Disregulation of neurovascular unit in the retina after optic nerve injury | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Disregulation of neurovascular unit in the retina after optic nerve injury Qiong Wu, hui wang, HongJuan Liu, Luyin Zhang, Qiping Wei This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9014888/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 11 You are reading this latest preprint version Abstract Purpose: To investigate the changes in the neurovascular unit (NVU) of the retina in rats following optic nerve (ON) injury Methods: The ON transverse quantitative traction (ONTQT) was performed to establish the model of ON and retinal injury. The rats were divided into the sham group (SG) and the model group (MG). At 14th day post-modeling, flash visual evoked potential (FVEP) test was performed to evaluate the visual function. Transmission electron microscopy (TEM) was used to observe the microstructure of retinal NVU. RNA binding protein with multiple splicing (RBPMS) immunofluorescence was applied to detect the survival retinal ganglion cell (RGC). The activity of astrocytes and Müller cells in retina was detected by glial fibrillary acidic protein (GFAP) immunofluorescence. The expression of tight junction proteins (Claudin-1, Claudin-5) and glial end feet markers aquaporin-4 (AQP4) and inwardly rectifying potassium channel subtype 4.1 (Kir4.1) in retinal tissue were test by western blot and PCR. Results: At 14th day following ONTQT, the FVEP results exhibited the prolonged peak latency of P2 and the reduced amplitudes of N1-P1 and N2-P2. TEM showed structural changes of the basement membranes in NVU and ultrastructural abnormalities of tight junctions (TJs) after ONTQT. Besides, the expression of RBPMS in GCL was down-regulated and GFAP was over-expression in the injured retinal sections. The relative expressions of claudin-1and claudin-5 declined and the mRNA levels of AQP4increased in the retina at 14 daysfollowing ONTQT. The mRNA levels of Kir4.1 was downregulated in the retina of MG. Conclusions: ONTQT can be applied in the model of ON and retina injury. The dysfunction of retinal NVU may promotes the optic degeneration in rats following ONTQT, contributing to the RGCs loss and impaired visual function. Neurovascular unit Optic nerve injury Retinal ganglion cells Astrocyte Tight junctions Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction In retina, the blood-retinal barrier (BRB) system can be divided into inner blood-retina barrier (iBRB) and outer blood-retina barrier (oBRB). The iBRB comprises endothelial cells that forming a single-layer lining of the retinal vasculature, which rests on a basal lamina that is covered by the processes of astrocytes and Müller cells [1]. The iBRB regulates the paracellular movement of fluids and molecules across retinal capillaries and plays a fundamental role in the microenvironment of the neural retina. While the oBRB is formed by the tight junctions (Tjs) between retinal pigment epithelial (RPE) cells, which rests on underlying Bruch’s membrane and regulates the paracellular movement of fluids and molecules between the choriocapillaris and the retina [2]. The general make-up of the iBRB consists of the neurovascular unit (NVU), in retina which is a complex multi-cellular structure composed of retina neurones, retinal vascular endothelial cells (ECs) with their dual basement membrane, surrounded by pericytes (PCs) and glial cells including astrocytes, muller cells and microglia [3]. The retina relies on the NVU as a structural and functional unit to regulate blood flow and energy such as oxygen and glucose in the various pathophysiologic environment. The non-neuronal cells in the NVU are critical for the survival and homeostasis of neurons and maintenance of their functions. Increasing evidence demonstrated that the dysfunction of NVU among vascular components, neurons and glial cells can lead to many neurodegenerative and neuroinflammatory diseases, such as stroke, Alzheimer's disease, Parkinson's disease, and optic neuropathies [4]. As a crucial component of NVU, astrocytes can regulate the iBRB by releasing trophic factors, proinflammatory cytikines and shifting molecules structures of TJs [5]. The research suggested that in the early stage of diabetic retinopathy, the disruption of NVU occurs, leading to the decrease number of astrocytes and the impairment in the structure and function of microvasculature and neurons [6]. The previous research has confirmed attenuating iBRB injury and NVU dysfunction could rescue retinal ganglion cell (RGC) loss and optic nerve (ON) axon degeneration in animal model of glaucoma [7]. Therefore, it makes sense to investigate the mechanism of NVU in retinal neurodegeneration, neuroinflammation, Tjs and microvascular disorders. Traumatic optic neuropathy (TON) is a rare disease that can lead to severe irreversible visual impairment, which occurs usually secondary to orbital, ocular, head, or traumatic facial injuries. TON occurs in up to 5% of all closed head injuries and 2.5% of maxillofacial and mid-face traumas [8]. Indirect TON exhibits a higher prevalence compared to direct TON. In general, TON is characterized by a loss of vision associated with RGC death and axonal loss of the optic nerve [9]. Three classical rat models are widely applied in studying retinal and ON injury, which were ON transection, ON crush (ONC), and ocular blast injury [10]. Among them, ONC and ocular blast injury models are both models of indirect TON. Instead of ocular blast injury model, ONC model could avoid serious anterior and posterior segment damage and decrease mortality rate of animal. However, the drawback of the ONC model though is that it cannot calculate the force applied on the forceps to obtain crush injury [11]. Therefore, we improved the ONC model and developed a new model of ON transverse quantitative traction (ONTQT), which could both simulate model of indirect TON