Functional Characterization of Fad Genes from Two Chemosymbiotic Bivalves Inhabiting the Haima Cold Seep

Functional Characterization of Fad Genes from Two Chemosymbiotic Bivalves Inhabiting the Haima Cold Seep | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Functional Characterization of Fad Genes from Two Chemosymbiotic Bivalves Inhabiting the Haima Cold Seep Runli Liu, Danli Jiang, Meixia Chen, Helu Liu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9035091/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Deep-sea cold seeps are chemosynthetically driven ecosystems deficient in essential PUFAs. However, the mechanisms by which seep-dwelling bivalves meet their physiological requirements for PUFAs remain poorly understood. Here, we investigated the fatty acid profiles and endogenous biosynthetic capacity of two dominant bivalves from the Haima Cold Seep—the mussel Gigantidas haimaensis and the clam Archivesica marissinica. Fatty acid analysis revealed their high proportions of bacterial-derived MUFAs, consistent with chemosynthetic nutrition. A. marissinica lacked detectable essential PUFAs, while G. haimaensis contained trace arachidonic acid (ARA) and eicosapentaenoic acid (EPA), suggesting partial dietary supplementation. Transcriptome assembly identified three fatty acid desaturase ( Fad ) genes per species, phylogenetically clustering into Δ5 and Δ6/8 clades, with lineage-specific duplications within the Δ5 clade. Functional assays in yeast demonstrated that Δ6/8-clade Fads possess Δ8-desaturase activity enabling LC-PUFA biosynthesis. Δ5-clade isoforms exhibited divergent substrate specificities: GhFads2 and AmFads1 functioned as classical Δ5-desaturases on PUFA substrates, whereas GhFads1 and AmFads2 specifically desaturated the bacterial MUFA C18:1n-7 to produce the non-methylene-interrupted (NMI) PUFA C18:2n-7—a precise nutritional adaptation to the n‑7 fatty acid-rich seep environment. Physiological assays using GhFads1-transformed yeast showed that NMI C18:2n-7 confers cold tolerance comparable to conventional PUFAs and provides superior protection under high hydrostatic pressure. Our results reveal that cold-seep bivalves retain endogenous LC-PUFA biosynthetic capacity and have evolved duplicated Δ5-desaturases with novel regioselectivity toward bacterial MUFAs. The resulting NMI fatty acids likely represent adaptive membrane modifications for survival under extreme deep-sea conditions. Cold seep Bivalves Fatty acid desaturase Long-chain polyunsaturated fatty acids (lcPUFA) Non-methylene-interrupted fatty acids Deep-sea adaptation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Deep-sea chemosynthetic ecosystems, such as hydrothermal vents and cold seeps, constitute remarkable oases of life and biodiversity in an otherwise oligotrophic habitat [ 1 ]. Cold seeps, frequently located along continental margins, are formed by the upward migration of reduced fluids—including methane, hydrogen sulfide, and hydrocarbons—through sediments and into the benthic boundary layer. Since the discovery of the first seep community at the Florida Escarpment in 1983 [ 2 ], numerous seep systems have been documented globally, including in the Gulf of Mexico, Monterey Bay, the Eastern Mediterranean, the Japan and Kurile trenches, and the South China Sea, spanning depths from 400 to over 6,000 meters [ 3 , 4 ]. These environments create distinct geochemical gradients that support high localized biomass, sustained not by photosynthesis but by microbial chemosynthesis [ 5 ]. The energy base of cold seep is microbial chemosynthesis, driven primarily by anaerobic methane-oxidizing archaea, sulfate-reducing bacteria, and sulfide-oxidizing bacteria [ 6 – 8 ]. This microbial production sustains dense assemblages of megafaunal hosts, such as mussels, clams, and tube worms, which harbor these chemosynthetic symbionts and form the basis of the seep consumer network [ 9 , 10 ]. Discovered in 2015, the Haima Cold Seep is one of only two known active seeps in the South China Sea, situated at depths of 1360–1400 m[ 11 ]. Characterized by considerable biomass and species richness, it hosts over 80 documented species and serves as an excellent model for seep ecology. Among the dominant taxa are the mussel Gigantidas haimaensis and the clam Archivesica marissinica , both newly described species that form patchy beds and play foundational roles in the seep ecosystem through their symbiotic nutrition [ 11 , 12 ]. Long-chain polyunsaturated fatty acids (lcPUFAs), including arachidonic acid (ARA, 20:4n-6), eicosapentaenoic acid (EPA, 20:5n-3), and docosahexaenoic acid (DHA, 22:6n-3), are essential for animal growth, development, and physiological regulation [ 13 , 14 ]. In marine ecosystems, PUFAs are primarily synthesized by marine phytoplankton and other microorganisms, such as diatoms, cyanobacteria, oomycetes, and fungi, and are subsequently transferred through the food web [ 15 ]. Although ω3 fatty acid desaturase (Fad) genes have been widely identified across the animal kingdom, most animals, including bivalves, lack the complete enzymatic machinery for de novo lcPUFA biosynthesis [ 16 , 17 ]. Consequently, they must acquire these fatty acids either directly from dietary sources or indirectly via the desaturation and elongation of precursor PUFAs such as linoleic acid (LA) and α-linolenic acid (ALA). The fad gene family encodes enzymes critical for lcPUFA biosynthesis, with Δ5 and Δ6/8 desaturases playing particularly important roles in the desaturation of PUFA precursors. Studies using ¹⁴C-labeled fatty acids have confirmed that marine molluscs can modify their lcPUFA profiles [ 18 ], and endogenous fad genes have been widely investigated [ 19 ]. Functionally characterized fad genes have been isolated from several littoral molluscs including Octopus vulgaris [ 20 ], Haliotis discus [ 21 ], Chlamys nobilis [ 22 , 23 ], Sinonovacula constricta [ 24 ] and Mulinia lateralis [ 25 ]. With the exception of a Δ8 desaturase from C. nobilis and Δ6 desaturase from S. constricta , all functionally characterized molluscan Fads exhibit Δ5 desaturase activity. Nevertheless, the phylogenetic relationships and functional diversity of fad gene families in deep-sea molluscs—which inhabit environments typically poor in PUFAs—remain entirely unexplored. Moreover, the fatty acid profiles available in deep-sea chemosynthetic ecosystems are distinct: sulfur-oxidizing bacterial symbionts generally produce monounsaturated fatty acids (MUFAs) such as C16:1n-7 and C18:1n-7 [ 26 ], while aerobic methanotrophs synthesize n-8 and n-9 MUFAs [ 27 ]. PUFAs are not typically synthesized by these chemosynthetic prokaryotes [ 26 , 27 ]. As a result, seep/vent-dwelling bivalves often exhibit low levels of essential PUFAs and instead accumulate bacterial MUFAs, a profile that contrasts markedly with that of their shallow-water relatives. Given the physiological importance of PUFAs, it remains an open question how seep bivalves meet their nutritional demands in an environment chronically deficient in these essential lipids, and whether their endogenous PUFA biosynthetic pathways have undergone adaptive evolution. Recent years have seen a substantial increase in publicly available genome and transcriptome data for deep-sea molluscs. This growing resource, together with advances in bioinformatics and computational analysis, has enabled the prediction and identification of functional genes across diverse molluscan groups. In this study, we identified and characterized fad genes from two dominant bivalves inhabiting the Haima Cold Seep— Gigantidas haimaensis and Archivesica marissinica . We performed phylogenetic analyses to elucidate the evolution of the fad gene family within molluscs and determined the functional activity of the encoded enzymes through heterologous expression in yeast. Materials and Methods Sample Collection Samples were collected in October 2023 during cruise TS2-30 aboard the research vessel TANSUOERHAO at the Haima cold seep in the South China Sea, using the human-occupied vehicle (HOV) SHENHAIYONGSHI . The sampling site was characterized by active gas seepage and a thriving macrofaunal community, dominated by dense but patchy beds of the bathymodiolin mussel Gigantidas haimaensis and the vesicomyid clam Archivesica marissinica on a muddy substrate (Fig. 1 ). Numerous other invertebrates were observed within these beds, including the snail Phymorhynchus buccinoides , the holothuria Chiridota heheva , the squat lobster Munidopsis lauensis , and the brittlestar Histampica haimaensis . The polynoid polychaete Branchipolynoe pettiboneae was frequently found inhabiting the mantle cavity of G. haimaensis . Surrounding the bivalve beds, the polychaete Lindaspio polybranchiata occupied burrows in the sediment, extending its hair-like feeding appendages into the water current to capture particulate matter (Fig. 1 ). Specimens were collected using the HOV's mechanical arm and immediately placed into an insulated biobox to minimize thermal stress. Upon retrieval on deck, samples were flash-frozen in liquid nitrogen and subsequently stored at − 80°C until further processing. Species identification was confirmed by sequencing the mitochondrial cytochrome c oxidase subunit I ( CoxI ) gene using the universal primers LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG-3′) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′). Lipid Extraction and Fractionation Total lipids were extracted from tissues according to the method of Folch et al (1957) [ 28 ], with minor modifications. Wet tissue weight was recorded, and samples were freeze-dried to constant weight for dry weight determination. Dried tissues were homogenized to a fine powder. Lipids were extracted by adding methanol:chloroform (1:2, v/v) at a solid-to-liquid ratio of 1:5 (w/v), followed by ultrasonication for 10 min and overnight gentle shaking at room temperature. The mixture was centrifuged at 5000 rpm, and the supernatant was collected. Extraction was repeated once, and the supernatants were pooled. To separate the lipid phase, two volumes of ddH₂O were added to the combined organic supernatant. After thorough mixing, the biphasic system was centrifuged at 3000 × g for 10 min at 4°C. The lower chloroform phase was carefully collected into a pre-weighed, clean glass tube. Chloroform was evaporated under a nitrogen stream at 45°C, and total lipid content (TLC) was determined gravimetrically. Lipid extracts were fractionated into neutral and polar lipids using Sep-Pak Silica Vac 6 cc cartridges (WAT036910, Waters) according to the method of Hamilton & Comai [ 29 ]. Cartridges were preconditioned with chloroform. Samples were loaded in chloroform, neutral lipids were eluted with chloroform, and polar lipids (including phospholipids and glycolipids) were subsequently eluted with methanol. Solvents were evaporated under a nitrogen stream at 45°C, and neutral lipid content (NLC) and polar lipid content (PLC) were determined gravimetrically. Fatty Acid Methyl Ester (FAME) Preparation and Analysis For FAME preparation, approximately 100 mg of total lipids was dissolved in 2 mL of 1 M NaOH in methanol (containing 0.01% butylated hydroxytoluene as antioxidant). The mixture was vortexed and incubated at 60°C for 20 min to saponify lipids. After cooling, 2 mL of boron trifluoride-methanol reagent was added, and the mixture was incubated at 60°C for 5 min to methylate free fatty acids. Subsequently, 2 mL of n-hexane was added, and incubation continued at 60°C for 2 min. Saturated NaCl solution (2 mL) was then added, and the tube was allowed to stand at room temperature for 15 min to facilitate phase separation. The upper hexane phase containing FAMEs was transferred to a 1.5 mL Eppendorf tube, centrifuged at ≥ 10,000 × g for 20 min at 4°C, and passed through a 0.25 µm filter membrane. FAMEs were analyzed by gas chromatography using an Agilent 6890 GC equipped with a flame ionization detector and an HP-88 capillary column (60 m × 0.25 mm i.d., 0.25 µm film thickness; Agilent), and time-of-flight mass spectrometry (Agilent 8890-LECO Pegasus BT series, MI, USA) with an Rtx-35ms column (30 m, 0.25 mm i.d., 0.10 µm df; Restek, Bellefonte, PA, USA) coupled to a Pegasus III MS system (Leco, St Joseph, MI, USA). The temperature program was as follows: initial temperature 80°C held for 1 min, increased to 150°C at 20°C/min and held for 10 min, then increased to 230°C at 10°C/min and held for 15 min. Individual FAMEs were identified by comparison with authentic standards, and relative contents were calculated as the percentage of each fatty acid peak area relative to the total fatty acid peak area. Bioinformatic Analysis Transcriptomic data for G. haimaensis were obtained from the Science Data Bank ( https://www.scidb.cn/anonymous/Wk5Cbm1t ). Transcriptomic data for A. marissinica were retrieved from the NCBI Sequence Read Archive under access no. SRP259750. Raw reads were quality-assessed with FastQC and preprocessed (quality trimming and adapter removal) using fastp v0.12.4. Clean reads were de novo assembled with Trinity v2.5.1 under default parameters. Redundant transcripts showing ≥ 95% sequence similarity were clustered using CD-HIT-EST v4.6.8. Open reading frames (ORFs) and corresponding putative peptide sequences were predicted from the non-redundant transcript sets using TransDecoder v5.7.1. Candidate fatty acid desaturase (Fad) genes were identified by performing homology searches against the predicted peptide sequences with BLASTP v2.12.0. Sequence and Phylogenetic Analyses Multiple sequence alignments of the putative Fad protein sequences were generated using MUSCLE as implemented in MEGA v.11 [ 30 ]. Neighbor-Joining (NJ) phylogenetic tree was constructed with the same software based on the aligned sequences. Branch support was assessed using bootstrap analysis with 1,000 replicates. RNA Extraction Total RNA was isolated from adductor tissues of the mussel G. haimaensis and the clam Ar. marissinica using a TRIzol-based method. Approximately 100 mg of frozen tissue was homogenized in 1 mL of QIAzol Lysis Reagent (Qiagen, #79306). Chloroform (200 µL) was then added, and the mixture was vortexed vigorously for 15 s, incubated at room temperature for 2–3 min, and centrifuged at 12,000 × g for 15 min at 4°C. The upper aqueous phase was carefully transferred to a fresh 1.5 mL microcentrifuge tube and mixed with an equal volume of isopropanol. After incubation at room temperature for 10 min, RNA was precipitated by centrifugation at 12,000 × g for 10 min at 4°C. The supernatant was discarded, and the RNA pellet was washed once with 1 mL of 75% ethanol, followed by centrifugation at 7,500 × g for 5 min at 4°C. The ethanol was removed, and the pellet was air-dried briefly at room temperature before resuspension in RNase-free water. RNA concentration and purity were determined using a NanoDrop 2000 spectrophotometer (Thermofisher Scientific), and RNA integrity was verified by 1% agarose gel electrophoresis. cDNA Synthesis First-strand cDNA was synthesized from 1 µg of total RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermofisher Scientific, #K1622) according to the manufacturer’s protocol. Briefly, total RNA was mixed with oligo(dT)₁₈ primers and reaction buffer provided with the kit, denatured at 65°C for 5 min, and immediately chilled on ice. dNTP mix, RNase inhibitor, and RevertAid Reverse Transcriptase were then added. The reverse transcription reaction was carried out at 42°C for 60 min, followed by enzyme inactivation at 70°C for 5 min. Then the synthesized cDNA was stored at − 20°C until further use. Plasmid Construction Open reading frames (ORFs) encoding candidate Fads were amplified from cDNA using PrimeSTAR® GXL Premix (Takara, #R053A). PCR reactions consisted of an initial denaturation at 98°C for 30 s, followed by 35 cycles of 98°C for 10 s, annealing at 55°C for 5 s, and extension at 68°C for 60 s. Primers containing the respective restriction sites are listed in Table 1 . Amplified fragments were purified, digested with the indicated restriction enzymes, and ligated into the same digested yeast expression vector pYES2 (Invitrogen, #V82520). Recombinant plasmids were transformed into compolent cell E. coli DH5α, and verified by Sanger sequencing. Table 1 Primer list Gene Sequence GhFads1 F:CGG GGTACC CTTCCGATAAGTAGGCCTATGCAAT(Kpn I) R:TGC TCTAGA ATTTAATGAATCTTGTCTGTCTTTA (Xba I) GhFads2 F:CGG GGTACC AATTTGAAACCTGGATTGAAATGGA(Kpn I) R:TGC TCTAGA TAAGTCTAATTAATAGACAAGTCAT (Xba I) GhFads3 F:CGG GGTACC AATTTGAAACCTGGATTGAAATGGA(Kpn I) R:TGC TCTAGA ACTAGTGTGTGGAGACCATGATATA (Xba I) AmFads1 F:CGG GGTACC AATCTGAGTACTGTCGTCTGATGGG(Kpn I) R:TGC TCTAGA GATCGTCCGTGTGTAATGATGTAGG (Xba I) AmFads2 F:CGG GGTACC ACATCCACCGAATACCACTGAACAA(Kpn I) R:TGC TCTAGA TGTGTTGATTCAATGTAGACTTTAT (Xba I) AmFads3 F:CGG GGTACC ACATTAGATCGTGCACTTACAAATA(Kpn I) R:TGC TCTAGA ACATTACGATCACTCTCTGTCCCAC (Xba I) Heterologous Expression in Yeast Sequence-confirmed plasmids were transformed into Saccharomyces cerevisiae strain INVSc1 (Invitrogen) following the manufacturer's protocol for the pYES2 vector. Transformants