrial function, including subunits of complex I, such as ND4L [ 23 ]. Our results indicate a significant increase in the expression levels of ND4L in the oximetric group and, to a lesser extent, in the asymptomatic group of patients. We hypothesize that the significant increase in the oximetric group is triggered by a drop in saturation of more than 20% during CEA, which likely induced a reduction in DNA methylation followed by an increase in mitochondrial function. This neuroprotective effect was also observed in a milder form in the asymptomatic group. We hypothesize that this group, which has never previously experienced ischemic stroke, does not require such a strong stimulus to induce a similar effect, and that even the CEA procedure, without major complications such as a significant drop in saturation, was sufficient to reduce DNA methylation and subsequently increase mitochondrial function. In contrast, the symptomatic group likely exhibited a mild decrease in ND4L expression, probably as a result of previously experienced ischemic stroke, suggesting a slight increase in DNA methylation, which is proportional to the reduction in mitochondrial function. The genes induced in the results of the microarray analysis in our study, specific to the Oximetric group, are HMSD , SESN3 , and DPY19L4 . Serpin-domain containing protein is a protein encoded by the HMSD gene. It is believed that this protein, containing a minor serpin domain of histocompatibility, functions as an inhibitor of serine proteases (known as serpins). Serpins are known for their ability to inhibit serine proteases, a class of enzymes involved in various physiological processes, including blood clotting, inflammation, and immunity. By inhibiting serine proteases, serpins help regulate these processes and maintain homeostasis in the body. The specific function of the protein encoded by HMSD containing the histocompatibility serpin domain likely involves the modulation of serine protease activity in myeloid cells, a type of immune cell involved in innate immunity, as HMSD is predominantly expressed in myeloid cells. By regulating the activity of serine proteases in myeloid cells, this protein may influence immune responses, inflammation, and potentially other cellular processes. Compounds that modulate the activity of serine proteases generally exhibit neuroprotective activity [ 24 , 25 ]. Our results indicate a significant increase in the expression level of HMSD in the oximetric group and, to a lesser extent, in the asymptomatic group of patients. We hypothesize that the pronounced increase in the oximetric group is triggered by a drop in oxygen saturation of more than 20% during CEA, which likely caused an increase in the inhibition of serine proteases, followed by the regulation of inflammatory and immune neuroprotective responses. This neuroprotective effect was observed at a lower intensity in the asymptomatic group of patients as well. Since this group has never experienced ischemic stroke, we assume that the stimulus induced by the CEA procedure alone, without complications and with a decrease in oxygen saturation of more than 20%, was sufficient to trigger the body's neuroprotective response, leading to ischemic tolerance. In the symptomatic group of patients, we did not observe an increase in HMSD expression, and its expression level remained the same as in individuals from the negative control group. This may be due to the past ischemic stroke experienced by this group, which likely caused an increased level of ischemic tolerance induced by natural preconditioning. We assume that if oxygen saturation does not drop by more than 20% during CEA, it is not a sufficient stimulus to activate neuroprotective cascades modulating serine protease activity in a significantly sufficient manner in this group of patients. SESN3 , or Sestrin 3, is a gene that codes for a protein playing a key role in stress responses and maintaining cellular homeostasis. This protein is a member of the stress-inducible family of sestrin proteins, which reduces intracellular reactive oxygen species (ROS) levels, thereby inducing resistance to oxidative stress [ 26 , 27 ]. Due to its antioxidant biological activity and ability to promote autophagy, the protective effect mediated by sestrins has great potential in the treatment of many neurodegenerative diseases and neurological disorders. SESN3 is highly expressed in brain tissue, and its expression is often associated with conditions such as seizures, neuropathic pain, or ischemic stroke (IS). These close associations with neurological conditions suggest an important role for SESN3 in protecting the nervous system and its responses to various stressors and damage [ 28 ]. Our results indicate a significant increase in the expression levels of SESN3 in the oximetric group, and to a lesser extent in both the asymptomatic and symptomatic groups of patients. We hypothesize that the significant increase observed in the oximetric group is induced by a drop in oxygen saturation of more than 20% during CEA, which likely acts as a strong stressor, inducing an increase in SESN3 production as part of the sestrin family. This, in turn, reduces intracellular ROS levels and triggers a neuroprotective effect through a cascade of responses that induce resistance to oxidative stress. This neuroprotective effect was observed with significant intensity, though at a lower level, also in the asymptomatic group. Since this group has never experienced ischemic stroke, we assume that the CEA procedure alone, even without complications such as a drop in oxygen saturation of more than 20%, was a sufficient stressor to trigger the stress-induced neuroprotective response, enhancing resistance to oxidative stress through SESN3 -regulated reduction of intracellular ROS levels. In the symptomatic group of patients, an increase in SESN3 expression was also observed as a result of the CEA procedure, although this increase was not statistically significant. This may suggest that natural preconditioning, which we hypothesize occurred in the symptomatic group, led to a situation where the stressor induced by CEA, without a drop in oxygen saturation of more than 20%, was not sufficient to induce a stress-induced neuroprotective response at a statistically significant level. However, the mild increase without significant statistical significance suggests that a mild form of activation of this SESN3 -regulated antioxidant protection against ROS likely occurs. DPY19L4 is a gene that encodes a putative C-mannosyltransferase. This enzyme mediates the C-mannosylation of tryptophan residues on target proteins. It is involved in post-translational modifications and is thought to enable mannosyltransferase activity. It has been shown that protein glycosylation, including C-mannosylation, affects the outcome of a cerebrovascular accident by influencing inflammatory response, excitotoxicity, neuronal apoptosis, and disruption of the blood-brain barrier [ 29 ]. Glycosylation can modify the function, stability, and interactions of proteins, which can impact various cellular processes. In the context of a cerebrovascular accident, altered protein glycosylation may contribute to the inflammatory response, excitotoxicity, and neuronal apoptosis, which can worsen damage after a stroke. Furthermore, DPY19L4 may be involved in disrupting the blood-brain barrier, leading to increased brain oedema and a worse outcome in stroke [ 30 ]. Our results indicate a significant increase in the expression levels of DPY19L4 in the oximetric group and, to a lesser extent, in the asymptomatic group of patients. We assume that the significant increase in the oximetric group was induced by a drop in oximetry by more than 20% during CEA, which likely led to an increase in mannosyltransferase activity, contributing to the propagation of neurodegenerative cascades affecting inflammation, excitotoxicity, disruption of the blood-brain barrier, and neuronal apoptosis. This neurodegenerative effect was also observed in a milder form in the asymptomatic group. We assume that the lower intensity of the expression increase, indicating a milder course of neurodegenerative processes induced by the increase in mannosyltransferase activity, is related to the degree of stress the patients underwent during CEA. Since the oximetry level in the asymptomatic group did not drop by more than 20%, as in the oximetric group, this form of CEA represents a lower burden on the body, corresponding to a milder intensity of neurodegenerative cascades. In the symptomatic group of patients, however, we observed a significant decrease in the expression of DPY19L4 . We hypothesize that the ischemic stroke these patients had experienced functions as a form of natural preconditioning, which induced an ischemic-tolerant phenotype. Therefore, we believe that the stressor in the form of CEA, which triggered neurodegenerative processes in patients without a tolerant phenotype, in the case of patients with a tolerant phenotype, initiates a decrease in mannosyltransferase activity, thus dampening neurodegenerative cascades affecting inflammation, excitotoxicity, disruption of the blood-brain barrier, and neuronal apoptosis. This results in the induction and likely the deepening of the already existing neuroprotective effect of ischemic tolerance. The genes inhibited in the microarray analysis results common to all tested groups are UBE3A and PCDH9 . The UBE3A gene encodes a protein called ubiquitin-protein ligase E3A, also known as E6-associated protein (E6-AP), which plays a key role in the targeted degradation of proteins in cells. This gene is essential for the normal development and function of the nervous system, regulating the synthesis and degradation of proteins to maintain proteostasis [ 31 ]. UBE3A has been identified as a regulator of the transcription factors IRF1 and IRF4 (interferon regulatory factors 1 and 4), which are involved in immune reactivity and neuronal survival in brain tissue following ischemic stroke. Several studies have shown that IRF1 acts as a coregulator of p53 in the apoptosis pathway [ 32 ]. Our results indicate a significant decrease in UBE3A expression in the symptomatic group, and a less significant decrease in the asymptomatic group. This significant reduction in expression in the symptomatic group is likely related to the presumed presence of an ischemic tolerant phenotype, which we expect in this group based on their history of ischemic stroke, acting as a form of natural preconditioning. We believe that the intensity of the stress stimulus induced by the CEA procedure was sufficient for conditioned patients to trigger a neuroprotective response through the reduction of UBE3A levels, which is involved in the regulation of immune response cascades, neuronal survival, and apoptosis. A similar neuroprotective effect, though not statistically significant, was observed in the asymptomatic group. For this group as well, we hypothesize that the intensity of the stress stimulus induced by CEA was sufficient to induce a neuroprotective response by lowering UBE3A levels and subsequently activating the ischemic tolerant phenotype. In the oximetric group, which experienced a drop in oxygen saturation of more than 20% during CEA, we observed a slight increase in UBE3A expression. We assume that a drop in oxygen saturation by more than 20% represents too strong a stressor for the patient to respond with the induction of ischemic tolerance through UBE3A -regulated cascades. Instead, we see mild neurodegeneration in the brain tissue, which, although statistically significant, is likely not pronounced. Protocadherin 9 is a member of the protocadherin family and the cadherin superfamily, which are transmembrane proteins containing extracellular domains [ 33 ]. Cadherin domains mediate cell adhesion in neural tissues in the presence of calcium. The protein encoded by PCDH9 may therefore be involved in signalling at neuronal synaptic connections [ 34 ]. In addition, it was found that PCDH9 is downregulated 21 hours after treatment of coronary arteries with minimally oxidized LDL (moxLDL), which is a significant risk factor for the development of an atherosclerotic plaque and subsequent increased risk of ischemic stroke, as moxLDL activates immune responses that sustain chronic inflammatory reactions characteristic of atherosclerosis [ 35 ]. Our results point to the downregulation of PCDH9 across all groups. The most statistically significant decrease in expression was observed in the asymptomatic group. This group of patients, without prior ischemic conditioning, appears to be the most vulnerable to the stress stimulus applied in the form of CEA. This is likely because the stressor activates inflammatory and immune responses in which PCDH9 participates, similar to the formation of an atherosclerotic plaque, leading to neurodegenerative damage to brain tissue. In the symptomatic group, we observed a very slight decrease in PCDH9 expression, and these measured values do not differ significantly from the values of the negative control group. The previously experienced ischemic stroke in the symptomatic group of patients can be considered a form of natural preconditioning. Thus, we assume the presence of a tolerant phenotype in this group. This tolerant phenotype helps mitigate or completely block the onset of neurodegenerative cascades related to inflammatory and immune responses in which PCDH9 is involved. In the oximetric group, we observed a mild but significant downregulation of PCDH9 due to the CEA procedure with a drop in oximetry of more than 20%. Since the oximetric group consists of both symptomatic and asymptomatic patients, we believe that the resulting PCDH9 expression reflecting the presence or absence of neurodegenerative cascades is an average value of both patient groups (with and without natural preconditioning), which is supported by the large variability in statistical significance. We hypothesize that for the activation of these specific neurodegenerative pathways associated with PCDH9 downregulation, the degree of oximetry decline is not as significant a factor as whether ischemic tolerance through preconditioning is present in the patients or not. In conclusion, the findings of this study suggest that monitoring changes in gene expression in peripheral blood may be useful in identifying an increased ability to induce ischemic tolerance. We have also demonstrated that CEA may initiate protective processes to some extent after ischemic stroke. Based on this, we can consider it a form of ischemic tolerance activation. These insights may contribute to the development of new therapeutic strategies aimed at improving the prognosis of patients with ischemic stroke, for example, through a personalized approach to treatment and the prevention of secondary ischemic events. Submission declaration and verification The work has not been published previously, it is not under consideration for publication elsewhere, its publication is approved by all authors and tacitly or explicitly by the responsible authorities where the work was carried out, and, if accepted, it will not be published elsewhere in the same form, in English or in any other language, including electronically without the written consent of the copyright-holder. Declarations Submission declaration and verification The work has not been published previously, it is not under consideration for publication elsewhere, its publication is approved by all authors and tacitly or explicitly by the responsible authorities where the work was carried out, and, if accepted, it will not be published elsewhere in the same form, in English or in any other language, including electronically without the written consent of the copyright-holder. Funding This work was supported by the grant from the Slovak Scientific Grant Agency VEGA (Grant number 2/0101/24) received by author Rastislav Mucha. This publication was created thanks to support under the Operational Programme Integrated Infrastructure for the project: Strengthening of Research, Development and Innovation Capacities of Translational Biomedical Research of Human Diseases,, IMTS: 313021BZC9, co-financed by the European Regional Development Fund. Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author contribution Rastislav Mucha: Conceptualization, Data Curation, Methodology, Project administration, Supervision, Validation, Writing - original draft, Writing - Review and Editing. Marek Furman: Data curation; Formal analysis, Investigation, Methodology, Software, Visualization, Writing - original draft. Alexandra Urbanova: Writing - review & editing , Ivan Kopolovets: Resources, Methodology. Miroslava Nemethova: Methodology, Investigation, Writing - review & editing. Michal Virag: Data curation, Methodology, Resources. Stanislav Hresko: Writing - review & editing. Vladimir Katuch: Writing - review & editing. Vladimir Sihotsky: Conceptualization, Investigation, Methodology, Resources, Project administration, Writing - Review & Editing. Data Availability The datasets generated during and/or analysed during the current study are not publicly available but are available from the corresponding author on reasonable request. Ethics approval The Ethics Committee of VUSCH, Inc., after reviewing the purpose and methodology of the study, decided on July 30.2018, to grant approval for the proposed project. Clinical trial number: not applicable. Consent to participate Informed consent was obtained from all individual participants included in the study. References Doeppner TR, Zechmeister B, Kaltwasser B, Jin F, Zheng X, Majid A, Venkataramani V, Bahr M, Hermann DM (2018) Very Delayed Remote Ischemic Post-conditioning Induces Sustained Neurological Recovery by Mechanisms Involving Enhanced Angioneurogenesis and Peripheral Immunosuppression Reversal. Front Cell Neurosci 12:383 Shi CX, Ding YB, Jin FYJ, Li T, Ma JH, Qiao LY, Pan WZ, Li KZ (2018) Effects of sevoflurane post-conditioning in cerebral ischemia-reperfusion injury via TLR4/NF-kappaB pathway in rats. Eur Rev Med Pharmacol Sci 22:1770–1775 Doeppner TR, Doehring M, Kaltwasser B, Majid A, Lin F, Bahr M, Kilic E, Hermann DM (2017) Ischemic Post-Conditioning Induces Post-Stroke Neuroprotection via Hsp70-Mediated Proteasome Inhibition and Facilitates Neural Progenitor Cell Transplantation. Mol Neurobiol 54:6061–6073 Howard DPJ, Gaziano L, Rothwell PM (2021) Risk of stroke in relation to degree of asymptomatic carotid stenosis: a population-based cohort study, systematic review, and meta-analysis. Lancet Neurol 20:193–202 Brouns R, De Deyn PP (2009) The complexity of neurobiological processes in acute ischemic stroke. Clin Neurol Neurosurg 111:483–495 Burda R, Burda J, Morochovic R (2023) Ischemic Tolerance-A Way to Reduce the Extent of Ischemia-Reperfusion Damage. Cells 12 Murry CE, Jennings RB, Reimer KA (1986) Preconditioning with ischemia: a delay of lethal cell injury in ischemic myocardium. Circulation 74:1124–1136 Saccaro LF, Aimo A, Emdin M, Pico F (2021) Remote Ischemic Conditioning in Ischemic Stroke and Myocardial Infarction: Similarities and Differences. Front Neurol 12:716316 Furman M, Sihotsky V, Virag M, Kopolovets I, Nemethova M, Mucha R (2023) Quantitative analysis of selected genetic markers of induced brain stroke ischemic tolerance detected in human blood. Brain Res 1821:148590 Tang Y, Lu A, Aronow BJ, Sharp FR (2001) Blood genomic responses differ after stroke, seizures, hypoglycemia, and hypoxia: blood genomic fingerprints of disease. Ann Neurol 50:699–707 Furman M, Nemethova M, Macakova L, Sihotsky V, Kopolovets I, Berek P, Virag M, Mucha R (2022) Modifications of gene expression detected in peripheral blood after brain ischemia treated with remote postconditioning. Mol Biol Rep 49:477–485 Ramsay L, Quille ML, Orset C, de la Grange P, Rousselet E, Ferec C, Le Gac G, Genin E, Timsit S (2019) Blood transcriptomic biomarker as a surrogate of ischemic brain gene expression. Ann Clin Transl Neurol 6:1681–1695 Amir Shaghaghi M, Zhouyao H, Tu H, El-Gabalawy H, Crow GH, Levine M, Bernstein CN, Eck P (2017) The SLC2A14 gene, encoding the novel glucose/dehydroascorbate transporter GLUT14, is associated with inflammatory bowel disease. Am J Clin Nutr 106:1508–1513 Zhang Y, Zhang Y, Yao R, He X, Zhao L, Zuo X, Lu B, Pang Z (2022) Ferroptosis-related differentially expressed genes serve as new biomarkers in ischemic stroke and identification of therapeutic drugs. Front Nutr 9:1010918 Inoue K, Xiong ZG, Ueki T (2020) The TRPM7 Channel in the Nervous and Cardiovascular Systems. Curr Protein Pept Sci 21:985–992 Sun HS, Horgen FD, Romo D, Hull KG, Kiledal SA, Fleig A, Feng ZP (2020) Waixenicin A, a marine-derived TRPM7 inhibitor: a promising CNS drug lead. Acta Pharmacol Sin 41:1519–1524 Turlova E, Wong R, Xu B, Li F, Du L, Habbous S, Horgen FD, Fleig A, Feng ZP, Sun HS (2021) TRPM7 Mediates Neuronal Cell Death Upstream of Calcium/Calmodulin-Dependent Protein Kinase II and Calcineurin Mechanism in Neonatal Hypoxic-Ischemic Brain Injury. Translational stroke Res 12:164–184 Zhang RY, He X, Chen JJ, Wu CM, Lin YL, Wang YB, Wang Q, Zheng L, Hu XM (2025) UGP2, a novel target gene of TP53, inhibits endothelial cells apoptosis and atherosclerosis. Life Sci 363:123393 Ganta VC, Kuppuswamy S, Wood M, Reddy M, Thounaojam M (2023) Abstract 537: Inhibiting Glycolytic Determinants In Hypoxic Endothelial Cells Promotes Angiogenesis In Preclinical Peripheral Artery Disease. Arteriosclerosis, Thrombosis, and Vascular Biology 43 Azzaz F, Mazzarino M, Chahinian H, Yahi N, Scala CD, Fantini J (2023) Structure of the Myelin Sheath Proteolipid Plasmolipin (PLLP) in a Ganglioside-Containing Lipid Raft. Front Biosci 28:157 Shulgin AA, Lebedev TD, Prassolov VS, Spirin PV (2021) Plasmolipin and Its Role in Cell Processes. Mol Biol 55:773–785 Gowda VK, Bylappa AY, Kinhal U, Srinivasan VM, Vamyanmane DK (2023) Mitochondrial Complex I Deficiency Masquerading as Stroke-Like Episode Clinically and as Alexander Disease Radiologically Following Chicken Pox. Ann Indian Acad Neurol 26:977–979 Choi DH, Choi IA, Lee J (2022) The Role of DNA Methylation in Stroke Recovery. Int J Mol Sci 23 Lebeurrier N, Vivien D, Ali C (2004) The complexity of tissue-type plasminogen activator: can serine protease inhibitors help in stroke management? Expert Opin Ther Targets 8:309–320 Vivien D, Buisson A (2000) Serine protease inhibitors: novel therapeutic targets for stroke? J Cereb Blood Flow Metab 20:755–764 Budanov AV, Sablina AA, Feinstein E, Koonin EV, Chumakov PM (2004) Regeneration of peroxiredoxins by p53-regulated sestrins, homologs of bacterial AhpD. Science 304:596–600 Zamkova M, Khromova N, Kopnin BP, Kopnin P (2013) Ras-induced ROS upregulation affecting cell proliferation is connected with cell type-specific alterations of HSF1/SESN3/p21Cip1/WAF1 pathways. Cell Cycle 12:826–836 Chen Y, Huang T, Yu Z, Yu Q, Wang Y, Hu J, Shi J, Yang G (2022) The functions and roles of sestrins in regulating human diseases. Cell Mol Biol Lett 27:2 Shcherbakova A, Tiemann B, Buettner FF, Bakker H (2017) Distinct C-mannosylation of netrin receptor thrombospondin type 1 repeats by mammalian DPY19L1 and DPY19L3. Proc Natl Acad Sci USA 114:2574–2579 Li J, Qiu Y, Zhang C, Wang H, Bi R, Wei Y, Li Y, Hu B (2023) The role of protein glycosylation in the occurrence and outcome of acute ischemic stroke. Pharmacol Res 191:106726 Chaudhary P, Proulx J, Park IW (2023) Ubiquitin-protein ligase E3A (UBE3A) mediation of viral infection and human diseases. Virus Res 335:199191 Furumai R, Tamada K, Liu X, Takumi T (2019) UBE3A regulates the transcription of IRF, an antiviral immunity. Hum Mol Genet 28:1947–1958 Xiao X, Zheng F, Chang H, Ma Y, Yao YG, Luo XJ, Li M (2018) The Gene Encoding Protocadherin 9 (PCDH9), a Novel Risk Factor for Major Depressive Disorder. Neuropsychopharmacology: official publication of the American College of Neuropsychopharmacology 43:1128–1137 Watanabe Y, Yoshida M, Yamanishi K, Yamamoto H, Okuzaki D, Nojima H, Yasunaga T, Okamura H, Matsunaga H, Yamanishi H (2015) Genetic analysis of genes causing hypertension and stroke in spontaneously hypertensive rats: Gene expression profiles in the kidneys. Int J Mol Med 36:712–724 Karagiannis GS, Weile J, Bader GD, Minta J (2013) Integrative pathway dissection of molecular mechanisms of moxLDL-induced vascular smooth muscle phenotype transformation. BMC Cardiovasc Disord 13:4 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 03 Feb, 2026 Read the published version in Journal of Molecular Neuroscience → Version 1 posted Editorial decision: Revision requested 21 Oct, 2025 Reviews received at journal 13 Oct, 2025 Reviews received at journal 12 Oct, 2025 Reviewers agreed at journal 26 Sep, 2025 Reviewers agreed at journal 23 Sep, 2025 Reviewers agreed at journal 21 Sep, 2025 Reviewers invited by journal 21 Sep, 2025 Editor assigned by journal 19 Sep, 2025 Submission checks completed at journal 19 Sep, 2025 First submitted to journal 12 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7597075","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":522875559,"identity":"7069248b-7880-43bf-8478-e5324ffa017b","order_by":0,"name":"Rastislav Mucha","email":"","orcid":"","institution":"Slovak Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Rastislav","middleName":"","lastName":"Mucha","suffix":""},{"id":522875560,"identity":"81709a6c-4a6a-41cd-8b89-fa5e6f0b219b","order_by":1,"name":"Marek Furman","email":"","orcid":"","institution":"Slovak Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Marek","middleName":"","lastName":"Furman","suffix":""},{"id":522875562,"identity":"cc55de18-e3a0-41ef-9da8-93c2c833e925","order_by":2,"name":"Alexandra Urbanova","email":"","orcid":"","institution":"Slovak Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Alexandra","middleName":"","lastName":"Urbanova","suffix":""},{"id":522875566,"identity":"e8ca1738-adc5-48e2-9d6b-bbb6b76ec6fb","order_by":3,"name":"Ivan Kopolovets","email":"","orcid":"","institution":"East Slovak Institute of Cardiovascular Diseases","correspondingAuthor":false,"prefix":"","firstName":"Ivan","middleName":"","lastName":"Kopolovets","suffix":""},{"id":522875571,"identity":"a18d1040-167a-4c71-8e57-cfbd5d0b6727","order_by":4,"name":"Miroslava Nemethova","email":"","orcid":"","institution":"Slovak Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Miroslava","middleName":"","lastName":"Nemethova","suffix":""},{"id":522875580,"identity":"c364ba6d-aead-48d9-bc19-9a9704f386ac","order_by":5,"name":"Michal Virag","email":"","orcid":"","institution":"East Slovak Institute of Cardiovascular Diseases","correspondingAuthor":false,"prefix":"","firstName":"Michal","middleName":"","lastName":"Virag","suffix":""},{"id":522875581,"identity":"855a536c-5f1e-4521-b05b-6ca921f67d14","order_by":6,"name":"Stanislav Hresko","email":"","orcid":"","institution":"University of Veterinary Medicine and Pharmacy","correspondingAuthor":false,"prefix":"","firstName":"Stanislav","middleName":"","lastName":"Hresko","suffix":""},{"id":522875582,"identity":"7cf22bce-e9b5-40d7-ad57-e96c12c2d174","order_by":7,"name":"Vladimir Katuch","email":"","orcid":"","institution":"Pavol Jozef Šafárik University","correspondingAuthor":false,"prefix":"","firstName":"Vladimir","middleName":"","lastName":"Katuch","suffix":""},{"id":522875584,"identity":"e02e4553-8154-497f-90ab-93b7b931c508","order_by":8,"name":"Vladimir Sihotsky","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABM0lEQVRIie3RMWuEMBQH8CeBuAiukQ7tR4gIcgXRr2IQ7FLo0KVQsIIQl6Nd7bdol5uvBHTpBzi55W65WZdyhQ6NPYsU09KxUP+DvJj8yHsKMGXKX4wOQEIgstJ4t6ag82FLSxUEfSGhJEY5bH1L+hIfCIl/JlSg7Wp7PrsAU/BNu08cWu9Y04Dv3yFAbaEi2JmxBTlNCcvtIhQuXcfCKiCK7jPA1sOYWBm4RBLZj8aPjHDp0fUZRwagiArA2kZF9JcDMZ86kni0rjh6g5soELIxBTGR0d8CrCPIpStcysGFT+VT1Zgkl90sFBPGrSIWjvUcR9acViERmnwzJljPH+vXRUJNs9qRxkvs26q0m/3VdWDmmWjnYzLYz+Jk+fElgaXqH6nIcX8u+N3xKVOmTPkHeQczbV9LV6CIrQAAAABJRU5ErkJggg==","orcid":"","institution":"East Slovak Institute of Cardiovascular Diseases","correspondingAuthor":true,"prefix":"","firstName":"Vladimir","middleName":"","lastName":"Sihotsky","suffix":""}],"badges":[],"createdAt":"2025-09-12 06:23:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7597075/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7597075/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12031-025-02470-0","type":"published","date":"2026-02-03T15:57:37+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":92682922,"identity":"bb4f4261-dd2f-4e09-b78a-2a3ce048f176","added_by":"auto","created_at":"2025-10-03 01:25:21","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1014324,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript20250911rmaufinal.docx","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/7a50255cf1658c70e4e5bea5.docx"},{"id":92681346,"identity":"bfd983f2-ab6d-455a-ae17-10a802a0c5a7","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10519,"visible":true,"origin":"","legend":"","description":"","filename":"9b098a00c6a04c1885e591c555223505.json","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/4d0dcbd8ad25f63028e8cb13.json"},{"id":92682921,"identity":"1eca44dd-289b-4470-b3a6-8abfabdd6560","added_by":"auto","created_at":"2025-10-03 01:25:21","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":146412,"visible":true,"origin":"","legend":"","description":"","filename":"9b098a00c6a04c1885e591c5552235051enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/5bc26b3233affd5ed9400ba7.xml"},{"id":92681350,"identity":"03b3aeef-c566-4b4b-80d5-614c7f3461b7","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":216813,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/feb241b720ded4a579e06ef6.png"},{"id":92682923,"identity":"80774e38-ef0e-407c-818f-a885b786a79a","added_by":"auto","created_at":"2025-10-03 