Molecular confirmation of ToLCNDV resistance in cucumber (Cucumis sativus L.) genotypes through agroinoculation and field screening

Molecular confirmation of ToLCNDV resistance in cucumber (Cucumis sativus L.) genotypes through agroinoculation and field screening | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular confirmation of ToLCNDV resistance in cucumber (Cucumis sativus L.) genotypes through agroinoculation and field screening Naveena Elango, Rajasree Venkatachalam, Behara Tusar Kanti, Karthikeyan Gandhi, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4621625/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Research was carried out to identify the source of resistance in four cucumber genotypes for ToLCNDV under natural field epiphytotic and greenhouse conditions. Over all the mean percent disease index and incidence ranged from 0 to 92.00% and 0 to 93.3% respectively. Under natural field conditions, the genotype DC 70 was found to be totally free from ToLCNDV infection followed by P-85 with 8.57 PDI and 28.57% disease incidence while DC 773 recorded 75.00 PDI and 87.50% disease incidence and DC 769 with 42.85 PDI and 71.42% disease incidence in rabi season under field epiphytotic condition. Similarly, during the kharif season the genotype DC 70 and P-85 were found to be totally free from ToLCNDV infection while DC 773 recorded 65.71 PDI and 85.00% disease incidence and DC 769 with 40.00 PDI and 75.00% disease incidence. Based on natural field evaluation the selected entries were subjected to artificial screening under greenhouse conditions. DC 70 was totally free from ToLCNDV infection upon artificial screening by agroinoculation. This was followed by P-85 with 22.91 PDI and 46.60% disease incidence and DC 773 recorded 92.00 PDI and 93.3%disease incidence. Symptomatic and asymptomatic leaves were confirmed for the presence of ToLCNDV by PCR assay. Susceptible genotypes expressed leaf curling, yellowing and severe mosaic on 28 days post-inoculation. Out of four genotypes screened, DC 70 showed highly resistant reaction and identified as reliable source of resistance for ToLCNDV in cucumber. The resistant source identified is a good candidate for resistant breeding for ToLCNDV in cucumber. Cucumber ToLCNDV Natural & Artificial screening Agroinoculation PCR Figures Figure 1 Figure 2 Introduction Cucumber ( Cucumis sativs L.) is native to India, is a widely consumed fresh market vegetable that is used in many different dishes. Being a highly cross-pollinated crop, cucumber is monoecious in nature and prefers warm, sunny weather for optimal growth and development. Nowadays, the foremost constraint in cucurbit cultivation is viral disease caused by globalization and climatic variations speed up their transmission. The major infectious agents associated with cucurbits include Zucchini yellow mosaic virus (ZYMV), Cucumber mosaic virus (CMV), Watermelon bud necrosisvirus (WBNV) and Tomato leaf curl New Delhi virus (ToLCNDV). Among them, the largest general member of the Geminiviridae family, the Begomovirus, is posing a serious threat to cucurbitaceous crops in India. The geminivirus is transmitted by whiteflies ( Bemisia tabaci ) is the cause of the viral disease known as tomato leaf curl New Delhi virus (ToLCNDV). Since 20th century, the begomovirus in cucurbits became a significant problem in India, resulting in 50% loss in northern states of India (Tripathi and Verma. 2017). ToLCNDV was first identified in India during 1995 as a variation of the Tomato yellow leaf curl virus (TYLCV) by (Srivastava et al. 1995 ). Since 2012, ToLCNDV have been posing serious threat to the major cucurbitaceous crops (Juarez et al. 2014). Depending on the nature of genome present, this virus is bipartite contains two 2.6–2.7 kb circular single-stranded DNA strands, known as DNA-A and DNA-B, which are encapsulated in geminate particles and necessary for fundamental viral operations (Fortes et al. 2016 ). In general, beta satellite and monopartite begomovirus are linked however, a recent study also shown that beta satellite and bipartite begomovirus are also associated (Venkataravanappa et al. 2019 ). It is also known that beta satellite plays significant influence on the host range of the associated begomovirus. On the other hand, ToLCNDV has been rapidly expanding its host range and reaching new geographic areas in recent years (Malathi et al. 2017 ). However, a recent report shows that it also infects tomato (Prabhandakavi et al. 2018 ), chayotes and cucurbits (Patil et al. 2017 ) in the southern region of the country. This virus was reported in Spain in 2013 in the cities of Almerna and Cartagena (Murcia) and it primarily affects zucchini squash among other cucurbits. ToLCNDV has caused substantial harm to a variety of crops, particularly cucurbits, such as melons. In central Spain, its impact on open-field melon production has been particularly severe with reported losses reaching as high as 20% (Saez et al. 2017 ). Disease incidence embrace greater significance results in diminished fruit yield. The objective of this study was to identify sources of ToLCNDV resistant genotype in C. sativus through natural and artificial screening. Therefore, four genotypes were selected and screened for resistance to Tomato leaf curl New Delhi virus. MATERIALS AND METHODS Plant materials Cucumber genotypes including DC-70, DC-773, DC-769 and P-85 (Table 1 ) were used as plant materials for this experiment. Samples of infected plants exhibiting different ToLCNDV symptoms such as mosaic, yellowing, upward curling, puckering and stunting were randomly collected and brought to laboratory for molecular analysis. For every genotype disease index and incidence were computed and reported as percentage. Table 1 Sources and performance of cucumber genotypes used in the current study Genotype Source Bitterness Fruit Colour Salient Features DC-70 IARI, New Delhi + light green Monoecious, resistant to leaf curl disease and Downy Mildew, fruits 13–16 cm long, black spine DC-773 IARI, New Delhi + dark green Monoecious, fruits 40–43 cm long, white spine DC-769 IARI, New Delhi ++ dark green Monoecious, fruits 35–40 cm long, black spine P-85 IARI, New Delhi + light green Monoecious, fruits 25–30 cm long, black spine Field screening of cucumber genotypes against ToLCNDV The research was conducted at the Orchard, Department of Vegetable Science, HC&RI, TNAU, Coimbatore. Field screening of four cucumber genotypes was conducted against ToLCNDV under epiphytotic condition during the cropping seasons of Rabi (February 2023) and Kharif (July 2023). During the period the natural ToLCNDV vector population pressure was increased due to elevated normal temperature under natural epiphytotic conditions and. Without using insecticides, all farm practices of cucumber cultivation were carried out in order to raise healthy crop. Each plant was given a score on 0–5 rating scale (Table 2 ) based on the area of the leaf covered by symptoms, in accordance with the rating methodology as reported by Islam et al. ( 2011 ). Table 2 Disease reaction scale (gradings) in cucumber for ToLCNDV disease Severity grade Symptom Rating scale Severity range Response value 0 No symptoms Highly Resistant (HR) 0% 0.00 1 Mild mosaic of young leaves covering < 10% of the surface Resistant (R) 1–10% 0.25 2 Mosaic of young leaves covering < 25% of the surface Moderately Resistant (MR) 11–25% 0.50 3 Mosaic of young leaves covering < 50% of the surface, blistering and puckering of leaves Moderately Susceptible (MS) 26–50% 0.75 4 Severe mosaic of young leaves covering 75% of the surface, distortion of leaves and stunting of the plants Highly Susceptible (HS) 76–100% 1.00 The coefficient of infection was calculated by multiplying % disease by the ‘response value’ assigned to each severity grade. Thus, the coefficient of infections combined the percentage of infection and its severity Disease scoring procedure Symptom evaluation was done by visual scoring of ToLCNDV symptoms at 28 dpi. Disease assessment was carried out for four genotypes viz. , DC 70, DC 773, DC 769 and P-85 evaluating their susceptibility to ToLCNDV disease. Per cent disease index was graded using a modified scale ranging from 0 to 5, as suggested by Islam et al. ( 2011 ) presented in Table 2 . Percent disease index of ToLCNDV as per the formula defined by McKinney ( 1923 ), which assisted comparison among genotypes. $$\text{P}\text{e}\text{r} \text{c}\text{e}\text{n}\text{t} \text{d}\text{i}\text{s}\text{e}\text{a}\text{s}\text{e} \text{i}\text{n}\text{d}\text{e}\text{x} \left(\text{P}\text{D}\text{I}\right)=\frac{\text{S}\text{u}\text{m} \text{o}\text{f} \text{a}\text{l}\text{l} \text{n}\text{u}\text{m}\text{e}\text{r}\text{i}\text{c}\text{a}\text{l} \text{r}\text{a}\text{t}\text{i}\text{n}\text{g}\text{s}}{\text{T}\text{o}\text{t}\text{a}\text{l} \text{n}\text{u}\text{m}\text{b}\text{e}\text{r} \text{o}\text{f} \text{p}\text{l}\text{a}\text{n}\text{t}\text{s} \text{o}\text{b}\text{s}\text{e}\text{r}\text{v}\text{e}\text{d}}\text{x}\frac{100}{\text{M}\text{a}\text{x}\text{i}\text{m}\text{u}\text{m} \text{d}\text{i}\text{s}\text{e}\text{a}\text{s}\text{e} \text{g}\text{r}\text{a}\text{d}\text{e}}$$ Depending on the percent disease index values, the genotypes were distinguished into various classes viz. , Highly Resistant (PDI% = 0), resistant (PDI% = 1–10), moderately resistant (PDI% =11–25), moderately susceptible (PDI% = 26–50), susceptible (PDI% = 51–75) and highly susceptible (PDI% = 76–100). To increase the vector population pressure, one row of ToLCNDV susceptible genotype DC 773 was planted along with every genotype in the experimental field. For ToLCNDV, the percentage of disease index and disease incidence were determined as follows. Percent disease incidence Cucumber genotypes were screened under both natural epiphytotic conditions and artificial screening to identify the resistant genotype for exploiting in further breeding programme. Per cent disease incidence was calculated by the formula given by Tiwari et al. (2012). $$\text{D}\text{i}\text{s}\text{e}\text{a}\text{s}\text{e} \text{i}\text{n}\text{c}\text{i}\text{d}\text{e}\text{n}\text{c}\text{e} \left(\text{%}\right)=\frac{\text{T}\text{o}\text{t}\text{a}\text{l} \text{n}\text{u}\text{m}\text{b}\text{e}\text{r} \text{o}\text{f} \text{p}\text{l}\text{a}\text{n}\text{t}\text{s} \text{i}\text{n}\text{f}\text{e}\text{c}\text{t}\text{e}\text{d} \text{w}\text{i}\text{t}\text{h} \text{T}\text{o}\text{L}\text{C}\text{N}\text{D}\text{V}}{\text{T}\text{o}\text{t}\text{a}\text{l} \text{n}\text{u}\text{m}\text{b}\text{e}\text{r} \text{o}\text{f} \text{p}\text{l}\text{a}\text{n}\text{t}\text{s} \text{o}\text{b}\text{s}\text{e}\text{r}\text{v}\text{e}\text{d}}\text{x}100$$ Agroinoculationand Artificial screening The ToLCNDV agro-infectious construct was obtained from Department of Plant Pathology, TNAU, Coimbatore and by the agroinoculation was carried out following the protocol described by Vignesh et al. ( 2023 ). Agrobacteriumtumefaciens containing recombinant plasmidsof DNA A, DNA B and β satellite of ToLCNDV grown in LB broth with an optical density (OD) of 1.0 at 600nm was used.To improve seed germination, four genotypes of seeds were submerged in sterile water for 48 hours. Ten days old seedlings were inoculated with liquid culture using the pinpricking technique. For the purpose of artificial virus inoculation, germinated seed hypocotyls were pinpricked under laminar air flow chamber. The following day, the pinpricked seeds were planted in pots which contained a mixture of autoclaved red soil and FYM (3:1) after being submerged in agro inoculation buffer for 14 hours at 37˚C in the dark. A total of 60 plants at the two leaves stage (10 days old) of cucumber seedlings of both resistant and susceptible genotypes were agroinfiltrated with ToLCNDV infectious clone. Stem inoculation around the developing nodal region of the stem used 30-gauge needle containing 20 µl of an Agrobacterium culture. Thereafter, both resistant and susceptible genotypes of agroinoculatedand control plants were grown in an insect-proof growth chamber with a photoperiod of 16 h/8 h (day and night), temperature 28 ± 2°C and 60% relative humidity depicted in (Fig. 1). All plants were observed regularly and leaf samples from each genotypes were collected from terminal part of both agroinoculated and control plants. Cucumber leaf samples preserved were stored at ˗80˚C for future experimental analysis. DNA isolation and PCR mediated amplification A specific degenerative primer GKNDV DNA-A was used to detect the presence of coat protein gene of ToLCNDV in all the agroinfiltrated leaf samples (Vignesh et al. 2023 ). The assay of ToLCNDV infection was assured by PCR amplification of leaf samples. The presence of DNA-A component was examined in both symptomatic and asymptomatic leaf samples of agroinoculated and control plants. In order to confirm the suspected virus PCR was carried out by utilising a pair of primers developed from coat protein gene area of a well-characterized ToLCNDV DNA-A. The coat protein gene of the ToLCNDV DNA-A genome was found using a specific degenerative primer, GKNDV DNA. For molecular validation of the presence or absence of ToLCNDV genome, PCR amplification was performed on all plant samples using the GKNDV DNA-A-F and GKNDV DNA-A-R primer sets that are unique to the ToLCNDV DNA-A. Four weeks after inoculation, approximately 100 mg of fresh apical leaves from four genotypes were harvested. Total genomic DNA was extracted from leaves exhibiting severe, mild and symptomless samples. Total DNA from leaf tissues were extracted by CTAB DNA extraction method as described by Doyle and Doyle (1990). The following reagents were used to produce the mixture for the PCR reaction: 20 µL of nuclease free water, 0.5 µL of primer forward (10 pM), 0.5 µL of primer reverse (10 pM), and 3.5 µL of 1 × AccuPower® PCR Mastermix (Bioneer).The PCR reaction setup was 94 ◦ C for 4 mins, 30 cycles of denaturation for 30 sec at 94 ◦ C, annealing for 30 sec at 58 ◦ C and extension for 1 min at 72 ◦ C (DNA A) reaction was finished with a final extension for 20 min at 72 ◦ C. To determine the amplicon size, the PCR products were resolved on a 1% agarose gel and stained with ethidium bromide. Sequence of ToLCNDV DNA- A specific primers used Forward primer (GKNDV DNA-A-F): 5’CGCAGGTTGTGGTTGAACTG 3’ (20 nt) Reverse primer (GKNDV DNA-A-R): 5’ GCAAAACAATGTGGGCTCGT 3’(20 nt) Statistical analysis The mean values of per cent disease index and disease incidence of each genotype were screened under natural field and artificially inoculated conditions were compared using Duncan's Multiple Range Test (DMRT) after the data had been statistically analyzed using SPSS Software version 16 and presented in table (Gomez and Gomez. 