were selected on synthetic complete minimal medium lacking uracil (SC-U). For functional expression, recombinant yeast strains were cultured in SC-U broth containing 2% galactose to induce expression from the GAL1 promoter, as described previously [ 31 ]. Exogenous fatty acid substrates (C18:2n-6, C18:3n-3, C20:2n-6, C20:3n-3, C20:3n-6, and C18:1n-7) were saponified in 0.5 M KOH-ethanol and added to the culture medium at a final concentration of 0.75 µM. Yeast cells were harvested by centrifugation, and total lipids were extracted by homogenization in chloroform:methanol (2:1, v/v) containing 0.01% BHT. Fatty acid methyl esters (FAMEs) were prepared from the extracted lipids, recovered by hexane extraction, and analyzed by gas chromatography as described above. The proportion of substrate fatty acid converted to desaturation product was calculated from the gas chromatograms as 100 × [product area/(product area + substrate area)]. Cold and high-pressure treatment For cold stress assays, transgenic yeast cells were cultured in SC-U broth supplemented with 2% galactose at either 15°C or 28°C. Exogenous fatty acid substrates—including C18:0, C18:1n-7, C18:1n-9, and C18:2n-6—were individually added to the culture medium at a final concentration of 50 µM. For high-pressure treatment, transformed yeast cells were transferred into 10 mL sterile syringes (or sealed containers) filled with SC-U broth containing 2% galactose and the same four fatty acid substrates (50 µM each). The cultures were incubated at 28°C inside a high-pressure bioreactor and kept at 20 MPa for 24 hours. Following both treatments, cell viability was assessed by counting cell concentrations using a Cellometer. All experiments were performed in 6 replications to ensure statistical reliability. Statistical Analysis Data were analyzed and graphed using GraphPad Prism version 10.4.0 (La Jolla, CA, USA). Paired data were evaluated by Student's t-test. We used a one-way ANOVA for multiple comparisons. A P value less than 0.05 was considered as statistically significant. . Results Fatty acid profile analysis in chemosynthetic bivalve of Haima Cold Seep Lipid contents are presented in Table 2 . In the mussel G. haimaensis , total lipid content (TLC) values (mean ± SD) were 5.38 ± 0.20% in gill tissue, 5.73 ± 0.14% in mantle tissue, and 5.88 ± 0.02% in foot tissue. In the clam A. marissinica , gill tissue exhibited substantially higher TLC (9.24 ± 0.03%) compared to adductor muscle (4.89 ± 0.05%) and foot (3.74 ± 0.01%) tissues. Neutral lipids primarily serve as energy storage, while polar lipids constitute the main components of membrane structures. Accordingly, we also quantified polar lipid content (PLC) and neutral lipid content, revealing that PLC accounted for the majority of lipids in all samples (Table 2 ). Table 2 Lipid content in the two cold seep bivalves Species Tissue TLC (g/100g DW) PLC NLC Archivesica marissinica Gill 9.24 ± 0.03 4.44 ± 0.03 3.87 ± 0.01 Adductor 4.89 ± 0.05 3.04 ± 0.2 1.61 ± 0.01 Foot 3.74 ± 0.01 2.61 ± 0.07 0.8 ± 0.02 Gigantidas haimaensis Gill 5.38 ± 0.20 3.37 ± 0.05 1.81 ± 0.04 Adductor 5.73 ± 0.14 4.32 ± 0.01 0.93 ± 0.04 Foot 5.88 ± 0.02 2.95 ± 0.11 1.33 ± 0.09 Fatty acid profiles are summarized in Table 3 . The gills of these two chemosymbiotic bivalves, where they host their associated symbiotic microbes, were characterized by high proportions of bacterial-derived n-7 fatty acids (56.61–72.28%), with C16:1n-7 as the predominant fatty acid. Compared to G. haimaensis , A. marissinica exhibited higher total n-7 fatty acid levels in both muscle and gill tissues. Even though G. haimaensis were reported to hold the aerobic methanotrophs bacteria, we only detected a trace levels of C16:1n-8 in both the gill (1.6 ± 0.04) and muscle (0.19 ± 0.01%). Polyunsaturated fatty acid (PUFA) analysis revealed that G. haimaensis contained measurable amounts of essential PUFAs including AA and EPA, whereas docosahexaenoic acid (DHA) was undetectable. In contrast, these essential PUFAs were below detection limits in A. marissinica tissues. Table 3 Fatty acid profile in the two cold seep bivalves Fatty acids G. haimaensis Ar. marissinica Muscle Gill muscle Gill C14:0 1.34 ± 0.67 2.07 ± 0.29 2.75 ± 0.74 9.94 ± 1.11 C15:0 0 ± 0 0.83 ± 0.03 0.8 ± 0.82 1.44 ± 0.19 C16:0 19.09 ± 2.63 21.38 ± 1.01 20.54 ± 1.21 10.06 ± 0.47 C18:0 5.6 ± 0.16 7.17 ± 1.71 4.57 ± 1.47 2.2 ± 0.42 C14:1n 0 ± 0 0 ± 0 2.21 ± 0.29 1.18 ± 0.23 C16:1n-7 33.6 ± 3.01 39.2 ± 2.39 36.02 ± 6.33 52.23 ± 2.63 C18:1n-7 7.26 ± 0.45 7.23 ± 1.76 8.51 ± 0.72 9.59 ± 0.36 C18:1n-8 0.19 ± 0.01 1.6 ± 0.04 0 ± 0 0 ± 0 C18:1n-9 6.39 ± 0.07 3.02 ± 0.03 7.02 ± 1.39 2.91 ± 0.31 C20:1n-7 6.42 ± 0.83 6.89 ± 2.24 8.95 ± 0.97 3.57 ± 2.71 C20:1n-9 0.4 ± 0.08 0.21 ± 0.03 0 ± 0 0 ± 0 C16:2n-7 1.59 ± 0.29 1.44 ± 0.02 2.2 ± 0.42 0.69 ± 0.02 Δ5,11 C18:2n 5.26 ± 0.68 4.1 ± 0.41 4.4 ± 0.18 2.6 ± 0.18 C18:2n-6 2.76 ± 0.31 0.3 ± 0.43 0 ± 0 0 ± 0 C18:3n-3 2.11 ± 0.15 0.91 ± 0.08 0± 0± C20:2n-6 2.81 ± 0.56 0.51 ± 0.13 0 ± 0 0 ± 0 Δ5,13 C20:2n 2.47 ± 0.82 1.99 ± 0.27 2.03 ± 0.53 3.6 ± 0.49 C20:4n-6 1.61 ± 0.56 0.5 ± 0.04 0 ± 0 0 ± 0 C20:5n-3 1.09 ± 0.05 0.63 ± 0.09 0 ± 0 0 ± 0 Sum SFA 26.03 ± 3.46 31.46 ± 3.04 28.65 ± 3.24 23.64 ± 2.19 Sum MUFA 54.27 ± 4.63 58.15 ± 3.45 62.71 ± 2.13 69.47 ± 4.27 Sum PUFA 19.7 ± 6.18 10.39 ± 3.81 8.63 ± 2.97 6.89 ± 3.31 Sum(n-7) 56.61 ± 4.29 60.85 ± 2.49 62.11 ± 3.75 72.28 ± 3.4 Note: The muscle was a mix of adductor and food tissue. “-”, no detected Identification and phylogenetic analysis of candidate Fad genes Through transcriptome assembly and homology-based searches, we identified multiple fad transcripts. Both G. haimaensis and A. marissinica possessed three full-length Fads each, with lengths ranging from 432 to 444 amino acids (Table 4 ). These identified full-length peptides contained both the characteristic cyt-b5 (PF00173) and FA_desaturase (PF00487) domains, displaying a 47.27%-61.50% similarity to the functionally characterized Chlamys nobilis Fads (AIC34709). No ω3 Fad was identified in both bivalves suggesting their disability to de novo biosynthesize the PUFA. Multiple sequence alignment of the full-length Fad proteins revealed high conservation of critical functional motifs across these Fads (Fig. 2 ). These included the hame-binding motif (HPGG) and the three histidine-rich boxes: HXXXH, HXXHH, and QXXHH. The first histidine box conformed to the consensus sequence HD(F/V/Y)GH, with a high variation at the third amino acid. The second box (HXXHH) was variant, with a consensus of H(Y/F/S)(Q/L)HH. The final QXXHH box was highly conserved sequence Q(I/V)EHH, with only a conservative isoleucine-to-valine substitution observed in one A. marissinica Fads2. Table 4 List of candidate genes that encode putative Fad proteins identified from transcriptome assemblies Species Contig name Full length Protein length Pfam domain Archivesica_marissinica AmFads2 Yes 432 cyt-b5,FA_desaturase AmFads1 Yes 436 cyt-b5,FA_desaturase AmFads3 Yes 444 cyt-b5,FA_desaturase Gigantidas_haimaensis GhFads1 Yes 435 cyt-b5,FA_desaturase GhFads2 Yes 435 cyt-b5,FA_desaturase GhFads3 Yes 438 cyt-b5,FA_desaturase Fads usually formed two clades according to their catalytic activity (Δ5 and Δ6/8 desaturation activity) in phylogenetic topology, which was reported both in vertebrate and invertebrate [ 23 ]. Phylogenetic analysis of the full-length ORF sequences for these cold seep Fad sequences also identified two well supported clades (Δ5 Fad clade and Δ6 Fads clade) (Fig. 3 ). Both G. haimaensis and A. marissinica had two Fads formed distinct pairs that clustered within the Δ5 Fad clade and one Fad cluster within the Δ6 Fad clade, indicating a lineage-specific gene duplication event for these two species within Δ5 Fad clade. Functional characterization of Fad genes The putative Fad desaturases from these two vent bivalves were functionally characterized by heterologously expressing their cDNA open reading frames (ORFs) in yeast in the presence of Δ5- (C20:3n − 6), Δ6-(C18:3n − 3 and C18:2n − 6), and Δ8-desaturation (C20:2n − 6 and C20:3n − 3) substrates. and analyzing the resulting fatty acid profiles. Yeast cell transformed with the empty pYES2 vector (control) showed a baseline fatty acid profile consisting primarily of C16:0, C16:1n − 7, C18:0, and C18:1n − 9 (Data not shown). Yeast transformed with GhFads2 (Fig. 4 A), GhFads1 (Fig. 4 B) or AmFads1 (Fig. 4 C) showed a Δ5-desaturase activity, as evidenced by their ability to convert C20:3n-6 into C20:4n-6 (AA), with conversion rates of 31.37%, 76.55%, and 45.94%, respectively(Table 5 ), while AmFads2 exhibited no detectable Δ5-desaturase activity toward C20:3n-6. None of these genes displayed Δ6- or Δ8-desaturase activity when tested with the corresponding substrates. Interestingly, AmFads2 showed activity toward the MUFA substrate C18:1n-7, converting it to 5,11 C18:2n-7 (Fig. 4 D), thereby demonstrating Δ5-desaturase activity on this MUFA. However, it displayed no activity on C18:1n-9, indicating substrate specificity. Similarly, GhFads1 was also able to catalyze C18:1n-7 into 5,11 C18:2n-7 (Fig. 4 G) without activity on C18:1n-9. Thus, GhFads1 exhibited broader substrate specificity than AmFads2, as it acted on both MUFA and PUFA substrates. In contrast, functional assays revealed no catalytic activity of GhFads2 or AmFads1 toward C18:1n-7. Table 5 Functional characterization of the putative desaturase cDNA from chemosymbiotic bivalves G. haimaensis and Ar. marissinica in the yeast S. cerevisiae cell Fad gene Substrate Production Conversion Ratio (%) Activity GhFads1 C20:3n−6 C20:4n−6 31.37 Δ5 C18:2n−6 - - Δ6 C20:2n−6 - - Δ8 C18:1n−7 C18:2n(7,13) 43.81 Δ5 GhFads2 C20:3n−6 C20:4n−6 76.55 Δ5 C18:2n−6 - - Δ6 C20:2n−6 - - Δ8 C18:1n−7 - - Δ5 AmFads1 C20:3n−6 C20:4n−6 45.94 Δ5 C18:2n−6 - - Δ6 C20:2n−6 - - Δ8 C18:1n−7 - - Δ5 AmFads2 C20:3n−6 - - Δ5 C18:2n−6 - - Δ6 C20:2n−6 - - Δ8 C18:1n−7 C18:2n(7,13) 27.94 Δ5 GhFads3 C20:2n−6 C20:3n−6 36.41 Δ8 C20:3n−3 C20:4n−3 35.95 Δ8 C18:2n−6 - - - C20:3n−6 - - - C18:1n−7 - - - AmFads3 C20:2n−6 C20:3n−6 37.07 Δ8 C20:3n−3 C20:4n−3 28.19 Δ8 C18:2n−6 - - Δ6 C20:3n−6 - - Δ5 C18:1n−7 - - Δ6/8 When yeast transformed with AmFads3 or GhFads3 recombinant plasmids were grown in the presence of Δ5- (C20:3n − 6), Δ6-(C18:3n − 3 and C18:2n − 6), and Δ8-desaturation (C20:2n − 6 and C20:3n − 3) substrates. Both of AmFads3 (Fig. 4 E,F) and GhFads3 (Fig. 4 H,I) convert the exogenously added C20:2n − 6 and C20:3n − 3 into C20:3n − 6 and C20:4n − 3 respectively, indicating that both of AmFads3 and GhFads3 possessed Δ8-desaturation activity. About 36.41% of 20:2n − 6 and 35.95% of 20:3n − 3 were desaturated to 20:3n − 6 and 20:4n − 3 respectively for GhFads3. About 37.07% of 20:2n − 6 and 28.19% of 20:3n − 3 were desaturated to 20:3n − 6 and 20:4n − 3 for AmFads3(Table 5 ). No additional desaturated products were detected when Δ6 (18:3n − 3 and 18:2n − 6) or Δ5 (20:3n − 6) fatty acids were used as the substrates, indicating that both of AmFads3 and GhFads3 possessed no Δ6- or Δ5-desaturation activity. Thus, both of AmFads3 or GhFads3 display a classical Δ8-desaturation activity. Non-methylene-interrupted (NMI) fatty acids enhance cellular tolerance to cold and high-pressure stress. To investigate the potential function of NMI fatty acids, we assessed the growth performance of yeast cells transformed with GhFads1, as this enzyme efficiently converts C18:1n-7 into the NMI fatty acid C18:2n-7. Under standard culture conditions at 28°C, the addition of exogenous fatty acids showed little significant difference on cell growth than vehicle ( data not shown ). However, when cultured at 15°C, the addition of C18:1n-7, C18:1n-9, and C18:2n-6 significantly promoted yeast cell growth compared to the vehicle (Fig. 5 A). In empty vector control cells, C18:2n-6 conferred a greater growth advantage than C18:1n-7 or C18:1n-9 under cold stress. GhFads1-transformed cells supplemented with C18:1n-7—the substrate for NMI C18:2n-7 production—exhibited growth comparable to that of cells supplemented with C18:2n-6 (Fig. 5 A). This suggests that the NMI fatty acid C18:2n-7, endogenously produced by GhFads1, provides a protective effect similar to that of the polyunsaturated fatty acid (PUFA) C18:2n-6. Given that deep-sea vent bivalves inhabit environments characterized by constant high hydrostatic pressure, we further examined whether NMI fatty acids confer protection under high-pressure conditions. At 20 MPa, supplementation with all three unsaturated fatty acids significantly enhanced yeast growth, whereas the saturated fatty acid C18:0 reduced growth in empty vector control cells (Fig. 5 B). Notably, C18:2n-6 did not outperform C18:1n-7 or C18:1n-9 under high pressure. However, GhFads1-transformed yeast cells supplemented with C18:1n-7 showed significantly higher growth than any other group, indicating that the NMI fatty acid C18:2n-7 offers superior protection compared to conventional PUFAs under high-pressure stress. Discussion Most deep-sea ecosystems are heterotrophic and rely on the downward flux of particulate organic matter derived from photosynthesis in surface waters. This chronic energy limitation is a fundamental force shaping deep-sea community structure and function [ 32 ]. A major exception to this paradigm occurs in chemosynthesis-based ecosystems, where chemical energy replaces solar energy to drive primary production [ 33 , 34 ]. The Haima Cold Seep is a classic example, sustaining exceptionally high biodiversity through dense beds of the chemosymbiotic bivalves Gigantidas haimaensis and Archivesica marissinica. These bivalves provision higher trophic levels by hosting endosymbiotic bacteria that perform chemosynthesis. In contrast to surface habitats, where organic matter is rich in essential PUFAs [ 23 , 35 ], bacterial biomass at cold seeps is characteristically PUFA-poor but enriched in bacterial-derived MUFAs, such as C16:1n-7 and C18:1n-7 [ 36 ]. These stark compositional differences make fatty acid profiles highly effective trophic tracers [ 36 , 37 ]. Consistent with previous studies of vent and seep fauna, our results showed both G. haimaensis and A. marissinica contained high proportions of bacterial fatty acids and showed the clearest signatures of seep dependency [ 36 ]. A. marissinica lacked detectable essential PUFAs, indicating strict reliance on symbiont-derived nutrition. In contrast, G. haimaensis contained trace levels of EPA and AA. Because its transcriptome lacks ω3-desaturase genes and therefore cannot synthesize these PUFAs de novo , the trace EPA and AA must originate from an external dietary source. This nutritional flexibility may explain why G. haimaensis occasionally occurs in inactive or weakly active seep areas, whereas A. marissinica is restricted to actively venting sites. Thus, although essential PUFAs are generally critical for animal development, they appear dispensable for these seep-adapted bivalves. Transcriptomic analyses identified three fatty acid desaturase (Fad) genes in both species, which clustered into the two clades typical of invertebrates [ 23 ]. Gene duplication is a primary mechanism for generating genetic novelty and functional diversification [ 38 , 39 ]. We observed lineage-specific duplications within the Δ5-Fad clade of both G. haimaensis and A. marissinica . These duplicated genes likely underpin novel desaturase activities that enable survival in a PUFA-poor environment. Comparable duplication events have been reported across mollusks (e.g., Haliotis discus , Crassostrea gigas , Lottia gigantea ) [ 19 , 21 ] and vertebrates (fish and mammals)[ 40 ], highlighting the widespread evolutionary role of Fad gene expansion. Given the chronically low dietary PUFA supply at seeps, we asked whether these bivalves retain any capacity for long-chain PUFA (LC-PUFA) biosynthesis. Functional characterization revealed that GhFads3 and AmFads3 (Δ6/8 clade) exhibit Δ8-desaturase activity on PUFA substrates, while GhFads2 and AmFads1 display classical Δ5-desaturase activity. These enzymes together enable LC-PUFA synthesis via the alternative “Δ8 pathway.” Moreover, conversion efficiencies of the seep bivalve Fads (28.19–76.55%) substantially exceed those reported for littoral counterparts such as Chlamys nobilis (14.9–31.4%)[ 22 , 23 ] and Sinonovacula constricta (8.58–13.39%)[ 24 ], suggesting enhanced biosynthetic capacity adapted to nutrient scarcity. Functional characterization of invertebrate desaturases has established that NMI fatty acid biosynthesis is primarily catalyzed by Δ5-desaturases. For example, the scallop Δ5 Fad converts C18:1n-9, C20:3n-3, and C20:2n-6 into Δ5,9 C18:2, Δ5,11,14,17 C20:4, and Δ5,11,14 C20:3, respectively [ 22 ]. Similarly, urchin FadsA introduces a Δ5 double bond into the MUFA substrates 20:1n-9 and 20:1n-7, yielding Δ5,11 20:2 and Δ5,13 20:2 [ 24 ]. Fatty acid profiles of the two seep bivalves contained the diagnostic NMI species Δ5,11 C18:2 and Δ5,13 20:2, indicating that their endogenous Δ5 Fads convert dietary or endogenous MUFAs into these unusual dienoic acids. Heterologous expression confirmed that the duplicated isoforms GhFads1 and AmFads2 possess