01:25:21","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":108116,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/46bf2865863f1d01f2993040.png"},{"id":92681354,"identity":"c07a2ec6-950f-4ff0-b7b8-4b31383c492c","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":80086,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/152b8e035340be55ab44e88c.png"},{"id":92681356,"identity":"d40ea9ce-e70f-4474-8976-fad76d54f329","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":119332,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/51b31a80c34ea52cdaddf958.png"},{"id":92681359,"identity":"56d39ae8-33f6-461a-8841-684e4a79c748","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":79818,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/7aaedbaa82bec74b2784c364.png"},{"id":92682499,"identity":"87a5d18f-797b-49e1-8e79-d71c9966f7c8","added_by":"auto","created_at":"2025-10-03 01:17:21","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":292129,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/1e25df645a270acae1bf7a2f.png"},{"id":92681357,"identity":"a81b6f39-0493-4e22-a4cd-8d7334914116","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37567,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/e27a2c516418e4e32c2ec51f.png"},{"id":92681366,"identity":"ad54e169-a303-4ff6-9e57-bb22d27a7f26","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20083,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/6f7d464826e31c4ac325567a.png"},{"id":92681364,"identity":"9d4a1a06-f6eb-4a28-8f79-14ba1d4f778d","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14048,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/41df70ede88f2d4e6216e637.png"},{"id":92681361,"identity":"fdf37766-fab5-46b7-8e93-1db36a7b1243","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22017,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/39b502b9cf0904cb23f71568.png"},{"id":92681363,"identity":"e6987019-9756-4327-971b-b0663ac9a043","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14517,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/fa402b010f4f3dbe779b66ab.png"},{"id":92682501,"identity":"0a82ed26-6252-40b5-8536-6bfcb648c60e","added_by":"auto","created_at":"2025-10-03 01:17:21","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":25019,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/bf1c13d5ec93b5216099f6ee.png"},{"id":92681365,"identity":"fa194df7-a4ea-4fa8-9da2-d5e30b9b6ba8","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":140853,"visible":true,"origin":"","legend":"","description":"","filename":"9b098a00c6a04c1885e591c5552235051structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/d4af517d63ef44d78b74067e.xml"},{"id":92681367,"identity":"d87efe1e-7c3b-4caa-a9e2-223d4b42448c","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"html","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":157687,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/a6e7e0323bd1418ed1d21d09.html"},{"id":92681347,"identity":"ead652ec-aa6e-4547-9828-c9eb4aa97cce","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":181547,"visible":true,"origin":"","legend":"\u003cp\u003eMicroarray analysis results – Venn diagram\u003c/p\u003e\n\u003cp\u003eGraphical representation of the number of genes and their overlap within patient groups 48 hours after carotid endarterectomy, measured by microarray analysis of representative samples from these groups. The total number of genes with a significant change in expression levels \u0026gt; ±2 compared to the negative control is shown for each group in parentheses under the group name. The individual gene counts for the overlap between groups are expressed numerically directly on the graph.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/8be38e541658722aab99325b.png"},{"id":92681345,"identity":"8e9f3fec-df76-4a78-8860-94e8c2b7bc45","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":90379,"visible":true,"origin":"","legend":"\u003cp\u003eExpression levels of \u003cem\u003eSLC2A14, TRPM7\u003c/em\u003e, and \u003cem\u003eUGP2\u003c/em\u003e modified by the impact of CEA\u003c/p\u003e\n\u003cp\u003eComparison of expression level changes in \u003cem\u003eSLC2A14, TRPM7\u003c/em\u003e, and \u003cem\u003eUGP2\u003c/em\u003e among the Sym, Asym, and Oxim groups that underwent CEA. All changes were normalized against the negative control, which represents the 0 value on the X-axis in the graphs. For statistically significant expression changes: * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/a76b75087efdc6b05659d99f.png"},{"id":92681348,"identity":"5b96b8d0-17fb-4c4d-9370-6ac612fcafe3","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":65904,"visible":true,"origin":"","legend":"\u003cp\u003eExpression levels of \u003cem\u003ePLLP\u003c/em\u003e and \u003cem\u003eND4L\u003c/em\u003e genes modified by the impact of CEA\u003c/p\u003e\n\u003cp\u003eComparison of expression level changes in \u003cem\u003ePLLP\u003c/em\u003e and \u003cem\u003eND4L\u003c/em\u003e genes among the Sym, Asym, and Oxim groups that underwent carotid endarterectomy (CEA). All changes were normalized against the negative control, which represents the 0 value on the X-axis in the graphs. For statistically significant expression changes: * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/6d7341d928bfe668b1c70905.png"},{"id":92682496,"identity":"0984e267-b929-4fa3-8c86-ac364b45602d","added_by":"auto","created_at":"2025-10-03 01:17:21","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":102361,"visible":true,"origin":"","legend":"\u003cp\u003eExpression levels of \u003cem\u003eHMSD, SESN3\u003c/em\u003e, and \u003cem\u003eDPY19L4\u003c/em\u003e genes modified by the impact of CEA\u003c/p\u003e\n\u003cp\u003eComparison of expression level changes in \u003cem\u003eHMSD\u003c/em\u003e, \u003cem\u003eSESN3\u003c/em\u003e, and \u003cem\u003eDPY19L4\u003c/em\u003e genes among the Sym, Asym, and Oxim groups that underwent carotid endarterectomy. All changes were normalized against the negative control, which represents the 0 value on the X-axis in the graphs. For statistically significant expression changes: * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/c98b57f39192c15536afe936.png"},{"id":92681349,"identity":"1443186b-d3db-44c3-b645-0c3c89b5cb24","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":67171,"visible":true,"origin":"","legend":"\u003cp\u003eExpression levels of \u003cem\u003eUBE3A\u003c/em\u003e and \u003cem\u003ePCDH9\u003c/em\u003e genes modified by the impact of CEA\u003c/p\u003e\n\u003cp\u003eComparison of expression level changes in \u003cem\u003eUBE3A\u003c/em\u003e and \u003cem\u003ePCDH9\u003c/em\u003e genes among the Sym, Asym, and Oxim groups that underwent carotid endarterectomy. All changes were normalized against the negative control, which represents the 0 value on the X-axis in the graphs. For statistically significant expression changes: * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/da8a5c6a25dac95f2380c6bc.png"},{"id":92681352,"identity":"3d90dfd2-5b8e-411c-8260-983be4d108ab","added_by":"auto","created_at":"2025-10-03 01:09:21","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":220289,"visible":true,"origin":"","legend":"\u003cp\u003eGene expression heatmap based on gene analysis\u003c/p\u003e\n\u003cp\u003eThe heatmap graphically represents the gene expression ratio (left column) relative to the three studied patient groups: Sym, Asym, and Oxim. The colors in the heatmap (right column) indicate the level of gene expression compared to the control sample. Green represents decreased expression, while red indicates increased expression compared to the control sample. The control sample, with a value of 0, is marked in black. The color gradients between green and red represent varying degrees of expression changes. The arrangement of genes within the table corresponds to the results of the representative samples analysed using the microarray method, summarized in Table 3. The genes of each representative sample are separated by white horizontal sections, with their descriptions listed on the far left. The expected upregulation (up) or downregulation (down) of each gene within the group is indicated in parentheses next to the group name.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/f4599723e143f0b479e679bf.png"},{"id":102234202,"identity":"69473eec-84fc-4f30-ab1b-32d9bacf9911","added_by":"auto","created_at":"2026-02-09 16:07:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1790682,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7597075/v1/eb8baac3-1d0b-4101-8b17-dbc72d991e75.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Protective effect of carotid endarterectomy: inducing ischemic tolerance in brain tissue after stroke","fulltext":[{"header":"Highlights","content":"\u003cp\u003e- Whole transcriptome expression changes were identified in stroke\u003c/p\u003e\u003cp\u003e- A potential method of neuroprotection activation after stroke was identified\u003c/p\u003e\u003cp\u003e- Potential blood-based markers of stroke and neuroprotection were identified\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eStroke is now the second most prevalent cause of mortality in the European Union, following ischemic heart disease, with its incidence increasing by 26.1% since 1995. Together, stroke and ischemic heart disease have caused 15.2\u0026nbsp;million deaths per year (15\u0026ndash;15.6\u0026nbsp;million) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Moreover, 47.4\u0026nbsp;million disability-adjusted life years (DALYs) were recorded in 2013 [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In addition, an increase in incidence is expected [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Over 50% of stroke survivors require assistance from others to carry out their daily tasks. Stroke places a significant financial burden on caregivers and healthcare systems. In Europe, stroke-related expenses exceed 38\u0026nbsp;billion euros per year [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe mechanisms of ischemia are complex and form the so-called ischemic cascade. The ischemic cascade can be broadly described as cellular bioenergetic failure resulting from focal hypoperfusion of the brain's neural tissue, followed by excitotoxicity, oxidative stress, blood-brain barrier dysfunction, microvascular damage, haemostatic activation, post-ischemic inflammation, and ultimately, cell death of neurons, glial cells, and endothelial cells [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Given this complexity, therapies targeting individual ischemic mechanisms have not been effective so far. Therefore, attention has shifted to endogenous neuroprotective mechanisms and their ability to induce ischemic tolerance. This process, known as conditioning, begins with stimulation that triggers the production of effector molecules, which either alter gene expression or modify existing proteins. These changes result in an ischemic-tolerant phenotype. Ischemic tolerance (IT) refers to a state in which cells exhibit resistance to the harmful effects of ischemia, leading to a reduced rate of cell death caused by ischemia-reperfusion (IR) injury. Cells exposed to metabolic stress or sublethal ischemia become temporarily resistant to a subsequent otherwise lethal level of stress [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Ischemic conditioning, as an effective non-pharmacological strategy for reducing IR injury, was first demonstrated in 1986 in the field of cardiology on a dog's heart [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The neuroprotective mechanism of reperfusion injury in conditioning involves the suppression of pathophysiological pathways that occur during ischemia. As a result, conditioning offers an innovative approach to neuroprotection by targeting multiple cellular and molecular processes, including apoptosis, inflammation, oxidative stress, brain oedema, hemodynamics, and neurorepair [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eCarotid endarterectomy (CEA) is a surgical procedure used to remove atherosclerotic plaque. Performing this procedure requires the temporary occlusion of the carotid artery. Subsequently, during CEA, the brain is supplied with blood only through one of the carotid arteries. In some cases, CEA can lead to a decrease in brain tissue oxygenation above 20%, which may symptomatically manifest in patients as a mild ischemic attack. These symptoms spontaneously resolve within 2 to 7 days. Such a stimulus activates a cellular response (a cascade of reactions inducing ischemic tolerance), which is reflected in changes at the gene expression level and the subsequent de novo synthesis of effector proteins.\u003c/p\u003e\u003cp\u003eIn experimental animal models of ischemic stroke, it has been shown that a certain gene expression profile after ischemia occurs in both peripheral blood and brain nerve tissue [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Peripheral blood appears to be a good choice as a source of RNA [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Clear similarities in gene expression in both blood and brain were found in a study of ischemic stroke performed by focal occlusion of the middle cerebral artery (MCA), in a model of monkey \u003cem\u003eMacaca mulatta\u003c/em\u003e. The brain structures of this species are significantly similar to those of the human brain. In this analysis, it was found that 493 upregulated and as many as 2,156 downregulated genes overlap, with this overlap in gene expression in both brain nerve tissue and blood reached a statistically significant level for both upregulated and downregulated gene groups [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe aim of this work was to identify the effect of CEA on the process of IT induction based on transcriptomic analysis of peripheral blood cells and subsequently study the changes in the expression of selected genes in the transcriptome of peripheral blood cells of patients influenced by CEA as a potential neuroprotective post-conditioning in humans.