1984). Results and Discussion Field screening against ToLCNDV under natural condition To identify the source of resistance, four genotypes were sown and evaluated against ToLCNDV in natural epiphytotic conditions. Morphological characteristics of four genotypes were statistically analysed. Except DC 70, all genotypes showed expression of ToLCNDV incidence on 45 DAS. Based on the observed percent disease index (PDI), the screened genotypes showed a significant difference in response to ToLCNDV infection and disease incidence ranged from highly resistant to susceptible reactions, and there was a slight variation from the rabi to kharif seasons. Under natural field screening conditions, the ToLCNDV disease index varied from 0–75.00%among genotypes (Table 3 ).Results showed that genotype DC 773 recorded significantly highest disease index (75.00%) and incidence (87.50%) with the lowest yield of 1.06 kg/plant proved to be susceptible followed by DC-769 with 42.85% and 71.42% respectively with yield of 1.32 kg/plant (Table 4 ) expressed moderately susceptible reaction. Similarly Singh et al. ( 2024 ) observed that disease incidence in commercially cultivated sponge gourd varieties varied from 76.50–96.10% were proved to be susceptible to ToLCNDV under natural screening in the kharif season. P-85 showed 8.57 PDI and 28.57%incidence with a yield of 1.69 kg/plant proved to be resistant to ToLCNDV. DC-70 was found to be totally free from ToLCNDV symptoms with a yield of 2.01 kg/plant (Table 4 ) determined as highly resistant to ToLCNDV during Rabi season (February 2023). However, during Kharif season (July 2023) significantly highest disease index recorded in genotype DC 773 (65.71%) (Table 3 ) and incidence (85.00%) with the lowest yield of 1.10 kg/plant proved to be susceptible followed by DC -769 with 40.00% and 75.00% respectively(Table 3 ) with yield of 1.47 kg/plant (Table 5 ) expressed moderately susceptible. DC-70 and P-85 were found to be totally free from ToLCNDV symptoms with a yield of 2.19 and 1.89 kg/plant proved to be resistant to ToLCNDV. Likewise, field survey conducted in various bitter gourd cultivation areas of Coimbatore revealed symptoms such as mosaic, slight leaf curl and blistering with disease incidence value fluctuated from 65–80% (Nagendran et al. 2014 ; Vignesh et al. 2023 ) reported that mean disease incidence in ash gourd field survey was about 75% . Table 3 Response of the different genotypes used in field screening of ToLCNDV under epiphytotic conditions (Rabi and Kharif seasons) Genotypes Season Percent Disease Index (PDI) Percent Disease Incidence Coefficient of infection Disease reaction Symptoms observed DC-70 Rabi 0.00 (0.00 a ) 0.00 (0.00 a ) 0.00 Highly Resistant (HR) No symptoms Kharif 0.00 (0.00 a ) 0.00 (0.00 a ) 0.00 Highly Resistant (HR) No symptoms DC-773 Rabi 75.00 (60.00 d ) 87.50 (69.30 d ) 75.00 Susceptible (S) Severe mosaic, yellowing, curling of leaves and stunting of the plants Kharif 65.71 (54.16 c ) 85.00 (67.21 c ) 65.71 Susceptible (S) Severe mosaic, yellowing, curling of leaves and stunting of the plants DC-769 Rabi 42.85 (40.89 c ) 71.42 (57.68 c ) 32.13 Moderately Susceptible (MS) Mosaic of young leaves and slight yellowing of leaves Kharif 40.00 (39.23 b ) 75.00 (60.00 b ) 30.00 Moderately Susceptible (MS) Mosaic of young leaves and slight yellowing of leaves P-85 Rabi 8.57 (17.02 b ) 28.57 (32.31 b ) 21.4 Resistant(R) Mild mosaic of young leaves Kharif 0.00 (0.00 a ) 0.00 (0.00 a ) 0.00 Highly resistant (I) No symptoms Means in a column followed by superscript are significantly different by Duncans Multiple Range Test at P (0.05) Table 4 Morphological parameters of the rabi season Geno types No. of branches Fruit length (cm) Fruit girth (cm) Fruit weight (g) No. of fruits /plant Crop duration Days for first harvest Vine length (cm) Yield per plant (kg) DC-70 5.33 (13.35 a ) 19.10 (25.91 d ) 12.89 (21.04 a ) 210.12 (14.51 a ) 8.30 (16.74 b ) 93.00 (74.66 a ) 40.20 39.35 c ) 126.00 (11.25 c ) 2.01 (8.15 a ) DC-773 3.00 (9.97 d ) 29.10 (32.65 b ) 11.80 (20.09 b ) 211.56 (14.56 a ) 6.20 (14.42 d ) 78.70 (62.51 c ) 50.50 (45.29 a ) 110.98 (10.56 d ) 1.06 (5.91 d ) DC 769 3.80 (11.24 c ) 37.00 (37.46 a ) 12.01 (20.28 b ) 219.83 (14.84 a ) 7.12 (15.48 c ) 76.73 (61.16 c ) 47.42 (43.52 b ) 154.60 (12.45 b ) 1.32 (6.6 c ) P-85 4.40 (12.11 b ) 21.80 (27.83 c ) 9.80 (18.24 c ) 175.83 (13.28 b ) 9.40 (17.85 a ) 89.00 (70.63 b ) 48.00 (43.85 b ) 228.20 (15.12 a ) 1.69 (7.47 b ) Mean 4.13 26.75 11.63 204.34 7.76 84.36 46.53 154.945 1.52 SED 0.18 1.06 0.52 9.20 0.28 3.78 2.01 6.72 0.07 CD 0.05 0.38 2.29 1.12 19.96 0.61 8.19 4.36 14.57 0.15 Means in a column followed by superscript are significantly different by Duncans Multiple Range Test at P (0.05) From this study it is manifested that the genotype DC 70 of cucumber expressed stable resistance reaction against ToLCNDV under natural field epiphytotic conditions during both the growing seasons whereas P 85 was found to be highly resistant during Kharif season. According to Pandey et al. ( 2022 ) reported that all the Arya lines of Cucumis melo under study scored zero for disease scoring, designating them as highly resistant to ToLCNDV. Moreover, the ability of DC 70 genotype capable to grow profusely and produce high yield in both the rabi and kharif seasons as well as showed highly resistant response when challenged by an infectious ToLCNDV virus clone under glasshouse and most likely by a natural viral inoculum in an open field may offer an efficient way to induce a ToLCNDV highly resistant response while using less insecticides. The results of this study showed that rabi and kharif seasons had significantly highest mean values recorded for yield attributing parameters viz. ,number of branches (5.3; 5.50) (Table 4 & 5 ),crop duration (93.00 ; 95.00)showed in Table 4 & 5 , fruit girth (12.89 cm) in rabi season and superior mean values in terms of days for first harvest (40.20;45.87) (Table 4 , 5 ) which were considered desirable traits obtained in DC 70 genotype. In contrast, DC 769 genotype showed the significantly highest fruit length (37.00; 36.90 cm) (Table 4 , 5 ) and fruit weight (219.83; 37.45 g) (Table 4 , 5 ) and P-85 exhibited significantly highest number of fruits/vine (9.40; 10.67) and vine length (228.20; 231.33cm) (Table 4 , 5 ) and fruit girth (15.27 cm) in kharif respectively(Table 5 ). Mostly occurrence of various types of virus (both mono- and bipartite) and inherent mixed infections, variations in whitefly populations as well as primarily influenced by rainfall could have contributed Disease incidence in genotypes of cucumbers varied slightly among seasons (Maruthi et al. 2005 ).Out of four genotypes screened, significantly lowest mean values were recorded in number of branches (3.00; 3.40), vine length (110.98; 11.50 cm) (Table 4 , 5 )and number of fruits/plant resulted (6.20) (Table 4 ) in rabi season whereas kharif season showed fruit girth (11.99 cm) and crop duration (73.77) (Table 5 ) in DC 70 genotype respectively. DC 769 resulted crop duration (76.73) in rabi season and number of fruits/vine (6.20) in kharif season respectively. In rabi season, P-85 displayed the following fruit characteristics viz. , fruit girth (9.80cm), fruit weight (175.83; 177.17g) and fruit length (21.80; 20.07 cm) (Table 4 , 5 ). This result is in concordance with previous findings of Pandey et al. ( 2022 ) in melon; Singh et al. ( 2024 ) in field screening performance of sponge gourd. Table 5 Morphological parameters of the kharif season Geno types No. of branches Fruit length (cm) Fruit girth (cm) Fruit weight (g) No. of fruits /plant Crop duration Days for first harvest Vine length (cm) Yield per plant (kg) DC 70 5.50 (13.56 a ) 20.10 (26.64 c ) 15.10 (22.87 a ) 210.98 (14.54 b ) 10.00 (18.43 b ) 95.00 (77.08 a ) 45.87 (42.63 b ) 173.86 (13.2 b ) 2.19 (8.51 a ) DC 773 3.40 (10.63 d ) 36.23 (37.01 b ) 11.99 (20.26 b ) 221.89 (14.91 b ) 6.50 (14.77 c ) 73.77 (59.19 c ) 51.57 (45.9 a ) 112.50 (10.63 c ) 1.10 (6.02 d ) DC 769 4.00 (11.54 c ) 39.9 (39.17 a ) 12.8 (20.96 b ) 237.45 (15.43 a ) 6.20 (14.42 c ) 81.30 (64.38 b ) 49.66 (44.81 a ) 175.89 (13.28 b ) 1.47 (6.96 c ) P-85 4.67 (12.48 b ) 20.07 (26.62 c ) 15.27 (23.00 a ) 177.17 (13.33 c ) 10.67 (19.07 a ) 94.00 (75.82 a ) 49.67 (44.81 a ) 231.33 (15.23 a ) 1.89 (7.90 b ) Mean 4.39 29.08 13.79 211.87 8.34 86.02 49.19 173.40 1.66 SED 0.21 1.11 0.64 8.10 0.39 3.82 2.25 8.03 0.06 CD 0.05 0.46 2.40 1.39 17.58 0.85 8.28 4.80 17.42 0.13 Means in a column followed by superscript are significantly different by Duncans Multiple Range Test at P (0.05) Artificial screening against ToLCNDV by agroinoculation Globally vegetable crop production is seriously threatened by Tomato leaf curl New Delhi virus (ToLCNDV). Presently, it is common in India and has also been occurred in some countries like Pakistan, Bangladesh, and Thailand. ToLCNDV is becoming a serious threat to the production of cucurbit crops due to its host range extension, which is being supported by its evolution and the potential for a different mechanism of transmission (Juarez et al. 2019 ). ToLCNDV infected cucurbits shows in high economic losses among cucurbits. In an epidemic situations, the crops infected with ToLCNDV disease can cause cent per cent yield loss. Therefore, identifying ToLCNDV-resistant sources in other species of cucumber is crucial to mitigate the effects of this virus. As a result, intensive screening of a wide range of genetic resources is required to discover resistant sources for use in cucumber breeding programmes. An artificial screening study was carried out with four distinct genotypes of cucumber, to verify whether ToLCNDV was truly pathogenicity on above genotypes. Yamamoto et al. ( 2021 ) observed more severe symptoms of ToLCNDV-[ES-Alm-Cuc-16] in agroinoculated cucurbit plants, especially in melon and zucchini plants compared to field-grown plants probably due to inoculation during the cotyledon stage prior to the occurrence of true leaves. Artificial screening was done to confirm the resistance observed under field screening using four selected genotypes. Cucumber genotypes showed highly resistant to highly susceptible reactions under natural field study during rabi and kharif seasons were selected for artificial screening to confirm the resistance of the genotypes. Employing artificial screening systems allows for disease evaluation trials regardless of weather conditions that might be any period of time in the season (Kaur et al. 2021 ). In this study, four genotypes of cucumber were successfully agroinoculated with ToLCNDV, three genotypes displayed ToLCNDV symptoms and one genotype did not express any symptoms at all (Table 2 ). Differential symptom reactions against ToLCNDV was expressed though same concentration of inoculum was agroinoculated into each genotype during the agroinoculation process. Hanson et al. ( 2000 ) evaluated their potential for use in new region, south Indian resistant/tolerant tomato cultivars were artificially screened against the Bangladesh ToLCV. This was done because conventional breeding for ToLCNVD resistance is a slow and challenging procedure. Susceptible genotypes initially showed symptoms like slight yellowing of the leaves. Later, it was noticed that the apical leaves showing puckering, curling, and yellowing with mosaic symptoms. Stunting and leaf curling were also noted during severe stage of infection. Similar pattern of symptoms such as leaf curling, mosaic yellowing, and stunting were reported as serious pathogenicity to pumpkin, zucchini and melon as shown for other Mediterranean or Asian isolates and suggested that ToLCNDV had increased pathogenicity reported by Thuy et al.(2022). Symptoms, percent disease index, and percent disease incidence have also been provided in Table 6 & 7 . The genotypes reaction were recorded using the Percent Disease Index (PDI) calculation. The artificial screening results showed that both control and inoculated DC 70 plants on 28 dpi to be symptom less highly resistant reaction suggested that genotype could resist ToLCNDV infection than other genotypes. Symptomless highly resistant reaction of DC 70 might be due to genetic variability of the crop species which is crucial for the resistant genotype. Furthermore, different genetic background of genotypes, every genotype may perhaps various symptom expression properties for virus spread and infection. Infected plants expressed a typical disease symptoms at 28 dpi. Similarly, Islam et al. ( 2011 ) identified ToLCNDV-resistance in sponge gourd lines, DSG-6 and DSG-7 through sterilized virion inoculation in insect-proof net houses while Kaur et al. ( 2021 ) confirmed resistance in L. cylindrica and L. acutangula germplasms were recognized to have potential resistance to ToLCNDV. The disease index % of symptoms was significantly higher in DC-773 inoculated plants which expressed the highest PDI (92.00%) (Table 7 ) and highly susceptible reactions such as severe mosaic, yellowing, curling of leaves, and stunted plant, while the DC 773 control plants expressed the moderately susceptible reactions such as mosaic, yellowing and curling on a fewer leaves with PDI of 29.87% (Table 7 ). These symptoms were similar to those depicted for ToLCNDV infection on melon (Trisciuzzi et al. 2018 ). Based on the study, disease transmission qualities implied on changing behaviors and types of disease-causing capacity as well as the potential for wider host ranges and disease dissemination. These findings are consistent with earlier reports from Yamamoto et al. ( 2021 ) on cucumber, melon and zucchini and Mei et al. ( 2023 ) on Cucumis melo. In DC 769 inoculated plants PDI (52.50%) (Table 7 ) with susceptible reactions viz. , mosaic of young leaves, yellowing, distortion of leaves were observed while PDI (18.75%) (Table 7 ) in DC 769 control plants caused moderately susceptible reactions such as young leaf mosaic and mild yellowing of leaves. Results of this study also implied the susceptible reaction of cucumber plants, which concurrent with the report by Ruiz et al. ( 2017 ).DC 85 inoculated plants had PDI (22.91%) (Table 7 ) with moderately resistant viz. , mosaic of young leaves and resistant reactions viz. , mild mosaic of young leaves reached PDI (9.20%) in DC 85 control plants. The reasons for the variations in per cent disease incidence and index of ToLCNDV might be due to difference in the inoculum source, vector population, climatic conditions and geographic location. These findings were concurrent with earlier research on pumpkin plants studied by Dhillon et al. ( 2021 ). Among the four screened genotypes of inoculated and control plants percent disease incidence ranged from 0.00 to 93.30% (Table 7 ). DC 773 had significantly highest percent disease incidence, followed by DC 769 (73.00 and 20.00%) and P-85 (46.60 and 6.66%) (Table 6 ). Similarly, ridge gourd varieties such as RHRG-2, SVRGH-54, VRGH-2 and VRGH-336 were identified