Δ5-desaturase activity specifically toward C18:1n-7. Notably, neither enzyme acted on the substrates preferred by the scallop Δ5 Fad (C18:1n-9, C20:3n-3 or C20:2n-6), demonstrating distinct regioselectivity and clear functional diversification among the Δ5 Fad isoforms. Because cold-seep environments are naturally enriched in n-7 fatty acids, the strong substrate preference of GhFads1 and AmFads2 for C18:1n-7 constitutes a precise nutritional and environmental adaptation. NMI fatty acids are widely reported in invertebrates, yet their physiological roles remain comparatively understudied [ 41 ]. Because authentic NMI fatty acids are not commercially available, we exploited GhFads1-transformed yeast cells—which accumulate high levels of NMI fatty acids when supplied with C18:1n-7—as a convenient in vivo model to probe function. These engineered cells exhibited growth performance at low temperature (15°C) that was indistinguishable from yeast supplemented with the conventional PUFA linoleic acid (C18:2n-6). This result is mechanistically coherent with the well-established role of PUFAs in cold adaptation [ 42 , 43 ]. Low temperature reduces kinetic energy and promotes tighter van der Waals interactions between saturated acyl chains, driving the membrane bilayer from the fluid liquid-crystalline phase into a more ordered, gel-like state [ 43 ]. The cis double bonds in PUFAs (and apparently in NMI fatty acids) introduce steric “kinks” that disrupt chain packing, lower the gel-to-liquid crystalline transition temperature, and restore optimal membrane fluidity [ 44 ]. This homeoviscous adaptation preserves critical membrane properties—permeability, lateral diffusion of proteins, and activity of membrane-bound enzymes—thereby enabling cellular function in chronically cold habitats [ 42 ]. Deep-sea environments impose the additional challenge of high hydrostatic pressure, which also compresses the lipid bilayer, reduces free volume, and favors the ordered gel phase, increasing rigidity and impairing membrane transport, ion channel gating, and protein conformational dynamics [ 45 , 46 ]. Organisms adapted to high-pressure environments counteract this through elevated incorporation of PUFAs, whose multiple cis double bonds create persistent molecular disorder that offsets pressure-induced ordering [ 46 ]. Unexpectedly, GhFads1-transformed yeast cells supplied with C18:1n-7 grew significantly better under hyperbaric conditions than those supplemented with conventional PUFAs. It is hypothesized that the NMI arrangement of double bonds in these fatty acids creates a distinct chain conformation. ​This unique structure might be more effective at preventing pressure-driven chain alignment or at stabilizing specific lipid-protein interactions, offering an advantage in membrane dynamics and transport capacity beyond what classical methylene-interrupted PUFAs provide. ​Despite these observations, the exact biophysical mechanisms through which NMI fatty acids enhance survival in combined cold and high-pressure conditions, such as their effects on bilayer thickness, lateral pressure profiles, or specific lipid domain formation, still require further investigation. ​Such studies would help clarify if NMI fatty acids represent a specialized evolutionary adaptation for life in extreme deep-sea chemosynthetic ecosystems. In conclusion, this study provides the comprehensive report of Fads in cold-seep bivalves that host chemosynthetic bacteria as symbionts. Our results demonstrate that these bivalves retain a high capacity for lcPUFA biosynthesis, despite inhabiting an environment persistently deficient in PUFAs. Notably, the identified Fads exhibited desaturase activity toward bacterial C18 MUFA substrates, leading to the production of NMI PUFAs. This finding suggests a unique enzymatic adaptation to the nutritional constraints of the cold-seep ecosystem. Furthermore, physiological assays revealed that NMI fatty acids may confer protective benefits under cold and high-pressure conditions. Together, these results provide compelling molecular evidence for the endogenous synthesis of PUFAs in deep-sea bivalves and, more specifically, for the production of unusual NMI-FAs as a potential adaptive strategy in extreme environments. Declarations Declaration of competing interest The authors declare no competing interests. Declaration of AI-assisted technologies in the manuscript preparation process During the preparation of this work the authors only used ChatGPT for language editing and make sentence readable. After using this service, the authors reviewed and edited the content as needed and take full responsibility for the content of the published article. CRediT authorship contribution statement Runlin Liu: Writing – original draft, Methodology, Formal analysis. Danli Jiang: Writing – review & editing. Meixia Chen: Writing – review & editing. Helu Liu: Writing – review & editing, Supervision, Funding acquisition. Acknowledgments We acknowledge the crews of the research vessel TANSUO 2 and the pilots of the HOV SHENHAIYONGSHI under cruise of TS2-30 for their kind help with collecting specimens. This work was supported by National Key R & D Program of China (2022YFC2805505), Hainan Provincial Natural Science Foundation of China (823QN247) and National Natural Science Foundation of China (41606152). References Levin, L.A. (2005) Ecology of Cold Seep Sediments: Interactions of Fauna with Flow, Chemistry and Microbes. Oceanogr. Mar. Biol. Annu. Rev. 43:751–754. Paull, C.K., Hecker, B., Commeau, R., Freemanlynde, R.P., Neumann, C., Corso, W.P., Golubic, S., Hook, J.E., Sikes, E., and Curray, J. (1984) Biological communities at the Florida Escarpment resemble hydrothermal vent taxa. Science 226:965–967. Feng, D., Qiu, J.-W., Hu, Y., Peckmann, J., Guan, H., Tong, H., Chen, C., Chen, J., Gong, S., and Li, N. (2018) Cold seep systems in the South China Sea: An overview. Journal of Asian Earth Sciences 168:3-16. Chen, Z., Ma, S., Qin, G., Qu, M., Zhang, B., and Lin, Q. (2022) Strategy of micro-environmental adaptation to cold seep among different brittle stars’ colonization. . Frontiers in Ecology and Evolution 10:1027139. Yang, S., Lv, Y., Liu, X., Wang, Y., Fan, Q., Yang, Z., Boon, N., Wang, F., Xiao, X., and Zhang, Y. (2020) Genomic and enzymatic evidence of acetogenesis by anaerobic methanotrophic archaea. Nature Communications 11(1):3941. Knittel, K., and Boetius, A. (2009) Anaerobic oxidation of methane: progress with an unknown process. Annual Review of Microbiology 63(1):311-334. Holler, T., Wegener, G., Niemann, H., Deusner, C., Ferdelman, T.G., Boetius, A., Brunner, B., and Widdel, F. (2011) Carbon and sulfur back flux during anaerobic microbial oxidation of methane and coupled sulfate reduction. Proceedings of the National Academy of Sciences 108(52):E1484-E1490. Niu, M., Fan, X., Zhuang, G., Liang, Q., and Wang, F. (2017) Methane-metabolizing microbial communities in sediments of the Haima cold seep area, northwest slope of the South China Sea. FEMS Microbiology Ecology 93(9):fix101. Raggi, L., Schubotz, F., Hinrichs, K.U., Dubilier, N., and Petersen, J.M. (2013) Bacterial symbionts of Bathymodiolus mussels and Escarpia tubeworms from Chapopote, an asphalt seep in the southern Gulf of Mexico. Environmental Microbiology 15(7):1969-1987. Lin, Y.-T., Xu, T., Ip, J.C.-H., Sun, Y., Fang, L., Luan, T., Zhang, Y., Qian, P.-Y., and Qiu, J.-W. (2023) Interactions among deep-sea mussels and their epibiotic and endosymbiotic chemoautotrophic bacteria: Insights from multi-omics analysis. Zoological Research 44(1):106. Ke, Z., Li, R., Chen, Y., Chen, D., Chen, Z., Lian, X., and Tan, Y. (2022) A preliminary study of macrofaunal communities and their carbon and nitrogen stable isotopes in the Haima cold seeps, South China Sea. Deep Sea Research Part I: Oceanographic Research Papers 184:103774. Xu, H., Du, M., Li, J., Zhang, H., Chen, W., Wei, J., Wu, Z., Zhang, H., Li, J., and Chen, S. (2020) Spatial distribution of seepages and associated biological communities within Haima cold seep field, South China Sea. Journal of Sea Research 165:101957. Xu, T., Feng, D., Tao, J., and Qiu, J.-W. (2019) A new species of deep-sea mussel (Bivalvia: Mytilidae: Gigantidas) from the South China Sea: morphology, phylogenetic position, and gill-associated microbes. Deep Sea Research Part I: Oceanographic Research Papers 146:79-90. Vrablik, T.L., and Watts, J.L. (2013) Polyunsaturated fatty acid derived signaling in reproduction and development: insights from Caenorhabditis elegans and Drosophila melanogaster . Molecular Reproduction Development 80(4):244-259. Dong, Y., Wei, Y., Wang, L., Song, K., Zhang, C., Lu, K., and Rahimnejad, S. (2023) Dietary n-3/n-6 polyunsaturated fatty acid ratio modulates growth performance in spotted seabass (Lateolabrax maculatus) through regulating lipid metabolism, hepatic antioxidant capacity and intestinal health. Animal Nutrition 14:20-31. Sambra, V., Echeverria, F., Valenzuela, A., Chouinard-Watkins, R., and Valenzuela, R. (2021) Docosahexaenoic and arachidonic acids as neuroprotective nutrients throughout the life cycle. Nutrients 13(3):986. Vrablik, T.L., and Watts, J.L. (2012) Emerging roles for specific fatty acids in developmental processes. Genes Development 26(7):631-637. Hernanz-Torrijos, M., Bartual, A., and Ortega, M. (2025) Modulation of PUFA and PUA production in coastal diatoms by varying light and phosphate availability. Algal Research:104365. Liu, X., Sheng, J., and Curtiss III, R. (2011) Fatty acid production in genetically modified cyanobacteria. Proceedings of the National Academy of Sciences 108(17):6899-6904. Mo, B.K., Ando, A., Nakatsuji, R., Okuda, T., Takemoto, Y., Ikemoto, H., Kikukawa, H., Sakamoto, T., Sakuradani, E., and Ogawa, J. (2021) Characterization of ω3 fatty acid desaturases from oomycetes and their application toward eicosapentaenoic acid production in Mortierella alpina . Bioscience, Biotechnology, Biochemistry 85(5):1252-1265. Tian, L., Chi, G., Lin, S., Ling, X., and He, N. (2024) Marine microorganisms: Natural factories for polyunsaturated fatty acid production. Blue Biotechnology 1(1):15. Liu, H., Wang, H., Cai, S., and Zhang, H. (2017) A novel ω3-desaturase in the deep sea giant tubeworm Riftia pachyptila . Marine Biotechnology 19(4):345-350. Kabeya, N., Fonseca, M.M., Ferrier, D.E., Navarro, J.C., Bay, L.K., Francis, D.S., Tocher, D.R., Castro, L.F.C., and Monroig, Ó. (2018) Genes for de novo biosynthesis of omega-3 polyunsaturated fatty acids are widespread in animals. Science adances 4(5):eaar6849. Waldock, M., and Holland, D. (1984) Fatty acid metabolism in young oysters, Crassostrea gigas : polyunsaturated fatty acids. Lipids 19(5):332. Surm, J.M., Prentis, P.J., and Pavasovic, A. (2015) Comparative analysis and distribution of omega-3 lcPUFA biosynthesis genes in marine molluscs. PLoS One 10(8):e0136301. Monroig, Ó., Navarro, J.C., Dick, J.R., Alemany, F., and Tocher, D.R. (2012) Identification of a Δ5-like fatty acyl desaturase from the cephalopod Octopus vulgaris (Cuvier 1797) involved in the biosynthesis of essential fatty acids. Marine Biotechnology 14(4):411-422. Li, M., Mai, K., He, G., Ai, Q., Zhang, W., Xu, W., Wang, J., Liufu, Z., Zhang, Y., and Zhou, H. (2013) Characterization of two Δ5 fatty acyl desaturases in abalone ( Haliotis discus hannai Ino). Aquaculture 416:48-56. Liu, H., Guo, Z., Zheng, H., Wang, S., Wang, Y., Liu, W., and Zhang, G. (2014) Functional characterization of a Δ5-like fatty acyl desaturase and its expression during early embryogenesis in the noble scallop Chlamys nobilis Reeve. Molecular Biology Reports 41(11):7437-7445. Liu, H., Zhang, H., Zheng, H., Wang, S., Guo, Z., and Zhang, G. (2014) PUFA biosynthesis pathway in marine scallop Chlamys nobilis Reeve. Journal of Agricultural Food Chemistry 62(51):12384-12391. Ran, Z., Xu, J., Liao, K., Li, S., Chen, S., and Yan, X. (2018) Biosynthesis of polyunsaturated fatty acids in the razor clam Sinonovacula constricta : characterization of Δ5 and Δ6 fatty acid desaturases. Journal of Agricultural Food Chemistry 66(18):4592-4601. Teng, T., Zheng, Z., Jiao, W., Liu, N., Wang, A., Liu, M., Xie, L., Yang, Z., Hu, J., and Bao, Z. (2024) Characterization and. Genes 15(3):365. Fullarton, J.G., Dando, P.R., Sargent, J.R., Southwards, A.J., and Southward, E.C. (1995) Fatty acids of hydrothermal vent Ridgeia piscesae and inshore bivalves containing symbiotic bacteria. Journal of the Marine Biological Association of the United Kingdom 75(2):455-468. Guan, H., Feng, D., Birgel, D., Kiel, S., Peckmann, J., Li, S., and Tao, J. (2022) Lipid biomarker patterns reflect nutritional strategies of seep-dwelling bivalves from the South China Sea. Frontiers in Marine Science 9:831286. Nichols, P.D., Glen A, S., Antworth, C.P., Hanson, R.S., and White, D.C. (1985) Phospholipid and lipopolysaccharide normal and hydroxy fatty acids as potential signatures for methane-oxidizing bacteria. FEMS Microbiology Ecology 1(6):327-335. Bowman, J.P., Skerratt, J.H., Nichols, P.D., and Sly, L.I. (1991) Phospholipid fatty acid and lipopolysaccharide fatty acid signature lipids in methane-utilizing bacteria. FEMS Microbiology Letters 85(1):15-21. Guezennec, J., and Fiala-Medioni, A. (1996) Bacterial abundance and diversity in the Barbados Trench determined by phospholipid analysis. FEMS microbiology ecology 19(2):83-93. Ben-Mlih, F., Marty, J., and Fiala-Medioni, A. (1992) Fatty acid composition in deep hydrothermal vent symbiotic bivalves. Journal of Lipid Research 33(12):1797-1806. Folch, J., Lees, M., and Stanley, G.S. (1957) A simple method for the isolation and purification of total lipides from animal tissues. Journal of biological chemistry 226(1):497-509. Hamilton, J.G., and Comai, K. (1988) Rapid separation of neutral lipids, free fatty acids and polar lipids using prepacked silica Sep-Pak columns. Lipids 23(12):1146-1149. Tamura, K., Stecher, G., and Kumar, S. (2021) MEGA11: molecular evolutionary genetics analysis version 11. Molecular Biology Evolution 38(7):3022-3027. Hastings, N., Agaba, M., Tocher, D.R., Leaver, M.J., Dick, J.R., Sargent, J.R., and Teale, A.J. (2001) A vertebrate fatty acid desaturase with Δ5 and Δ6 activities. Proceedings of the National Academy of Sciences 98(25):14304-14309. Ramirez-Llodra, E., Brandt, A., Danovaro, R., De Mol, B., Escobar, E., German, C.R., Levin, L.A., Martinez Arbizu, P., Menot, L., Buhl-Mortensen, P., et al. (2010) Deep, diverse and definitely different: unique attributes of the world's largest ecosystem. Biogeosciences 7(9):2851-2899. Sun, Q.-L., Xu, K., Cao, L., Du, Z., Wang, M., and Sun, L. (2023) Nitrogen and sulfur cycling driven by Campylobacterota in the sediment–water interface of deep-sea cold seep: a case in the South China Sea. mBio. Levin, L.A. (2005) ECOLOGY OF COLD SEEP SEDIMENTS: INTERACTIONS OF FAUNA WITH FLOW, CHEMISTRY AND MICROBES. Oceanography and Marine Biology 43:11-56. Svetashev, V.I.J.M.D. (2021) Investigation of deep-sea ecosystems using marker fatty acids: Sources of essential polyunsaturated fatty acids in abyssal megafauna. Marine Drugs 20(1):17. Colaço, A., Desbruyères, D., and Guezennec, J. (2007) Polar lipid fatty acids as indicators of trophic associations in a deep‐sea vent system community. Marine Ecology 28(1):15-24. von Weissenberg, E., Ruhanen, H., Holopainen, M., Käkelä, R., and Engström-Öst, J.J.F.i.M.S. (2024) Fatty acid profiles reveal dietary variability of a large calanoid copepod Limnocalanus macrurus in the northern Baltic Sea. 11:1340349. Ohta, T. (1989) Role of gene duplication in evolution. Genome 31(1):304-310. Long, M., and Thornton, K. (2001) Gene duplication and evolution. Science 293(5535):1551-1551. Monroig, Ó., Zheng, X., Morais, S., Leaver, M.J., Taggart, J.B., and Tocher, D.R. (2010) Multiple genes for functional∆ 6 fatty acyl desaturases (Fad) in Atlantic salmon (Salmo salar L.): Gene and cDNA characterization, functional expression, tissue distribution and nutritional regulation. Biochimica et Biophysica Acta -Molecular Cell Biology of Lipids 1801(9):1072-1081. Zheng, X., Seiliez, I., Hastings, N., Tocher, D.R., Panserat, S., Dickson, C., Bergot, P., and Teale, A. (2004) Characterization and comparison of fatty acyl Δ6 desaturase cDNAs from freshwater and marine teleost fish species. Comparative Biochemistry Physiology Part B: Biochemistry Molecular Biology 139(2):269-279. Teng, T., Zheng, Z., Jiao, W., Liu, N., Wang, A., Liu, M., Xie, L., Yang, Z., Hu, J., and Bao, Z. (2024) Characterization and Functional Analysis of Fads Reveals Δ5 Desaturation Activity during Long-Chain Polyunsaturated Fatty Acid Biosynthesis in Dwarf Surf Clam Mulinia lateralis . Genes 15(3):365. Tanaka, T., Takimoto, T., Morishige, J.