and calculate the force applied on the ON by transverse quantitative traction. In previous studies, we confirmed that the survival rates of RGCs at 1, 3, 7 and 14 days post-modeling were 78.94 %, 60.07 %, 38.92 %, and 17.31 % respectively. The modeling was achieved by ON transverse traction horizontally for a duration of 20 seconds (S) with a force of 0.1 newton (N) [12]. Previous research has shown that the integrity of the NVU upon ONC was destroyed in the retina of mice and MMP-3 can attenuate neuroinflammation and neurodegeneration by tightening the glia limitans [4]. Therefore, in this study we aimed to investigate the complex interplay between RGCs, astrocytes and microvascular cells in a new optic nerve injury model of ONTQT. The study’s hypothesis is that ONTQT causes the NVU dysfunction of inner retina, including the impairment of two basement membrane constitutes of astrocyte end-feet and ECs/PCs, which accelerate the RGC loss. Following experimental TON, we investigated changes in the retinal iBRB and NVU function through ultrastructural observation and evaluation of tight junction (TJ) proteins and astrocyte end-feet proteins. Elucidating the pathophysiological sequence following ON injury is crucial for optimizing clinical management and developing novel strategies to prevent or reverse vison loss in patients with TON. Methods Animals All animal procedures were approved by the Animal Ethics and Welfare Committee of Beijing Tongren Hospital Affiliated to Capital Medical University (Approval No.: TRLAWEC2022-S169). Specific pathogen-free (SPF) male Wistar rats aged 6 to 8 weeks were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. A total of 24 rats were housed in a SPF animal facility under controlled conditions (22°C constant temperature, 12 h light/12 h dark cycle) with free access to food and water. All animal experimental procedures were strictly in accordance with the national guidelines for the care and use of laboratory animals, including the Guide for the Care and Use of Laboratory Animals and the Beijing Laboratory Animal Welfare and Ethics Review Criteria issued by the Ministry of Science and Technology of China. ONTQT Surgery Before model establishment, funduscopic examination was performed using an ophthalmoscope (Olympus Co., Ltd., Tokyo, Japan) to verify the integrity of the retina and its vasculature. The ONTQT model was established referring to a previously reported method with minor modifications [12]. Briefly, following anesthesia with 2% pentobarbital sodium (50 mg/kg, i.p.), each rat was positioned prone. The surgical field was sterilized with iodine, and a lateral canthal incision was made in the left orbit using conjunctival scissors. The oblique rectus muscle was carefully detached to expose the optic nerve (ON), which was then bluntly dissected from its sheath. For the model group (MG), a 6-0 polyester suture was looped around the ON at 2 mm posterior to the globe. The loop's circumference was matched to that of the ON to avoid constriction. A digital force gauge (DNT-50, TECLOCK, Japan) was attached to the suture end, and a perpendicular traction force of 0.20 N was applied horizontally for 20 s. Post-operatively, the skin incision was closed, and the wound was disinfected with iodine and treated with topical erythromycin ointment. In the sham group (SG), the ON was surgically exposed but not subjected to traction. Flash visual evoked potentials (FVEP) test The rats underwent FVEP testing 14 days post-injury. After being adapted to the dark for 15 minutes, the rats were anesthetized and fixed to the experiment station. The waveforms for each rat were recorded using an electrophysiological tester (Roland Electronics Co., Ltd., Keltern, Germany). A silver electrode was implanted beneath the skin at the midpoint of the line connecting the ear roots, which was recording electrode. The reference electrode was implanted into the midpoint of the binoculus and the ground electrode was inserted into the tail. When recording from the left eye, the right eye was covered with a self-made black eyeshade. White flash stimuli were delivered 50 times at frequency of 1 hertz (Hz) for a duration of 250 ms. To evaluate visual function, the latency (ms) and amplitude (μv) of the P1 and P2 waves in rats from each group were compared [13, 14]. The FVEP test of every rat were repeated four times and there were 4 rats in each group received FVEP test. After FVEP test, all rats were euthanized by an intraperitoneal overdose of pentobarbital sodium (150 mg/kg). Death was verified by respiratory and cardiac arrest before tissue collection. All procedures were performed in accordance with the institutional guidelines for animal welfare. Immunofluorescence protocol The eyeball tissue was harvested and fixed immediately in 10% formalin. The tissue was subsequently dehydrated in graded ethanol series and embedded in paraffin. Four-μm serial paraffin sections were cut along the vertical meridian with a microtome (CR-601ST, Jinhua Craftek lnstrument Co., Ltd., JinHua, China). Tissues were washed in PBS (3 x 5 min) and then incubated in blocking solution (10% goat serum) for 0.5 h at room temperature, followed by incubation in primary antibodies either overnight at 4 °C. The primary antibodies used were: glial fibrillary acidic protein (GFAP) monoclonal antibody (1:200, 60190-1-lg, Proteintech), RNA binding protein with multiple splicing (RBPMS) polyclonal antibody (1:200, 15187-1-AP, Proteintech). The next day, tissues were washed in PBS (3 × 5 min) and incubated with secondary antibodies conjugated to PE (1:200, goat anti–rabbit; Servicebio) for 1 h. Retinas were incubated with the nuclear dye DAPI for 20 min, washed in PBS (3 × 5 min), before microscopic analysis. All sections were observed under fluorescence microscope (Nippon Kogaku, ELCIPSE-CI) and x 200, x 400 magnification photomicrograph images were captured. The results were analyzed using an imaging analysis