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Composition of the test cohorts\u003c/h2\u003e\u003cp\u003e The set of test cohorts chosen for our research analysis consisted of a total of 22 volunteers, of whom 20 were patients and 2 were healthy individuals.. Each participant was properly informed about the goal and course of the study. They voluntarily agreed to participate in this biomedical study, as confirmed by signing the informed consent form. In addition, each participant voluntarily provided data on their medical history for the purposes of the study. Preoperative (before CEA) and postoperative (2 days after CEA) neurological examinations were performed for each participant. To assess the severity of stenosis, imaging techniques such as ultrasonography (USG), MRI angiography, digital subtraction angiography (DSA), and CT angiography were used. The degree of internal carotid artery stenosis for each patient was evaluated using at least two imaging techniques. The size of the ischemic lesion for each patient who had suffered an ischemic stroke prior to CEA was measured either with MRI or a native CT brain scan. CEA was recommended for all patients in accordance with current clinical guidelines. The study participants were divided into four groups:\u003c/p\u003e\u003cp\u003e Asymptomatic Group (Asym) \u0026ndash; a cohort of 8 asymptomatic patients, meaning patients recommended for CEA based on current clinical guidelines, without symptomatic manifestations of stroke.\u003c/p\u003e\u003cp\u003e Symptomatic Group (Sym) \u0026ndash; a cohort of 8 symptomatic patients, meaning patients recommended for CEA based on current clinical guidelines for those who underwent CEA between 7 and 180 days after the onset of neurological symptoms of ischemic stroke.\u003c/p\u003e\u003cp\u003eOximetric Group (Oxim) \u0026ndash; 4 patients (both Sym and Asym) in whom a decrease in saturation detected by transcranial Doppler of more than 20% was observed during CEA\u003c/p\u003e\u003cp\u003eNegative Control (Negat) \u0026ndash; the control group consisted of 2 healthy volunteers (ages 27 and 49) without a history of acute or chronic diseases and therefore without the need for medication.\u003c/p\u003e\u003cp\u003e The average age of the participating patients was 71 years, and efforts were made to ensure that the distribution of age and gender was similar across all patient groups. The duration of carotid artery occlusion during the surgical procedure, recorded by the Invos device, was also documented in the anesthesiology surgical record.\u003c/p\u003e\u003cp\u003eFor patients included in the tested groups the following exclusion criteria were applied: history of oncological or any embolic disease, autoimmune diseases, history of thrombosis or other types of ischemic events excluding stroke, acute and chronic kidney or liver diseases, acute or chronic infections, coagulation disorders, ischemic lesions (if larger than 3 cm). As an exclusion factor for the asymptomatic group, we also included stroke that occurred more than 6 months ago.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eClinical characteristic of the patients\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePatient groups\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSymptomatic\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAsymptomatic\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eOximetric\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNumber of patients\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAge (years)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e75\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e68\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e71\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e71\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSex (male/female)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e50%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e40%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e50%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e45%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHypertension\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHeart disease\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRenal insufficiency\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePulmonary diseases\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDiabetes mellitus\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSmokers\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eClamping time (minutes)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e16\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOximetry decline (%)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e18\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eOverview of patients included in the study cohorts and clinical characteristics for each of them\u003c/p\u003e\u003cp\u003eAll patients received exactly the same postoperative care according to the same protocol, which included antibiotic treatment, low molecular weight heparin (0.05 ml per 10 kg body weight every 12 hours), and an antiplatelet agent (75 mg of clopidogrel once daily). During this postoperative care, patients also continued taking their chronic medications. No comorbidities or medications were recorded that could have affected the gene analysis results or that were not evenly represented across the patient groups. Each patient included in our study underwent the reverse type of surgical procedure known as carotid endarterectomy (CEA).\u003c/p\u003e\u003cp\u003e The implementation of CEA as well as the blood sample collection took place at the Department of Anesthesiology and Intensive Care of the Eastern Slovak Institute of Cardiovascular Diseases, Inc., Kosice, Slovakia (VUSCH, Inc.) and also at the Department of Vascular Surgery of VUSCH, Inc., Blood samples of a total volume of 5 ml for the purposes of biomedical research were collected from patients with the assistance of nurses, alongside routine blood draws and preoperative examinations. The Ethics Committee of VUSCH, Inc., after reviewing the purpose and methodology of the study, decided on July 30, 2018, to grant approval for the proposed project.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e1.1 Microarray analysis\u003c/h2\u003e\u003cp\u003eWhole-transcriptome microarray analysis of representative samples of isolated, purified, and decontaminated human mRNA was performed using Human Clariom-S plates (Affymetrix) designed for human samples. Post-processing analysis of the measured data was conducted using Power Tools software (Affymetrix).\u003c/p\u003e\u003cp\u003eThe data were summarized and normalized using the SST-RMA (Signal Space Transformation-Robust Multichip Analysis) method implemented in Affymetrix\u0026reg; Power Tools (APT). The results were exported with SST-RMA analysis at the gene level, and a differential gene expression (DEG) analysis was performed.\u003c/p\u003e\u003cp\u003eThe statistical significance of expression level data was determined using \"fold change.\" For the set of differentially expressed genes (DEG), hierarchical cluster analysis was performed using complete linkage and Euclidean distance as a measure of similarity.\u003c/p\u003e\u003cp\u003eGene enrichment and functional annotation analyses for generating a list of significant probes were conducted using Gene Ontology (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://geneontology.org\u003c/span\u003e\u003cspan address=\"http://geneontology.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and KEGG (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://kegg.jp\u003c/span\u003e\u003cspan address=\"http://kegg.jp\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAll data analyses and visualizations of differentially expressed genes were performed using R 3.3.2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.r-project.org\u003c/span\u003e\u003cspan address=\"http://www.r-project.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e1.1 Isolation and Processing of Blood Samples, mRNA Isolation, Reverse Transcription to cDNA, and Primer Design\u003c/h2\u003e\u003cp\u003ePeripheral whole blood was collected into Eppendorf tubes containing an anticoagulant solution, and plasma and blood cells were then separated by centrifugation for 15 minutes at 3500 g at 4\u0026ordm;C. The individual fractions were stored at -80\u0026ordm;C.\u003c/p\u003e\u003cp\u003ePhosphate buffer (PBS), composed of 137 mmol/L NaCl, 10 mmol/L Na₂HPO₄\u0026middot;2H₂O\u0026thinsp;+\u0026thinsp;KH₂PO₄, and 2.7 mmol/L KCl, with a pH of 7.4, was used to dilute whole blood cells in a 1:1 ratio. The diluted sample was lysed using TRIzol reagent (Thermo Fisher, USA), and total RNA was extracted with chloroform and isopropanol (propan-2-ol). To eliminate any potential genomic DNA contamination of mRNA, the lysate was treated with DNase I (RNase-free enzyme, Thermo Fisher Scientific, USA). The High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA) was used to reverse transcribe RNA to cDNA according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\u003cp\u003ePrimer design was performed \u003cem\u003ein silico\u003c/em\u003e using the Geneious software (Biomatters, Ltd., New Zealand). The designed forward and reverse primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers for qRT-PCR quantification used in the study\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer [bp]\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRevers primer [bp]\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAnnealing temperature [◦C]\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eAmplified sequence [bp]\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003e18S\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGACCATAAACGATGCCGACT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTGAGGTTTCCCGTGTTGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e190\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eADM\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTGGACTTTGCGGGTTTTGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTTCGGAACTGCGAGGAAGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCDKN1A\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTGTCGCTGTCTTGCACTCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCTGACCCACAGCAGAAGAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGADD45G\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATGAAGATGACGACCGGGAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTAGCGACTTTCCCGGCAAAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e271\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIL6\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGGAACGAAAGTCAACTCCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATCAGTCCCAAGAAGGCAACT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e94\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTM4SF1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGTGCTATGGGAAGTGTGCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTTATTTGTTTTTGTTTTTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e819\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSLC2A14\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACCCCAGCTCTGATCTTTGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCACAGACAAGGACCAGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e58,6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e185\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eUGP2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGCAAACTGAGACTGGTGGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATGACATTCAGGCCTCCATCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e58,6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ePLLP\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTCTTCCCTCCCTGCATTTCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCCATGTGCCTAGTCAGCAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e69\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e180\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eDPY19L4\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTAGTCCCAGCTACTCCGAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGTCTGGCATTTGGGAGGCTA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e190\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTRPM7\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGTCTTGGTGGGGCATGGTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGACCTTGTGATCCGCCCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e67\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e220\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eND4L\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGCTCACACCTCATATCCTCCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGTAGTCTAGGCCATATGTGTTGGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e202\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSESN3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTGACACAACCATGCTGCGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGAGTGTTTGAACTGCCGCCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e62,3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eHMSD\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATCAACCCCCTTGCAGCCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTAGCAAACCCGGCAACCTCTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e215\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eUBE3A\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGTCACCGAATGGCCACAGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGTGCAGGCTTCATTTCCACAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e61,5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ePCDH9\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGCTGTCGCCATGCATCAAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCGGCAGGCTTATTGTCCCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e67\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e214\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eForward and reverse primer sequences along with qPCR reaction parameters: annealing temperature (primer binding) and the length of the amplified sequence during the qRT-PCR reaction in base pairs [bp]\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e1.2 Quantitative real-time PCR (qRT-PCR)\u003c/h2\u003e\u003cp\u003eThe cDNA concentrations were diluted to the level recommended by the manufacturer of the qRT-PCR mastermix used (Power SYBRTM Green PCR Master Mix, Applied Biosystems, USA).\u003c/p\u003e\u003cp\u003e The recorded Ct values of individual genes were normalized according to the Ct values of the housekeeping gene used as the reference for the given sample. Subsequently, the ΔCt values for specific genes were calculated. The housekeeping gene used was 18S. The PCR reaction was performed on the Bio-Rad CFX96\u0026trade; Real-Time PCR Detection System, with the software used for evaluating Ct values being CFX Maestro qPCR Analysis Software (Bio-Rad).