as highly susceptible to ToLCNDV via inoculation observed by Sohrab et al. ( 2013 ). In contrast, DC 70 had the lowest or no score at 28 dpi (0.00 & 0.00%) (Table 7 ), respectively. High temperature encouraged the proliferation of whiteflies, might be the cause for high disease incidence percentage in the field during the rabi season than kharif season.The corresponding trend in Luffa actangula per cent disease incidence was reported by Premchand et al. (2017); Parrella et al. ( 2017 ) in pumpkin plants. Moreover, investigation of seed transmission of ToLCNDV is crucial for potential quarantine measures to prevent virus spread into new geographical areas. Table 6 Reaction of genotypes for ToLCNDV under artificially inoculated condition Genotypes Inoculum Time taken for symptom expression Number of infected plants/agroinocuated plants Per cent Disease Incidence PCR of ToLCNDV DNA-A Virus recognition by PCR (%) DC-70 (V) DNA - A + B + β satellite 28 dpi 0/15 0.00 (0.00 a ) - 0.00 DC-70 (C) - 38 DAS 0/15 0.00 (0.00 a ) - 0.00 DC-773 (V) DNA - A + B + β satellite 28 dpi 14/15 93.30 (17.79 d ) + 93.3 DC-773 (C) - 38 DAS 5/15 40.00 (11.54 d ) + 33.33 DC 769 (V) DNA - A + B + β satellite 28 dpi 11/15 73.00 (15.68 c ) + 73.33 DC 769 (C) - 38 DAS 3/15 20.00 (8.13 c ) + 20.00 P-85 (V) DNA - A + B + β satellite 28 dpi 7/15 46.60 (12.47 b ) + 46.66 P-85 (C) - 38 DAS 1/15 6.66 (4.68 b ) + 6.66 dpi- days post inoculation DAS- Days after sowing Means in a column followed by superscript are significantly different by Duncans Multiple Range Test at P (0.05) Table 7 Response of cucumber genotypes against ToLCNDV under artificial screening by agroinoculation Genotypes Percent Disease Index Coefficient of infection Disease reaction Symptoms DC-70 (V) 0.00 (0.00 a ) 0.00 Highly Resistant (HR) No visible symptoms and normal growth DC-70 (C) 0.00 (0.00 a ) 0.00 Highly Resistant (HR) No visible symptoms and normal growth DC-773 (V) 92.00 (73.57 d ) 92.00 Highly Susceptible (HS) Severe mosaic, yellowing, curling of leaves and stunting of the plants DC-773 (C) 29.87 (33.13 d ) 22.40 Moderately Susceptible (MS) Mosaic of young leaves, curling and puckering of leaves DC 769 (V) 52.50 (46.43 c ) 52.50 Susceptible (S) Mosaic of young leaves, yellowing, distortion of leaves DC 769 (C) 18.75 (25.66 c ) 9.38 Moderately Susceptible (MS) Mosaic of young leaves and slight yellowing of leaves P-85 (V) 22.91 (28.60 b ) 11.45 Moderately Resistant (MR) Mosaic of young leaves P-85 (C) 9.20 (17.66 b ) 2.30 Resistant (R) Mild mosaic of young leaves Means in a column followed by superscript are significantly different by Duncans Multiple Range Test at P (0.05) Molecular confirmation of agroinoculated plants by PCR amplification The PCR analysis demonstrated that ToLCNDV infection was the cause of the symptoms displayed on several genotypes employed in artificial screening. At 28 dpi Cucumber genotypes inoculated with ToLCNDV expressed typical symptoms compared with control plants. In this study, only ToLCNDV infectious clone was used as positive control. Using a set of GKNDV DNA-A primers, DNA collected from both symptomatic and non-symptomatic leaf samples was subjected to PCR for a preliminary screening of ToLCNDV infection. The coat protein gene of ToLCNDV DNA-A was amplified using a primer pair of GKNDV DNA-A (40 nt). According to PCR results, the samples resulted positive for GKNDV DNA-A primer displayed amplification of DNA-Aband at an amplicon size of 630 bp was seen in symptomatic leaves of DC 773, 769 and P-85genotypesconfirmed the presence of ToLCNDV infection transmitted by Agrobacterium mediated agroinoculation were showed in Fig. 2a &2b .Likewise, molecular detection employing begomovirus-specific deng primers and coat protein gene primers revealed the ToLCNDV presence in bitter gourd samples reported by Kiran et al. (2021) and similar tendency on amplicon size of 630 bp in agroinocuated cucurbits crops for ToLCNDV coat protein DNA-A gene through conventional PCR was previously reported by Vignesh et al. ( 2023 ) in cucurbitaceous crops and. However, no such amplicon was found in symptomless leaf samples of DC 70 as confirmed through PCR assay. In PCR investigation, samples showing positive using degenerate primers indicated begomovirus infection. Similarly, Saha et al. (2014) confirmed begomovirus associated with tomato leaf curl disease in tomato samples from the Brahmaputra valley of Assam. By employing PCR amplification, the viral genome was recognized in all symptomatic plants infected with ToLCNDV. Out of 36leaf samples from four genotypes including both inoculated and control leaf samples were subjected to preliminary detection in PCR using GKNDV DNA-A primer which amplified for DNA-A. PCR analysis confirmed that 24 samples amplified CP gene of ToLCNDV DNA-A. Besides, integrating resistance in identified lines into disease management strategies, including vector control and cropping practices is an essential for sustaining resistance efficacy. Conclusion Four different genotypes of cucumber ( Cucumis sativus ) were screened for their resistance to ToLCNDV under both field epiphytotic and artificial inoculated conditions. Out of them the genotype DC-70 was found to be totally free from any visible symptoms and ToLCNDV under both natural field trials and artificial screening by agroinoculation under controlled environmental conditions. The novel genotype of cucumber DC-70 has proved to be resistant to ToLCNDV. ToLCNDV is the major production constraint experienced by growers in many countries and commercial cultivars resistant to this virus are currently unavailable. DC-70 act as a good source of ToLCNDV resistance that can be introgrossed into other cucumber cultivars. The identified resistant genotype DC-70 will serve as good candidate in breeding program for developing ToLCNDV-resistant cultivars in cucumber. Declarations Acknowledgment & Funding I would like to give my deepest thanks to the Department of Vegetable Science, Horticultural College and Research Institute, Tamil Nadu Agricultural University for providing me with the chance to do this research. Funding National Agricultural Science Fund (NASF), Indian Council of Agricultural Research, KAB-I, Pusa Campus, New Delhi-110012 Conflicts of interest The authors declare that there is no conflict of interest. Author Contribution E. N.Conducting research work and article writing, V. R. Chairmen, Seed collection and article correction , Advisory committee member, T.K. B.Research mentor, -G. K. Guide the ToLCNDV Screening and article correction, M. K. Advisory committee member, Crop Production guidance, -D. R. Statistical analysis . References Dhillon NP, Srimat S, Laenoi S, Bhunchoth A, Phuangrat B, Warin N, Kenyon L (2021) Resistance to three distinct Begomovirus species in the agro nomical superior tropical pumpkin line AVPU1426 developed at the world vegetable center. Agronomy, 11(6):1256. https://doi.org/10.3390/agronomy11061256. Fortes IM, Sa nchez-Campos S, Fiallo-Olive E, Dıaz-Pendon JA, Navas-Castillo J, Moriones E. A (2016) Novel strain of Tomato leaf curl New Delhi virus has spread to the Mediterranean basin. Viruses 8:307. https://doi.org/10.3390/v8110307. Gomez KA, Gomez AA (1984) Statistical procedures for agricultural research. John Wiley and Sons, New York, USA. Hanson PM, Bemacchi D, Green SK, Tanksley SD, Muniyappa V, Padmaja AS, Chen HM, Kuo G, Fang D, Chen JT (2000) Mapping a wild tomato introgression associated with tomato yellow leaf curl virus resistance in a cultivated tomato line. J. Am. Soc. Hortic. Sci. 125:15-20. https://doi.org/10.21273/JASHS.125.1.15 Islam S, Anilabh Das M, Verma M, Arya L, Mandal B, Tusar Kanti B, Sanjay Kumar L (2011) Screening of Luffa cylindrica Roem. for resistance against Tomato Leaf Curl New Delhi Virus, inheritance of resistance, and identification of SRAP markers linked to the single dominant resistance gene. The Journal of Horticultural Science and Biotechnology, 86(6): 661-667. https://doi.org/10.1080/14620316.2011.11512819. Juarez M, Rabadan, MP. Martínez LD, Tayahi M, Grande-Perez A, Gomez, P (2019) Natural Hosts and Genetic Diversity of the Emerging Tomato Leaf Curl New Delhi Virus in Spain. Front. Microbiol. 10:140. https://doi.org/10.3389/fmicb.2019.00140. Kaur M, Varalakshmi B, Pitchaimuthu M, Mahesha B (2021) Screening Luffa germplasm and advanced breeding lines for resistance to Tomato leaf curl New Delhi virus. Journal of General Plant Pathology, 87:287-294. https://doi.org/10.1007/s10327-021-01010-z. Kiran GVM, Nagaraju N, Girish TR, Ashwini BN. Molecular investigations reveal bitter gourd crop is more susceptible to tomato leaf curl New Delhi virus infection in diverse crop cultivation practices. 3 Biotech, 11:1-9. Malathi VG, Devi R, Chakraborty S, Biswas KK, Roy A, Venkataravanappa V, Mandal B (2017) Begomoviruses and their satellites occurring in India: distribution, diversity and pathogenesis. In: Mandal B, Rao G, Baranwal V, Jain R, editors. A century of plant virology in India. Singapore: Springer p. 75–177. DOI:10.1007/978-981-10-5672-7_5. Maruthi MN, Alam SN, Kader, KA, Rekha AR, Cork A, Colvin J (2005) Nucleotide sequencing, whitefly transmission, and screening tomato for resistance against two newly described begomoviruses in Bangladesh. Phytopathology, 95(12):1472-1481. https://doi.org /10.1094/PHYTO-95-1472 McKinney HH (1923) Investigations of the rosette disease of wheat and its control. Journal of Agricultural Research. 23(7-12):771. Mei Y, Cai L, Wang Y, Li F, Yang X, Yang J, Zhou X (2023) Molecular characterization and pathogenicity of an infectious clone of tomato leaf curl New Delhi virus isolate infecting Cucumis melo . Stress Biology, 3(1):51. https://doi.org/10.1007/s44154-023-00128-8. Nagendran K, Kumar SM, Manoranjitham SK, Karthikeyan G (2014) Molecular detection and characterization of Tomato leaf curl New Delhi virus causing mosaic disease on bitter gourd in Tamil Nadu, India. Trends in Biosciences. 7(23):3925-3931. https://doi.org/10.1007/s13337-017-0403-7. Pandey A, Ranjan P, Malav PK, Ranjan JK, Ghosh A, Mandal S, Kumar A (2022) Characterization and evaluation of Arya melon ( Cucumis melo ) for agromorphological traits and screening against ToLCNDV. The Indian Journal of Agricultural Sciences. 92(11):1406-1409. https://doi.org/10.56093/ijas.v92i11.125245 Panno S, Iacono G, Davino M, Marchione S, Zappardo V, Bella P, Tomassoli L, Accotto G, Davino S. (2016) First report of Tomato leaf curl New Delhi virus affecting zucchini squash in an important horticultural area of southern Italy. New Dis. Rep. 33:6. http://dx. doi.org/10.5197/j.2044-0588.2016.033.006 Parrella G, Troiano E, Formisano G, Accotto GP, Giorgini M. (2017) First report of Tomato leaf curl New Delhi virus associated with severe mosaic of pumpkin in Italy. Plant Dis. 102:459 https://doi.org/10.1094/PDIS-07-17-0940-PDN Patil CV, Ramdas SV, Premchand U, Shankarappa KS (2017) Survey, symptomatology, transmission, host range and characterization of begomovirus associated with yellow mosaic disease of ridge gourd in southern India. Virus disease. 28(2):146–155. https://doi.org/ 10.1007/s13337-017-0376-6. Prabhandakavi P, Kumar R, Palicherla SR, E R, Pinnamaneni R (2018) Occurrence and molecular detection of bipartite begomovirus on tomato in Southern India. Arch Phytopathol Plant Protect. 51(17-18):951–955. https://doi.org/10.1080 /032 3540 8.201 8.1541622 Ruiz L, Simon A, Velasco L, Janssen D (2017) Biological characterization of Tomato leaf curl New Delhi virus from Spain. Plant Pathology. 66(3):376-382. https://doi. org/10.1111/ppa.12587. Saez C, Esteras C, Martinez C, Ferriol M, Dhillon NPS, Lopez C, Pico B (2017) Resistance to tomato leaf curl New Delhi virus in melon is controlled by a major QTL located in chromosome 11. Plant Cell Rep. 36:1571–1584. https://doi.org/10.4038/jnsfsr.v42i3.7400. Singh J, Munshi AD, Singh D, Meena BR, Singh AK, Nagar A, Mahajani K (2024) Identification of new stable resistant sources and assessing agro-morphological performance of sponge gourd germplasm against Tomato Leaf curl New Delhi Virus incidence. Frontiers in Plant Science. 15:1373352. https://doi.org /10.3389/fpls. 2024. 1373352. Sivalingam PN, Malathi VG, Varma A (2010) Molecular diversity of DNA-β associated with tomato leaf curl disease in India. Arch. Virol. 155:757-764. https://doi.org /10.100 7/s00705-010-0634-z. Sohrab SS, Karim S, Varma A, Abuzenadah AM, Chaudhary AG, Damanhouri GA, Mandal BM (2013) Characterization of Tomato Leaf Curl New Delhi Virus infecting cucurbits: Evidence for sap transmission in a host specific manner. African journal of Biotechnology.12(32). https://doi.org/10.5897/AJB2013.12012. Srivastava KM, Hallan V, Raizada RK, Chandra G, Singh BP, Sane PV (1995) Molecular cloning of Indian tomato leaf curl virus genome following a simple method of concentrating the supercoiled replicative form of viral DNA. J. Virol. Methods. 51(2-3):297–304. https://doi.org/10.1016/0166-0934(94)00122-W Tiwari N, Singh VB, Sharma PK, Malathi VG (2013) Tomato leaf curl Joydebpur virus: a monopartite-begomovirus causing severe leaf curl in tomato in West Bengal. Arch. Virol. 158:1-10. https://doi.org/10.1007/s00705-012-1440-6 Trisciuzzi N, Silletti MR, Gallitelli D, Spano R (2018) First detection of tomato leaf curl New Delhi virus in melon and zucchini squash in southern Italy. J Plant Pathol. 100:149. https://doi.org/10.1007/s42161-018-0038-6 Venkataravanappa V, Reddy LC, Shankarappa K, Reddy MK (2019) Association of Tomato Leaf Curl New Delhi Virus, Beta satellite, and Alpha satellite with Mosaic Disease of Spine Gourd (Momordica dioica Roxb.Willd) in India. Iran J Biotechnol. 17(1):17. https://doi.org/10.21859/ijb.2134. Vignesh S, Renukadevi P, Nagendran K, Senthil N, Kumar RV, SwarnaPriya R, Karthikeyan, GA (2023) Distinct strain of tomato leaf curl New Delhi virus that causes mosaic disease in ash gourd and other cucurbitaceous crops. Frontiers in Microbiology. 14:1268333. https://doi.org/10.3389/fmicb.2023.1268333 Thuy TB, AamirLal, Phuong THo, Elisa Troiano, Giuseppe Parrella, Eui-JoonKil, Sukchan Lee (2022) Different infectivity of Mediterranean and Southern Asian tomato leaf curl New Delhi virus isolates in cucurbit crops. Plants. 11 (5):704. https://doi.org/10.3390/plants11050704 Yamamoto H, Wakita Y, Kitaoka T, Fujishiro K, Kesumawati E, Koeda S (2021) Southeast Asian isolate of the tomato leaf curl New Delhi virus shows higher pathogenicity against tomato and cucurbit crops compared to that of the Mediterranean isolate. The Horticulture Journal. 90(3):314-325. https://doi.org/10.2503/hortj.UTD-269. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4621625","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":325370914,"identity":"a76bfd91-84e9-4ad4-b947-29bfc2c93ac4","order_by":0,"name":"Naveena Elango","email":"","orcid":"","institution":"Horticultural College and Research Institute, Tamil Nadu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Naveena","middleName":"","lastName":"Elango","suffix":""},{"id":325370915,"identity":"97ab4eb6-21e4-49a4-bf0d-1254927fc245","order_by":1,"name":"Rajasree Venkatachalam","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJklEQVRIie3PsUrDQBjA8QsfXJePdk1J8BkOAqkitK+SEMiUFKVjxQqCU+gc3yJTQXA4CTbL4RxwkkAGQSgEakERE41DIQm4Cd5/OO6O+x13hMhkfzFeDUgIq9cWI1DtqfpvCLUqgt2E7BFk9TXN9R853ez08WSkxXfZ6e14OlK94jk9O0TSi++jBjJ8sOA6QMe+WbqOEebO7Cj0V8feunwYum7aQJggQBDBYgJNDTnYUeqvDI+WREWzjSjvuJgwMXh9Q74oiZcb3kc3AcRYiQRSQB5XBDL/qp0MhXIJOiZ2JKihhTyZMZGb4C9VpC1/6QuIlZdgXj4MnooTPp+yxMkKb3t+MOjF6yZCiHJBlOB7CvUWVb/GxuM/7fYJbDpPy2Qy2X/rE1IKYpvf9qU0AAAAAElFTkSuQmCC","orcid":"","institution":"Horticultural College and Research Institute, Tamil Nadu Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Rajasree","middleName":"","lastName":"Venkatachalam","suffix":""},{"id":325370916,"identity":"23fde767-ca74-486f-a3f3-4fd580c24c0c","order_by":2,"name":"Behara Tusar Kanti","email":"","orcid":"","institution":"Indian Council of Agricultural Research- Indian Institute of Horticultural Research","correspondingAuthor":false,"prefix":"","firstName":"Behara","middleName":"Tusar","lastName":"Kanti","suffix":""},{"id":325370917,"identity":"70dca3cb-58d1-4268-bdbd-17ea13ae1478","order_by":3,"name":"Karthikeyan Gandhi","email":"","orcid":"","institution":"Tamil Nadu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Karthikeyan","middleName":"","lastName":"Gandhi","suffix":""},{"id":325370918,"identity":"6eccaabf-a8b3-4f22-b43b-ae21359e34dc","order_by":4,"name":"Kavitha Murugavel","email":"","orcid":"","institution":"Horticultural College and Research Institute, Tamil Nadu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Kavitha","middleName":"","lastName":"Murugavel","suffix":""},{"id":325370919,"identity":"60a6d530-1569-4df5-b48a-0db29e06a0d6","order_by":5,"name":"Rameshkumar Durai","email":"","orcid":"","institution":"SRM College of Agricultural Sciences, SRM Institute of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Rameshkumar","middleName":"","lastName":"Durai","suffix":""}],"badges":[],"createdAt":"2024-06-22 11:08:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4621625/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4621625/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60469040,"identity":"ec3fade5-03c4-4f3b-8290-78b39459abce","added_by":"auto","created_at":"2024-07-17 06:14:00","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":87040,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4621625/v1/4fee7af1d97acde27cb09d39.jpeg"},{"id":60469041,"identity":"aec0f03c-9e52-4a3c-8a2b-78f43826742b","added_by":"auto","created_at":"2024-07-17 06:14:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":137359,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4621625/v1/cf707f90857cfadc16a02bda.png"},{"id":60693145,"identity":"5624171b-4750-42e4-b149-270f24b7be17","added_by":"auto","created_at":"2024-07-19 15:30:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1258949,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4621625/v1/28eb7654-e132-4e0c-8c2a-e28411980ee7.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular confirmation of ToLCNDV resistance in cucumber (Cucumis sativus L.) genotypes through agroinoculation and field screening","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCucumber (\u003cem\u003eCucumis sativs\u003c/em\u003e L.) is native to India, is a widely consumed fresh market vegetable that is used in many different dishes. Being a highly cross-pollinated crop, cucumber is monoecious in nature and prefers warm, sunny weather for optimal growth and development. Nowadays, the foremost constraint in cucurbit cultivation is viral disease caused by globalization and climatic variations speed up their transmission.\u003c/p\u003e \u003cp\u003eThe major infectious agents associated with cucurbits include Zucchini yellow mosaic virus (ZYMV), Cucumber mosaic virus (CMV), Watermelon bud necrosisvirus (WBNV) and Tomato leaf curl New Delhi virus (ToLCNDV). Among them, the largest general member of the Geminiviridae family, the Begomovirus, is posing a serious threat to cucurbitaceous crops in India. The geminivirus is transmitted by whiteflies (\u003cem\u003eBemisia tabaci\u003c/em\u003e) is the cause of the viral disease known as tomato leaf curl New Delhi virus (ToLCNDV). Since 20th century, the begomovirus in cucurbits became a significant problem in India, resulting in 50% loss in northern states of India (Tripathi and Verma. 2017). ToLCNDV was first identified in India during 1995 as a variation of the Tomato yellow leaf curl virus (TYLCV) by (Srivastava et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). Since 2012, ToLCNDV have been posing serious threat to the major cucurbitaceous crops (Juarez et al. 2014). Depending on the nature of genome present, this virus is bipartite contains two 2.6\u0026ndash;2.7 kb circular single-stranded DNA strands, known as DNA-A and DNA-B, which are encapsulated in geminate particles and necessary for fundamental viral operations (Fortes et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In general, beta satellite and monopartite begomovirus are linked however, a recent study also shown that beta satellite and bipartite begomovirus are also associated (Venkataravanappa et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). It is also known that beta satellite plays significant influence on the host range of the associated begomovirus.\u003c/p\u003e \u003cp\u003eOn the other hand, ToLCNDV has been rapidly expanding its host range and reaching new geographic areas in recent years (Malathi et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). However, a recent report shows that it also infects tomato (Prabhandakavi et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), chayotes and cucurbits (Patil et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) in the southern region of the country. This virus was reported in Spain in 2013 in the cities of Almerna and Cartagena (Murcia) and it primarily affects zucchini squash among other cucurbits. ToLCNDV has caused substantial harm to a variety of crops, particularly cucurbits, such as melons. In central Spain, its impact on open-field melon production has been particularly severe with reported losses reaching as high as 20% (Saez et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Disease incidence embrace greater significance results in diminished fruit yield. The objective of this study was to identify sources of ToLCNDV resistant genotype in \u003cem\u003eC. sativus\u003c/em\u003e through natural and artificial screening. Therefore, four genotypes were selected and screened for resistance to Tomato leaf curl New Delhi virus.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant materials\u003c/h2\u003e \u003cp\u003eCucumber genotypes including DC-70, DC-773, DC-769 and P-85 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were used as plant materials for this experiment. Samples of infected plants exhibiting different ToLCNDV symptoms such as mosaic, yellowing, upward curling, puckering and stunting were randomly collected and brought to laboratory for molecular analysis. For every genotype disease index and incidence were computed and reported as percentage.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSources and performance of cucumber genotypes used in the current study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBitterness\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFruit Colour\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSalient Features\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC-70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIARI, New Delhi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003elight green\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMonoecious, resistant to leaf curl disease and Downy Mildew, fruits 13\u0026ndash;16 cm long, black spine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC-773\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIARI, New Delhi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003edark green\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMonoecious, fruits 40\u0026ndash;43 cm long, white spine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC-769\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIARI, New Delhi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e++\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003edark green\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMonoecious, fruits 35\u0026ndash;40 cm long, black spine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP-85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIARI, New Delhi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003elight green\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMonoecious, fruits 25\u0026ndash;30 cm long, black spine\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eField screening of cucumber genotypes against ToLCNDV\u003c/h2\u003e \u003cp\u003eThe research was conducted at the Orchard, Department of Vegetable Science, HC\u0026amp;RI, TNAU, Coimbatore. Field screening of four cucumber genotypes was conducted against ToLCNDV under epiphytotic condition during the cropping seasons of Rabi (February 2023) and Kharif (July 2023). During the period the natural ToLCNDV vector population pressure was increased due to elevated normal temperature under natural epiphytotic conditions and. Without using insecticides, all farm practices of cucumber cultivation were carried out in order to raise healthy crop. Each plant was given a score on 0\u0026ndash;5 rating scale (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) based on the area of the leaf covered by symptoms, in accordance with the rating methodology as reported by Islam et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDisease reaction scale (gradings) in cucumber for ToLCNDV disease\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSeverity grade\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSymptom\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRating scale\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSeverity range\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eResponse value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo symptoms\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHighly Resistant (HR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMild mosaic of young leaves covering\u0026thinsp;\u0026lt;\u0026thinsp;10% of the surface\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eResistant (R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u0026ndash;10%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMosaic of young leaves covering\u0026thinsp;\u0026lt;\u0026thinsp;25% of the surface\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eModerately Resistant (MR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11\u0026ndash;25%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMosaic of young leaves covering\u0026thinsp;\u0026lt;\u0026thinsp;50% of the surface, blistering and puckering of leaves\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eModerately Susceptible (MS)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e26\u0026ndash;50%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSevere mosaic of young leaves covering\u0026thinsp;\u0026lt;\u0026thinsp;75% of the surface, distortion of leaves\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSusceptible (S)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e51\u0026ndash;75%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSevere mosaic of young leaves covering\u0026thinsp;\u0026gt;\u0026thinsp;75% of the surface, distortion of leaves and stunting of the plants\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHighly Susceptible (HS)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e76\u0026ndash;100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe coefficient of infection was calculated by multiplying % disease by the \u0026lsquo;response value\u0026rsquo; assigned to each severity grade. Thus, the coefficient of infections combined the percentage of infection and its severity\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eDisease scoring procedure\u003c/h2\u003e \u003cp\u003eSymptom evaluation was done by visual scoring of ToLCNDV symptoms at 28 dpi. Disease assessment was carried out for four genotypes \u003cem\u003eviz.\u003c/em\u003e, DC 70, DC 773, DC 769 and P-85 evaluating their susceptibility to ToLCNDV disease. Per cent disease index was graded using a modified scale ranging from 0 to 5, as suggested by Islam et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Percent disease index of ToLCNDV as per the formula defined by McKinney (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1923\u003c/span\u003e), which assisted comparison among genotypes.\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\text{P}\\text{e}\\text{r} \\text{c}\\text{e}\\text{n}\\text{t} \\text{d}\\text{i}\\text{s}\\text{e}\\text{a}\\text{s}\\text{e} \\text{i}\\text{n}\\text{d}\\text{e}\\text{x} \\left(\\text{P}\\text{D}\\text{I}\\right)=\\frac{\\text{S}\\text{u}\\text{m} \\text{o}\\text{f} \\text{a}\\text{l}\\text{l} \\text{n}\\text{u}\\text{m}\\text{e}\\text{r}\\text{i}\\text{c}\\text{a}\\text{l} \\text{r}\\text{a}\\text{t}\\text{i}\\text{n}\\text{g}\\text{s}}{\\text{T}\\text{o}\\text{t}\\text{a}\\text{l} \\text{n}\\text{u}\\text{m}\\text{b}\\text{e}\\text{r} \\text{o}\\text{f} \\text{p}\\text{l}\\text{a}\\text{n}\\text{t}\\text{s} \\text{o}\\text{b}\\text{s}\\text{e}\\text{r}\\text{v}\\text{e}\\text{d}}\\text{x}\\frac{100}{\\text{M}\\text{a}\\text{x}\\text{i}\\text{m}\\text{u}\\text{m} \\text{d}\\text{i}\\text{s}\\text{e}\\text{a}\\text{s}\\text{e} \\text{g}\\text{r}\\text{a}\\text{d}\\text{e}}$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eDepending on the percent disease index values, the genotypes were distinguished into various classes \u003cem\u003eviz.\u003c/em\u003e, Highly Resistant (PDI% = 0), resistant (PDI% = 1\u0026ndash;10), moderately resistant (PDI% =11\u0026ndash;25), moderately susceptible (PDI% = 26\u0026ndash;50), susceptible (PDI% = 51\u0026ndash;75) and highly susceptible (PDI% = 76\u0026ndash;100).\u003c/p\u003e \u003cp\u003eTo increase the vector population pressure, one row of ToLCNDV susceptible genotype DC 773 was planted along with every genotype in the experimental field. For ToLCNDV, the percentage of disease index and disease incidence were determined as follows.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003ePercent disease incidence\u003c/h2\u003e \u003cp\u003eCucumber genotypes were screened under both natural epiphytotic conditions and artificial screening to identify the resistant genotype for exploiting in further breeding programme. Per cent disease incidence was calculated by the formula given by Tiwari et al. (2012).