-i., Kikuta, Y., Sugiura, T., and Satouchi, K. (1999) Non-methylene-interrupted polyunsaturated fatty acids: effective substitute for arachidonate of phosphatidylinositol. Biochemical Biophysical Research Communications 264(3):683-688. Kharlamenko, V.I., and Odintsova, N.A. (2019) Unusual methylene-interrupted polyunsaturated fatty acids of abyssal and hadal invertebrates. Progress in Oceanography 178:102132. Hazel, J.R. (1995) Thermal adaptation in biological membranes: is homeoviscous adaptation the explanation? Annual review of physiology 57(1):19-42. Sinensky, M. (1974) Homeoviscous adaptation—a homeostatic process that regulates the viscosity of membrane lipids in Escherichia coli. Proceedings of the National Academy of Sciences 71(2):522-525. Seelig, A., and Seelig, J. (1977) Effect of a single cis double bond on the structure of a phospholipid bilayer. Biochemistry 16(1):45-50. Roach, C., Feller, S.E., Ward, J.A., Shaikh, S.R., Zerouga, M., and Stillwell, W. (2004) Comparison of cis and trans fatty acid containing phosphatidylcholines on membrane properties. Biochemistry 43(20):6344-6351. Wu, G., Baumeister, R., and Heimbucher, T. (2023) Molecular mechanisms of lipid-based metabolic adaptation strategies in response to cold. Cells 12(10):1353. Herrera, C.M., Voss, B.J., and Trent, M.S. (2021) Homeoviscous adaptation of the Acinetobacter baumannii outer membrane: alteration of lipooligosaccharide structure during cold stress. MBio 12(4):10.1128/mbio. 01295-01221. KANEko, H., Takami, H., Inoue, A., and Horikoshi, K. (2000) Effects of hydrostatic pressure and temperature on growth and lipid composition of the inner membrane of barotolerant Pseudomonas sp. BT1 isolated from the deep-sea. Bioscience, Biotechnology, Biochemistry 64(1):72-79. Fang, J., and Bazylinski, D.A. (2008) Deep‐Sea Geomicrobiology. High‐Pressure Microbiology:237-264. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9035091","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":605958220,"identity":"be782a29-d85c-4561-a792-e59b53287922","order_by":0,"name":"Runli Liu","email":"","orcid":"","institution":"Hainan Medical University","correspondingAuthor":false,"prefix":"","firstName":"Runli","middleName":"","lastName":"Liu","suffix":""},{"id":605958221,"identity":"ec12e364-a014-4a9c-84f3-9f31069adf34","order_by":1,"name":"Danli Jiang","email":"","orcid":"","institution":"Hainan Medical University","correspondingAuthor":false,"prefix":"","firstName":"Danli","middleName":"","lastName":"Jiang","suffix":""},{"id":605958223,"identity":"c3e8a8df-2e3d-443e-84e5-9dbd084ee8ca","order_by":2,"name":"Meixia Chen","email":"","orcid":"","institution":"Chinese Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Meixia","middleName":"","lastName":"Chen","suffix":""},{"id":605958230,"identity":"37e66dff-a8a5-40f2-a58a-01224b075c8d","order_by":3,"name":"Helu Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYBACAwbmBoYHBgxybAwJRGthbGBIMGAwJlULA0NiA9FazNkb2yQSCg6n97GnP/7wgcFOnoH97AG8Wix7DgK1GBzObeN5YyY5gyHZsIEnD799BjcSoVokctiYeRiYExgkeAzwa7n/EKwlnU0i/fHnPwz1RGi5wQjWksAGJKUZGA4ToeVMYrNFgkG6IdgvPQbHgYwcAlqOHz5448Mfa3n5dmCI/aioludnP4NfC7oJDAxspKgfBaNgFIyCUYAdAAAaDD91NRj1swAAAABJRU5ErkJggg==","orcid":"","institution":"Chinese Academy of Sciences","correspondingAuthor":true,"prefix":"","firstName":"Helu","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2026-03-05 02:54:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9035091/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9035091/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105565110,"identity":"52758f08-53f5-4be3-a758-e3b2d9ff752d","added_by":"auto","created_at":"2026-03-27 12:51:59","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3296569,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eColor images of macrofaunal ecosystem from the Haima Cold Seeps. \u003c/strong\u003e\u003cem\u003eP. buccinoides\u003c/em\u003e, \u003cem\u003eM. lauensis\u003c/em\u003e, \u003cem\u003eH. haimaensis\u003c/em\u003e, \u003cem\u003eC. heheva\u003c/em\u003e and \u003cem\u003eB. pettiboneae\u003c/em\u003e were always observed in the mussel \u003cem\u003eG. haimaensis\u003c/em\u003e bed, while \u003cem\u003eA. marissinica\u003c/em\u003e was exclusive to the clam bed. \u003cem\u003eL. polybranchiata\u003c/em\u003e formed a novel group adjacent to the mussel bed.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9035091/v1/545f05b1ac1563d7b15d4dbe.jpg"},{"id":105324977,"identity":"b1522a93-220a-4c9d-9f6d-2b1b5566032d","added_by":"auto","created_at":"2026-03-24 18:29:45","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1324980,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAlignment of Fad protein sequences showing conserved and variable regions. \u003c/strong\u003eThe haeme binding domain (HPGG) and the three histidine boxes (HXXXH, HXXHH and QXXHH) are indicated with a red rectangular outline. CnFads1: \u003cem\u003eChlamys nobilis\u003c/em\u003e Fads1(AIC34709.1). AmFads1, AmFads2, AmFads3:\u003cem\u003eArchivesica_marissinica\u003c/em\u003e Fads. GhFads1, GhFads2, GhFads3:\u003cem\u003eGigantidas_haimaensis\u003c/em\u003eFads.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9035091/v1/a97f701c64708dce62159ad5.jpg"},{"id":105565011,"identity":"6439e51e-78be-4381-99b9-4b804d9a7c0f","added_by":"auto","created_at":"2026-03-27 12:51:34","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":836560,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic tree comparing the deduced aa sequences of Fad from cold seep with their orthologues from representative vertebrates and invertebrates. \u003c/strong\u003eThe tree was constructed using the maximum likelihood method by MEGA 7.0. The horizontal branch length is proportional to the aa substitution rate per site. The numbers represent the frequencies (%) with which the tree topology presented was replicated after 1,000 iterations.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9035091/v1/415c7b77c8a5704eb276957f.jpg"},{"id":105324980,"identity":"800d03bf-e038-47b1-a812-058d21757c24","added_by":"auto","created_at":"2026-03-24 18:29:45","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2901523,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFunctional characterization of the putative Fads2 from chemosymbiotic bivalves G\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e. haimaensis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. marissinica\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein transgenic yeast (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eS. cerevisiae\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e).\u003c/strong\u003e (A-C) FAMEs were extracted from yeast transformed with pYES2-GhFads2 (A), pYES2-GhFads1 (B) and pYES2-AmFads1 (C), and grown in the presence of FA substrates C20:3n−6. (D, G) FAMEs were extracted from yeast transformed with pYES2-GhFads1 (D) or pYES2-AmFads2 (G), and grown in the presence of FA substrates C18:1n−7. (E,F) FAMEs were extracted from yeast transformed with pYES2-GhFads3 in the presence of FA substrates C20:2n−6 (E) or C20:3n−3(F). (H,I) FAMEs were extracted from yeast transformed with pYES2- AmFads3 in the presence of FA substrates C20:2n−6 (H) or C20:3n−3(I). Peaks 1−4 correspond to the major endogenous yeast fatty acids 16:0, 16:1, 18:0 and 18:1n−9, respectively. Only chromatograms showing new productions were displayed here. Horizontal axis: retention time. Vertical axis: FID response.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9035091/v1/d6d032e4d96a11b5d0ce687a.jpg"},{"id":105324978,"identity":"651eea17-ec1b-46e1-af58-57ae77d6aa58","added_by":"auto","created_at":"2026-03-24 18:29:45","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3305312,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNMI fatty acids enhance cellular tolerance to cold and high-pressure stress. \u003c/strong\u003e(A) NMI fatty acids improve cell viability under cold stress. \u003cem\u003eS. cerevisiae\u003c/em\u003e cells were cultured at 15 °C for 24 hours in SC medium supplemented and exogenous fatty acids (C18:0, C18:1n-7, C18:1n-9, or C18:2n-6) at a final concentration of 50 μM. Cell viability was measured after 24 hours. (B) NMI fatty acids improve cell viability under high-pressure stress. Yeast cells were cultured at 28 °C under 20 MPa hydrostatic pressure for 24 hours in SC medium supplemented with exogenous fatty acids (C18:0, C18:1n-7, C18:1n-9 or C18:2n-6) at a final concentration of 50 μM. Cell viability was measured after 24 hours.\u003c/p\u003e","description":"","filename":"figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9035091/v1/4ac15d1c86354da408b1c8f9.jpg"},{"id":108803724,"identity":"8ccc39e0-2874-42d2-b4c0-3c2ccd5ccf21","added_by":"auto","created_at":"2026-05-08 15:04:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":25617993,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9035091/v1/79dd2337-43fb-4518-a8cc-4dc850d50d93.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Functional Characterization of Fad Genes from Two Chemosymbiotic Bivalves Inhabiting the Haima Cold Seep","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDeep-sea chemosynthetic ecosystems, such as hydrothermal vents and cold seeps, constitute remarkable oases of life and biodiversity in an otherwise oligotrophic habitat [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Cold seeps, frequently located along continental margins, are formed by the upward migration of reduced fluids\u0026mdash;including methane, hydrogen sulfide, and hydrocarbons\u0026mdash;through sediments and into the benthic boundary layer. Since the discovery of the first seep community at the Florida Escarpment in 1983 [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], numerous seep systems have been documented globally, including in the Gulf of Mexico, Monterey Bay, the Eastern Mediterranean, the Japan and Kurile trenches, and the South China Sea, spanning depths from 400 to over 6,000 meters [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. These environments create distinct geochemical gradients that support high localized biomass, sustained not by photosynthesis but by microbial chemosynthesis [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The energy base of cold seep is microbial chemosynthesis, driven primarily by anaerobic methane-oxidizing archaea, sulfate-reducing bacteria, and sulfide-oxidizing bacteria [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. This microbial production sustains dense assemblages of megafaunal hosts, such as mussels, clams, and tube worms, which harbor these chemosynthetic symbionts and form the basis of the seep consumer network [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Discovered in 2015, the Haima Cold Seep is one of only two known active seeps in the South China Sea, situated at depths of 1360\u0026ndash;1400 m[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Characterized by considerable biomass and species richness, it hosts over 80 documented species and serves as an excellent model for seep ecology. Among the dominant taxa are the mussel \u003cem\u003eGigantidas haimaensis\u003c/em\u003e and the clam \u003cem\u003eArchivesica marissinica\u003c/em\u003e, both newly described species that form patchy beds and play foundational roles in the seep ecosystem through their symbiotic nutrition [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eLong-chain polyunsaturated fatty acids (lcPUFAs), including arachidonic acid (ARA, 20:4n-6), eicosapentaenoic acid (EPA, 20:5n-3), and docosahexaenoic acid (DHA, 22:6n-3), are essential for animal growth, development, and physiological regulation [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In marine ecosystems, PUFAs are primarily synthesized by marine phytoplankton and other microorganisms, such as diatoms, cyanobacteria, oomycetes, and fungi, and are subsequently transferred through the food web [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Although ω3 fatty acid desaturase (Fad) genes have been widely identified across the animal kingdom, most animals, including bivalves, lack the complete enzymatic machinery for \u003cem\u003ede novo\u003c/em\u003e lcPUFA biosynthesis [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Consequently, they must acquire these fatty acids either directly from dietary sources or indirectly via the desaturation and elongation of precursor PUFAs such as linoleic acid (LA) and α-linolenic acid (ALA). The \u003cem\u003efad\u003c/em\u003e gene family encodes enzymes critical for lcPUFA biosynthesis, with Δ5 and Δ6/8 desaturases playing particularly important roles in the desaturation of PUFA precursors. Studies using \u0026sup1;⁴C-labeled fatty acids have confirmed that marine molluscs can modify their lcPUFA profiles [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], and endogenous \u003cem\u003efad\u003c/em\u003e genes have been widely investigated [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Functionally characterized \u003cem\u003efad\u003c/em\u003e genes have been isolated from several littoral molluscs including \u003cem\u003eOctopus vulgaris\u003c/em\u003e [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], \u003cem\u003eHaliotis discus\u003c/em\u003e [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], \u003cem\u003eChlamys nobilis\u003c/em\u003e [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], \u003cem\u003eSinonovacula constricta\u003c/em\u003e [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] and \u003cem\u003eMulinia lateralis\u003c/em\u003e [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. With the exception of a Δ8 desaturase from \u003cem\u003eC. nobilis\u003c/em\u003e and Δ6 desaturase from \u003cem\u003eS. constricta\u003c/em\u003e, all functionally characterized molluscan Fads exhibit Δ5 desaturase activity. Nevertheless, the phylogenetic relationships and functional diversity of \u003cem\u003efad\u003c/em\u003e gene families in deep-sea molluscs\u0026mdash;which inhabit environments typically poor in PUFAs\u0026mdash;remain entirely unexplored. Moreover, the fatty acid profiles available in deep-sea chemosynthetic ecosystems are distinct: sulfur-oxidizing bacterial symbionts generally produce monounsaturated fatty acids (MUFAs) such as C16:1n-7 and C18:1n-7 [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], while aerobic methanotrophs synthesize n-8 and n-9 MUFAs [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. PUFAs are not typically synthesized by these chemosynthetic prokaryotes [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. As a result, seep/vent-dwelling bivalves often exhibit low levels of essential PUFAs and instead accumulate bacterial MUFAs, a profile that contrasts markedly with that of their shallow-water relatives. Given the physiological importance of PUFAs, it remains an open question how seep bivalves meet their nutritional demands in an environment chronically deficient in these essential lipids, and whether their endogenous PUFA biosynthetic pathways have undergone adaptive evolution.\u003c/p\u003e \u003cp\u003eRecent years have seen a substantial increase in publicly available genome and transcriptome data for deep-sea molluscs. This growing resource, together with advances in bioinformatics and computational analysis, has enabled the prediction and identification of functional genes across diverse molluscan groups. In this study, we identified and characterized \u003cem\u003efad\u003c/em\u003e genes from two dominant bivalves inhabiting the Haima Cold Seep\u0026mdash;\u003cem\u003eGigantidas haimaensis\u003c/em\u003e and \u003cem\u003eArchivesica marissinica\u003c/em\u003e. We performed phylogenetic analyses to elucidate the evolution of the \u003cem\u003efad\u003c/em\u003e gene family within molluscs and determined the functional activity of the encoded enzymes through heterologous expression in yeast.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample Collection\u003c/h2\u003e \u003cp\u003eSamples were collected in October 2023 during cruise TS2-30 aboard the research vessel \u003cem\u003eTANSUOERHAO\u003c/em\u003e at the Haima cold seep in the South China Sea, using the human-occupied vehicle (HOV) \u003cem\u003eSHENHAIYONGSHI\u003c/em\u003e. The sampling site was characterized by active gas seepage and a thriving macrofaunal community, dominated by dense but patchy beds of the bathymodiolin mussel \u003cem\u003eGigantidas haimaensis\u003c/em\u003e and the vesicomyid clam \u003cem\u003eArchivesica marissinica\u003c/em\u003e on a muddy substrate (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Numerous other invertebrates were observed within these beds, including the snail \u003cem\u003ePhymorhynchus buccinoides\u003c/em\u003e, the holothuria \u003cem\u003eChiridota heheva\u003c/em\u003e, the squat lobster \u003cem\u003eMunidopsis lauensis\u003c/em\u003e, and the brittlestar \u003cem\u003eHistampica haimaensis\u003c/em\u003e. The polynoid polychaete \u003cem\u003eBranchipolynoe pettiboneae\u003c/em\u003e was frequently found inhabiting the mantle cavity of \u003cem\u003eG. haimaensis\u003c/em\u003e. Surrounding the bivalve beds, the polychaete \u003cem\u003eLindaspio polybranchiata\u003c/em\u003e occupied burrows in the sediment, extending its hair-like feeding appendages into the water current to capture particulate matter (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Specimens were collected using the HOV's mechanical arm and immediately placed into an insulated biobox to minimize thermal stress. Upon retrieval on deck, samples were flash-frozen in liquid nitrogen and subsequently stored at \u0026minus;\u0026thinsp;80\u0026deg;C until further processing. Species identification was confirmed by sequencing the mitochondrial cytochrome c oxidase subunit I (\u003cem\u003eCoxI\u003c/em\u003e) gene using the universal primers LCO1490 (5\u0026prime;-GGTCAACAAATCATAAAGATATTGG-3\u0026prime;) and HCO2198 (5\u0026prime;-TAAACTTCAGGGTGACCAAAAAATCA-3\u0026prime;).