\u003c/p\u003e\u003cp\u003eThe normalized ΔCt value for a specific gene in the sample was obtained by calculation:\u003c/p\u003e\u003cp\u003eΔCt(gene x) = /Ct(gene x)/ \u0026ndash; /Ct(\u003cem\u003e18S\u003c/em\u003e)/\u003c/p\u003e\u003cp\u003eCt \u0026ndash; Cycle threshold\u003c/p\u003e\u003cp\u003eΔCt - The normalized value of a specific gene x in the sample\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003e - Housekeeping gene\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003e\u003cem\u003e18S\u003c/em\u003e - Housekeeping gene\u003c/div\u003e\u003cp\u003eThe resulting values of the overall expression change of the studied gene relative to the negative samples of the control groups (ΔΔCt(gene x)) were calculated as the difference in ΔCt(gene x) values between the tested groups (test) vs. their negative samples of the control group (ctrl).\u003c/p\u003e\u003cp\u003eΔΔCt(gene x) = ΔCt(gene x test) \u0026ndash; ΔCt(gene x ctrl)\u003c/p\u003e\u003cp\u003eΔCt - The normalized value of a specific gene x in the sample\u003c/p\u003e\u003cp\u003eΔΔCt - The final value of the overall expression change\u003c/p\u003e\u003cp\u003eThe gene expression level (fold difference (fd)) was calculated based on the following equation:\u003c/p\u003e\u003cp\u003efd\u0026thinsp;=\u0026thinsp;2\u003csup\u003e-ΔΔCt\u003c/sup\u003e\u003c/p\u003e\u003cp\u003eΔΔCt - The final value of the overall expression change\u003c/p\u003e\u003cp\u003eThe final values of RNA expression change were obtained based on calculation:\u003c/p\u003e\u003cp\u003eRNA (expression change rate)\u0026thinsp;=\u0026thinsp;log2 (fd)\u003c/p\u003e\u003cp\u003efd \u0026ndash; fold change\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e1.2 Statistical evaluation\u003c/h2\u003e\u003cp\u003eFor calculating the variance of ΔCt(gene x) values in the set of individuals, we used the mathematical formula for standard deviation (s):\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\:s=\\sqrt{\\frac{1}{N-1}*{\\sum\\:}_{i=1}^{N}{\\left(xi-\\overline{x}\\right)}^{2}}$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003es - standard deviation\u003c/p\u003e\u003cp\u003eN - Number of individuals in the tested group\u003c/p\u003e\u003cp\u003e\u0026#119909;\u0026#119894; - The ΔCt(gene x) value for a specific sample\u003c/p\u003e\u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\overline{x}\\)\u003c/span\u003e\u003c/span\u003e - The average value of ΔCt(gene x) from the entire tested group\u003c/p\u003e\u003cp\u003eThe standard deviation was calculated as a 95% confidence interval. For the calculation, we used the online software Standard Deviation Calculator (calculator.net).\u003c/p\u003e\u003cp\u003eUsing the t-test, we calculated the size of the difference between the sample means in relation to their variability, with a threshold value and statistical significance (P) based on the chosen significance level (0.05 to 0.001):\u003c/p\u003e\u003cp\u003eP\u0026thinsp;\u0026gt;\u0026thinsp;0,05 - Insignificant, P 0,05\u0026thinsp;\u0026minus;\u0026thinsp;0,01 (*) - Marginally significant, P 0,01\u0026thinsp;\u0026minus;\u0026thinsp;0,001 (**) - Moderately significant, P\u0026thinsp;\u0026lt;\u0026thinsp;0,001 (***) - Highly significant\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003e2. Theory/calculation\u003c/h3\u003e\n\u003cp\u003eWe hypothesize that carotid endarterectomy (CEA) induces specific changes in gene expression within the transcriptome of peripheral blood cells, which are associated with the mechanisms of induced tolerance (IT) and may indicate the activation of post-ischemic neuroprotection in patients undergoing CEA.\u003c/p\u003e\u003cp\u003eIntervention in cerebral perfusion through CEA may trigger biological responses similar to ischemic preconditioning. It is further hypothesized that these responses are reflected at the gene expression level in peripheral blood, allowing for non-invasive monitoring of the activation of potentially protective mechanisms. Transcriptomic analysis may reveal gene expression signatures related to neuroprotection, inflammatory response, oxidative stress, or apoptosis\u0026mdash;key pathways commonly implicated in induced tolerance and postconditioning.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1 Whole transcriptome analysis\u003c/h2\u003e\n \u003cp\u003eUsing microarray whole transcriptome analysis, we identified the occurrence of 791 genes with a significant change in expression levels\u0026thinsp;\u0026gt;\u0026thinsp;\u0026plusmn;\u0026thinsp;2 compared to the negative control within the Sym group, with 523 genes being specific to this group and not overlapping with other groups. The total number of genes with a significant change in expression levels\u0026thinsp;\u0026gt;\u0026thinsp;\u0026plusmn;\u0026thinsp;2 compared to the negative control in the Asym group was identified as 688 genes, with 422 genes being specific to this group and not overlapping with others. For the Oxim group, the total number of genes with a significant change in expression levels\u0026thinsp;\u0026gt;\u0026thinsp;\u0026plusmn;\u0026thinsp;2 compared to the negative control was 637, with 359 genes being specific to this group and not overlapping with others (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e1.1 Gene analysis\u003c/h2\u003e\n \u003cp\u003eThis part of the study focused on analysing changes in gene expression levels selected based on the results of the previous whole-transcriptome microarray analysis of representative samples from individual patient test groups undergoing CEA, who had experienced a stroke at varying time intervals before CEA. Based on the expression levels of individual genes within the groups, we identified the genes with the highest expression changes compared to the negative control for each group. In our selection process, we also considered the involvement of these genes in molecular signalling pathways related to ischemic brain tissue damage or, conversely, to tolerance mechanisms against such damage. The genes selected according to the above-mentioned criteria are listed in Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eGenes selected for a detailed analysis of expression level changes\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePatient groups\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eUpregulated gene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eDownregulated gene\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eSymptomatic\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSLC2A14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e(Sym)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUGP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTRPM7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUBE3A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePCDH9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eAsymptomatic\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ePLLP\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eUBE3A\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e(Asym)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eND4L\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ePCDH9\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eOximetric\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eHMSD\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eUBE3A\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e(Oxim)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eSESN3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cem\u003ePCDH9\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eDPY19L4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003eBased on the results of the whole transcriptome analysis of gene expression changes in representative patient samples, we selected the genes with the greatest difference in expression levels compared to the negative control for each group. Upregulated genes exhibited a significantly increased expression level, whereas downregulated genes showed a significant decrease in expression.\u003c/p\u003e\n \u003cp\u003eSym \u0026ndash; symptomatic patients;\u003c/p\u003e\n \u003cp\u003eAsym \u0026ndash; asymptomatic patients;\u003c/p\u003e\n \u003cp\u003eOxim \u0026ndash; patients with a decrease in oximetry of more than 20% during CEA\u003c/p\u003e\n \u003cp\u003eWe primarily focused on observing changes caused by a decrease in oximetry of more than 20% during CEA. The results were normalized against the negative control and compared with Sym and Asym patients also after CEA.\u003c/p\u003e\n \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e\n \u003ch2\u003e1.1.1 Expression of genes selectively analysed in the Symptomatic group\u003c/h2\u003e\n \u003cp\u003eThe increased expression level of \u003cem\u003eSLC2A14\u003c/em\u003e compared to the negative control was observed in the Asym and Oxim groups in a marginally significant form, whereas in the Sym group, we observed a statistically significant decrease in \u003cem\u003eSLC2A14\u003c/em\u003e expression compared to the negative control (Figs. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eAn increase in \u003cem\u003eTRPM7\u003c/em\u003e expression compared to the negative control was observed only in the Asym group, though it was not significant. However, a significant decrease in \u003cem\u003eTRPM7\u003c/em\u003e expression compared to the negative control was observed in both the Sym and Oxim groups, with a higher level of statistical significance in the Sym group (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eThe expression level of \u003cem\u003eUGP2\u003c/em\u003e increased compared to the negative control in all tested groups. The least pronounced change was observed in the Sym group. A statistically more significant increase in \u003cem\u003eUGP2\u003c/em\u003e expression was observed in the Asym group. The most substantial increase in expression was recorded in the Oxim group, where the statistical significance reached P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 (Figs. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e\n \u003ch2\u003e1.1.2 Expression of genes selectively analysed in the Asymptomatic group\u003c/h2\u003e\n \u003cp\u003eThe most pronounced increase in \u003cem\u003ePLLP\u003c/em\u003e expression compared to the negative control was observed in the Asym group, with a milder increase also observed in the Oxim group. In both groups, the results were statistically significant in comparison to the negative control (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). In contrast, in the Sym group, the \u003cem\u003ePLLP\u003c/em\u003e expression was significantly decreased when compared to the negative control (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Figs. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eAn increase in \u003cem\u003eND4L\u003c/em\u003e expression compared to the negative control was observed in the Asym and Oxim groups, with a more pronounced increase recorded in the Oxim group. A slight decrease in \u003cem\u003eND4L\u003c/em\u003e expression compared to the negative control was observed in the Sym group. The statistical significance of the results was set at P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 for all groups (Figs. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e\n \u003ch2\u003e1.1.3 Expression of genes selectively analysed in the Oximetric group\u003c/h2\u003e\n \u003cp\u003eAn increase in \u003cem\u003eHMSD\u003c/em\u003e expression compared to the negative control was observed in both the Asym and Oxim groups, with a more pronounced and statistically significant increase in the Oxim group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the Sym group, the measured \u003cem\u003eHMSD\u003c/em\u003e expression level was similar to the negative control and, therefore, not statistically significant (Figs. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eAn increased expression level of \u003cem\u003eSESN3\u003c/em\u003e compared to the negative control was observed in all groups, with the most statistically significant increase observed in the Oxim group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), a less pronounced increase in the Asym group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and without statistically significant change in \u003cem\u003eSESN3\u003c/em\u003e expression observed in the Sym group (Figs. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eA significant increase in \u003cem\u003eDPY19L4\u003c/em\u003e expression compared to the negative control occurred in a milder form in the Asym group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and in a more pronounced form in the Oxim group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). A decrease in \u003cem\u003eDPY19L4\u003c/em\u003e expression compared to the negative control was observed in the Sym group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Figs. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec16\" class=\"Section3\"\u003e\n \u003ch2\u003e1.1.4 Selectively analysed downregulated genes common to all groups\u003c/h2\u003e\n \u003cp\u003eA decrease in \u003cem\u003eUBE3A\u003c/em\u003e expression compared to the negative control was observed in the Sym and Asym groups, with the result in the Sym group being statistically more significant. In the Oxim group, a slight, statistically insignificant increase in \u003cem\u003eUBE3A\u003c/em\u003e expression compared to the negative control was observed (Figs. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eA decrease in \u003cem\u003ePCDH9\u003c/em\u003e expression compared to the negative control was observed in all tested groups. The most pronounced decrease in expression was recorded in the Asym group, a less pronounced decrease in the Oxim group, and the least pronounced decrease in the Sym group. The level of statistical significance decreased in the same order, from the most significant result in the Asym group with a statistical significance of P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 to the Sym group, which showed no statistical significance (Figs. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eFor the whole transcriptome microarray analysis on representative samples from each tested cohort, our study used the Human Clariom-S chip from Affymetrix, which contains over 20,000 probes of well-annotated genes that bind to specific mRNA sequences. This allows for the simultaneous analysis of a large number of genes and their expression in one experiment. From the Venn diagram of the microarray analysis results, we can see that when compared to the negative control, hundreds of genes were identified as specifically expressed in our tested cohorts out of the more than 20,000 genes. When comparing overlaps between the individual groups, only tens of genes were involved. Since the microarray analysis only involved representative samples, a rational selection of the most suitable gene candidates was performed for subsequent, more detailed qRT-PCR analysis within broader statistical patient groups.