\u003cdiv id=\"Equb\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equb\" name=\"EquationSource\"\u003e\n$$\\text{D}\\text{i}\\text{s}\\text{e}\\text{a}\\text{s}\\text{e} \\text{i}\\text{n}\\text{c}\\text{i}\\text{d}\\text{e}\\text{n}\\text{c}\\text{e} \\left(\\text{%}\\right)=\\frac{\\text{T}\\text{o}\\text{t}\\text{a}\\text{l} \\text{n}\\text{u}\\text{m}\\text{b}\\text{e}\\text{r} \\text{o}\\text{f} \\text{p}\\text{l}\\text{a}\\text{n}\\text{t}\\text{s} \\text{i}\\text{n}\\text{f}\\text{e}\\text{c}\\text{t}\\text{e}\\text{d} \\text{w}\\text{i}\\text{t}\\text{h} \\text{T}\\text{o}\\text{L}\\text{C}\\text{N}\\text{D}\\text{V}}{\\text{T}\\text{o}\\text{t}\\text{a}\\text{l} \\text{n}\\text{u}\\text{m}\\text{b}\\text{e}\\text{r} \\text{o}\\text{f} \\text{p}\\text{l}\\text{a}\\text{n}\\text{t}\\text{s} \\text{o}\\text{b}\\text{s}\\text{e}\\text{r}\\text{v}\\text{e}\\text{d}}\\text{x}100$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eAgroinoculationand Artificial screening\u003c/h2\u003e \u003cp\u003eThe ToLCNDV agro-infectious construct was obtained from Department of Plant Pathology, TNAU, Coimbatore and by the agroinoculation was carried out following the protocol described by Vignesh et al. (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003cem\u003eAgrobacteriumtumefaciens\u003c/em\u003e containing recombinant plasmidsof DNA A, DNA B and β satellite of ToLCNDV grown in LB broth with an optical density (OD) of 1.0 at 600nm was used.To improve seed germination, four genotypes of seeds were submerged in sterile water for 48 hours. Ten days old seedlings were inoculated with liquid culture using the pinpricking technique. For the purpose of artificial virus inoculation, germinated seed hypocotyls were pinpricked under laminar air flow chamber. The following day, the pinpricked seeds were planted in pots which contained a mixture of autoclaved red soil and FYM (3:1) after being submerged in agro inoculation buffer for 14 hours at 37˚C in the dark.\u003c/p\u003e \u003cp\u003eA total of 60 plants at the two leaves stage (10 days old) of cucumber seedlings of both resistant and susceptible genotypes were agroinfiltrated with ToLCNDV infectious clone. Stem inoculation around the developing nodal region of the stem used 30-gauge needle containing 20 \u0026micro;l of an \u003cem\u003eAgrobacterium\u003c/em\u003e culture. Thereafter, both resistant and susceptible genotypes of agroinoculatedand control plants were grown in an insect-proof growth chamber with a photoperiod of 16 h/8 h (day and night), temperature 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C and 60% relative humidity depicted in (Fig.\u0026nbsp;1). All plants were observed regularly and leaf samples from each genotypes were collected from terminal part of both agroinoculated and control plants. Cucumber leaf samples preserved were stored at ˗80˚C for future experimental analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDNA isolation and PCR mediated amplification\u003c/h2\u003e \u003cp\u003eA specific degenerative primer GKNDV DNA-A was used to detect the presence of coat protein gene of ToLCNDV in all the agroinfiltrated leaf samples (Vignesh et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The assay of ToLCNDV infection was assured by PCR amplification of leaf samples. The presence of DNA-A component was examined in both symptomatic and asymptomatic leaf samples of agroinoculated and control plants. In order to confirm the suspected virus PCR was carried out by utilising a pair of primers developed from coat protein gene area of a well-characterized ToLCNDV DNA-A. The coat protein gene of the ToLCNDV DNA-A genome was found using a specific degenerative primer, GKNDV DNA. For molecular validation of the presence or absence of ToLCNDV genome, PCR amplification was performed on all plant samples using the GKNDV DNA-A-F and GKNDV DNA-A-R primer sets that are unique to the ToLCNDV DNA-A.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFour weeks after inoculation, approximately 100 mg of fresh apical leaves from four genotypes were harvested. Total genomic DNA was extracted from leaves exhibiting severe, mild and symptomless samples. Total DNA from leaf tissues were extracted by CTAB DNA extraction method as described by Doyle and Doyle (1990). The following reagents were used to produce the mixture for the PCR reaction: 20 \u0026micro;L of nuclease free water, 0.5 \u0026micro;L of primer forward (10 pM), 0.5 \u0026micro;L of primer reverse (10 pM), and 3.5 \u0026micro;L of 1 \u0026times; AccuPower\u0026reg; PCR Mastermix (Bioneer).The PCR reaction setup was 94\u003csup\u003e◦\u003c/sup\u003eC for 4 mins, 30 cycles of denaturation for 30 sec at 94\u003csup\u003e◦\u003c/sup\u003eC, annealing for 30 sec at 58\u003csup\u003e◦\u003c/sup\u003eC and extension for 1 min at 72\u003csup\u003e◦\u003c/sup\u003eC (DNA A) reaction was finished with a final extension for 20 min at 72\u003csup\u003e◦\u003c/sup\u003eC. To determine the amplicon size, the PCR products were resolved on a 1% agarose gel and stained with ethidium bromide.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eSequence of ToLCNDV DNA- A specific primers used\u003c/h2\u003e \u003cp\u003eForward primer (GKNDV DNA-A-F): 5\u0026rsquo;CGCAGGTTGTGGTTGAACTG 3\u0026rsquo; (20 nt)\u003c/p\u003e \u003cp\u003eReverse primer (GKNDV DNA-A-R): 5\u0026rsquo; GCAAAACAATGTGGGCTCGT 3\u0026rsquo;(20 nt)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe mean values of per cent disease index and disease incidence of each genotype were screened under natural field and artificially inoculated conditions were compared using Duncan's Multiple Range Test (DMRT) after the data had been statistically analyzed using SPSS Software version 16 and presented in table (Gomez and Gomez. 1984).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results and Discussion","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eField screening against ToLCNDV under natural condition\u003c/h2\u003e \u003cp\u003eTo identify the source of resistance, four genotypes were sown and evaluated against ToLCNDV in natural epiphytotic conditions. Morphological characteristics of four genotypes were statistically analysed. Except DC 70, all genotypes showed expression of ToLCNDV incidence on 45 DAS. Based on the observed percent disease index (PDI), the screened genotypes showed a significant difference in response to ToLCNDV infection and disease incidence ranged from highly resistant to susceptible reactions, and there was a slight variation from the rabi to kharif seasons. Under natural field screening conditions, the ToLCNDV disease index varied from 0\u0026ndash;75.00%among genotypes (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).Results showed that genotype DC 773 recorded significantly highest disease index (75.00%) and incidence (87.50%) with the lowest yield of 1.06 kg/plant proved to be susceptible followed by DC-769 with 42.85% and 71.42% respectively with yield of 1.32 kg/plant (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) expressed moderately susceptible reaction. Similarly Singh et al. (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) observed that disease incidence in commercially cultivated sponge gourd varieties varied from 76.50\u0026ndash;96.10% were proved to be susceptible to ToLCNDV under natural screening in the kharif season. P-85 showed 8.57 PDI and 28.57%incidence with a yield of 1.69 kg/plant proved to be resistant to ToLCNDV. DC-70 was found to be totally free from ToLCNDV symptoms with a yield of 2.01 kg/plant (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) determined as highly resistant to ToLCNDV during Rabi season (February 2023). However, during Kharif season (July 2023) significantly highest disease index recorded in genotype DC 773 (65.71%) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) and incidence (85.00%) with the lowest yield of 1.10 kg/plant proved to be susceptible followed by DC -769 with 40.00% and 75.00% respectively(Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) with yield of 1.47 kg/plant (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) expressed moderately susceptible. DC-70 and P-85 were found to be totally free from ToLCNDV symptoms with a yield of 2.19 and 1.89 kg/plant proved to be resistant to ToLCNDV. Likewise, field survey conducted in various bitter gourd cultivation areas of Coimbatore revealed symptoms such as mosaic, slight leaf curl and blistering with disease incidence value fluctuated from 65\u0026ndash;80% (Nagendran et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Vignesh et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) reported that mean disease incidence in ash gourd field survey was about 75% .\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eResponse of the different genotypes used in field screening of ToLCNDV under epiphytotic conditions (Rabi and Kharif seasons)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotypes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSeason\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePercent Disease Index\u003c/p\u003e \u003cp\u003e(PDI)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePercent Disease Incidence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCoefficient of infection\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDisease reaction\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSymptoms observed\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDC-70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003cp\u003e(0.00\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003cp\u003e(0.00\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHighly Resistant (HR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNo symptoms\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKharif\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003cp\u003e(0.00\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003cp\u003e(0.00\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHighly Resistant (HR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNo symptoms\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDC-773\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e75.00\u003c/p\u003e \u003cp\u003e(60.00\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e87.50\u003c/p\u003e \u003cp\u003e(69.30\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e75.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSusceptible (S)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSevere mosaic, yellowing, curling of leaves and stunting of the plants\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKharif\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e65.71\u003c/p\u003e \u003cp\u003e(54.16\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e85.00\u003c/p\u003e \u003cp\u003e(67.21\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e65.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSusceptible (S)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSevere mosaic, yellowing, curling of leaves and stunting of the plants\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDC-769\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e42.85\u003c/p\u003e \u003cp\u003e(40.89\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e71.42\u003c/p\u003e \u003cp\u003e(57.68\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e32.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eModerately Susceptible (MS)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMosaic of young leaves and slight yellowing of leaves\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKharif\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40.00\u003c/p\u003e \u003cp\u003e(39.23\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e75.00\u003c/p\u003e \u003cp\u003e(60.00\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e30.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eModerately Susceptible (MS)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMosaic of young leaves and slight yellowing of leaves\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP-85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8.57\u003c/p\u003e \u003cp\u003e(17.02\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e28.57\u003c/p\u003e \u003cp\u003e(32.31\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e21.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eResistant(R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMild mosaic of young leaves\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKharif\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003cp\u003e(0.00\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003cp\u003e(0.00\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHighly resistant (I)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNo symptoms\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eMeans in a column followed by superscript are significantly different by Duncans Multiple Range Test at P (0.05)\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMorphological parameters of the rabi season\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGeno\u003c/p\u003e \u003cp\u003etypes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo. of branches\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFruit length (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFruit girth (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFruit weight (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNo. of fruits /plant\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCrop duration\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eDays for first harvest\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eVine length (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eYield per plant (kg)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDC-70\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.33\u003c/p\u003e \u003cp\u003e(13.35\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19.10\u003c/p\u003e \u003cp\u003e(25.91\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12.89\u003c/p\u003e \u003cp\u003e(21.04\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e210.12\u003c/p\u003e \u003cp\u003e(14.51\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8.30\u003c/p\u003e \u003cp\u003e(16.74\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e93.00\u003c/p\u003e \u003cp\u003e(74.66\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e40.20\u003c/p\u003e \u003cp\u003e39.35\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e126.00\u003c/p\u003e \u003cp\u003e(11.25\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.01\u003c/p\u003e \u003cp\u003e(8.15\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDC-773\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.00\u003c/p\u003e \u003cp\u003e(9.97\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e29.10\u003c/p\u003e \u003cp\u003e(32.65\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.80\u003c/p\u003e \u003cp\u003e(20.09\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e211.56\u003c/p\u003e \u003cp\u003e(14.56\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.20\u003c/p\u003e \u003cp\u003e(14.42\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e78.70\u003c/p\u003e \u003cp\u003e(62.51\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e50.50\u003c/p\u003e \u003cp\u003e(45.29\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e110.98\u003c/p\u003e \u003cp\u003e(10.56\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.06\u003c/p\u003e \u003cp\u003e(5.91\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDC 769\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.80\u003c/p\u003e \u003cp\u003e(11.24\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e37.00\u003c/p\u003e \u003cp\u003e(37.46\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12.01\u003c/p\u003e \u003cp\u003e(20.28\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e219.83\u003c/p\u003e \u003cp\u003e(14.84\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.12\u003c/p\u003e \u003cp\u003e(15.48\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e76.73\u003c/p\u003e \u003cp\u003e(61.16\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e47.42\u003c/p\u003e \u003cp\u003e(43.52\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e154.60\u003c/p\u003e \u003cp\u003e(12.45\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.32\u003c/p\u003e \u003cp\u003e(6.6\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eP-85\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.40\u003c/p\u003e \u003cp\u003e(12.11\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.80\u003c/p\u003e \u003cp\u003e(27.83\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.80\u003c/p\u003e \u003cp\u003e(18.24\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e175.83\u003c/p\u003e \u003cp\u003e(13.28\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e9.40\u003c/p\u003e \u003cp\u003e(17.85\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e89.00\u003c/p\u003e \u003cp\u003e(70.63\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e48.00\u003c/p\u003e \u003cp\u003e(43.85\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e228.20\u003c/p\u003e \u003cp\u003e(15.12\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.69\u003c/p\u003e \u003cp\u003e(7.47\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMean\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e204.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e84.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e46.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e154.945\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSED\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e6.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCD 0.05\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e19.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e8.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e14.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eMeans in a column followed by superscript are significantly different by Duncans Multiple Range Test at P (0.05)\u003c/p\u003e \u003cp\u003eFrom this study it is manifested that the genotype DC 70 of cucumber expressed stable resistance reaction against ToLCNDV under natural field epiphytotic conditions during both the growing seasons whereas P 85 was found to be highly resistant during Kharif season. According to Pandey et al. (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) reported that all the Arya lines of \u003cem\u003eCucumis melo\u003c/em\u003e under study scored zero for disease scoring, designating them as highly resistant to ToLCNDV. Moreover, the ability of DC 70 genotype capable to grow profusely and produce high yield in both the rabi and kharif seasons as well as showed highly resistant response when challenged by an infectious ToLCNDV virus clone under glasshouse and most likely by a natural viral inoculum in an open field may offer an efficient way to induce a ToLCNDV highly resistant response while using less insecticides.\u003c/p\u003e \u003cp\u003eThe results of this study showed that rabi and kharif seasons had significantly highest mean values recorded for yield attributing parameters \u003cem\u003eviz.\u003c/em\u003e,number of branches (5.3; 5.50) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e \u0026amp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e),crop duration (93.00 ; 95.00)showed in Table \u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e \u0026amp; \u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, fruit girth (12.89 cm) in rabi season and superior mean values in terms of days for first harvest (40.20;45.87) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e,\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) which were considered desirable traits obtained in DC 70 genotype. In contrast, DC 769 genotype showed the significantly highest fruit length (37.00; 36.90 cm) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e,\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) and fruit weight (219.83; 37.45 g) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e,\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) and P-85 exhibited significantly highest number of fruits/vine (9.40; 10.67) and vine length (228.20; 231.33cm) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e,\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) and fruit girth (15.27 cm) in kharif respectively(Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Mostly occurrence of various types of virus (both mono- and bipartite) and inherent mixed infections, variations in whitefly populations as well as primarily influenced by rainfall could have contributed Disease incidence in genotypes of cucumbers varied slightly among seasons (Maruthi et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2005\u003c/span\u003e).Out of four genotypes screened, significantly lowest mean values were recorded in number of branches (3.00; 3.40), vine length (110.98; 11.50 cm) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e,\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e)and number of fruits/plant resulted (6.20) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) in rabi season whereas kharif season showed fruit girth (11.99 cm) and crop duration (73.77) (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) in DC 70 genotype respectively. DC 769 resulted crop duration (76.73) in rabi season and number of fruits/vine (6.20) in kharif season respectively. In rabi season, P-85 displayed the following fruit characteristics \u003cem\u003eviz.\u003c/em\u003e, fruit girth (9.80cm), fruit weight (175.83; 177.17g) and fruit length (21.80; 20.07 cm) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e,\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). This result is in concordance with previous findings of Pandey et al. (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) in melon; Singh et al. (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) in field screening performance of sponge gourd.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMorphological parameters of the kharif season\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGeno\u003c/p\u003e \u003cp\u003etypes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo. of branches\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFruit length (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFruit girth (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFruit weight (g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNo. of fruits /plant\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCrop duration\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eDays for first harvest\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eVine length (cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eYield per plant (kg)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDC 70\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.50\u003c/p\u003e \u003cp\u003e(13.56\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.10\u003c/p\u003e \u003cp\u003e(26.64\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15.10\u003c/p\u003e \u003cp\u003e(22.87\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e210.98\u003c/p\u003e \u003cp\u003e(14.54\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10.00\u003c/p\u003e \u003cp\u003e(18.43\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e95.00\u003c/p\u003e \u003cp\u003e(77.08\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e45.87\u003c/p\u003e \u003cp\u003e(42.63\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e173.86\u003c/p\u003e \u003cp\u003e(13.2\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.19\u003c/p\u003e \u003cp\u003e(8.51\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDC 773\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.40\u003c/p\u003e \u003cp\u003e(10.63\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e36.23\u003c/p\u003e \u003cp\u003e(37.01\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11.99\u003c/p\u003e \u003cp\u003e(20.26\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e221.89\u003c/p\u003e \u003cp\u003e(14.91\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.50\u003c/p\u003e \u003cp\u003e(14.77\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e73.77\u003c/p\u003e \u003cp\u003e(59.19\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e51.57\u003c/p\u003e \u003cp\u003e(45.9\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e112.50\u003c/p\u003e \u003cp\u003e(10.63\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.10\u003c/p\u003e \u003cp\u003e(6.02\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDC 769\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.00\u003c/p\u003e \u003cp\u003e(11.54\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e39.9\u003c/p\u003e \u003cp\u003e(39.17\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12.8\u003c/p\u003e \u003cp\u003e(20.96\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e237.45\u003c/p\u003e \u003cp\u003e(15.43\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e6.20\u003c/p\u003e \u003cp\u003e(14.42\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e81.30\u003c/p\u003e \u003cp\u003e(64.38\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e49.66\u003c/p\u003e \u003cp\u003e(44.81\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e175.89\u003c/p\u003e \u003cp\u003e(13.28\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.47\u003c/p\u003e \u003cp\u003e(6.96\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eP-85\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.67\u003c/p\u003e \u003cp\u003e(12.48\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.07\u003c/p\u003e \u003cp\u003e(26.62\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15.27\u003c/p\u003e \u003cp\u003e(23.00\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e177.17\u003c/p\u003e \u003cp\u003e(13.33\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10.67\u003c/p\u003e \u003cp\u003e(19.07\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e94.00\u003c/p\u003e \u003cp\u003e(75.82\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e49.67\u003c/p\u003e \u003cp\u003e(44.81\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e231.33\u003c/p\u003e \u003cp\u003e(15.23\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.89\u003c/p\u003e \u003cp\u003e(7.90\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMean\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e29.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e211.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e86.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e49.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e173.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSED\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e8.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.06\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCD 0.05\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e8.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e4.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e17.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eMeans in a column followed by superscript are significantly different by Duncans Multiple Range Test at P (0.05)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eArtificial screening against ToLCNDV by agroinoculation\u003c/h2\u003e \u003cp\u003eGlobally vegetable crop production is seriously threatened by Tomato leaf curl New Delhi virus (ToLCNDV). Presently, it is common in India and has also been occurred in some countries like Pakistan, Bangladesh, and Thailand. ToLCNDV is becoming a serious threat to the production of cucurbit crops due to its host range extension, which is being supported by its evolution and the potential for a different mechanism of transmission (Juarez et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). ToLCNDV infected cucurbits shows in high economic losses among cucurbits. In an epidemic situations, the crops infected with ToLCNDV disease can cause cent per cent yield loss. Therefore, identifying ToLCNDV-resistant sources in other species of cucumber is crucial to mitigate the effects of this virus. As a result, intensive screening of a wide range of genetic resources is required to discover resistant sources for use in cucumber breeding programmes. An artificial screening study was carried out with four distinct genotypes of cucumber, to verify whether ToLCNDV was truly pathogenicity on above genotypes. Yamamoto et al. (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) observed more severe symptoms of ToLCNDV-[ES-Alm-Cuc-16] in agroinoculated cucurbit plants, especially in melon and zucchini plants compared to field-grown plants probably due to inoculation during the cotyledon stage prior to the occurrence of true leaves.\u003c/p\u003e \u003cp\u003eArtificial screening was done to confirm the resistance observed under field screening using four selected genotypes. Cucumber genotypes showed highly resistant to highly susceptible reactions under natural field study during rabi and kharif seasons were selected for artificial screening to confirm the resistance of the genotypes. Employing artificial screening systems allows for disease evaluation trials regardless of weather conditions that might be any period of time in the season (Kaur et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In this study, four genotypes of cucumber were successfully agroinoculated with ToLCNDV, three genotypes displayed ToLCNDV symptoms and one genotype did not express any symptoms at all (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Differential symptom reactions against ToLCNDV was expressed though same concentration of inoculum was agroinoculated into each genotype during the agroinoculation process. Hanson et al. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2000\u003c/span\u003e) evaluated their potential for use in new region, south Indian resistant/tolerant tomato cultivars were artificially screened against the Bangladesh ToLCV. This was done because conventional breeding for ToLCNVD resistance is a slow and challenging procedure.\u003c/p\u003e \u003cp\u003eSusceptible genotypes initially showed symptoms like slight yellowing of the leaves. Later, it was noticed that the apical leaves showing puckering, curling, and yellowing with mosaic symptoms. Stunting and leaf curling were also noted during severe stage of infection. Similar pattern of symptoms such as leaf curling, mosaic yellowing, and stunting were reported as serious pathogenicity to pumpkin, zucchini and melon as shown for other Mediterranean or Asian isolates and suggested that ToLCNDV had increased pathogenicity reported by Thuy et al.(2022). Symptoms, percent disease index, and percent disease incidence have also been provided in Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e \u0026amp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. The genotypes reaction were recorded using the Percent Disease Index (PDI) calculation.\u003c/p\u003e \u003cp\u003eThe artificial screening results showed that both control and inoculated DC 70 plants on 28 dpi to be symptom less highly resistant reaction suggested that genotype could resist ToLCNDV infection than other genotypes. Symptomless highly resistant reaction of DC 70 might be due to genetic variability of the crop species which is crucial for the resistant genotype. Furthermore, different genetic background of genotypes, every genotype may perhaps various symptom expression properties for virus spread and infection. Infected plants expressed a typical disease symptoms at 28 dpi. Similarly, Islam et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) identified ToLCNDV-resistance in sponge gourd lines, DSG-6 and DSG-7 through sterilized virion inoculation in insect-proof net houses while Kaur et al. (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) confirmed resistance in \u003cem\u003eL. cylindrica\u003c/em\u003e and \u003cem\u003eL. acutangula\u003c/em\u003e germplasms were recognized to have potential resistance to ToLCNDV. The disease index % of symptoms was significantly higher in DC-773 inoculated plants which expressed the highest PDI (92.00%) (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e) and highly susceptible reactions such as severe mosaic, yellowing, curling of leaves, and stunted plant, while the DC 773 control plants expressed the moderately susceptible reactions such as mosaic, yellowing and curling on a fewer leaves with PDI of 29.87% (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). These symptoms were similar to those depicted for ToLCNDV infection on melon (Trisciuzzi et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Based on the study, disease transmission qualities implied on changing behaviors and types of disease-causing capacity as well as the potential for wider host ranges and disease dissemination. These findings are consistent with earlier reports from Yamamoto et al. (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) on cucumber, melon and zucchini and Mei et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) on \u003cem\u003eCucumis melo.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eIn DC 769 inoculated plants PDI (52.50%) (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e) with susceptible reactions \u003cem\u003eviz.\u003c/em\u003e, mosaic of young leaves, yellowing, distortion of leaves were observed while PDI (18.75%) (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e) in DC 769 control plants caused moderately susceptible reactions such as young leaf mosaic and mild yellowing of leaves. Results of this study also implied the susceptible reaction of cucumber plants, which concurrent with the report by Ruiz et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).DC 85 inoculated plants had PDI (22.91%) (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e) with moderately resistant \u003cem\u003eviz.\u003c/em\u003e, mosaic of young leaves and resistant reactions \u003cem\u003eviz.\u003c/em\u003e, mild mosaic of young leaves reached PDI (9.20%) in DC 85 control plants. The reasons for the variations in per cent disease incidence and index of ToLCNDV might be due to difference in the inoculum source, vector population, climatic conditions and geographic location. These findings were concurrent with earlier research on pumpkin plants studied by Dhillon et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAmong the four screened genotypes of inoculated and control plants percent disease incidence ranged from 0.00 to 93.30% (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). DC 773 had significantly highest percent disease incidence, followed by DC 769 (73.00 and 20.00%) and P-85 (46.60 and 6.66%) (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Similarly, ridge gourd varieties such as RHRG-2, SVRGH-54, VRGH-2 and VRGH-336 were identified as highly susceptible to ToLCNDV \u003cem\u003evia\u003c/em\u003e inoculation observed by Sohrab et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). In contrast, DC 70 had the lowest or no score at 28 dpi (0.00 \u0026amp; 0.00%) (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e), respectively. High temperature encouraged the proliferation of whiteflies, might be the cause for high disease incidence percentage in the field during the rabi season than kharif season.The corresponding trend in \u003cem\u003eLuffa actangula\u003c/em\u003e per cent disease incidence was reported by Premchand et al. (2017); Parrella et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) in pumpkin plants. Moreover, investigation of seed transmission of ToLCNDV is crucial for potential quarantine measures to prevent virus spread into new geographical areas.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eReaction of genotypes for ToLCNDV under artificially inoculated condition\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotypes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInoculum\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTime taken for symptom expression\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNumber of infected plants/agroinocuated plants\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePer cent Disease Incidence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePCR of ToLCNDV\u003c/p\u003e \u003cp\u003eDNA-A\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eVirus recognition by PCR (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC-70 (V)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDNA\u003cb\u003e-\u003c/b\u003eA\u0026thinsp;+\u0026thinsp;B\u0026thinsp;+\u0026thinsp;β satellite\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28 dpi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0/15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003cp\u003e(0.00\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC-70 (C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e38 DAS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0/15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003cp\u003e(0.00\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC-773 (V)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDNA\u003cb\u003e-\u003c/b\u003eA\u0026thinsp;+\u0026thinsp;B\u0026thinsp;+\u0026thinsp;β satellite\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28 dpi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14/15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e93.30\u003c/p\u003e \u003cp\u003e(17.79\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e93.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC-773 (C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e38 DAS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5/15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e40.00\u003c/p\u003e \u003cp\u003e(11.54\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e33.33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC 769 (V)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDNA\u003cb\u003e-\u003c/b\u003eA\u0026thinsp;+\u0026thinsp;B\u0026thinsp;+\u0026thinsp;β satellite\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28 dpi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11/15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e73.00\u003c/p\u003e \u003cp\u003e(15.68\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e73.33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC 769 (C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e38 DAS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3/15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003cp\u003e(8.13\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e20.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP-85 (V)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDNA\u003cb\u003e-\u003c/b\u003eA\u0026thinsp;+\u0026thinsp;B\u0026thinsp;+\u0026thinsp;β satellite\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28 dpi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7/15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e46.60\u003c/p\u003e \u003cp\u003e(12.47\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e46.66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP-85 (C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e38 DAS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1/15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.66\u003c/p\u003e \u003cp\u003e(4.68\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e6.66\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003edpi- days post inoculation DAS- Days after sowing\u003c/p\u003e \u003cp\u003eMeans in a column followed by superscript are significantly different by Duncans Multiple Range Test at P (0.05)\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eResponse of cucumber genotypes against ToLCNDV under artificial screening by agroinoculation\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenotypes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePercent Disease Index\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCoefficient of infection\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDisease reaction\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSymptoms\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC-70 (V)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003cp\u003e(0.00\u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHighly Resistant (HR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNo visible symptoms and normal growth\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC-70 (C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003cp\u003e(0.00 \u003csup\u003ea\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHighly Resistant (HR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNo visible symptoms and normal growth\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC-773 (V)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e92.00\u003c/p\u003e \u003cp\u003e(73.57\u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e92.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHighly Susceptible (HS)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSevere mosaic, yellowing, curling of leaves and stunting of the plants\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC-773 (C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e29.87\u003c/p\u003e \u003cp\u003e(33.13 \u003csup\u003ed\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eModerately Susceptible (MS)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMosaic of young leaves, curling and puckering of leaves\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC 769 (V)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e52.50\u003c/p\u003e \u003cp\u003e(46.43\u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e52.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSusceptible (S)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMosaic of young leaves, yellowing, distortion of leaves\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDC 769 (C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18.75\u003c/p\u003e \u003cp\u003e(25.66 \u003csup\u003ec\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eModerately Susceptible (MS)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMosaic of young leaves and slight yellowing of leaves\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP-85 (V)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e22.91\u003c/p\u003e \u003cp\u003e(28.60\u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eModerately Resistant (MR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMosaic of young leaves\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP-85 (C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.20\u003c/p\u003e \u003cp\u003e(17.66 \u003csup\u003eb\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eResistant (R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMild mosaic of young leaves\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eMeans in a column followed by superscript are significantly different by Duncans Multiple Range Test at P (0.05)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eMolecular confirmation of agroinoculated plants by PCR amplification\u003c/h2\u003e \u003cp\u003eThe PCR analysis demonstrated that ToLCNDV infection was the cause of the symptoms displayed on several genotypes employed in artificial screening. At 28 dpi Cucumber genotypes inoculated with ToLCNDV expressed typical symptoms compared with control plants. In this study, only ToLCNDV infectious clone was used as positive control. Using a set of GKNDV DNA-A primers, DNA collected from both symptomatic and non-symptomatic leaf samples was subjected to PCR for a preliminary screening of ToLCNDV infection. The coat protein gene of ToLCNDV DNA-A was amplified using a primer pair of GKNDV DNA-A (40 nt). According to PCR results, the samples resulted positive for GKNDV DNA-A primer displayed amplification of DNA-Aband at an amplicon size of 630 bp was seen in symptomatic leaves of DC 773, 769 and P-85genotypesconfirmed the presence of ToLCNDV infection transmitted by \u003cem\u003eAgrobacterium\u003c/em\u003e mediated agroinoculation were showed in \u003cb\u003eFig.