system. Western Blot Analysis Retinal tissues were carefully dissected on ice and immediately lysed in RIPA lysis buffer containing a protease inhibitor cocktail. The lysates were centrifuged at 20,000 rpm for 15 min at 4°C (Scilogex, LLC, Rocky Hill, CT, USA), and the supernatant was collected as the total protein extract. The protein concentration in each sample was determined using a BCA Protein Assay Kit (Solarbio, Beijing, China) according to the manufacturer’s instructions. Based on the molecular weight of target proteins, equal amounts of protein samples were separated by 10%–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), then electrotransferred onto nitrocellulose (NC) membranes. The NC membranes were blocked with 5% non-fat dry milk in TBST buffer for 1 h at room temperature to block non-specific binding, followed by incubation with primary antibodies at 4°C overnight. The primary antibodies used were as follows: Rabbit anti-Claudin 1 (1:1000, 2H10D10, Invitrogen), Rabbit anti-Claudin 5 (1:1000, 4C3C2, Invitrogen), aquaporin-4 (AQP4) polyclonal antibody (1:1000, 16473-1-AP, Proteintech), inwardly rectifying potassium channel subtype 4.1 (Kir4.1) polyclonal antibody (1:1000, 12503-1-AP, Proteintech), Rabbit anti-tubulin (1:5000, Servicebio) and anti-beta-actin (1:5000, Servicebio). After three washes with TBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated anti-rabbit IgG secondary antibody (1:5000, Servicebio) for 1 h at room temperature. The protein bands were visualized using an enhanced chemiluminescence (ECL) detection system (Clinx Science Instruments Co., Ltd., Shanghai, China). The relative optical density of each protein band was quantified using Image J software (NIH, USA), with tubulin or beta-actin as the internal reference. Transmission electron microscopy (TEM) Eyes were isolated and fixed in 2.5% glutaraldehyde (pH 7.4) for 2h. The eye was gently secured in place by the optic nerve and the cornea removed with microdissection scissors rostral or anterior to the limbus. The lens and vitreous were then removed though the opening made by removal of the cornea. After washed three times with 0.1M phosphate buffer (pH 7.2) and fixed in 1% osmic acid at 4 ℃ for 2h. Then the samples were gradient dehydrated in a graded series of ethanol. Subsequently, the samples were embedded in Epon-Araldite resin for penetration and placed in a mold for polymerization. After the semi thin section was used for positioning, the ultrathin section was made and collected for microstructure analysis. Followed the counterstaining of 3% uranyl acetate and 2.7% lead citrate. Then observed with a JEM1400 transmission electron microscope. Quantitative Real-Time PCR Analysis Total RNA was extracted from frozen retinal tissues using a Total RNA Extractor Kit (Sangon Biotech, Shanghai, China), and the RNA purity and concentration were determined by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). First-strand cDNA was synthesized from 1 μg of total RNA using a PrimeScript RT Reagent Kit (Vazyme, Nanjing, China) following the manufacture’s protocol. Quantitative real-time PCR (RT-qPCR) was performed on an ABI 7300 Real-Time PCR System (Applied Biosystems, USA) using a SYBR Green qPCR Master Mix (Vazyme, Nanjing, China). The thermal cycling program was set as follows: initial denaturation at 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 15 s and annealing/extension at 60°C for 30 s. All qPCR reactions were performed in triplicate with three biological replicates. The primer sequences for target genes are listed in Table 1. The relative mRNA expression levels of target genes were calculated using the 2 −ΔCt method, and the fold change in expression compared with the model group was determined using the 2 −ΔΔCt method. Tubulin was used as the housekeeping gene for internal normalization. Beta-actin was used as the housekeeping gene for internal normalization. Table 1 The mRNA sequences of primers Target primer AQP4 forward primer CCTCTGCTTTGGACTCAGCA reverse primer CTTTCGTGTGCACACCATGG Kir4.1 forward primer GGCTATGGCTTCCGCTACAT reverse primer AGAATGGTGGTGAGCACGAG Beta-Actin forward primer ACCCAGATCATGTTTGAGACCT reverse primer GACCAGAGGCATACAGGGACAAC Abbreviations: AQP4, Aquaporin-4; Kir4.1 Inwardly rectifying potassium channel subtype 4.1 Statistical analysis All experimental data were expressed as the mean ± standard error of the mean (SEM). Statistical analyses were performed using SPSS 27.0 software (IBM SPSS, Shanghai, China). The normality of data distribution was tested using the Shapiro-Wilk test. For two-group comparisons, an independent-sample t-test was applied for normally distributed data; otherwise, the Mann-Whitney U test was used. A two-tailed P value < 0.05 was considered statistically significant. Results A decline in visual function in rats following ONTQT To explore the visual function of the optic nerve, we record the F-VEP at 14 days post-modeling (Figure 2). In terms of P1 peak latency, there was no statistically significant difference between the MG group and SG group on the 14th day after injury ( P > 0.05). However, the peak latency of P2 was prolonged at 14 days post ONTQT injury ( P < 0.05). In addition, the MG exhibited a significantly decreased amplitude in N1-P1 and N2-P2 compared to the SG ( P < 0.05). These changes indicated that ONTQT surgery decreased visual function of rats. Modifications in the Components of NVU within the Retina Following ONT QT in a Rat To observe the structure of the NVU in the inner retina, we conducted TEM on retinal tissue from rats 14 days post-modeling. In the TEM (Figure 2), we can find the NVU consists of two main components. Firstly, ECs, which are covered by the endothelial basement membrane and sealed tightly by vascular tight junctions, form the BRB. Secondly, the end - feet of astrocytes and muller glia along with the glial basement membrane make up the glia limitans. These two NVU barriers encircle