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eLipid Extraction and Fractionation\u003c/h3\u003e\n\u003cp\u003eTotal lipids were extracted from tissues according to the method of Folch et al (1957) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], with minor modifications. Wet tissue weight was recorded, and samples were freeze-dried to constant weight for dry weight determination. Dried tissues were homogenized to a fine powder. Lipids were extracted by adding methanol:chloroform (1:2, v/v) at a solid-to-liquid ratio of 1:5 (w/v), followed by ultrasonication for 10 min and overnight gentle shaking at room temperature. The mixture was centrifuged at 5000 rpm, and the supernatant was collected. Extraction was repeated once, and the supernatants were pooled. To separate the lipid phase, two volumes of ddH₂O were added to the combined organic supernatant. After thorough mixing, the biphasic system was centrifuged at 3000 \u0026times; g for 10 min at 4\u0026deg;C. The lower chloroform phase was carefully collected into a pre-weighed, clean glass tube. Chloroform was evaporated under a nitrogen stream at 45\u0026deg;C, and total lipid content (TLC) was determined gravimetrically. Lipid extracts were fractionated into neutral and polar lipids using Sep-Pak\u003c/p\u003e \u003cp\u003eSilica Vac 6 cc cartridges (WAT036910, Waters) according to the method of Hamilton \u0026amp; Comai [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Cartridges were preconditioned with chloroform. Samples were loaded in chloroform, neutral lipids were\u003c/p\u003e \u003cp\u003eeluted with chloroform, and polar lipids (including phospholipids and glycolipids) were subsequently eluted with methanol. Solvents were evaporated under a nitrogen stream at 45\u0026deg;C, and neutral lipid content (NLC) and polar lipid content (PLC) were determined gravimetrically.\u003c/p\u003e\n\u003ch3\u003eFatty Acid Methyl Ester (FAME) Preparation and Analysis\u003c/h3\u003e\n\u003cp\u003eFor FAME preparation, approximately 100 mg of total lipids was dissolved in 2 mL of 1 M NaOH in methanol (containing 0.01% butylated hydroxytoluene as antioxidant). The mixture was vortexed and incubated at 60\u0026deg;C for 20 min to saponify lipids. After cooling, 2 mL of boron trifluoride-methanol reagent was added, and the mixture was incubated at 60\u0026deg;C for 5 min to methylate free fatty acids. Subsequently, 2 mL of n-hexane was added, and incubation continued at 60\u0026deg;C for 2 min. Saturated NaCl solution (2 mL) was then added, and the tube was allowed to stand at room temperature for 15 min to facilitate phase separation. The upper hexane phase containing FAMEs was transferred to a 1.5 mL Eppendorf tube, centrifuged at \u0026ge;\u0026thinsp;10,000 \u0026times; g for 20 min at 4\u0026deg;C, and passed through a 0.25 \u0026micro;m filter membrane. FAMEs were analyzed by gas chromatography using an Agilent 6890 GC equipped with a flame ionization detector and an HP-88 capillary column (60 m \u0026times; 0.25 mm i.d., 0.25 \u0026micro;m film thickness; Agilent), and time-of-flight mass spectrometry (Agilent 8890-LECO Pegasus BT series, MI, USA) with an Rtx-35ms column (30 m, 0.25 mm i.d., 0.10 \u0026micro;m df; Restek, Bellefonte, PA, USA) coupled to a Pegasus III MS system (Leco, St Joseph, MI, USA). The temperature program was as follows: initial temperature 80\u0026deg;C held for 1 min, increased to 150\u0026deg;C at 20\u0026deg;C/min and held for 10 min, then increased to 230\u0026deg;C at 10\u0026deg;C/min and held for 15 min. Individual FAMEs were identified by comparison with authentic standards, and relative contents were calculated as the percentage of each fatty acid peak area relative to the total fatty acid peak area.\u003c/p\u003e\n\u003ch3\u003eBioinformatic Analysis\u003c/h3\u003e\n\u003cp\u003eTranscriptomic data for \u003cem\u003eG. haimaensis\u003c/em\u003e were obtained from the Science Data Bank (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.scidb.cn/anonymous/Wk5Cbm1t\u003c/span\u003e\u003cspan address=\"https://www.scidb.cn/anonymous/Wk5Cbm1t\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Transcriptomic data for \u003cem\u003eA. marissinica\u003c/em\u003e were retrieved from the NCBI Sequence Read Archive under access no. SRP259750. Raw reads were quality-assessed with FastQC and preprocessed (quality trimming and adapter removal) using fastp v0.12.4. Clean reads were \u003cem\u003ede novo\u003c/em\u003e assembled with Trinity v2.5.1 under default parameters. Redundant transcripts showing\u0026thinsp;\u0026ge;\u0026thinsp;95% sequence similarity were clustered using CD-HIT-EST v4.6.8. Open reading frames (ORFs) and corresponding putative peptide sequences were predicted from the non-redundant transcript sets using TransDecoder v5.7.1. Candidate fatty acid desaturase (Fad) genes were identified by performing homology searches against the predicted peptide sequences with BLASTP v2.12.0.\u003c/p\u003e\n\u003ch3\u003eSequence and Phylogenetic Analyses\u003c/h3\u003e\n\u003cp\u003eMultiple sequence alignments of the putative Fad protein sequences were generated using MUSCLE as implemented in MEGA v.11 [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Neighbor-Joining (NJ) phylogenetic tree was constructed with the same software based on the aligned sequences. Branch support was assessed using bootstrap analysis with 1,000 replicates.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eRNA Extraction\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from adductor tissues of the mussel \u003cem\u003eG. haimaensis\u003c/em\u003e and the clam \u003cem\u003eAr. marissinica\u003c/em\u003e using a TRIzol-based method. Approximately 100 mg of frozen tissue was homogenized in 1 mL of QIAzol Lysis Reagent (Qiagen, #79306). Chloroform (200 \u0026micro;L) was then added, and the mixture was vortexed vigorously for 15 s, incubated at room temperature for 2\u0026ndash;3 min, and centrifuged at 12,000 \u0026times; g for 15 min at 4\u0026deg;C. The upper aqueous phase was carefully transferred to a fresh 1.5 mL microcentrifuge tube and mixed with an equal volume of isopropanol. After incubation at room temperature for 10 min, RNA was precipitated by centrifugation at 12,000 \u0026times; g for 10 min at 4\u0026deg;C. The supernatant was discarded, and the RNA pellet was washed once with 1 mL of 75% ethanol, followed by centrifugation at 7,500 \u0026times; g for 5 min at 4\u0026deg;C. The ethanol was removed, and the pellet was air-dried briefly at room temperature before resuspension in RNase-free water. RNA concentration and purity were determined using a NanoDrop 2000 spectrophotometer (Thermofisher Scientific), and RNA integrity was verified by 1% agarose gel electrophoresis.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ecDNA Synthesis\u003c/h3\u003e\n\u003cp\u003eFirst-strand cDNA was synthesized from 1 \u0026micro;g of total RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermofisher Scientific, #K1622) according to the manufacturer\u0026rsquo;s protocol. Briefly, total RNA was mixed with oligo(dT)₁₈ primers and reaction buffer provided with the kit, denatured at 65\u0026deg;C for 5 min, and immediately chilled on ice. dNTP mix, RNase inhibitor, and RevertAid Reverse Transcriptase were then added. The reverse transcription reaction was carried out at 42\u0026deg;C for 60 min, followed by enzyme inactivation at 70\u0026deg;C for 5 min. Then the synthesized cDNA was stored at \u0026minus;\u0026thinsp;20\u0026deg;C until further use.\u003c/p\u003e\n\u003ch3\u003ePlasmid Construction\u003c/h3\u003e\n\u003cp\u003eOpen reading frames (ORFs) encoding candidate Fads were amplified from cDNA using PrimeSTAR\u0026reg; GXL Premix (Takara, #R053A). PCR reactions consisted of an initial denaturation at 98\u0026deg;C for 30 s, followed by 35 cycles of 98\u0026deg;C for 10 s, annealing at 55\u0026deg;C for 5 s, and extension at 68\u0026deg;C for 60 s. Primers containing the respective restriction sites are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Amplified fragments were purified, digested with the indicated restriction enzymes, and ligated into the same digested yeast expression vector pYES2 (Invitrogen, #V82520). Recombinant plasmids were transformed into compolent cell E. coli DH5α, and verified by Sanger sequencing.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer list\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGhFads1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CGG\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGTACC\u003c/span\u003eCTTCCGATAAGTAGGCCTATGCAAT(Kpn I)\u003c/p\u003e \u003cp\u003eR:TGC\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTCTAGA\u003c/span\u003eATTTAATGAATCTTGTCTGTCTTTA (Xba I)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGhFads2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CGG\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGTACC\u003c/span\u003eAATTTGAAACCTGGATTGAAATGGA(Kpn I)\u003c/p\u003e \u003cp\u003eR:TGC\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTCTAGA\u003c/span\u003eTAAGTCTAATTAATAGACAAGTCAT (Xba I)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGhFads3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CGG\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGTACC\u003c/span\u003eAATTTGAAACCTGGATTGAAATGGA(Kpn I)\u003c/p\u003e \u003cp\u003eR:TGC\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTCTAGA\u003c/span\u003eACTAGTGTGTGGAGACCATGATATA (Xba I)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmFads1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CGG\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGTACC\u003c/span\u003eAATCTGAGTACTGTCGTCTGATGGG(Kpn I)\u003c/p\u003e \u003cp\u003eR:TGC\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTCTAGA\u003c/span\u003eGATCGTCCGTGTGTAATGATGTAGG (Xba I)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmFads2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CGG\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGTACC\u003c/span\u003eACATCCACCGAATACCACTGAACAA(Kpn I)\u003c/p\u003e \u003cp\u003eR:TGC\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTCTAGA\u003c/span\u003eTGTGTTGATTCAATGTAGACTTTAT (Xba I)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmFads3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CGG\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGTACC\u003c/span\u003eACATTAGATCGTGCACTTACAAATA(Kpn I)\u003c/p\u003e \u003cp\u003eR:TGC\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTCTAGA\u003c/span\u003eACATTACGATCACTCTCTGTCCCAC (Xba I)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eHeterologous Expression in Yeast\u003c/h2\u003e \u003cp\u003eSequence-confirmed plasmids were transformed into \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e strain INVSc1 (Invitrogen) following the manufacturer's protocol for the pYES2 vector. Transformants were selected on synthetic complete minimal medium lacking uracil (SC-U). For functional expression, recombinant yeast strains were cultured in SC-U broth containing 2% galactose to induce expression from the GAL1 promoter, as described previously [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Exogenous fatty acid substrates (C18:2n-6, C18:3n-3, C20:2n-6, C20:3n-3, C20:3n-6, and C18:1n-7) were saponified in 0.5 M KOH-ethanol and added to the culture medium at a final concentration of 0.75 \u0026micro;M. Yeast cells were harvested by centrifugation, and total lipids were extracted by homogenization in chloroform:methanol (2:1, v/v) containing 0.01% BHT. Fatty acid methyl esters (FAMEs) were prepared from the extracted lipids, recovered by hexane extraction, and analyzed by gas chromatography as described above. The proportion of substrate fatty acid converted to desaturation product was calculated from the gas chromatograms as 100 \u0026times; [product area/(product area\u0026thinsp;+\u0026thinsp;substrate area)].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eCold and high-pressure treatment\u003c/h2\u003e \u003cp\u003eFor cold stress assays, transgenic yeast cells were cultured in SC-U broth supplemented with 2% galactose at either 15\u0026deg;C or 28\u0026deg;C. Exogenous fatty acid substrates\u0026mdash;including C18:0, C18:1n-7, C18:1n-9, and C18:2n-6\u0026mdash;were individually added to the culture medium at a final concentration of 50 \u0026micro;M. For high-pressure treatment, transformed yeast cells were transferred into 10 mL sterile syringes (or sealed containers) filled with SC-U broth containing 2% galactose and the same four fatty acid substrates (50 \u0026micro;M each). The cultures were incubated at 28\u0026deg;C inside a high-pressure bioreactor and kept at 20 MPa for 24 hours. Following both treatments, cell viability was assessed by counting cell concentrations using a Cellometer. All experiments were performed in 6 replications to ensure statistical reliability.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eData were analyzed and graphed using GraphPad Prism version 10.4.0 (La Jolla, CA, USA). Paired data were evaluated by Student's t-test. We used a one-way ANOVA for multiple comparisons. A P value less than 0.05 was considered as statistically significant.\u003c/p\u003e \u003cp\u003e.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eFatty acid profile analysis in chemosynthetic bivalve of Haima Cold Seep\u003c/h2\u003e \u003cp\u003eLipid contents are presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. In the mussel \u003cem\u003eG. haimaensis\u003c/em\u003e, total lipid content (TLC) values (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) were 5.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20% in gill tissue, 5.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14% in mantle tissue, and 5.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02% in foot tissue. In the clam \u003cem\u003eA. marissinica\u003c/em\u003e, gill tissue exhibited substantially higher TLC (9.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03%) compared to adductor muscle (4.89\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05%) and foot (3.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01%) tissues. Neutral lipids primarily serve as energy storage, while polar lipids constitute the main components of membrane structures. Accordingly, we also quantified polar lipid content (PLC) and neutral lipid content, revealing that PLC accounted for the majority of lipids in all samples (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eLipid content in the two cold seep bivalves\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTissue\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTLC (g/100g DW)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePLC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNLC\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cem\u003eArchivesica marissinica\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGill\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e9.24\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e4.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e3.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAdductor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e4.89\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e3.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFoot\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e3.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e2.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cem\u003eGigantidas haimaensis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGill\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e5.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e3.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAdductor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e5.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e4.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFoot\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e5.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e2.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eFatty acid profiles are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The gills of these two chemosymbiotic bivalves, where they host their associated symbiotic microbes, were characterized by high proportions of bacterial-derived n-7 fatty acids (56.61\u0026ndash;72.28%), with C16:1n-7 as the predominant fatty acid. Compared to \u003cem\u003eG. haimaensis\u003c/em\u003e, \u003cem\u003eA. marissinica\u003c/em\u003e exhibited higher total n-7 fatty acid levels in both muscle and gill tissues. Even though \u003cem\u003eG. haimaensis\u003c/em\u003e were reported to hold the aerobic methanotrophs bacteria, we only detected a trace levels of C16:1n-8 in both the gill (1.