\u0026nbsp;2a \u0026amp;2b\u003c/b\u003e.Likewise, molecular detection employing begomovirus-specific deng primers and coat protein gene primers revealed the ToLCNDV presence in bitter gourd samples reported by Kiran et al. (2021) and similar tendency on amplicon size of 630 bp in agroinocuated cucurbits crops for ToLCNDV coat protein DNA-A gene through conventional PCR was previously reported by Vignesh et al. (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) in cucurbitaceous crops and. However, no such amplicon was found in symptomless leaf samples of DC 70 as confirmed through PCR assay.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn PCR investigation, samples showing positive using degenerate primers indicated begomovirus infection. Similarly, Saha et al. (2014) confirmed begomovirus associated with tomato leaf curl disease in tomato samples from the Brahmaputra valley of Assam. By employing PCR amplification, the viral genome was recognized in all symptomatic plants infected with ToLCNDV. Out of 36leaf samples from four genotypes including both inoculated and control leaf samples were subjected to preliminary detection in PCR using GKNDV DNA-A primer which amplified for DNA-A. PCR analysis confirmed that 24 samples amplified CP gene of ToLCNDV DNA-A. Besides, integrating resistance in identified lines into disease management strategies, including vector control and cropping practices is an essential for sustaining resistance efficacy.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eFour different genotypes of cucumber (\u003cem\u003eCucumis sativus\u003c/em\u003e) were screened for their resistance to ToLCNDV under both field epiphytotic and artificial inoculated conditions. Out of them the genotype DC-70 was found to be totally free from any visible symptoms and ToLCNDV under both natural field trials and artificial screening by agroinoculation under controlled environmental conditions. The novel genotype of cucumber DC-70 has proved to be resistant to ToLCNDV. ToLCNDV is the major production constraint experienced by growers in many countries and commercial cultivars resistant to this virus are currently unavailable. DC-70 act as a good source of ToLCNDV resistance that can be introgrossed into other cucumber cultivars. The identified resistant genotype DC-70 will serve as good candidate in breeding program for developing ToLCNDV-resistant cultivars in cucumber.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eAcknowledgment \u0026amp; Funding\u003c/h2\u003e \u003cp\u003eI would like to give my deepest thanks to the Department of Vegetable Science, Horticultural College and Research Institute, Tamil Nadu Agricultural University for providing me with the chance to do this research. Funding National Agricultural Science Fund (NASF), Indian Council of Agricultural Research, KAB-I, Pusa Campus, New Delhi-110012\u003c/p\u003e \u003ch2\u003eConflicts of interest\u003c/h2\u003e \u003cp\u003eThe authors declare that there is no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eE. N.Conducting research work and article writing, V. R. Chairmen, Seed collection and article correction , Advisory committee member, T.K. B.Research mentor, -G. K. Guide the ToLCNDV Screening and article correction, M. K. Advisory committee member, Crop Production guidance, -D. R. Statistical analysis .\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eDhillon NP, Srimat S, Laenoi S, Bhunchoth A, Phuangrat B, Warin N, Kenyon L (2021) Resistance to three distinct Begomovirus species in the agro nomical superior tropical pumpkin line AVPU1426 developed at the world vegetable center. Agronomy, 11(6):1256. https://doi.org/10.3390/agronomy11061256. \u003c/li\u003e\n\u003cli\u003eFortes IM, Sa nchez-Campos S, Fiallo-Olive E, Dıaz-Pendon JA, Navas-Castillo J, Moriones E. A (2016) Novel strain of Tomato leaf curl New Delhi virus has spread to the Mediterranean basin. Viruses 8:307. https://doi.org/10.3390/v8110307. \u003c/li\u003e\n\u003cli\u003eGomez KA, Gomez AA (1984) Statistical procedures for agricultural research. John Wiley and Sons, New York, USA.\u003c/li\u003e\n\u003cli\u003eHanson PM, Bemacchi D, Green SK, Tanksley SD, Muniyappa V, Padmaja AS, Chen HM, Kuo G, Fang D, Chen JT (2000) Mapping a wild tomato introgression associated with tomato yellow leaf curl virus resistance in a cultivated tomato line. J. Am. Soc. Hortic. Sci. 125:15-20. https://doi.org/10.21273/JASHS.125.1.15 \u003c/li\u003e\n\u003cli\u003eIslam S, Anilabh Das M, Verma M, Arya L, Mandal B, Tusar Kanti B, Sanjay Kumar L (2011) Screening of Luffa cylindrica Roem. for resistance against Tomato Leaf Curl New Delhi Virus, inheritance of resistance, and identification of SRAP markers linked to the single dominant resistance gene. The Journal of Horticultural Science and Biotechnology, 86(6): 661-667. https://doi.org/10.1080/14620316.2011.11512819. \u003c/li\u003e\n\u003cli\u003eJuarez M, Rabadan, MP. Mart\u0026iacute;nez LD, Tayahi M, Grande-Perez A, Gomez, P (2019) Natural Hosts and Genetic Diversity of the Emerging Tomato Leaf Curl New Delhi Virus in Spain. Front. Microbiol. 10:140. https://doi.org/10.3389/fmicb.2019.00140. \u003c/li\u003e\n\u003cli\u003eKaur M, Varalakshmi B, Pitchaimuthu M, Mahesha B (2021) Screening Luffa germplasm and advanced breeding lines for resistance to Tomato leaf curl New Delhi virus. Journal of General Plant Pathology, 87:287-294. https://doi.org/10.1007/s10327-021-01010-z. \u003c/li\u003e\n\u003cli\u003eKiran GVM, Nagaraju N, Girish TR, Ashwini BN. Molecular investigations reveal bitter gourd crop is more susceptible to tomato leaf curl New Delhi virus infection in diverse crop cultivation practices. 3 Biotech, 11:1-9. \u003c/li\u003e\n\u003cli\u003eMalathi VG, Devi R, Chakraborty S, Biswas KK, Roy A, Venkataravanappa V, Mandal B (2017) Begomoviruses and their satellites occurring in India: distribution, diversity and pathogenesis. In: Mandal B, Rao G, Baranwal V, Jain R, editors. A century of plant virology in India. Singapore: Springer p. 75\u0026ndash;177. DOI:10.1007/978-981-10-5672-7_5. \u003c/li\u003e\n\u003cli\u003eMaruthi MN, Alam SN, Kader, KA, Rekha AR, Cork A, Colvin J (2005) Nucleotide sequencing, whitefly transmission, and screening tomato for resistance against two newly described begomoviruses in Bangladesh. Phytopathology, 95(12):1472-1481. https://doi.org /10.1094/PHYTO-95-1472 \u003c/li\u003e\n\u003cli\u003eMcKinney HH (1923) Investigations of the rosette disease of wheat and its control. Journal of Agricultural Research. 23(7-12):771.\u003c/li\u003e\n\u003cli\u003eMei Y, Cai L, Wang Y, Li F, Yang X, Yang J, Zhou X (2023) Molecular characterization and pathogenicity of an infectious clone of tomato leaf curl New Delhi virus isolate infecting \u003cem\u003eCucumis melo\u003c/em\u003e. Stress Biology, 3(1):51. https://doi.org/10.1007/s44154-023-00128-8.\u003c/li\u003e\n\u003cli\u003eNagendran K, Kumar SM, Manoranjitham SK, Karthikeyan G (2014) Molecular detection and characterization of Tomato leaf curl New Delhi virus causing mosaic disease on bitter gourd in Tamil Nadu, India. Trends in Biosciences. 7(23):3925-3931. https://doi.org/10.1007/s13337-017-0403-7. \u003c/li\u003e\n\u003cli\u003ePandey A, Ranjan P, Malav PK, Ranjan JK, Ghosh A, Mandal S, Kumar A (2022) Characterization and evaluation of Arya melon (\u003cem\u003eCucumis melo\u003c/em\u003e) for agromorphological traits and screening against ToLCNDV. The Indian Journal of Agricultural Sciences. 92(11):1406-1409. https://doi.org/10.56093/ijas.v92i11.125245\u003c/li\u003e\n\u003cli\u003ePanno S, Iacono G, Davino M, Marchione S, Zappardo V, Bella P, Tomassoli L, Accotto G, Davino S. (2016) First report of Tomato leaf curl New Delhi virus affecting zucchini squash in an important horticultural area of southern Italy. New Dis. Rep. 33:6. http://dx. doi.org/10.5197/j.2044-0588.2016.033.006 \u003c/li\u003e\n\u003cli\u003eParrella G, Troiano E, Formisano G, Accotto GP, Giorgini M. (2017) First report of Tomato leaf curl New Delhi virus associated with severe mosaic of pumpkin in Italy. Plant Dis. 102:459 https://doi.org/10.1094/PDIS-07-17-0940-PDN\u003c/li\u003e\n\u003cli\u003ePatil CV, Ramdas SV, Premchand U, Shankarappa KS (2017) Survey, symptomatology, transmission, host range and characterization of begomovirus associated with yellow mosaic disease of ridge gourd in southern India. Virus disease. 28(2):146\u0026ndash;155. https://doi.org/ 10.1007/s13337-017-0376-6. \u003c/li\u003e\n\u003cli\u003ePrabhandakavi P, Kumar R, Palicherla SR, E R, Pinnamaneni R (2018) Occurrence and molecular detection of bipartite begomovirus on tomato in Southern India. Arch Phytopathol Plant Protect. 51(17-18):951\u0026ndash;955. https://doi.org/10.1080 /032 3540 8.201 8.1541622 \u003c/li\u003e\n\u003cli\u003eRuiz L, Simon A, Velasco L, Janssen D (2017) Biological characterization of Tomato leaf curl New Delhi virus from Spain. Plant Pathology. 66(3):376-382. https://doi. org/10.1111/ppa.12587. \u003c/li\u003e\n\u003cli\u003eSaez C, Esteras C, Martinez C, Ferriol M, Dhillon NPS, Lopez C, Pico B (2017) Resistance to tomato leaf curl New Delhi virus in melon is controlled by a major QTL located in chromosome 11. Plant Cell Rep. 36:1571\u0026ndash;1584. https://doi.org/10.4038/jnsfsr.v42i3.7400. \u003c/li\u003e\n\u003cli\u003eSingh J, Munshi AD, Singh D, Meena BR, Singh AK, Nagar A, Mahajani K (2024) Identification of new stable resistant sources and assessing agro-morphological performance of sponge gourd germplasm against Tomato Leaf curl New Delhi Virus incidence. Frontiers in Plant Science. 15:1373352. https://doi.org /10.3389/fpls. 2024. 1373352. \u003c/li\u003e\n\u003cli\u003eSivalingam PN, Malathi VG, Varma A (2010) Molecular diversity of DNA-\u0026beta; associated with tomato leaf curl disease in India. Arch. Virol. 155:757-764. https://doi.org /10.100 7/s00705-010-0634-z. \u003c/li\u003e\n\u003cli\u003eSohrab SS, Karim S, Varma A, Abuzenadah AM, Chaudhary AG, Damanhouri GA, Mandal BM (2013) Characterization of Tomato Leaf Curl New Delhi Virus infecting cucurbits: Evidence for sap transmission in a host specific manner. African journal of Biotechnology.12(32). https://doi.org/10.5897/AJB2013.12012. \u003c/li\u003e\n\u003cli\u003eSrivastava KM, Hallan V, Raizada RK, Chandra G, Singh BP, Sane PV (1995) Molecular cloning of Indian tomato leaf curl virus genome following a simple method of concentrating the supercoiled replicative form of viral DNA. J. Virol. Methods. 51(2-3):297\u0026ndash;304. https://doi.org/10.1016/0166-0934(94)00122-W \u003c/li\u003e\n\u003cli\u003eTiwari N, Singh VB, Sharma PK, Malathi VG (2013) Tomato leaf curl Joydebpur virus: a monopartite-begomovirus causing severe leaf curl in tomato in West Bengal. Arch. Virol. 158:1-10. https://doi.org/10.1007/s00705-012-1440-6\u003c/li\u003e\n\u003cli\u003eTrisciuzzi N, Silletti MR, Gallitelli D, Spano R (2018) First detection of tomato leaf curl New Delhi virus in melon and zucchini squash in southern Italy. J Plant Pathol. 100:149. https://doi.org/10.1007/s42161-018-0038-6 \u003c/li\u003e\n\u003cli\u003eVenkataravanappa V, Reddy LC, Shankarappa K, Reddy MK (2019) Association of Tomato Leaf Curl New Delhi Virus, Beta satellite, and Alpha satellite with Mosaic Disease of Spine Gourd (Momordica dioica Roxb.Willd) in India. Iran J Biotechnol. 17(1):17. https://doi.org/10.21859/ijb.2134. \u003c/li\u003e\n\u003cli\u003eVignesh S, Renukadevi P, Nagendran K, Senthil N, Kumar RV, SwarnaPriya R, Karthikeyan, GA (2023) Distinct strain of tomato leaf curl New Delhi virus that causes mosaic disease in ash gourd and other cucurbitaceous crops. Frontiers in Microbiology. 14:1268333. https://doi.org/10.3389/fmicb.2023.1268333 \u003c/li\u003e\n\u003cli\u003eThuy TB, AamirLal, Phuong THo, Elisa Troiano, Giuseppe Parrella, Eui-JoonKil, Sukchan Lee (2022) Different infectivity of Mediterranean and Southern Asian tomato leaf curl New Delhi virus isolates in cucurbit crops. Plants. 11 (5):704. https://doi.org/10.3390/plants11050704 \u003c/li\u003e\n\u003cli\u003eYamamoto H, Wakita Y, Kitaoka T, Fujishiro K, Kesumawati E, Koeda S (2021) Southeast Asian isolate of the tomato leaf curl New Delhi virus shows higher pathogenicity against tomato and cucurbit crops compared to that of the Mediterranean isolate. The Horticulture Journal. 90(3):314-325. https://doi.org/10.2503/hortj.UTD-269. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Cucumber, ToLCNDV, Natural \u0026 Artificial screening, Agroinoculation, PCR","lastPublishedDoi":"10.21203/rs.3.rs-4621625/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4621625/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eResearch was carried out to identify the source of resistance in four cucumber genotypes for ToLCNDV under natural field epiphytotic and greenhouse conditions. Over all the mean percent disease index and incidence ranged from 0 to 92.00% and 0 to 93.3% respectively. Under natural field conditions, the genotype DC 70 was found to be totally free from ToLCNDV infection followed by P-85 with 8.57 PDI and 28.57% disease incidence while DC 773 recorded 75.00 PDI and 87.50% disease incidence and DC 769 with 42.85 PDI and 71.42% disease incidence in rabi season under field epiphytotic condition. Similarly, during the kharif season the genotype DC 70 and P-85 were found to be totally free from ToLCNDV infection while DC 773 recorded 65.71 PDI and 85.00% disease incidence and DC 769 with 40.00 PDI and 75.00% disease incidence. Based on natural field evaluation the selected entries were subjected to artificial screening under greenhouse conditions. DC 70 was totally free from ToLCNDV infection upon artificial screening by agroinoculation. This was followed by P-85 with 22.91 PDI and 46.60% disease incidence and DC 773 recorded 92.00 PDI and 93.3%disease incidence. Symptomatic and asymptomatic leaves were confirmed for the presence of ToLCNDV by PCR assay. Susceptible genotypes expressed leaf curling, yellowing and severe mosaic on 28 days post-inoculation. Out of four genotypes screened, DC 70 showed highly resistant reaction and identified as reliable source of resistance for ToLCNDV in cucumber. The resistant source identified is a good candidate for resistant breeding for ToLCNDV in cucumber.\u003c/p\u003e","manuscriptTitle":"Molecular confirmation of ToLCNDV resistance in cucumber (Cucumis sativus L.) genotypes through agroinoculation and field screening","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-17 06:13:55","doi":"10.21203/rs.3.rs-4621625/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a136b27e-3b51-45b1-b0a2-a30898be7c83","owner":[],"postedDate":"July 17th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-07-19T15:22:41+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-17 06:13:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4621625","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4621625","identity":"rs-4621625","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}