a perivascular space. The present ultrastructural study showed that microvessel of inner retina after ONTQT exhibited irregularity of luminal circularity compared to that of sham group. Remodeling of PCs can be easily observed in the MG sample, which exhibits rounded nuclei and hypertrophic changes accompanied by increased lysosomes, vacuoles, and vesicles. Few Endothelial cell swellings and vacuole formations can be seen in the MG. Furthermore, structural changes of the basement membranes of NVU, including degradation, diffusion and thickening have been found in the retina of MG. Moreover, astrocyte swellings and end-foot detachments were observed in the MG and the perivascular astrocyte showed swollen, cytoplasmic vacuolation and cytoplasmic. Besides, most of the TJs appeared intact as a series of electron-dense zones sealing intercellular clefts in SG. By contrast, ultrastructural abnormalities of TJs were observed in MG. Loss of RGCs and glia activitation in retina of rats after ONT QT The ganglion cell layer (GCL) contained a monolayer of RGCs. The expression of RBPMS, as a marker of RGCs, was used to evaluate the survival of RGCs. We uesd immunofluorescence assays with antibodies against RBPMS in the retina of rats and estimated the expression of RBPMS in GCL 14-day after modeling. As shown in Figure 4A, the number of of RGC labeled RBPMS in GCL was reduced in the injured retinal tissues (p < 0.05). To evaluate the activity of glia, GFAP immunofluorescence staining was conducted. Figure 4C displays GFAP, as an astrocyte marker, was over-expression in the injured retinal sctions post 14-day ONTQT (p < 0.05). The results illustrate that the modeling of ONTQT significantly promotes the death of RGCs, whereas it enhances the activation of glial cells. ONT QT results in a downregulation of tight junction molecules (TJMs) in the retina. The maintenance of epithelial-tight junctional integrity by TJMs is essential for protecting the NVU in the retina, where claudins are the primary transmembrane molecules that facilitate epithelial contact. To investigate the expression of TJMs in the retinal NVU, western blot analysis was performed. As shown in Figure 5A and Figure 5B, the relative expression of claudin-1 and claudin-5 was reduced in ONTQT retina compared to those in the sham group ( P < 0.05). Furthermore, astrocytes are integral components of the Neurovascular Unit (NVU) and play a crucial role in its maintenance. The mRNA expression levels of astrocyte end-foot markers, such as AQP4 and Kir4.1, was conducted using qRT-PCR analysis. Figures 5C and 5D reveal that there was a significant increase in the mRNA level of AQP4 ( P < 0.05), whereas the mRNA level of Kir4.1 was decreased in the retina 14 days post-ONC compared to those observed in the sham group ( P < 0.05). Discussion The retina is a portion of the central nervous system, as well as a highly vascularized tissue [15]. Retinal cells have a high metabolic rate and are extremely sensitive to glucose and oxygen deprivation. The retinal microvasculature supplies nutrients and oxygen to the retinal cells, playing a critical role in maintaining the visual function of the neural retina [16]. Therefore, the microenvironment of the retina must be tightly regulated, and is separated from the systemic circulation by the BRB [17]. The retinal microvasculatures contain the two main cellular constituents of ECs and PCs, sharing the same basement membrane on the blood vessel walls [18]. The basement membrane covered by ECs and PCs constitutes one of the NVU barriers, which tightly sealed by vascular TJs. On the other hand, the glial basement membrane constitutes another barrier within the NVU, comprising the end feet of astrocytes and muller glia [4]. The NVU plays a role in maintaining the overall integrity of the iBRB, whereas the TJMs located between retinal endothelial cells are the essential molecular structures responsible for the maintenance of iBRB [19]. The TJMs are formed by different types of intracellular proteins and transmembrane adhesion proteins, including the tight-junction-associated MARVEL proteins, claudin family members and junctional adhesion molecules (JAMs) [20]. The claudin family of proteins are transmembrane proteins that allow for the maintenance of tight junction integrity, which have at least 27 known members [21]. Claudins are essential for TJs formation, cell-to-cell adhesion, and the regulation of TJs permeability [1]. In the retina, claudin-1 and -5 are distributed in the plasma membranes of large and small vessels, and are specifically expressed in retinal vascular endothelial cells [22]. Claudin-5 is the most highly expressed claudin protein in endothelial cells of retinal NVU [23]. Claudin-5 expression promotes the sealing of tight junctions, and as a consequence, decreased vessel permeability, and thus enhanced endothelial barrier function [19]. Diabetic retinopathy (DR) is characterized by increased iBRB permeability. Previous studies have shown that redistribution of claudin-5 and claudin-1 occurs in the diabetic retina, along with increased vascular permeability [24-26]. Inflammation has been implicated in the pathogenesis of DR and inflammatory cytokines like VEGF, TNF-α, IL-6 and IL-1β further decreased claudin-5 expression in the retinas of diabetic animals [24, 27]. Besides, inducible endothelial-specific claudin-5 knockdown mice show severe neuroinflammation within 2 weeks after the initiation of knockdown [28]. Furthermore, previous study has shown that expression of TJM claudin-5 showed a trend towards decreased expression within the first 4 days after optic nerve crush [4]. In our study, the expression of claudin-5 and claudin-1 in the retina was significantly downregulated in rats at 14 day following optic nerve injury, indicating the increase permeability of iBRB and the disruption of the NVU in the retina. As an essential component of the visual system, astrocytes perform various