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04) and muscle (0.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01%). Polyunsaturated fatty acid (PUFA) analysis revealed that \u003cem\u003eG. haimaensis\u003c/em\u003e contained measurable amounts of essential PUFAs including AA and EPA, whereas docosahexaenoic acid (DHA) was undetectable. In contrast, these essential PUFAs were below detection limits in \u003cem\u003eA. marissinica\u003c/em\u003e tissues.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFatty acid profile in the two cold seep bivalves\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFatty acids\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. haimaensis\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e\u003cem\u003eAr. marissinica\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMuscle\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGill\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003emuscle\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGill\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC14:0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e2.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e9.94\u0026thinsp;\u0026plusmn;\u0026thinsp;1.11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC15:0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC16:0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e19.09\u0026thinsp;\u0026plusmn;\u0026thinsp;2.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e21.38\u0026thinsp;\u0026plusmn;\u0026thinsp;1.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e20.54\u0026thinsp;\u0026plusmn;\u0026thinsp;1.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e10.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.47\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC18:0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e5.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e7.17\u0026thinsp;\u0026plusmn;\u0026thinsp;1.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e4.57\u0026thinsp;\u0026plusmn;\u0026thinsp;1.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e2.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.42\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC14:1n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e2.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC16:1n-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e33.6\u0026thinsp;\u0026plusmn;\u0026thinsp;3.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e39.2\u0026thinsp;\u0026plusmn;\u0026thinsp;2.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e36.02\u0026thinsp;\u0026plusmn;\u0026thinsp;6.33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e52.23\u0026thinsp;\u0026plusmn;\u0026thinsp;2.63\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC18:1n-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e7.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e7.23\u0026thinsp;\u0026plusmn;\u0026thinsp;1.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e8.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e9.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC18:1n-8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC18:1n-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e6.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e3.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e7.02\u0026thinsp;\u0026plusmn;\u0026thinsp;1.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e2.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC20:1n-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e6.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e6.89\u0026thinsp;\u0026plusmn;\u0026thinsp;2.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e8.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e3.57\u0026thinsp;\u0026plusmn;\u0026thinsp;2.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC20:1n-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC16:2n-7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e2.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003csup\u003eΔ5,11\u003c/sup\u003e C18:2n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e5.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e4.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e4.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e2.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC18:2n-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e2.76\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC18:3n-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e2.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0\u0026plusmn;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0\u0026plusmn;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC20:2n-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e2.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.51\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003csup\u003eΔ5,13\u003c/sup\u003e C20:2n\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e2.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.99\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e2.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e3.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC20:4n-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC20:5n-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0\u0026thinsp;\u0026plusmn;\u0026thinsp;0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSum SFA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e26.03\u0026thinsp;\u0026plusmn;\u0026thinsp;3.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e31.46\u0026thinsp;\u0026plusmn;\u0026thinsp;3.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e28.65\u0026thinsp;\u0026plusmn;\u0026thinsp;3.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e23.64\u0026thinsp;\u0026plusmn;\u0026thinsp;2.19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSum MUFA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e54.27\u0026thinsp;\u0026plusmn;\u0026thinsp;4.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e58.15\u0026thinsp;\u0026plusmn;\u0026thinsp;3.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e62.71\u0026thinsp;\u0026plusmn;\u0026thinsp;2.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e69.47\u0026thinsp;\u0026plusmn;\u0026thinsp;4.27\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSum PUFA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e19.7\u0026thinsp;\u0026plusmn;\u0026thinsp;6.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e10.39\u0026thinsp;\u0026plusmn;\u0026thinsp;3.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e8.63\u0026thinsp;\u0026plusmn;\u0026thinsp;2.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e6.89\u0026thinsp;\u0026plusmn;\u0026thinsp;3.31\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSum(n-7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e56.61\u0026thinsp;\u0026plusmn;\u0026thinsp;4.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e60.85\u0026thinsp;\u0026plusmn;\u0026thinsp;2.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e62.11\u0026thinsp;\u0026plusmn;\u0026thinsp;3.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e72.28\u0026thinsp;\u0026plusmn;\u0026thinsp;3.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eNote: The muscle was a mix of adductor and food tissue. \u0026ldquo;-\u0026rdquo;, no detected\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eIdentification and phylogenetic analysis of candidate Fad genes\u003c/h2\u003e \u003cp\u003eThrough transcriptome assembly and homology-based searches, we identified multiple \u003cem\u003efad\u003c/em\u003e transcripts. Both \u003cem\u003eG. haimaensis\u003c/em\u003e and \u003cem\u003eA. marissinica\u003c/em\u003e possessed three full-length Fads each, with lengths ranging from 432 to 444 amino acids (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). These identified full-length peptides contained both the characteristic cyt-b5 (PF00173) and FA_desaturase (PF00487) domains, displaying a 47.27%-61.50% similarity to the functionally characterized \u003cem\u003eChlamys nobilis\u003c/em\u003e Fads (AIC34709). No ω3 Fad was identified in both bivalves suggesting their disability to \u003cem\u003ede novo\u003c/em\u003e biosynthesize the PUFA. Multiple sequence alignment of the full-length Fad proteins revealed high conservation of critical functional motifs across these Fads (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). These included the hame-binding motif (HPGG) and the three histidine-rich boxes: HXXXH, HXXHH, and QXXHH. The first histidine box conformed to the consensus sequence HD(F/V/Y)GH, with a high variation at the third amino acid. The second box (HXXHH) was variant, with a consensus of H(Y/F/S)(Q/L)HH. The final QXXHH box was highly conserved sequence Q(I/V)EHH, with only a conservative isoleucine-to-valine substitution observed in one \u003cem\u003eA. marissinica\u003c/em\u003e Fads2.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of candidate genes that encode putative Fad proteins identified from transcriptome assemblies\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eContig name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFull length\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProtein length\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePfam domain\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cem\u003eArchivesica_marissinica\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmFads2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e432\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ecyt-b5,FA_desaturase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmFads1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e436\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ecyt-b5,FA_desaturase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmFads3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e444\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ecyt-b5,FA_desaturase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cem\u003eGigantidas_haimaensis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGhFads1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e435\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ecyt-b5,FA_desaturase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGhFads2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e435\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ecyt-b5,FA_desaturase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGhFads3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eYes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e438\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ecyt-b5,FA_desaturase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFads usually formed two clades according to their catalytic activity (Δ5 and Δ6/8 desaturation activity) in phylogenetic topology, which was reported both in vertebrate and invertebrate [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Phylogenetic analysis of the full-length ORF sequences for these cold seep Fad sequences also identified two well supported clades (Δ5 Fad clade and Δ6 Fads clade) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Both \u003cem\u003eG. haimaensis\u003c/em\u003e and \u003cem\u003eA. marissinica\u003c/em\u003e had two Fads formed distinct pairs that clustered within the Δ5 Fad clade and one Fad cluster within the Δ6 Fad clade, indicating a lineage-specific gene duplication event for these two species within Δ5 Fad clade.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eFunctional characterization of Fad genes\u003c/h2\u003e \u003cp\u003eThe putative Fad desaturases from these two vent bivalves were functionally characterized by heterologously expressing their cDNA open reading frames (ORFs) in yeast in the presence of Δ5- (C20:3n\u0026thinsp;\u0026minus;\u0026thinsp;6), Δ6-(C18:3n\u0026thinsp;\u0026minus;\u0026thinsp;3 and C18:2n\u0026thinsp;\u0026minus;\u0026thinsp;6), and Δ8-desaturation (C20:2n\u0026thinsp;\u0026minus;\u0026thinsp;6 and C20:3n\u0026thinsp;\u0026minus;\u0026thinsp;3) substrates. and analyzing the resulting fatty acid profiles. Yeast cell transformed with the empty pYES2 vector (control) showed a baseline fatty acid profile consisting primarily of C16:0, C16:1n\u0026thinsp;\u0026minus;\u0026thinsp;7, C18:0, and C18:1n\u0026thinsp;\u0026minus;\u0026thinsp;9 (Data not shown). Yeast transformed with GhFads2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), GhFads1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) or AmFads1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC) showed a Δ5-desaturase activity, as evidenced by their ability to convert C20:3n-6 into C20:4n-6 (AA), with conversion rates of 31.37%, 76.55%, and 45.94%, respectively(Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), while AmFads2 exhibited no detectable Δ5-desaturase activity toward C20:3n-6. None of these genes displayed Δ6- or Δ8-desaturase activity when tested with the corresponding substrates. Interestingly, AmFads2 showed activity toward the MUFA substrate C18:1n-7, converting it to \u003csup\u003e5,11\u003c/sup\u003e C18:2n-7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), thereby demonstrating Δ5-desaturase activity on this MUFA. However, it displayed no activity on C18:1n-9, indicating substrate specificity. Similarly, GhFads1 was also able to catalyze C18:1n-7 into \u003csup\u003e5,11\u003c/sup\u003e C18:2n-7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG) without activity on C18:1n-9. Thus, GhFads1 exhibited broader substrate specificity than AmFads2, as it acted on both MUFA and PUFA substrates. In contrast, functional assays revealed no catalytic activity of GhFads2 or AmFads1 toward C18:1n-7.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFunctional characterization of the putative desaturase cDNA from chemosymbiotic bivalves G. \u003cem\u003ehaimaensis\u003c/em\u003e and \u003cem\u003eAr. marissinica\u003c/em\u003e in the yeast \u003cem\u003eS. cerevisiae\u003c/em\u003e cell\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFad gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSubstrate\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProduction\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eConversion Ratio (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eActivity\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGhFads1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:3n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20:4n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e31.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:1n\u0026minus;7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC18:2n(7,13)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e43.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGhFads2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:3n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20:4n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e76.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:1n\u0026minus;7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmFads1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:3n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20:4n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e45.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:1n\u0026minus;7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmFads2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:3n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:1n\u0026minus;7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC18:2n(7,13)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e27.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGhFads3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20:3n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e36.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:3n\u0026minus;3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20:4n\u0026minus;3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e35.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:3n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:1n\u0026minus;7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmFads3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20:3n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e37.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:3n\u0026minus;3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC20:4n\u0026minus;3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e28.