\u003c/p\u003e\u003cp\u003eThe specific selectively chosen genes and their quantitative identification of expression changes were performed by group, based on the results of the microarray analysis. The genes induced in the microarray analysis results specific to the Symptomatic group are \u003cem\u003eSLC2A14\u003c/em\u003e, \u003cem\u003eTRPM7\u003c/em\u003e, and \u003cem\u003eUGP2\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003cem\u003eSLC2A14\u003c/em\u003e encodes the protein GLUT14, a member of the glucose transporter (GLUT) family, which is involved in the transport of deoxyglucose and dehydroascorbic acid. This gene is expressed in various tissues, including brain tissue and blood [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Changes in the expression levels of \u003cem\u003eSLC2A14\u003c/em\u003e have excellent diagnostic potential for determining the presence of ischemic stroke, as recent studies have identified \u003cem\u003eSLC2A14\u003c/em\u003e as a gene involved in the iron-dependent form of regulated cell death associated with ischemic stroke [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. An increase in the expression level of \u003cem\u003eSLC2A14\u003c/em\u003e is observed in our results for the Oximetric group. This suggests that in patients from the Oximetric group, a cascade of iron-dependent regulated cell death associated with ischemic stroke is triggered. A possible connection is indicated with transient, milder symptoms of ischemic stroke, which are common in the Oximetric group after CEA. However, a more moderate increase in \u003cem\u003eSLC2A14\u003c/em\u003e expression is also observed in the Asymptomatic group, where no symptomatic manifestations of ischemic stroke occur after CEA. Therefore, our research did not confirm a correlation between the increase in \u003cem\u003eSLC2A14\u003c/em\u003e expression and symptomatic manifestations of ischemic stroke. The only group where a decrease in \u003cem\u003eSLC2A14\u003c/em\u003e expression is observed after CEA is the Symptomatic group. We hypothesize that this decrease is a consequence of a previous ischemic stroke, leading to the activation of a protective ischemic tolerance cascade caused by natural preconditioning.\u003c/p\u003e\u003cp\u003e\u003cem\u003eTRPM7\u003c/em\u003e is a calcium-permeable ion channel and also an enzyme that plays a key role in several biological processes, including axon development and the regulation of cells in response to hypoxia and ischemia. \u003cem\u003eTRPM7\u003c/em\u003e provides a link between the metabolic state of cells and intracellular calcium homeostasis in neurons due to its sensitivity to fluctuations in intracellular Mg-ATP levels. This protein plays a crucial role in ischemic and hypoxic neuronal cell death [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Potential mediators of cell death following \u003cem\u003eTRPM7\u003c/em\u003e activation are considered to be calcium/calmodulin-dependent protein kinase II (CaMKII) and the phosphatase calcineurin. In vivo experiments in mice have shown a significant reduction in brain tissue damage and improvements in both short-term and long-term functions after hypoxic-ischemic brain injury following the administration of the specific \u003cem\u003eTRPM7\u003c/em\u003e blocker, waixenicin A [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Our results indicate a decrease in the expression levels of \u003cem\u003eTRPM7\u003c/em\u003e in both the oximetric and symptomatic patient groups. The reduced expression of this gene is associated with a neuroprotective effect on brain tissue, which we can likely attribute to a previously experienced ischemic stroke in the symptomatic group, followed by tolerance induced by natural preconditioning. In the oximetric group, the decrease is likely associated with short-term mild hypoxia caused by a drop in oximetry levels of more than 20% during CEA, which triggers the body's defence mechanism to induce ischemic tolerance. In the asymptomatic group, which has not previously experienced any ischemic event, CEA did not cause any significant change in the expression levels of the \u003cem\u003eTRPM7\u003c/em\u003e gene compared to negative control samples. Therefore, we believe that if a patient has not previously experienced ischemic stroke, the CEA procedure itself, without complications such as a drop in oximetry by more than 20%, is not a sufficient stimulus to trigger ischemic tolerance in the form of a decrease in TRPM7 expression levels.\u003c/p\u003e\u003cp\u003eThe enzyme uridine diphosphate-glucose pyrophosphorylase (UGP2) is involved in cell proliferation and survival. Microarray analyses have revealed that in atherosclerotic plaques in humans, the expression level of this gene is reduced. An increase in UGP2 expression in endothelial cells leads to a decrease in reactive oxygen species (ROS) levels, cleaved caspase-3 expression, and apoptosis rates. These findings suggest that UGP2 may have a protective effect on endothelial cells and could be an important regulator of cell viability and apoptosis [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. UGP2 is also the only enzyme that catalyses the conversion of glucose 1-phosphate to UDP-glucose, which is an important molecule in anabolic pathways. This reaction is a key step in the synthesis of glucose 6-phosphate and the subsequent formation of glycogen, glycolysis, and other metabolic processes that are essential for cellular energy and function. Inhibition of UGP2 thus leads to a significant reduction in perfusion recovery and vessel density after hypoxia [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Our results indicate a significant increase in the expression level of \u003cem\u003eUGP2\u003c/em\u003e in the oximetric group and, to a lesser extent, in the asymptomatic group of patients. We hypothesize that the significant increase in the oximetric group is triggered by a drop in oxygen saturation of more than 20% during CEA, which likely stimulated a reduction in ROS levels and apoptosis, as well as perfusion recovery after hypoxia influenced by the presence of UGP2 and the neuroprotective cascades it mediates. This neuroprotective effect was observed at a lower intensity in the asymptomatic group as well. Since this group has never experienced ischemic stroke, we assume that the stimulus induced by CEA alone, without complications of oxygen saturation drop above 20%, was sufficient to trigger the neuroprotective response leading to ischemic tolerance. In the symptomatic group of patients, the increase in UGP2 expression was only observed at a very mild, statistically insignificant level. This may be due to the aftermath of a previous ischemic stroke in this group, which likely caused an increased level of ischemic tolerance induced by natural preconditioning. We assume that if the saturation drop during CEA does not exceed 20%, it is not a sufficient stimulus to significantly activate neuroprotective cascades in this group of patients.\u003c/p\u003e\u003cp\u003eThe genes induced in the results of the microarray analysis specific to the Asymptomatic group in our study are \u003cem\u003ePLLP\u003c/em\u003e and \u003cem\u003eND4L\u003c/em\u003e.\u003c/p\u003e\u003cp\u003ePlasmalipin (PLLP) is a membrane protein found in the myelin sheath as its main component. \u003cem\u003ePLLP\u003c/em\u003e also plays an important role in the development and optimal function of the nervous system. It is also involved in intracellular transport, lipid raft formation, and Notch signalling. PLLP expression is characteristic of cells that form the nervous system, gastrointestinal tract, and kidneys, with the highest levels of PLLP observed in epithelial, CNS, and PNS cells. \u003cem\u003ePLLP\u003c/em\u003e plays a critical role in the biogenesis of the myelin membrane and myelination, and is involved in the development and maintenance of the nervous system throughout life. Mechanisms associated with nerve regeneration after injury may also include PLLP. A direct correlation has been observed between the intensity of remyelination and the expression of PLLP mRNA and protein [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Our results indicate a significant increase in the expression level of \u003cem\u003ePLLP\u003c/em\u003e in the asymptomatic group and, to a lesser extent, in the oximetric group of patients. We assume that the marked increase in the asymptomatic group is triggered by the surgical procedure CEA, which, as a stress stimulus, activated the upregulation of genes involved in remyelination processes and brain tissue regeneration. Since the increased expression of \u003cem\u003ePLLP\u003c/em\u003e in the oximetric group did not exceed the levels observed in the asymptomatic group, we assume that this acute activation of a standby mode is not related to the degree of oxygen saturation drop of more than 20%, but rather to the CEA procedure itself. In contrast, in the symptomatic group, we observed a decrease in \u003cem\u003ePLLP\u003c/em\u003e expression, which may be associated with the phenomenon of natural preconditioning, which symptomatic patients experienced after overcoming ischemic stroke, which induced ischemic tolerance. In these patients, some pathways are expressed more than in healthy individuals, while others are suppressed. Since we observe a decrease in neuroprotective remyelination cascades managed by PLLP activation, we assume that this cascade was suppressed during natural preconditioning.\u003c/p\u003e\u003cp\u003e\u003cem\u003eND4L\u003c/em\u003e is a gene that encodes a mitochondrial protein (NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 4L), which is a subunit of mitochondrial complex I. Complex I is involved in the electron transport chain, which plays a key role in cellular energy production. ND4L, as a subunit of complex I, plays an important role in electron transfer within this complex. Its proper function is essential for the efficient operation of the electron transport chain and the subsequent production of ATP [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The connection between \u003cem\u003eND4L\u003c/em\u003e and ischemic stroke occurs through epigenetic mechanisms such as DNA methylation. Overall DNA methylation levels are generally increased after ischemia, associated with heightened activity of DNA methyltransferases (DNMTs). Increased DNA methylation following ischemic injury leads to transcriptional repression of many genes, which exacerbates brain damage. In contrast, DNA demethylation after ischemic injury is associated with recovery processes following a stroke, such as neurogenesis, angiogenesis, gliogenesis, axon growth, and synaptic plasticity. These processes are characterized by an increase in the mRNA levels of genes related to mitochondrial function, including subunits of complex I, such as \u003cem\u003eND4L\u003c/em\u003e [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Our results indicate a significant increase in the expression levels of \u003cem\u003eND4L\u003c/em\u003e in the oximetric group and, to a lesser extent, in the asymptomatic group of patients. We hypothesize that the significant increase in the oximetric group is triggered by a drop in saturation of more than 20% during CEA, which likely induced a reduction in DNA methylation followed by an increase in mitochondrial function. This neuroprotective effect was also observed in a milder form in the asymptomatic group. We hypothesize that this group, which has never previously experienced ischemic stroke, does not require such a strong stimulus to induce a similar effect, and that even the CEA procedure, without major complications such as a significant drop in saturation, was sufficient to reduce DNA methylation and subsequently increase mitochondrial function. In contrast, the symptomatic group likely exhibited a mild decrease in \u003cem\u003eND4L\u003c/em\u003e expression, probably as a result of previously experienced ischemic stroke, suggesting a slight increase in DNA methylation, which is proportional to the reduction in mitochondrial function.\u003c/p\u003e\u003cp\u003eThe genes induced in the results of the microarray analysis in our study, specific to the Oximetric group, are \u003cem\u003eHMSD\u003c/em\u003e, \u003cem\u003eSESN3\u003c/em\u003e, and \u003cem\u003eDPY19L4\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eSerpin-domain containing protein is a protein encoded by the \u003cem\u003eHMSD\u003c/em\u003e gene. It is believed that this protein, containing a minor serpin domain of histocompatibility, functions as an inhibitor of serine proteases (known as serpins). Serpins are known for their ability to inhibit serine proteases, a class of enzymes involved in various physiological processes, including blood clotting, inflammation, and immunity. By inhibiting serine proteases, serpins help regulate these processes and maintain homeostasis in the body. The specific function of the protein encoded by \u003cem\u003eHMSD\u003c/em\u003e containing the histocompatibility serpin domain likely involves the modulation of serine protease activity in myeloid cells, a type of immune cell involved in innate immunity, as HMSD is predominantly expressed in myeloid cells. By regulating the activity of serine proteases in myeloid cells, this protein may influence immune responses, inflammation, and potentially other cellular processes. Compounds that modulate the activity of serine proteases generally exhibit neuroprotective activity [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Our results indicate a significant increase in the expression level of \u003cem\u003eHMSD\u003c/em\u003e in the oximetric group and, to a lesser extent, in the asymptomatic group of patients. We hypothesize that the pronounced increase in the oximetric group is triggered by a drop in oxygen saturation of more than 20% during CEA, which likely caused an increase in the inhibition of serine proteases, followed by the regulation of inflammatory and immune neuroprotective responses. This neuroprotective effect was observed at a lower intensity in the asymptomatic group of patients as well. Since this group has never experienced ischemic stroke, we assume that the stimulus induced by the CEA procedure alone, without complications and with a decrease in oxygen saturation of more than 20%, was sufficient to trigger the body's neuroprotective response, leading to ischemic tolerance. In the symptomatic group of patients, we did not observe an increase in \u003cem\u003eHMSD\u003c/em\u003e expression, and its expression level remained the same as in individuals from the negative control group. This may be due to the past ischemic stroke experienced by this group, which likely caused an increased level of ischemic tolerance induced by natural preconditioning. We assume that if oxygen saturation does not drop by more than 20% during CEA, it is not a sufficient stimulus to activate neuroprotective cascades modulating serine protease activity in a significantly sufficient manner in this group of patients.