functions, including providing nutrients, regulating ionic balance, neurotransmission, supplying the BRB, structural support, and synaptic plasticity [29]. In response to various insults, including glaucoma, ischemia, optic neuritis, optic nerve crush, and optic nerve transection, quiescent astrocytes enter a reactive state, the main feature of which is the activation of astrocytes typically exhibiting increased GFAP expression [30]. In retina, astrocytes are located at the inner surface of the retina and Müller glial cells vertically span the entire thickness of the retina, all of which co-regulate the function of NVU. As a barrier within the NVU, astrocytic end-feet, which compose the glial basement membrane, envelop the ECs and PCs that constitute the blood vessel lumen in the retina [31]. The study first systematically reveals the multi-dimensional pathological changes in the retinal NVU after ONTQT. Under TEM, ultrastructural abnormalities of NVU at 14 th day following ONTQT include irregularity of luminal circularity, PCs remodeling, astrocyte swellings, detachments of astrocyte end-foot, structural changes like degradation, diffusion and thickening of the basement membranes of NVU, all of which were consistent with previous studies in CNS injuries model [32, 33]. However, swollen ECs were not distinct in the retina of NVU at 14 th day following ONTQT, which may relate to the observe time. In the eyes, AQP4 is found to be expressed in the retinal astrocytes and Müller glial cells, with the highest expression occurring in the end feet membranes, which are major in transcellular water transport and in regulating cellular volume [34].In the mammalian retina, Kir4.1 is mostly expressed in the end feet of retinal Müller glial cells and is the main potassium channel in Müller cells, whose polarised expression allows K+influx into muller cells from the extracellular space [35]. Water movement into and out of muller cells relies on the co-expression of Kir4.1 and AQP4 on muller cells, which allows water to follow K+ from perisynaptic spaces to blood vessels [36]. AQP4 and Kir4.1 in retinal muller cells play important roles in controlling retinal potassium. water homeostasis, as well as maintaining the integrality of iBRB [37]. Several studies have suggested that AQP4 and Kir4.1 levels of retina vary depending on the different damages and the stage of injury. In diabetic rat both BRB disruption and retinal oedema were also observed in these retinas as well as the increased AQP4 levels and decreased Kir4.1 levels [38]. In retinal injury induced by hypobaric hypoxia, the breakdown of the iBRB leads to retinal edema and increased expression of GFAP in muller cells, accompanied by an increase in retinal AQP4 expression and a decrease in Kir4.1 expression [36]. The previous research illustrated that AQP4 and Kir4.1 protein levels and mRNA expressions in retina decreased at days 2, 7, and 14 following optic nerve crush [39]. In our research, mRNA expressions of AQP4 in retina increased at days 14 following ONTQT injury, which is consistent with some studies [3, 36, 38]. The increasing number of reactive astrocytes in the inner retina following ONTQT may account for the rising mRNA level of AQP4. The astrocyte edema observed under TEM in the MG is probably associated with the increased expression of AQP4, which selectively transports water into cells. The decline mRNA expressions of Kir4.1 in our research indicates the intracellular potassium accumulation, which can lead to increased intracellular and extracellular osmotic pressure in astrocytes. Water is transported into cells through AQP4 driven by osmotic pressure, causing the oedema of astrocytes and muller cell [36]. However, the mRNA expression cannot completely represent the function of the protein. Retinal pathologies are accompanied by alterations of amounts and/or spatial distribution of AQP4 or Kir4.1 [35]. Muller cell oedema due to the regulation or redistribution of Kir4.1 and AQP4 has been reported to be involved in the development and progression of a variety of retinal diseases, including diabetic macular oedema, retinal vein occlusion and uveitis [36]. Firstly, the ON traction stimulates an acute local response in the injury epicenter and exacerbated glial activation immediately [40] so that increased GFAP expression of retina was exhibited following ONTQT. In the research, the reactive astrocyte with the abnormal mRNA expression of AQP4 and Kir4.1 cannot balance the potassium and water homeostasis resulting in the astrocyte swellings and detachments of astrocyte end-feet. Furthermore, another barrier of NVU was impaired, which was the basement membrane covered by ECs and PCs and tightly sealed by vascular TJs. The expression of TJs proteins like claundin-1 and claudin-5 decreased and under TEM the degradation, diffusion and thickening of the basement membranes of NVU can be observed. Finally, the disfunction of NVU boost the RGC loss in the inner retina, which was exhibited by the decrease number of RBPMS-positive RGC following ONTQT. Meanwhile, the RGC loss resulted in the visual disfunction tested by FVEP at the 14 th day following ONTQT. Conclusion In conclusion, ONTQT as a new model of indirect TON can reliably induce ON injuries and RGC loss. The research reveals that there is a link between the dysfunction of NVU and the death of RGCs at 14 th day following ON injury. The mechanisms of iBRB breakdown after ONTQT are relative to the downregulation of the TJs like claudin-1 and claudin-5, as well as the redistribution in the perivascular macroglial end feet markers like AQP4 and Kir4.1. The two barriers of NVU, constituted by the ECs and PCs and the end feet of astrocytes and muller glia, are critical for RGCs protection after optic nerve injury. However, we are lack of experiments at different time points after ONTQT. The expression of TJ proteins and perivascular macroglial end feet markers may show varying outcomes