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:2n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC20:3n\u0026minus;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC18:1n\u0026minus;7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eΔ6/8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eWhen yeast transformed with AmFads3 or GhFads3 recombinant plasmids were grown in the presence of Δ5- (C20:3n\u0026thinsp;\u0026minus;\u0026thinsp;6), Δ6-(C18:3n\u0026thinsp;\u0026minus;\u0026thinsp;3 and C18:2n\u0026thinsp;\u0026minus;\u0026thinsp;6), and Δ8-desaturation (C20:2n\u0026thinsp;\u0026minus;\u0026thinsp;6 and C20:3n\u0026thinsp;\u0026minus;\u0026thinsp;3) substrates. Both of AmFads3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE,F) and GhFads3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH,I) convert the exogenously added C20:2n\u0026thinsp;\u0026minus;\u0026thinsp;6 and C20:3n\u0026thinsp;\u0026minus;\u0026thinsp;3 into C20:3n\u0026thinsp;\u0026minus;\u0026thinsp;6 and C20:4n\u0026thinsp;\u0026minus;\u0026thinsp;3 respectively, indicating that both of AmFads3 and GhFads3 possessed Δ8-desaturation activity. About 36.41% of 20:2n\u0026thinsp;\u0026minus;\u0026thinsp;6 and 35.95% of 20:3n\u0026thinsp;\u0026minus;\u0026thinsp;3 were desaturated to 20:3n\u0026thinsp;\u0026minus;\u0026thinsp;6 and 20:4n\u0026thinsp;\u0026minus;\u0026thinsp;3 respectively for GhFads3. About 37.07% of 20:2n\u0026thinsp;\u0026minus;\u0026thinsp;6 and 28.19% of 20:3n\u0026thinsp;\u0026minus;\u0026thinsp;3 were desaturated to 20:3n\u0026thinsp;\u0026minus;\u0026thinsp;6 and 20:4n\u0026thinsp;\u0026minus;\u0026thinsp;3 for AmFads3(Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). No additional desaturated products were detected when Δ6 (18:3n\u0026thinsp;\u0026minus;\u0026thinsp;3 and 18:2n\u0026thinsp;\u0026minus;\u0026thinsp;6) or Δ5 (20:3n\u0026thinsp;\u0026minus;\u0026thinsp;6) fatty acids were used as the substrates, indicating that both of AmFads3 and GhFads3 possessed no Δ6- or Δ5-desaturation activity. Thus, both of AmFads3 or GhFads3 display a classical Δ8-desaturation activity.\u003c/p\u003e \u003cp\u003e \u003cb\u003eNon-methylene-interrupted (NMI) fatty acids enhance cellular tolerance to cold and high-pressure stress.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate the potential function of NMI fatty acids, we assessed the growth performance of yeast cells transformed with GhFads1, as this enzyme efficiently converts C18:1n-7 into the NMI fatty acid C18:2n-7. Under standard culture conditions at 28\u0026deg;C, the addition of exogenous fatty acids showed little significant difference on cell growth than vehicle (\u003cb\u003edata not shown\u003c/b\u003e). However, when cultured at 15\u0026deg;C, the addition of C18:1n-7, C18:1n-9, and C18:2n-6 significantly promoted yeast cell growth compared to the vehicle (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In empty vector control cells, C18:2n-6 conferred a greater growth advantage than C18:1n-7 or C18:1n-9 under cold stress. GhFads1-transformed cells supplemented with C18:1n-7\u0026mdash;the substrate for NMI C18:2n-7 production\u0026mdash;exhibited growth comparable to that of cells supplemented with C18:2n-6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). This suggests that the NMI fatty acid C18:2n-7, endogenously produced by GhFads1, provides a protective effect similar to that of the polyunsaturated fatty acid (PUFA) C18:2n-6.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGiven that deep-sea vent bivalves inhabit environments characterized by constant high hydrostatic pressure, we further examined whether NMI fatty acids confer protection under high-pressure conditions. At 20 MPa, supplementation with all three unsaturated fatty acids significantly enhanced yeast growth, whereas the saturated fatty acid C18:0 reduced growth in empty vector control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Notably, C18:2n-6 did not outperform C18:1n-7 or C18:1n-9 under high pressure. However, GhFads1-transformed yeast cells supplemented with C18:1n-7 showed significantly higher growth than any other group, indicating that the NMI fatty acid C18:2n-7 offers superior protection compared to conventional PUFAs under high-pressure stress.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMost deep-sea ecosystems are heterotrophic and rely on the downward flux of particulate organic matter derived from photosynthesis in surface waters. This chronic energy limitation is a fundamental force shaping deep-sea community structure and function [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. A major exception to this paradigm occurs in chemosynthesis-based ecosystems, where chemical energy replaces solar energy to drive primary production [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The Haima Cold Seep is a classic example, sustaining exceptionally high biodiversity through dense beds of the chemosymbiotic bivalves Gigantidas haimaensis and Archivesica marissinica. These bivalves provision higher trophic levels by hosting endosymbiotic bacteria that perform chemosynthesis. In contrast to surface habitats, where organic matter is rich in essential PUFAs [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], bacterial biomass at cold seeps is characteristically PUFA-poor but enriched in bacterial-derived MUFAs, such as C16:1n-7 and C18:1n-7 [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. These stark compositional differences make fatty acid profiles highly effective trophic tracers [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Consistent with previous studies of vent and seep fauna, our results showed both \u003cem\u003eG. haimaensis\u003c/em\u003e and \u003cem\u003eA. marissinica\u003c/em\u003e contained high proportions of bacterial fatty acids and showed the clearest signatures of seep dependency [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. \u003cem\u003eA. marissinica\u003c/em\u003e lacked detectable essential PUFAs, indicating strict reliance on symbiont-derived nutrition. In contrast, \u003cem\u003eG. haimaensis\u003c/em\u003e contained trace levels of EPA and AA. Because its transcriptome lacks ω3-desaturase genes and therefore cannot synthesize these PUFAs \u003cem\u003ede novo\u003c/em\u003e, the trace EPA and AA must originate from an external dietary source. This nutritional flexibility may explain why G. haimaensis occasionally occurs in inactive or weakly active seep areas, whereas A. marissinica is restricted to actively venting sites. Thus, although essential PUFAs are generally critical for animal development, they appear dispensable for these seep-adapted bivalves.\u003c/p\u003e \u003cp\u003eTranscriptomic analyses identified three fatty acid desaturase (Fad) genes in both species, which clustered into the two clades typical of invertebrates [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Gene duplication is a primary mechanism for generating genetic novelty and functional diversification [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. We observed lineage-specific duplications within the Δ5-Fad clade of both \u003cem\u003eG. haimaensis\u003c/em\u003e and \u003cem\u003eA. marissinica\u003c/em\u003e. These duplicated genes likely underpin novel desaturase activities that enable survival in a PUFA-poor environment. Comparable duplication events have been reported across mollusks (e.g., \u003cem\u003eHaliotis discus\u003c/em\u003e, \u003cem\u003eCrassostrea gigas\u003c/em\u003e, \u003cem\u003eLottia gigantea\u003c/em\u003e) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] and vertebrates (fish and mammals)[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], highlighting the widespread evolutionary role of Fad gene expansion. Given the chronically low dietary PUFA supply at seeps, we asked whether these bivalves retain any capacity for long-chain PUFA (LC-PUFA) biosynthesis. Functional characterization revealed that GhFads3 and AmFads3 (Δ6/8 clade) exhibit Δ8-desaturase activity on PUFA substrates, while GhFads2 and AmFads1 display classical Δ5-desaturase activity. These enzymes together enable LC-PUFA synthesis via the alternative \u0026ldquo;Δ8 pathway.\u0026rdquo; Moreover, conversion efficiencies of the seep bivalve Fads (28.19\u0026ndash;76.55%) substantially exceed those reported for littoral counterparts such as \u003cem\u003eChlamys nobilis\u003c/em\u003e (14.9\u0026ndash;31.4%)[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] and \u003cem\u003eSinonovacula constricta\u003c/em\u003e (8.58\u0026ndash;13.39%)[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], suggesting enhanced biosynthetic capacity adapted to nutrient scarcity. Functional characterization of invertebrate desaturases has established that NMI fatty acid biosynthesis is primarily catalyzed by Δ5-desaturases. For example, the scallop Δ5 Fad converts C18:1n-9, C20:3n-3, and C20:2n-6 into \u003csup\u003eΔ5,9\u003c/sup\u003e C18:2, \u003csup\u003eΔ5,11,14,17\u003c/sup\u003e C20:4, and \u003csup\u003eΔ5,11,14\u003c/sup\u003e C20:3, respectively [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Similarly, urchin FadsA introduces a Δ5 double bond into the MUFA substrates 20:1n-9 and 20:1n-7, yielding \u003csup\u003eΔ5,11\u003c/sup\u003e 20:2 and \u003csup\u003eΔ5,13\u003c/sup\u003e 20:2 [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Fatty acid profiles of the two seep bivalves contained the diagnostic NMI species \u003csup\u003eΔ5,11\u003c/sup\u003e C18:2 and \u003csup\u003eΔ5,13\u003c/sup\u003e 20:2, indicating that their endogenous Δ5 Fads convert dietary or endogenous MUFAs into these unusual dienoic acids. Heterologous expression confirmed that the duplicated isoforms GhFads1 and AmFads2 possess Δ5-desaturase activity specifically toward C18:1n-7. Notably, neither enzyme acted on the substrates preferred by the scallop Δ5 Fad (C18:1n-9, C20:3n-3 or C20:2n-6), demonstrating distinct regioselectivity and clear functional diversification among the Δ5 Fad isoforms. Because cold-seep environments are naturally enriched in n-7 fatty acids, the strong substrate preference of GhFads1 and AmFads2 for C18:1n-7 constitutes a precise nutritional and environmental adaptation.\u003c/p\u003e \u003cp\u003eNMI fatty acids are widely reported in invertebrates, yet their physiological roles remain comparatively understudied [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Because authentic NMI fatty acids are not commercially available, we exploited GhFads1-transformed yeast cells\u0026mdash;which accumulate high levels of NMI fatty acids when supplied with C18:1n-7\u0026mdash;as a convenient \u003cem\u003ein vivo\u003c/em\u003e model to probe function. These engineered cells exhibited growth performance at low temperature (15\u0026deg;C) that was indistinguishable from yeast supplemented with the conventional PUFA linoleic acid (C18:2n-6). This result is mechanistically coherent with the well-established role of PUFAs in cold adaptation [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Low temperature reduces kinetic energy and promotes tighter van der Waals interactions between saturated acyl chains, driving the membrane bilayer from the fluid liquid-crystalline phase into a more ordered, gel-like state [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. The cis double bonds in PUFAs (and apparently in NMI fatty acids) introduce steric \u0026ldquo;kinks\u0026rdquo; that disrupt chain packing, lower the gel-to-liquid crystalline transition temperature, and restore optimal membrane fluidity [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. This homeoviscous adaptation preserves critical membrane properties\u0026mdash;permeability, lateral diffusion of proteins, and activity of membrane-bound enzymes\u0026mdash;thereby enabling cellular function in chronically cold habitats [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Deep-sea environments impose the additional challenge of high hydrostatic pressure, which also compresses the lipid bilayer, reduces free volume, and favors the ordered gel phase, increasing rigidity and impairing membrane transport, ion channel gating, and protein conformational dynamics [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Organisms adapted to high-pressure environments counteract this through elevated incorporation of PUFAs, whose multiple cis double bonds create persistent molecular disorder that offsets pressure-induced ordering [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Unexpectedly, GhFads1-transformed yeast cells supplied with C18:1n-7 grew significantly better under hyperbaric conditions than those supplemented with conventional PUFAs. It is hypothesized that the NMI arrangement of double bonds in these fatty acids creates a distinct chain conformation. ​This unique structure might be more effective at preventing pressure-driven chain alignment or at stabilizing specific lipid-protein interactions, offering an advantage in membrane dynamics and transport capacity beyond what classical methylene-interrupted PUFAs provide. ​Despite these observations, the exact biophysical mechanisms through which NMI fatty acids enhance survival in combined cold and high-pressure conditions, such as their effects on bilayer thickness, lateral pressure profiles, or specific lipid domain formation, still require further investigation. ​Such studies would help clarify if NMI fatty acids represent a specialized evolutionary adaptation for life in extreme deep-sea chemosynthetic ecosystems.\u003c/p\u003e \u003cp\u003eIn conclusion, this study provides the comprehensive report of Fads in cold-seep bivalves that host chemosynthetic bacteria as symbionts. Our results demonstrate that these bivalves retain a high capacity for lcPUFA biosynthesis, despite inhabiting an environment persistently deficient in PUFAs. Notably, the identified Fads exhibited desaturase activity toward bacterial C18 MUFA substrates, leading to the production of NMI PUFAs. This finding suggests a unique enzymatic adaptation to the nutritional constraints of the cold-seep ecosystem. Furthermore, physiological assays revealed that NMI fatty acids may confer protective benefits under cold and high-pressure conditions. Together, these results provide compelling molecular evidence for the endogenous synthesis of PUFAs in deep-sea bivalves and, more specifically, for the production of unusual NMI-FAs as a potential adaptive strategy in extreme environments.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of AI-assisted technologies in the manuscript preparation process\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring the preparation of this work the authors only used ChatGPT for language editing and make sentence readable. After using this service, the authors reviewed and edited the content as needed and take full responsibility for the content of the published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRunlin Liu:\u003c/strong\u003e Writing – original draft, Methodology, Formal analysis. \u003cstrong\u003eDanli Jiang:\u003c/strong\u003eWriting – review \u0026amp; editing. \u003cstrong\u003eMeixia Chen:\u0026nbsp;\u003c/strong\u003eWriting – review \u0026amp; editing. \u003cstrong\u003eHelu Liu:\u003c/strong\u003e Writing – review \u0026amp; editing, Supervision, Funding acquisition.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe acknowledge the crews of the research vessel \u003cem\u003eTANSUO\u003c/em\u003e 2 and the pilots of the HOV \u003cem\u003eSHENHAIYONGSHI\u003c/em\u003e under cruise of TS2-30 for their kind help with collecting specimens. This work was supported by National Key R \u0026amp; D Program of China (2022YFC2805505), Hainan Provincial Natural Science Foundation of China (823QN247) and National Natural Science Foundation of China (41606152).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLevin, L.A. (2005) Ecology of Cold Seep Sediments: Interactions of Fauna with Flow, Chemistry and Microbes. Oceanogr. Mar. Biol. Annu. Rev. 43:751\u0026ndash;754.\u003c/li\u003e\n\u003cli\u003ePaull, C.K., Hecker, B., Commeau, R., Freemanlynde, R.P., Neumann, C., Corso, W.P., Golubic, S., Hook, J.E., Sikes, E., and Curray, J. (1984) Biological communities at the Florida Escarpment resemble hydrothermal vent taxa. Science 226:965\u0026ndash;967.\u003c/li\u003e\n\u003cli\u003eFeng, D., Qiu, J.-W., Hu, Y., Peckmann, J., Guan, H., Tong, H., Chen, C., Chen, J., Gong, S., and Li, N. (2018) Cold seep systems in the South China Sea: An overview. Journal of Asian Earth Sciences 168:3-16.\u003c/li\u003e\n\u003cli\u003eChen, Z., Ma, S., Qin, G., Qu, M., Zhang, B., and Lin, Q. (2022) Strategy of micro-environmental adaptation to cold seep among different brittle stars\u0026rsquo; colonization. . Frontiers in Ecology and Evolution 10:1027139.\u003c/li\u003e\n\u003cli\u003eYang, S., Lv, Y., Liu, X., Wang, Y., Fan, Q., Yang, Z., Boon, N., Wang, F., Xiao, X., and Zhang, Y. (2020) Genomic and enzymatic evidence of acetogenesis by anaerobic methanotrophic archaea. Nature Communications 11(1):3941.\u003c/li\u003e\n\u003cli\u003eKnittel, K., and Boetius, A. (2009) Anaerobic oxidation of methane: progress with an unknown process. Annual Review of Microbiology 63(1):311-334.\u003c/li\u003e\n\u003cli\u003eHoller, T., Wegener, G., Niemann, H., Deusner, C., Ferdelman, T.G., Boetius, A., Brunner, B., and Widdel, F. (2011) Carbon and sulfur back flux during anaerobic microbial oxidation of methane and coupled sulfate reduction. Proceedings of the National Academy of Sciences 108(52):E1484-E1490.