\u003c/p\u003e\u003cp\u003e\u003cem\u003eSESN3\u003c/em\u003e, or Sestrin 3, is a gene that codes for a protein playing a key role in stress responses and maintaining cellular homeostasis. This protein is a member of the stress-inducible family of sestrin proteins, which reduces intracellular reactive oxygen species (ROS) levels, thereby inducing resistance to oxidative stress [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Due to its antioxidant biological activity and ability to promote autophagy, the protective effect mediated by sestrins has great potential in the treatment of many neurodegenerative diseases and neurological disorders. \u003cem\u003eSESN3\u003c/em\u003e is highly expressed in brain tissue, and its expression is often associated with conditions such as seizures, neuropathic pain, or ischemic stroke (IS). These close associations with neurological conditions suggest an important role for SESN3 in protecting the nervous system and its responses to various stressors and damage [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Our results indicate a significant increase in the expression levels of \u003cem\u003eSESN3\u003c/em\u003e in the oximetric group, and to a lesser extent in both the asymptomatic and symptomatic groups of patients. We hypothesize that the significant increase observed in the oximetric group is induced by a drop in oxygen saturation of more than 20% during CEA, which likely acts as a strong stressor, inducing an increase in \u003cem\u003eSESN3\u003c/em\u003e production as part of the sestrin family. This, in turn, reduces intracellular ROS levels and triggers a neuroprotective effect through a cascade of responses that induce resistance to oxidative stress. This neuroprotective effect was observed with significant intensity, though at a lower level, also in the asymptomatic group. Since this group has never experienced ischemic stroke, we assume that the CEA procedure alone, even without complications such as a drop in oxygen saturation of more than 20%, was a sufficient stressor to trigger the stress-induced neuroprotective response, enhancing resistance to oxidative stress through \u003cem\u003eSESN3\u003c/em\u003e-regulated reduction of intracellular ROS levels. In the symptomatic group of patients, an increase in \u003cem\u003eSESN3\u003c/em\u003e expression was also observed as a result of the CEA procedure, although this increase was not statistically significant. This may suggest that natural preconditioning, which we hypothesize occurred in the symptomatic group, led to a situation where the stressor induced by CEA, without a drop in oxygen saturation of more than 20%, was not sufficient to induce a stress-induced neuroprotective response at a statistically significant level. However, the mild increase without significant statistical significance suggests that a mild form of activation of this \u003cem\u003eSESN3\u003c/em\u003e-regulated antioxidant protection against ROS likely occurs.\u003c/p\u003e\u003cp\u003e\u003cem\u003eDPY19L4\u003c/em\u003e is a gene that encodes a putative C-mannosyltransferase. This enzyme mediates the C-mannosylation of tryptophan residues on target proteins. It is involved in post-translational modifications and is thought to enable mannosyltransferase activity. It has been shown that protein glycosylation, including C-mannosylation, affects the outcome of a cerebrovascular accident by influencing inflammatory response, excitotoxicity, neuronal apoptosis, and disruption of the blood-brain barrier [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Glycosylation can modify the function, stability, and interactions of proteins, which can impact various cellular processes. In the context of a cerebrovascular accident, altered protein glycosylation may contribute to the inflammatory response, excitotoxicity, and neuronal apoptosis, which can worsen damage after a stroke. Furthermore, \u003cem\u003eDPY19L4\u003c/em\u003e may be involved in disrupting the blood-brain barrier, leading to increased brain oedema and a worse outcome in stroke [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Our results indicate a significant increase in the expression levels of \u003cem\u003eDPY19L4\u003c/em\u003e in the oximetric group and, to a lesser extent, in the asymptomatic group of patients. We assume that the significant increase in the oximetric group was induced by a drop in oximetry by more than 20% during CEA, which likely led to an increase in mannosyltransferase activity, contributing to the propagation of neurodegenerative cascades affecting inflammation, excitotoxicity, disruption of the blood-brain barrier, and neuronal apoptosis. This neurodegenerative effect was also observed in a milder form in the asymptomatic group. We assume that the lower intensity of the expression increase, indicating a milder course of neurodegenerative processes induced by the increase in mannosyltransferase activity, is related to the degree of stress the patients underwent during CEA. Since the oximetry level in the asymptomatic group did not drop by more than 20%, as in the oximetric group, this form of CEA represents a lower burden on the body, corresponding to a milder intensity of neurodegenerative cascades. In the symptomatic group of patients, however, we observed a significant decrease in the expression of \u003cem\u003eDPY19L4\u003c/em\u003e. We hypothesize that the ischemic stroke these patients had experienced functions as a form of natural preconditioning, which induced an ischemic-tolerant phenotype. Therefore, we believe that the stressor in the form of CEA, which triggered neurodegenerative processes in patients without a tolerant phenotype, in the case of patients with a tolerant phenotype, initiates a decrease in mannosyltransferase activity, thus dampening neurodegenerative cascades affecting inflammation, excitotoxicity, disruption of the blood-brain barrier, and neuronal apoptosis. This results in the induction and likely the deepening of the already existing neuroprotective effect of ischemic tolerance.\u003c/p\u003e\u003cp\u003eThe genes inhibited in the microarray analysis results common to all tested groups are \u003cem\u003eUBE3A\u003c/em\u003e and \u003cem\u003ePCDH9\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eThe \u003cem\u003eUBE3A\u003c/em\u003e gene encodes a protein called ubiquitin-protein ligase E3A, also known as E6-associated protein (E6-AP), which plays a key role in the targeted degradation of proteins in cells. This gene is essential for the normal development and function of the nervous system, regulating the synthesis and degradation of proteins to maintain proteostasis [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. \u003cem\u003eUBE3A\u003c/em\u003e has been identified as a regulator of the transcription factors IRF1 and IRF4 (interferon regulatory factors 1 and 4), which are involved in immune reactivity and neuronal survival in brain tissue following ischemic stroke. Several studies have shown that IRF1 acts as a coregulator of p53 in the apoptosis pathway [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Our results indicate a significant decrease in \u003cem\u003eUBE3A\u003c/em\u003e expression in the symptomatic group, and a less significant decrease in the asymptomatic group. This significant reduction in expression in the symptomatic group is likely related to the presumed presence of an ischemic tolerant phenotype, which we expect in this group based on their history of ischemic stroke, acting as a form of natural preconditioning. We believe that the intensity of the stress stimulus induced by the CEA procedure was sufficient for conditioned patients to trigger a neuroprotective response through the reduction of \u003cem\u003eUBE3A\u003c/em\u003e levels, which is involved in the regulation of immune response cascades, neuronal survival, and apoptosis. A similar neuroprotective effect, though not statistically significant, was observed in the asymptomatic group. For this group as well, we hypothesize that the intensity of the stress stimulus induced by CEA was sufficient to induce a neuroprotective response by lowering \u003cem\u003eUBE3A\u003c/em\u003e levels and subsequently activating the ischemic tolerant phenotype. In the oximetric group, which experienced a drop in oxygen saturation of more than 20% during CEA, we observed a slight increase in \u003cem\u003eUBE3A\u003c/em\u003e expression. We assume that a drop in oxygen saturation by more than 20% represents too strong a stressor for the patient to respond with the induction of ischemic tolerance through \u003cem\u003eUBE3A\u003c/em\u003e-regulated cascades. Instead, we see mild neurodegeneration in the brain tissue, which, although statistically significant, is likely not pronounced.\u003c/p\u003e\u003cp\u003eProtocadherin 9 is a member of the protocadherin family and the cadherin superfamily, which are transmembrane proteins containing extracellular domains [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Cadherin domains mediate cell adhesion in neural tissues in the presence of calcium. The protein encoded by \u003cem\u003ePCDH9\u003c/em\u003e may therefore be involved in signalling at neuronal synaptic connections [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In addition, it was found that \u003cem\u003ePCDH9\u003c/em\u003e is downregulated 21 hours after treatment of coronary arteries with minimally oxidized LDL (moxLDL), which is a significant risk factor for the development of an atherosclerotic plaque and subsequent increased risk of ischemic stroke, as moxLDL activates immune responses that sustain chronic inflammatory reactions characteristic of atherosclerosis [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Our results point to the downregulation of \u003cem\u003ePCDH9\u003c/em\u003e across all groups. The most statistically significant decrease in expression was observed in the asymptomatic group. This group of patients, without prior ischemic conditioning, appears to be the most vulnerable to the stress stimulus applied in the form of CEA. This is likely because the stressor activates inflammatory and immune responses in which \u003cem\u003ePCDH9\u003c/em\u003e participates, similar to the formation of an atherosclerotic plaque, leading to neurodegenerative damage to brain tissue. In the symptomatic group, we observed a very slight decrease in \u003cem\u003ePCDH9\u003c/em\u003e expression, and these measured values do not differ significantly from the values of the negative control group. The previously experienced ischemic stroke in the symptomatic group of patients can be considered a form of natural preconditioning. Thus, we assume the presence of a tolerant phenotype in this group. This tolerant phenotype helps mitigate or completely block the onset of neurodegenerative cascades related to inflammatory and immune responses in which \u003cem\u003ePCDH9\u003c/em\u003e is involved. In the oximetric group, we observed a mild but significant downregulation of \u003cem\u003ePCDH9\u003c/em\u003e due to the CEA procedure with a drop in oximetry of more than 20%. Since the oximetric group consists of both symptomatic and asymptomatic patients, we believe that the resulting \u003cem\u003ePCDH9\u003c/em\u003e expression reflecting the presence or absence of neurodegenerative cascades is an average value of both patient groups (with and without natural preconditioning), which is supported by the large variability in statistical significance. We hypothesize that for the activation of these specific neurodegenerative pathways associated with \u003cem\u003ePCDH9\u003c/em\u003e downregulation, the degree of oximetry decline is not as significant a factor as whether ischemic tolerance through preconditioning is present in the patients or not.\u003c/p\u003e\u003cp\u003eIn conclusion, the findings of this study suggest that monitoring changes in gene expression in peripheral blood may be useful in identifying an increased ability to induce ischemic tolerance. We have also demonstrated that CEA may initiate protective processes to some extent after ischemic stroke. Based on this, we can consider it a form of ischemic tolerance activation. These insights may contribute to the development of new therapeutic strategies aimed at improving the prognosis of patients with ischemic stroke, for example, through a personalized approach to treatment and the prevention of secondary ischemic events.\u003c/p\u003e\u003cp\u003e\u003cb\u003eSubmission declaration and verification\u003c/b\u003e\u003c/p\u003e\u003cp\u003e The work has not been published previously, it is not under consideration for publication elsewhere, its publication is approved by all authors and tacitly or explicitly by the responsible authorities where the work was carried out, and, if accepted, it will not be published elsewhere in the same form, in English or in any other language, including electronically without the written consent of the copyright-holder.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eSubmission declaration and verification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe work has not been published previously, it is not under consideration for publication elsewhere, its publication is approved by all authors and tacitly or explicitly by the responsible authorities where the work was carried out, and, if accepted, it will not be published elsewhere in the same form, in English or in any other language, including electronically without the written consent of the copyright-holder.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the grant from the Slovak Scientific Grant Agency VEGA (Grant number 2/0101/24) received by author Rastislav Mucha. This publication was created thanks to support under the Operational Programme Integrated Infrastructure for the project: Strengthening of Research, Development and Innovation Capacities of Translational Biomedical Research of Human Diseases,, IMTS: 313021BZC9, co-financed by the European Regional Development Fund.