in the early stages following optic nerve injury. The further investigation should be developed in the future. Abbreviations NVU Neurovascular unit ON Optic nerve ONTQT Optic nerve transverse quantitative traction SG Sham group MG Model group FVEP Flash visual evoked potentials TEM Transmission electron microscopy TJs Tight junctions RGC Retinal ganglion cell TON Traumatic optic neuropathy ONC Optic nerve crush RBPMS RNA binding protein with multiple splicing GFAP Glial fibrillary acidic protein AQP4 Aquaporin-4 Kir4.1 Inwardly rectifying potassium channel subtype 4.1 BRB Blood-retinal barrier iBRB Inner blood-retina barrier oBRB Outer blood-retina barrier RPE Retinal pigment epithelial GCL Ganglion cell layer TJMs Tight junction molecules ECs endothelial cells PCs pericytes JAMs Junctional adhesion molecules Declarations Ethics approval The Ethics and Welfare Review of Laboratory Animals in Beijing Tongren Hospital Affiliated to Capital Medical University (No. TRLAWEC2022-S169) gave approval for the animal care and experiments. The rats in research were carried out in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23) revised 1996. Consent for publication Not applicable. A vailability of Data and materials The data used to support the findings of this study are available from the corresponding author upon request. Competing Interest s The authors declare that there is no conflict of interest regarding the publication of this paper. Funding This research is funded by the National Natural Science Foundation of China (NO.82205194). A uthor s’ contribution s Qiong Wu: Writing - original draft, Writing - review & editing, Methodology, Investigation, Formal analysis, Data curation, Project administration, Funding acquisition. Hui Wang: Writing - review & editing, Formal analysis. Hongjuan Liu: Software, Supervision. Luyin Zhang: Methodology, Validation. Qiping Wei: Writing - review & editing, Methodology. Ackonwledgement Thanks for the laboratory equipment provided by University of Capital Medical University. References O'Leary F, Campbell M: The blood-retina barrier in health and disease . Febs j 2023, 290 (4):878-891. Naylor A, Hopkins A, Hudson N, Campbell M: Tight Junctions of the Outer Blood Retina Barrier . Int J Mol Sci 2019, 21 (1). Albargothy MJ, Azizah NN, Stewart SL, Troendle EP, Steel DHW, Curtis TM, Taggart MJ: Investigation of heterocellular features of the mouse retinal neurovascular unit by 3D electron microscopy . J Anat 2023, 243 (2):245-257. Lefevere E, Salinas-Navarro M, Andries L, Noterdaeme L, Etienne I, Van Wonterghem E, Vinckier S, Davis BM, Van Bergen T, Van Hove I et al : Tightening the retinal glia limitans attenuates neuroinflammation after optic nerve injury . Glia 2020, 68 (12):2643-2660. Horng S, Therattil A, Moyon S, Gordon A, Kim K, Argaw AT, Hara Y, Mariani JN, Sawai S, Flodby P et al : Astrocytic tight junctions control inflammatory CNS lesion pathogenesis . J Clin Invest 2017, 127 (8):3136-3151. Nian S, Lo ACY, Mi Y, Ren K, Yang D: Neurovascular unit in diabetic retinopathy: pathophysiological roles and potential therapeutical targets . Eye Vis (Lond) 2021, 8 (1):15. Alarcon-Martinez L, Shiga Y, Villafranca-Baughman D, Cueva Vargas JL, Vidal Paredes IA, Quintero H, Fortune B, Danesh-Meyer H, Di Polo A: Neurovascular dysfunction in glaucoma . Prog Retin Eye Res 2023, 97 :101217. Karimi S, Arabi A, Ansari I, Shahraki T, Safi S: A Systematic Literature Review on Traumatic Optic Neuropathy . J Ophthalmol 2021, 2021 :5553885. Ryan AK, Asemota BI, Heisler-Taylor T, Mello C, Rodriguez L, Sponsel WE, Racine J, Rex TS, Glickman RD, Reilly MA: Torsion-Induced Traumatic Optic Neuropathy (TITON): A Physiologically Relevant Animal Model of Traumatic Optic Neuropathy . bioRxiv 2025. Bastakis GG, Ktena N, Karagogeos D, Savvaki M: Models and treatments for traumatic optic neuropathy and demyelinating optic neuritis . Dev Neurobiol 2019, 79 (8):819-836. Levkovitch-Verbin H: Animal models of optic nerve diseases . Eye (Lond) 2004, 18 (11):1066-1074. Wu Q, Gu X, Liu X, Yan X, Liao L, Zhou J: Astragalus membranaceus Injection Protects Retinal Ganglion Cells by Regulating the Nerve Growth Factor Signaling Pathway in Experimental Rat Traumatic Optic Neuropathy . Evid Based Complement Alternat Med 2020, 2020 :2429843. Yi Z, Chen L, Wang X, Chen C, Xing Y: Protective Effects of Intravitreal Injection of the Rho-Kinase Inhibitor Y-27632 in a Rodent Model of Nonarteritic Anterior Ischemic Optic Neuropathy (rAION) . J Ophthalmol 2020, 2020 :1485425. Rocha LR, Nguyen Huu VA, Palomino La Torre C, Xu Q, Jabari M, Krawczyk M, Weinreb RN, Skowronska-Krawczyk D: Early removal of senescent cells protects retinal ganglion cells loss in experimental ocular hypertension . Aging Cell 2020, 19 (2):e13089. Kurihara T: Development and pathological changes of neurovascular unit regulated by hypoxia response in the retina . Prog Brain Res 2016, 225 :201-211. Huang H: Pericyte-Endothelial Interactions in the Retinal Microvasculature . Int J Mol Sci 2020, 21 (19). Cunha-Vaz J, Bernardes R, Lobo C: Blood-retinal barrier . Eur J Ophthalmol 2011, 21 Suppl 6 :S3-9. Zhou LY, Liu ZG, Sun YQ, Li YZ, Teng ZQ, Liu CM: Preserving blood-retinal barrier integrity: a path to retinal ganglion cell protection in glaucoma and traumatic optic neuropathy . Cell Regen 2025, 14 (1):13. Kakogiannos N, Ferrari L, Giampietro C, Scalise AA, Maderna C, Ravà M, Taddei A, Lampugnani MG, Pisati F, Malinverno M et al : JAM-A Acts via C/EBP-α to Promote Claudin-5 Expression and Enhance Endothelial Barrier Function . Circ Res 2020, 127 (8):1056-1073. Campbell M, Humphries P: The blood-retina barrier: tight junctions and barrier modulation . Adv Exp Med Biol 2012, 763 :70-84. Hudson N, Celkova L, Hopkins A, Greene C, Storti F, Ozaki E, Fahey E, Theodoropoulou S, Kenna PF, Humphries MM et al : Dysregulated claudin-5 cycling in the inner retina causes retinal pigment epithelial cell atrophy . JCI Insight 2019, 4 (15). Luo