\u003c/li\u003e\n\u003cli\u003eNiu, M., Fan, X., Zhuang, G., Liang, Q., and Wang, F. (2017) Methane-metabolizing microbial communities in sediments of the Haima cold seep area, northwest slope of the South China Sea. FEMS Microbiology Ecology 93(9):fix101.\u003c/li\u003e\n\u003cli\u003eRaggi, L., Schubotz, F., Hinrichs, K.U., Dubilier, N., and Petersen, J.M. (2013) Bacterial symbionts of \u003cem\u003eBathymodiolus mussels\u003c/em\u003e and \u003cem\u003eEscarpia tubeworms\u003c/em\u003e from Chapopote, an asphalt seep in the southern Gulf of Mexico. Environmental Microbiology 15(7):1969-1987.\u003c/li\u003e\n\u003cli\u003eLin, Y.-T., Xu, T., Ip, J.C.-H., Sun, Y., Fang, L., Luan, T., Zhang, Y., Qian, P.-Y., and Qiu, J.-W. (2023) Interactions among deep-sea mussels and their epibiotic and endosymbiotic chemoautotrophic bacteria: Insights from multi-omics analysis. Zoological Research 44(1):106.\u003c/li\u003e\n\u003cli\u003eKe, Z., Li, R., Chen, Y., Chen, D., Chen, Z., Lian, X., and Tan, Y. (2022) A preliminary study of macrofaunal communities and their carbon and nitrogen stable isotopes in the Haima cold seeps, South China Sea. Deep Sea Research Part I: Oceanographic Research Papers 184:103774.\u003c/li\u003e\n\u003cli\u003eXu, H., Du, M., Li, J., Zhang, H., Chen, W., Wei, J., Wu, Z., Zhang, H., Li, J., and Chen, S. (2020) Spatial distribution of seepages and associated biological communities within Haima cold seep field, South China Sea. Journal of Sea Research 165:101957.\u003c/li\u003e\n\u003cli\u003eXu, T., Feng, D., Tao, J., and Qiu, J.-W. (2019) A new species of deep-sea mussel (Bivalvia: Mytilidae: Gigantidas) from the South China Sea: morphology, phylogenetic position, and gill-associated microbes. Deep Sea Research Part I: Oceanographic Research Papers 146:79-90.\u003c/li\u003e\n\u003cli\u003eVrablik, T.L., and Watts, J.L. (2013) Polyunsaturated fatty acid derived signaling in reproduction and development: insights from \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e and \u003cem\u003eDrosophila melanogaster\u003c/em\u003e. Molecular Reproduction Development 80(4):244-259.\u003c/li\u003e\n\u003cli\u003eDong, Y., Wei, Y., Wang, L., Song, K., Zhang, C., Lu, K., and Rahimnejad, S. (2023) Dietary n-3/n-6 polyunsaturated fatty acid ratio modulates growth performance in spotted seabass (Lateolabrax maculatus) through regulating lipid metabolism, hepatic antioxidant capacity and intestinal health. Animal Nutrition 14:20-31.\u003c/li\u003e\n\u003cli\u003eSambra, V., Echeverria, F., Valenzuela, A., Chouinard-Watkins, R., and Valenzuela, R. (2021) Docosahexaenoic and arachidonic acids as neuroprotective nutrients throughout the life cycle. Nutrients 13(3):986.\u003c/li\u003e\n\u003cli\u003eVrablik, T.L., and Watts, J.L. (2012) Emerging roles for specific fatty acids in developmental processes. Genes Development 26(7):631-637.\u003c/li\u003e\n\u003cli\u003eHernanz-Torrijos, M., Bartual, A., and Ortega, M. (2025) Modulation of PUFA and PUA production in coastal diatoms by varying light and phosphate availability. Algal Research:104365.\u003c/li\u003e\n\u003cli\u003eLiu, X., Sheng, J., and Curtiss III, R. (2011) Fatty acid production in genetically modified cyanobacteria. Proceedings of the National Academy of Sciences 108(17):6899-6904.\u003c/li\u003e\n\u003cli\u003eMo, B.K., Ando, A., Nakatsuji, R., Okuda, T., Takemoto, Y., Ikemoto, H., Kikukawa, H., Sakamoto, T., Sakuradani, E., and Ogawa, J. (2021) Characterization of \u0026omega;3 fatty acid desaturases from oomycetes and their application toward eicosapentaenoic acid production in \u003cem\u003eMortierella alpina\u003c/em\u003e. Bioscience, Biotechnology, Biochemistry 85(5):1252-1265.\u003c/li\u003e\n\u003cli\u003eTian, L., Chi, G., Lin, S., Ling, X., and He, N. (2024) Marine microorganisms: Natural factories for polyunsaturated fatty acid production. Blue Biotechnology 1(1):15.\u003c/li\u003e\n\u003cli\u003eLiu, H., Wang, H., Cai, S., and Zhang, H. (2017) A novel \u0026omega;3-desaturase in the deep sea giant tubeworm \u003cem\u003eRiftia pachyptila\u003c/em\u003e. Marine Biotechnology 19(4):345-350.\u003c/li\u003e\n\u003cli\u003eKabeya, N., Fonseca, M.M., Ferrier, D.E., Navarro, J.C., Bay, L.K., Francis, D.S., Tocher, D.R., Castro, L.F.C., and Monroig, \u0026Oacute;. (2018) Genes for de novo biosynthesis of omega-3 polyunsaturated fatty acids are widespread in animals. Science adances 4(5):eaar6849.\u003c/li\u003e\n\u003cli\u003eWaldock, M., and Holland, D. (1984) Fatty acid metabolism in young oysters, \u003cem\u003eCrassostrea gigas\u003c/em\u003e: polyunsaturated fatty acids. Lipids 19(5):332.\u003c/li\u003e\n\u003cli\u003eSurm, J.M., Prentis, P.J., and Pavasovic, A. (2015) Comparative analysis and distribution of omega-3 lcPUFA biosynthesis genes in marine molluscs. PLoS One 10(8):e0136301.\u003c/li\u003e\n\u003cli\u003eMonroig, \u0026Oacute;., Navarro, J.C., Dick, J.R., Alemany, F., and Tocher, D.R. (2012) Identification of a \u0026Delta;5-like fatty acyl desaturase from the cephalopod Octopus vulgaris (Cuvier 1797) involved in the biosynthesis of essential fatty acids. Marine Biotechnology 14(4):411-422.\u003c/li\u003e\n\u003cli\u003eLi, M., Mai, K., He, G., Ai, Q., Zhang, W., Xu, W., Wang, J., Liufu, Z., Zhang, Y., and Zhou, H. (2013) Characterization of two \u0026Delta;5 fatty acyl desaturases in abalone (\u003cem\u003eHaliotis discus hannai \u003c/em\u003eIno). Aquaculture 416:48-56.\u003c/li\u003e\n\u003cli\u003eLiu, H., Guo, Z., Zheng, H., Wang, S., Wang, Y., Liu, W., and Zhang, G. (2014) Functional characterization of a \u0026Delta;5-like fatty acyl desaturase and its expression during early embryogenesis in the noble scallop \u003cem\u003eChlamys nobilis\u003c/em\u003e Reeve. Molecular Biology Reports 41(11):7437-7445.\u003c/li\u003e\n\u003cli\u003eLiu, H., Zhang, H., Zheng, H., Wang, S., Guo, Z., and Zhang, G. (2014) PUFA biosynthesis pathway in marine scallop \u003cem\u003eChlamys nobilis\u003c/em\u003e Reeve. Journal of Agricultural Food Chemistry 62(51):12384-12391.\u003c/li\u003e\n\u003cli\u003eRan, Z., Xu, J., Liao, K., Li, S., Chen, S., and Yan, X. (2018) Biosynthesis of polyunsaturated fatty acids in the razor clam\u003cem\u003e Sinonovacula constricta\u003c/em\u003e: characterization of \u0026Delta;5 and \u0026Delta;6 fatty acid desaturases. Journal of Agricultural Food Chemistry 66(18):4592-4601.\u003c/li\u003e\n\u003cli\u003eTeng, T., Zheng, Z., Jiao, W., Liu, N., Wang, A., Liu, M., Xie, L., Yang, Z., Hu, J., and Bao, Z. (2024) Characterization and. Genes 15(3):365.\u003c/li\u003e\n\u003cli\u003eFullarton, J.G., Dando, P.R., Sargent, J.R., Southwards, A.J., and Southward, E.C. (1995) Fatty acids of hydrothermal vent \u003cem\u003eRidgeia piscesae\u003c/em\u003e and inshore bivalves containing symbiotic bacteria. Journal of the Marine Biological Association of the United Kingdom 75(2):455-468.\u003c/li\u003e\n\u003cli\u003eGuan, H., Feng, D., Birgel, D., Kiel, S., Peckmann, J., Li, S., and Tao, J. (2022) Lipid biomarker patterns reflect nutritional strategies of seep-dwelling bivalves from the South China Sea. Frontiers in Marine Science 9:831286.\u003c/li\u003e\n\u003cli\u003eNichols, P.D., Glen A, S., Antworth, C.P., Hanson, R.S., and White, D.C. (1985) Phospholipid and lipopolysaccharide normal and hydroxy fatty acids as potential signatures for methane-oxidizing bacteria. FEMS Microbiology Ecology 1(6):327-335.\u003c/li\u003e\n\u003cli\u003eBowman, J.P., Skerratt, J.H., Nichols, P.D., and Sly, L.I. (1991) Phospholipid fatty acid and lipopolysaccharide fatty acid signature lipids in methane-utilizing bacteria. FEMS Microbiology Letters 85(1):15-21.\u003c/li\u003e\n\u003cli\u003eGuezennec, J., and Fiala-Medioni, A. (1996) Bacterial abundance and diversity in the Barbados Trench determined by phospholipid analysis. FEMS microbiology ecology 19(2):83-93.\u003c/li\u003e\n\u003cli\u003eBen-Mlih, F., Marty, J., and Fiala-Medioni, A. (1992) Fatty acid composition in deep hydrothermal vent symbiotic bivalves. Journal of Lipid Research 33(12):1797-1806.\u003c/li\u003e\n\u003cli\u003eFolch, J., Lees, M., and Stanley, G.S. (1957) A simple method for the isolation and purification of total lipides from animal tissues. Journal of biological chemistry 226(1):497-509.\u003c/li\u003e\n\u003cli\u003eHamilton, J.G., and Comai, K. (1988) Rapid separation of neutral lipids, free fatty acids and polar lipids using prepacked silica Sep-Pak columns. Lipids 23(12):1146-1149.\u003c/li\u003e\n\u003cli\u003eTamura, K., Stecher, G., and Kumar, S. (2021) MEGA11: molecular evolutionary genetics analysis version 11. Molecular Biology Evolution 38(7):3022-3027.\u003c/li\u003e\n\u003cli\u003eHastings, N., Agaba, M., Tocher, D.R., Leaver, M.J., Dick, J.R., Sargent, J.R., and Teale, A.J. (2001) A vertebrate fatty acid desaturase with \u0026Delta;5 and \u0026Delta;6 activities. Proceedings of the National Academy of Sciences 98(25):14304-14309.\u003c/li\u003e\n\u003cli\u003eRamirez-Llodra, E., Brandt, A., Danovaro, R., De Mol, B., Escobar, E., German, C.R., Levin, L.A., Martinez Arbizu, P., Menot, L., Buhl-Mortensen, P., et al. (2010) Deep, diverse and definitely different: unique attributes of the world\u0026apos;s largest ecosystem. Biogeosciences 7(9):2851-2899.\u003c/li\u003e\n\u003cli\u003eSun, Q.-L., Xu, K., Cao, L., Du, Z., Wang, M., and Sun, L. (2023) Nitrogen and sulfur cycling driven by Campylobacterota in the sediment\u0026ndash;water interface of deep-sea cold seep: a case in the South China Sea. mBio.\u003c/li\u003e\n\u003cli\u003eLevin, L.A. (2005) ECOLOGY OF COLD SEEP SEDIMENTS: INTERACTIONS OF FAUNA WITH FLOW, CHEMISTRY AND MICROBES. Oceanography and Marine Biology 43:11-56.\u003c/li\u003e\n\u003cli\u003eSvetashev, V.I.J.M.D. (2021) Investigation of deep-sea ecosystems using marker fatty acids: Sources of essential polyunsaturated fatty acids in abyssal megafauna. Marine Drugs 20(1):17.\u003c/li\u003e\n\u003cli\u003eCola\u0026ccedil;o, A., Desbruy\u0026egrave;res, D., and Guezennec, J. (2007) Polar lipid fatty acids as indicators of trophic associations in a deep‐sea vent system community. Marine Ecology 28(1):15-24.\u003c/li\u003e\n\u003cli\u003evon Weissenberg, E., Ruhanen, H., Holopainen, M., K\u0026auml;kel\u0026auml;, R., and Engstr\u0026ouml;m-\u0026Ouml;st, J.J.F.i.M.S. (2024) Fatty acid profiles reveal dietary variability of a large calanoid copepod Limnocalanus macrurus in the northern Baltic Sea. 11:1340349.\u003c/li\u003e\n\u003cli\u003eOhta, T. (1989) Role of gene duplication in evolution. Genome 31(1):304-310.\u003c/li\u003e\n\u003cli\u003eLong, M., and Thornton, K. (2001) Gene duplication and evolution. Science 293(5535):1551-1551.\u003c/li\u003e\n\u003cli\u003eMonroig, \u0026Oacute;., Zheng, X., Morais, S., Leaver, M.J., Taggart, J.B., and Tocher, D.R. (2010) Multiple genes for functional∆ 6 fatty acyl desaturases (Fad) in Atlantic salmon (Salmo salar L.): Gene and cDNA characterization, functional expression, tissue distribution and nutritional regulation. Biochimica et Biophysica Acta -Molecular Cell Biology of Lipids 1801(9):1072-1081.\u003c/li\u003e\n\u003cli\u003eZheng, X., Seiliez, I., Hastings, N., Tocher, D.R., Panserat, S., Dickson, C., Bergot, P., and Teale, A. (2004) Characterization and comparison of fatty acyl \u0026Delta;6 desaturase cDNAs from freshwater and marine teleost fish species. Comparative Biochemistry Physiology Part B: Biochemistry Molecular Biology 139(2):269-279.\u003c/li\u003e\n\u003cli\u003eTeng, T., Zheng, Z., Jiao, W., Liu, N., Wang, A., Liu, M., Xie, L., Yang, Z., Hu, J., and Bao, Z. (2024) Characterization and Functional Analysis of Fads Reveals \u0026Delta;5 Desaturation Activity during Long-Chain Polyunsaturated Fatty Acid Biosynthesis in Dwarf Surf Clam \u003cem\u003eMulinia lateralis\u003c/em\u003e. Genes 15(3):365.\u003c/li\u003e\n\u003cli\u003eTanaka, T., Takimoto, T., Morishige, J.-i., Kikuta, Y., Sugiura, T., and Satouchi, K. (1999) Non-methylene-interrupted polyunsaturated fatty acids: effective substitute for arachidonate of phosphatidylinositol. Biochemical Biophysical Research Communications 264(3):683-688.\u003c/li\u003e\n\u003cli\u003eKharlamenko, V.I., and Odintsova, N.A. (2019) Unusual methylene-interrupted polyunsaturated fatty acids of abyssal and hadal invertebrates. Progress in Oceanography 178:102132.\u003c/li\u003e\n\u003cli\u003eHazel, J.R. (1995) Thermal adaptation in biological membranes: is homeoviscous adaptation the explanation? Annual review of physiology 57(1):19-42.\u003c/li\u003e\n\u003cli\u003eSinensky, M. (1974) Homeoviscous adaptation\u0026mdash;a homeostatic process that regulates the viscosity of membrane lipids in Escherichia coli. Proceedings of the National Academy of Sciences 71(2):522-525.\u003c/li\u003e\n\u003cli\u003eSeelig, A., and Seelig, J. (1977) Effect of a single cis double bond on the structure of a phospholipid bilayer. Biochemistry 16(1):45-50.\u003c/li\u003e\n\u003cli\u003eRoach, C., Feller, S.E., Ward, J.A., Shaikh, S.R., Zerouga, M., and Stillwell, W. (2004) Comparison of cis and trans fatty acid containing phosphatidylcholines on membrane properties. Biochemistry 43(20):6344-6351.\u003c/li\u003e\n\u003cli\u003eWu, G., Baumeister, R., and Heimbucher, T. (2023) Molecular mechanisms of lipid-based metabolic adaptation strategies in response to cold. Cells 12(10):1353.\u003c/li\u003e\n\u003cli\u003eHerrera, C.M., Voss, B.J., and Trent, M.S. (2021) Homeoviscous adaptation of the Acinetobacter baumannii outer membrane: alteration of lipooligosaccharide structure during cold stress. MBio 12(4):10.1128/mbio. 01295-01221.\u003c/li\u003e\n\u003cli\u003eKANEko, H., Takami, H., Inoue, A., and Horikoshi, K. (2000) Effects of hydrostatic pressure and temperature on growth and lipid composition of the inner membrane of barotolerant Pseudomonas sp. BT1 isolated from the deep-sea. Bioscience, Biotechnology, Biochemistry 64(1):72-79.\u003c/li\u003e\n\u003cli\u003eFang, J., and Bazylinski, D.A. (2008) Deep‐Sea Geomicrobiology. High‐Pressure Microbiology:237-264.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Cold seep, Bivalves, Fatty acid desaturase, Long-chain polyunsaturated fatty acids (lcPUFA); Non-methylene-interrupted fatty acids, Deep-sea adaptation","lastPublishedDoi":"10.21203/rs.3.rs-9035091/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9035091/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDeep-sea cold seeps are chemosynthetically driven ecosystems deficient in essential PUFAs. However, the mechanisms by which seep-dwelling bivalves meet their physiological requirements for PUFAs remain poorly understood. Here, we investigated the fatty acid profiles and endogenous biosynthetic capacity of two dominant bivalves from the Haima Cold Seep—the mussel \u003cem\u003eGigantidas haimaensis\u003c/em\u003e and the clam \u003cem\u003eArchivesica marissinica.\u003c/em\u003e Fatty acid analysis revealed their high proportions of bacterial-derived MUFAs, consistent with chemosynthetic nutrition. \u003cem\u003eA. marissinica\u003c/em\u003e lacked detectable essential PUFAs, while \u003cem\u003eG. haimaensis\u003c/em\u003e contained trace arachidonic acid (ARA) and eicosapentaenoic acid (EPA), suggesting partial dietary supplementation. Transcriptome assembly identified three fatty acid desaturase (\u003cem\u003eFad\u003c/em\u003e) genes per species, phylogenetically clustering into Δ5 and Δ6/8 clades, with lineage-specific duplications within the Δ5 clade. Functional assays in yeast demonstrated that Δ6/8-clade Fads possess Δ8-desaturase activity enabling LC-PUFA biosynthesis. Δ5-clade isoforms exhibited divergent substrate specificities: GhFads2 and AmFads1 functioned as classical Δ5-desaturases on PUFA substrates, whereas GhFads1 and AmFads2 specifically desaturated the bacterial MUFA C18:1n-7 to produce the non-methylene-interrupted (NMI) PUFA C18:2n-7—a precise nutritional adaptation to the n‑7 fatty acid-rich seep environment. Physiological assays using GhFads1-transformed yeast showed that NMI C18:2n-7 confers cold tolerance comparable to conventional PUFAs and provides superior protection under high hydrostatic pressure. Our results reveal that cold-seep bivalves retain endogenous LC-PUFA biosynthetic capacity and have evolved duplicated Δ5-desaturases with novel regioselectivity toward bacterial MUFAs. The resulting NMI fatty acids likely represent adaptive membrane modifications for survival under extreme deep-sea conditions.\u003c/p\u003e","manuscriptTitle":"Functional Characterization of Fad Genes from Two Chemosymbiotic Bivalves Inhabiting the Haima Cold Seep","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-24 18:29:38","doi":"10.21203/rs.3.rs-9035091/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bd2a3b87-c4bc-4b4b-99a6-fdcd0f499214","owner":[],"postedDate":"March 24th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-27T09:12:27+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-24 18:29:38","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9035091","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9035091","identity":"rs-9035091","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}