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRastislav Mucha: Conceptualization, Data Curation, Methodology, Project administration, Supervision, Validation, Writing - original draft, Writing - Review and Editing. Marek Furman: Data curation; Formal analysis, Investigation, Methodology, Software, Visualization, Writing - original draft. Alexandra Urbanova: Writing - review \u0026amp; editing , Ivan Kopolovets: Resources, Methodology. Miroslava Nemethova: Methodology, Investigation, Writing - review \u0026amp; editing. Michal Virag: Data curation, Methodology, Resources. Stanislav Hresko: Writing - review \u0026amp; editing. Vladimir Katuch: Writing - review \u0026amp; editing. Vladimir Sihotsky: Conceptualization, Investigation, Methodology, Resources, Project administration, Writing - Review \u0026amp; Editing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and/or analysed during the current study are not publicly available but are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Ethics Committee of VUSCH, Inc., after reviewing the purpose and methodology of the study, decided on July 30.2018, to grant approval for the proposed project.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number:\u003c/strong\u003e not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInformed consent was obtained from all individual participants included in the study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eDoeppner TR, Zechmeister B, Kaltwasser B, Jin F, Zheng X, Majid A, Venkataramani V, Bahr M, Hermann DM (2018) Very Delayed Remote Ischemic Post-conditioning Induces Sustained Neurological Recovery by Mechanisms Involving Enhanced Angioneurogenesis and Peripheral Immunosuppression Reversal. Front Cell Neurosci 12:383\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShi CX, Ding YB, Jin FYJ, Li T, Ma JH, Qiao LY, Pan WZ, Li KZ (2018) Effects of sevoflurane post-conditioning in cerebral ischemia-reperfusion injury via TLR4/NF-kappaB pathway in rats. Eur Rev Med Pharmacol Sci 22:1770\u0026ndash;1775\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDoeppner TR, Doehring M, Kaltwasser B, Majid A, Lin F, Bahr M, Kilic E, Hermann DM (2017) Ischemic Post-Conditioning Induces Post-Stroke Neuroprotection via Hsp70-Mediated Proteasome Inhibition and Facilitates Neural Progenitor Cell Transplantation. Mol Neurobiol 54:6061\u0026ndash;6073\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHoward DPJ, Gaziano L, Rothwell PM (2021) Risk of stroke in relation to degree of asymptomatic carotid stenosis: a population-based cohort study, systematic review, and meta-analysis. Lancet Neurol 20:193\u0026ndash;202\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBrouns R, De Deyn PP (2009) The complexity of neurobiological processes in acute ischemic stroke. Clin Neurol Neurosurg 111:483\u0026ndash;495\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBurda R, Burda J, Morochovic R (2023) Ischemic Tolerance-A Way to Reduce the Extent of Ischemia-Reperfusion Damage. Cells 12\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMurry CE, Jennings RB, Reimer KA (1986) Preconditioning with ischemia: a delay of lethal cell injury in ischemic myocardium. Circulation 74:1124\u0026ndash;1136\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaccaro LF, Aimo A, Emdin M, Pico F (2021) Remote Ischemic Conditioning in Ischemic Stroke and Myocardial Infarction: Similarities and Differences. Front Neurol 12:716316\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFurman M, Sihotsky V, Virag M, Kopolovets I, Nemethova M, Mucha R (2023) Quantitative analysis of selected genetic markers of induced brain stroke ischemic tolerance detected in human blood. Brain Res 1821:148590\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang Y, Lu A, Aronow BJ, Sharp FR (2001) Blood genomic responses differ after stroke, seizures, hypoglycemia, and hypoxia: blood genomic fingerprints of disease. Ann Neurol 50:699\u0026ndash;707\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFurman M, Nemethova M, Macakova L, Sihotsky V, Kopolovets I, Berek P, Virag M, Mucha R (2022) Modifications of gene expression detected in peripheral blood after brain ischemia treated with remote postconditioning. Mol Biol Rep 49:477\u0026ndash;485\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRamsay L, Quille ML, Orset C, de la Grange P, Rousselet E, Ferec C, Le Gac G, Genin E, Timsit S (2019) Blood transcriptomic biomarker as a surrogate of ischemic brain gene expression. Ann Clin Transl Neurol 6:1681\u0026ndash;1695\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAmir Shaghaghi M, Zhouyao H, Tu H, El-Gabalawy H, Crow GH, Levine M, Bernstein CN, Eck P (2017) The SLC2A14 gene, encoding the novel glucose/dehydroascorbate transporter GLUT14, is associated with inflammatory bowel disease. Am J Clin Nutr 106:1508\u0026ndash;1513\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Zhang Y, Yao R, He X, Zhao L, Zuo X, Lu B, Pang Z (2022) Ferroptosis-related differentially expressed genes serve as new biomarkers in ischemic stroke and identification of therapeutic drugs. Front Nutr 9:1010918\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eInoue K, Xiong ZG, Ueki T (2020) The TRPM7 Channel in the Nervous and Cardiovascular Systems. Curr Protein Pept Sci 21:985\u0026ndash;992\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun HS, Horgen FD, Romo D, Hull KG, Kiledal SA, Fleig A, Feng ZP (2020) Waixenicin A, a marine-derived TRPM7 inhibitor: a promising CNS drug lead. Acta Pharmacol Sin 41:1519\u0026ndash;1524\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTurlova E, Wong R, Xu B, Li F, Du L, Habbous S, Horgen FD, Fleig A, Feng ZP, Sun HS (2021) TRPM7 Mediates Neuronal Cell Death Upstream of Calcium/Calmodulin-Dependent Protein Kinase II and Calcineurin Mechanism in Neonatal Hypoxic-Ischemic Brain Injury. Translational stroke Res 12:164\u0026ndash;184\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang RY, He X, Chen JJ, Wu CM, Lin YL, Wang YB, Wang Q, Zheng L, Hu XM (2025) UGP2, a novel target gene of TP53, inhibits endothelial cells apoptosis and atherosclerosis. Life Sci 363:123393\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGanta VC, Kuppuswamy S, Wood M, Reddy M, Thounaojam M (2023) Abstract 537: Inhibiting Glycolytic Determinants In Hypoxic Endothelial Cells Promotes Angiogenesis In Preclinical Peripheral Artery Disease. Arteriosclerosis, Thrombosis, and Vascular Biology 43\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAzzaz F, Mazzarino M, Chahinian H, Yahi N, Scala CD, Fantini J (2023) Structure of the Myelin Sheath Proteolipid Plasmolipin (PLLP) in a Ganglioside-Containing Lipid Raft. Front Biosci 28:157\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShulgin AA, Lebedev TD, Prassolov VS, Spirin PV (2021) Plasmolipin and Its Role in Cell Processes. Mol Biol 55:773\u0026ndash;785\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGowda VK, Bylappa AY, Kinhal U, Srinivasan VM, Vamyanmane DK (2023) Mitochondrial Complex I Deficiency Masquerading as Stroke-Like Episode Clinically and as Alexander Disease Radiologically Following Chicken Pox. Ann Indian Acad Neurol 26:977\u0026ndash;979\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChoi DH, Choi IA, Lee J (2022) The Role of DNA Methylation in Stroke Recovery. Int J Mol Sci 23\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLebeurrier N, Vivien D, Ali C (2004) The complexity of tissue-type plasminogen activator: can serine protease inhibitors help in stroke management? Expert Opin Ther Targets 8:309\u0026ndash;320\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVivien D, Buisson A (2000) Serine protease inhibitors: novel therapeutic targets for stroke? J Cereb Blood Flow Metab 20:755\u0026ndash;764\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBudanov AV, Sablina AA, Feinstein E, Koonin EV, Chumakov PM (2004) Regeneration of peroxiredoxins by p53-regulated sestrins, homologs of bacterial AhpD. Science 304:596\u0026ndash;600\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZamkova M, Khromova N, Kopnin BP, Kopnin P (2013) Ras-induced ROS upregulation affecting cell proliferation is connected with cell type-specific alterations of HSF1/SESN3/p21Cip1/WAF1 pathways. Cell Cycle 12:826\u0026ndash;836\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen Y, Huang T, Yu Z, Yu Q, Wang Y, Hu J, Shi J, Yang G (2022) The functions and roles of sestrins in regulating human diseases. Cell Mol Biol Lett 27:2\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShcherbakova A, Tiemann B, Buettner FF, Bakker H (2017) Distinct C-mannosylation of netrin receptor thrombospondin type 1 repeats by mammalian DPY19L1 and DPY19L3. Proc Natl Acad Sci USA 114:2574\u0026ndash;2579\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi J, Qiu Y, Zhang C, Wang H, Bi R, Wei Y, Li Y, Hu B (2023) The role of protein glycosylation in the occurrence and outcome of acute ischemic stroke. Pharmacol Res 191:106726\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChaudhary P, Proulx J, Park IW (2023) Ubiquitin-protein ligase E3A (UBE3A) mediation of viral infection and human diseases. Virus Res 335:199191\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFurumai R, Tamada K, Liu X, Takumi T (2019) UBE3A regulates the transcription of IRF, an antiviral immunity. Hum Mol Genet 28:1947\u0026ndash;1958\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiao X, Zheng F, Chang H, Ma Y, Yao YG, Luo XJ, Li M (2018) The Gene Encoding Protocadherin 9 (PCDH9), a Novel Risk Factor for Major Depressive Disorder. Neuropsychopharmacology: official publication of the American College of Neuropsychopharmacology 43:1128\u0026ndash;1137\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWatanabe Y, Yoshida M, Yamanishi K, Yamamoto H, Okuzaki D, Nojima H, Yasunaga T, Okamura H, Matsunaga H, Yamanishi H (2015) Genetic analysis of genes causing hypertension and stroke in spontaneously hypertensive rats: Gene expression profiles in the kidneys. Int J Mol Med 36:712\u0026ndash;724\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKaragiannis GS, Weile J, Bader GD, Minta J (2013) Integrative pathway dissection of molecular mechanisms of moxLDL-induced vascular smooth muscle phenotype transformation. BMC Cardiovasc Disord 13:4\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"journal-of-molecular-neuroscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jomn","sideBox":"Learn more about [Journal of Molecular Neuroscience](https://www.springer.com/journal/12031)","snPcode":"12031","submissionUrl":"https://submission.nature.com/new-submission/12031/3","title":"Journal of Molecular Neuroscience","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"brain stroke, ischemic tolerance, gene expression, blood, human","lastPublishedDoi":"10.21203/rs.3.rs-7597075/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7597075/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eStroke is a serious disease, ranking among the leading causes of mortality and permanent disability in EU countries. The ischemic cascade, triggered by the blockage of oxygenated blood supply to brain tissue, leads to excitotoxicity, oxidative stress, inflammation, and eventually, cell death. Current research highlights the promising neuroprotective effects of conditioning, which induces ischemic tolerance (IT). Thus, the main objective of this study is to analyse selected genes affected by ischemic stroke and the neuroprotective response to ischemic stroke, with a focus on ischemia and ischemic tolerance in peripheral blood.\u003c/p\u003e\u003cp\u003eWe investigated changes in gene expression indicative of cerebral ischemia during carotid endarterectomy (CEA), a procedure that involves the temporary occlusion of the \u003cem\u003earteria carotis interna\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eTo assess the influence of CEA on IT induction, we performed a whole-transcriptome analysis of peripheral blood cells isolated from symptomatic, asymptomatic, and oximetric patients.\u003c/p\u003e\u003cp\u003eThe presence of gene expression changes in genes selectively identified through whole-transcriptome analysis was subsequently statistically verified. Using quantitative qRT-PCR, we monitored gene expression changes \u003cem\u003ein SLC2A14, TRPM7, UGP2, PLLP, ND4L, HMSD, SESN3, DPY19L4, UBE3A\u003c/em\u003e, and \u003cem\u003ePCDH9\u003c/em\u003e. The results suggest that CEA affected the expression of all monitored genes, with statistically significant differences between groups, indicating the activation of distinct ischemic tolerance cascades in different patient groups.\u003c/p\u003e\u003cp\u003eThese findings may contribute to a better understanding and characterising of the molecular mechanisms underlying ischemic tolerance.\u003c/p\u003e","manuscriptTitle":"Protective effect of carotid endarterectomy: inducing ischemic tolerance in brain tissue after stroke","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-03 01:09:16","doi":"10.21203/rs.3.rs-7597075/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-21T11:07:45+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-13T18:17:07+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-12T17:42:22+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"70982824031892436721784423541012343209","date":"2025-09-26T14:45:35+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"335529986553675274494070743099937300176","date":"2025-09-23T14:48:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"224453440703870952647306369338452193544","date":"2025-09-21T11:21:19+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-21T09:36:38+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-19T13:24:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-19T13:23:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Molecular Neuroscience","date":"2025-09-12T06:17:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"journal-of-molecular-neuroscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jomn","sideBox":"Learn more about [Journal of Molecular Neuroscience](https://www.springer.com/journal/12031)","snPcode":"12031","submissionUrl":"https://submission.nature.com/new-submission/12031/3","title":"Journal of Molecular Neuroscience","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"2bf56658-9c1f-4e2b-9b2a-e0a8900ea346","owner":[],"postedDate":"October 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-02-09T16:03:39+00:00","versionOfRecord":{"articleIdentity":"rs-7597075","link":"https://doi.org/10.1007/s12031-025-02470-0","journal":{"identity":"journal-of-molecular-neuroscience","isVorOnly":false,"title":"Journal of Molecular Neuroscience"},"publishedOn":"2026-02-03 15:57:37","publishedOnDateReadable":"February 3rd, 2026"},"versionCreatedAt":"2025-10-03 01:09:16","video":"","vorDoi":"10.1007/s12031-025-02470-0","vorDoiUrl":"https://doi.org/10.1007/s12031-025-02470-0","workflowStages":[]},"version":"v1","identity":"rs-7597075","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7597075","identity":"rs-7597075","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.