Y, Xiao W, Zhu X, Mao Y, Liu X, Chen X, Huang J, Tang S, Rizzolo LJ: Differential expression of claudins in retinas during normal development and the angiogenesis of oxygen-induced retinopathy . Invest Ophthalmol Vis Sci 2011, 52 (10):7556-7564. Hashimoto Y, Campbell M: Key Claudins at the Blood-Retina Barriers . Adv Exp Med Biol 2025, 1468 :447-451. Arima M, Nakao S, Yamaguchi M, Feng H, Fujii Y, Shibata K, Wada I, Kaizu Y, Ahmadieh H, Ishibashi T et al : Claudin-5 Redistribution Induced by Inflammation Leads to Anti-VEGF-Resistant Diabetic Macular Edema . Diabetes 2020, 69 (5):981-999. Arima M, Cui D, Kimura T, Sonoda KH, Ishibashi T, Matsuda S, Ikeda E: Basigin can be a therapeutic target to restore the retinal vascular barrier function in the mouse model of diabetic retinopathy . Sci Rep 2016, 6 :38445. Xu X, Xu S, Gao Y, He S, He J, Chen X, Guo J, Zhang X: Remote ischemic conditioning slows blood-retinal barrier damage in type 1 diabetic rats . Brain Res 2025, 1846 :149253. Gonçalves A, Marques C, Leal E, Ribeiro CF, Reis F, Ambrósio AF, Fernandes R: Dipeptidyl peptidase-IV inhibition prevents blood-retinal barrier breakdown, inflammation and neuronal cell death in the retina of type 1 diabetic rats . Biochim Biophys Acta 2014, 1842 (9):1454-1463. Greene C, Kealy J, Humphries MM, Gong Y, Hou J, Hudson N, Cassidy LM, Martiniano R, Shashi V, Hooper SR et al : Dose-dependent expression of claudin-5 is a modifying factor in schizophrenia . Mol Psychiatry 2018, 23 (11):2156-2166. Yazdankhah M, Shang P, Ghosh S, Hose S, Liu H, Weiss J, Fitting CS, Bhutto IA, Zigler JS, Jr., Qian J et al : Role of glia in optic nerve . Prog Retin Eye Res 2021, 81 :100886. Yang X-T, Huang G-H, Feng D-F, Chen K: Insight into astrocyte activation after optic nerve injury . Journal of Neuroscience Research 2015, 93 (4):539-548. Hudson N, Campbell M: Tight Junctions of the Neurovascular Unit . Front Mol Neurosci 2021, 14 :752781. Li C, Chen S, Siedhoff HR, Grant D, Liu P, Balderrama A, Jackson M, Zuckerman A, Greenlief CM, Kobeissy F et al : Low-intensity open-field blast exposure effects on neurovascular unit ultrastructure in mice . Acta Neuropathol Commun 2023, 11 (1):144. Erickson MA, Shulyatnikova T, Banks WA, Hayden MR: Ultrastructural Remodeling of the Blood-Brain Barrier and Neurovascular Unit by Lipopolysaccharide-Induced Neuroinflammation . Int J Mol Sci 2023, 24 (2). Goodyear MJ, Crewther SG, Junghans BM: A role for aquaporin-4 in fluid regulation in the inner retina . Vis Neurosci 2009, 26 (2):159-165. Zhao M, Bousquet E, Valamanesh F, Farman N, Jeanny JC, Jaisser F, Behar-Cohen FF: Differential regulations of AQP4 and Kir4.1 by triamcinolone acetonide and dexamethasone in the healthy and inflamed retina . Invest Ophthalmol Vis Sci 2011, 52 (9):6340-6347. Han C, Li Y, Zheng X, Zhang X, Li G, Zhao L, Chen Z, Yang Y, Zhang W: AQP4- and Kir4.1-Mediated Müller Cell Oedema Is Involved in Retinal Injury Induced By Hypobaric Hypoxia . Mol Neurobiol 2025, 62 (2):2012-2022. Siqueiros-Marquez L, Bénard R, Vacca O, Charles-Messance H, Bolaños-Jimenez R, Guilloneau X, Sennlaub F, Montañez C, Sahel JA, Rendon A et al : Protection of Glial Müller Cells by Dexamethasone in a Mouse Model of Surgically Induced Blood-Retinal Barrier Breakdown . Invest Ophthalmol Vis Sci 2017, 58 (2):876-886. Zhang Y, Xu G, Ling Q, Da C: Expression of aquaporin 4 and Kir4.1 in diabetic rat retina: treatment with minocycline . J Int Med Res 2011, 39 (2):464-479. Dibas A, Oku H, Fukuhara M, Kurimoto T, Ikeda T, Patil RV, Sharif NA, Yorio T: Changes in ocular aquaporin expression following optic nerve crush . Mol Vis 2010, 16 :330-340. Epardo D, Balderas-Márquez JE, Rodríguez-Arzate CA, Thébault SC, Carranza M, Luna M, Ávila-Mendoza J, Calderón-Vallejo D, Quintanar JL, Arámburo C et al : Growth Hormone Neuroprotective Effects After an Optic Nerve Crush in the Male Rat . Invest Ophthalmol Vis Sci 2024, 65 (13):17. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 09 Apr, 2026 Reviews received at journal 07 Apr, 2026 Reviews received at journal 30 Mar, 2026 Reviewers agreed at journal 19 Mar, 2026 Reviewers agreed at journal 17 Mar, 2026 Reviewers agreed at journal 17 Mar, 2026 Reviewers invited by journal 16 Mar, 2026 Editor assigned by journal 11 Mar, 2026 Editor invited by journal 11 Mar, 2026 Submission checks completed at journal 10 Mar, 2026 First submitted to journal 10 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9014888","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":607666246,"identity":"d56b5cf9-2c85-476d-821b-d8b717197d1d","order_by":0,"name":"Qiong Wu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIiWNgGAWjYBACNvb2AwcSDCTq+ZmZDz5IqKghrIWP50zigwcFFgmS7W3JBg/OHCOsRU4iwdjwwYeKBIMzZ9QkH7YwE+EwngNpEkCH5RncyGGrSGxgY+Bv704g4JfGYyAtxZI3co/dSNwhwyBx5uwGomxh7LuRl3Yj8Qwbg4FELgEtEglmYC0NN3LMChLbmInSYmwA1JI44cwZMwbitIACGajFGBTIEglnjvEQ9It8e/uBgz/+1MmBovLjj4oaOf72XvxaMAAPacpHwSgYBaNgFGAFAGK1Tbo7s8ALAAAAAElFTkSuQmCC","orcid":"","institution":"Beijing Tongren Hospital","correspondingAuthor":true,"prefix":"","firstName":"Qiong","middleName":"","lastName":"Wu","suffix":""},{"id":607666248,"identity":"6095d859-d6f4-45cb-ac93-b9a530948c0d","order_by":1,"name":"hui wang","email":"","orcid":"","institution":"Beijing Tongren Hospital","correspondingAuthor":false,"prefix":"","firstName":"hui","middleName":"","lastName":"wang","suffix":""},{"id":607666250,"identity":"6795f99d-ddaf-4c57-8cc2-a7bc6c6a0441","order_by":2,"name":"HongJuan Liu","email":"","orcid":"","institution":"Beijing Tongren Hospital","correspondingAuthor":false,"prefix":"","firstName":"HongJuan","middleName":"","lastName":"Liu","suffix":""},{"id":607666251,"identity":"7a4f494e-7c9f-48d4-bd81-3747498dfc77","order_by":3,"name":"Luyin Zhang","email":"","orcid":"","institution":"Beijing Tongren Hospital","correspondingAuthor":false,"prefix":"","firstName":"Luyin","middleName":"","lastName":"Zhang","suffix":""},{"id":607666253,"identity":"283aa0c3-60d8-4098-bc3b-9815727b47ee","order_by":4,"name":"Qiping Wei","email":"","orcid":"","institution":"Dongfang Hospital, Beijing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qiping","middleName":"","lastName":"Wei","suffix":""}],"badges":[],"createdAt":"2026-03-03 02:23:39","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9014888/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9014888/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105562714,"identity":"881a79a9-46bd-4f52-8589-6ce748a86196","added_by":"auto","created_at":"2026-03-27 12:44:17","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2209499,"visible":true,"origin":"","legend":"\u003cp\u003eONTQT modeling. A. The exposed optic nerve (black arrow) B. A representative image of ON transverse quantitative traction surgery\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9014888/v1/8f7343dc59eda59995a49b48.jpg"},{"id":104917391,"identity":"9e3b1d25-3d16-477b-85cf-b41fc2ba0edc","added_by":"auto","created_at":"2026-03-18 16:32:24","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":647022,"visible":true,"origin":"","legend":"\u003cp\u003eEvaluation of visual function after modeling measured by F-VEP. A: Representative waveforms of rats in SG. B: Representative waveforms of rats in MG. C: P1 wave peak latency of the two groups (\u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05). D: P1 wave amplitude of the two groups (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). E: P2 wave peak latency of the two groups (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). F: P2 wave amplitude of the two groups (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). The data were shown as mean ± SD (n = 6). * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs SG.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9014888/v1/12a691a917054e87d15c0741.jpg"},{"id":104917395,"identity":"9b255371-549a-424c-b8af-dbf459df502d","added_by":"auto","created_at":"2026-03-18 16:32:24","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6126157,"visible":true,"origin":"","legend":"\u003cp\u003eTransmission electron microscopy image of the retinal NVU, captured in a rat 14-day post modeling. A, C: Representative electron micrograph of the inner retinal NVU in SG and MG. a: red blood cell; b: blood vessel; c: pericytes; d: astrocytes. Scale bar represents 2 µm. B, D: The enlarged detail image of NVU. e: endothelial basement membrane; f: perivascular space; g: glial basement membrane. Scale bar represents 500 nm.SG represented the sham group. MG represented the model group.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9014888/v1/24e0dd4c416ffcd985d0ec9f.jpg"},{"id":104917393,"identity":"8fd192ca-4928-4301-a1b6-fbef873f2158","added_by":"auto","created_at":"2026-03-18 16:32:24","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3291181,"visible":true,"origin":"","legend":"\u003cp\u003eRetinal immunofluorescent of RBPMS and GFAP. RBPMS immunostaining was applied to label RGCs in the GCL of retinal tissues. GFAP immunostaining was used to label activated astrocyte of retinal tissues. A: Representative images of RBPMS stained retinal sections 14-day post modeling. Green color: RBPMS-positive cells. Blue color: DAPI stained nuclei. B: Quantitative results of RBPMS-positive RGC in the GCL of retinal sections. C: Representative images of GFAP stained retinal sections 14-day post modeling. Red color: GFAP-positive protein. Blue color: DAPI stained nuclei. D: Quantitative analysis of GFAP expression on retina sections. The data were shown as mean ± SD (n = 3). * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 vs sham group. Scale bar represents 50 µm. SG represented the sham group. MG represented the model group.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9014888/v1/a174653fad580c3330ddb813.jpg"},{"id":105034574,"identity":"4c5ca2bb-07cb-4427-8ac4-11b766452a7e","added_by":"auto","created_at":"2026-03-20 07:23:38","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":224146,"visible":true,"origin":"","legend":"\u003cp\u003eTJM expression in the retina of rats at 2 weeks post-modeling. (A, B) Western blotting was used to assess the relative expression of protein Claudin 1 and Claudin 5 in the retina tissue of rats. Expression was normalized to MG expression level. (C, D) mRNA expression of AQP4 and Kir4.1 in retinal tissue by RT-qPCR detection. Data are presented as mean ± SD (n = 3). * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, versus SG. SG represented the sham group. MG represented the model group.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9014888/v1/a2bfb12af8743dc685940053.jpg"},{"id":105568623,"identity":"31d65346-1635-47f9-a654-bd4abc189392","added_by":"auto","created_at":"2026-03-27 13:09:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":14588883,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9014888/v1/ddca9aea-d435-4683-b036-fd8f1bbd4411.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Disregulation of neurovascular unit in the retina after optic nerve injury","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn retina, the blood-retinal barrier (BRB) system can be divided into inner blood-retina barrier (iBRB) and outer blood-retina barrier (oBRB). The iBRB comprises endothelial cells that forming a single-layer lining of the retinal vasculature, which rests on a basal lamina that is covered by the processes of astrocytes and M\u0026uuml;ller cells [1]. The iBRB regulates the paracellular movement of fluids and molecules across retinal capillaries and plays a fundamental role in the microenvironment of the neural retina. While the oBRB is formed by the tight junctions (Tjs) between retinal pigment epithelial (RPE) cells, which rests on underlying Bruch\u0026rsquo;s membrane and regulates the paracellular movement of fluids and molecules between the choriocapillaris and the retina [2]. The general make-up of the iBRB consists of the neurovascular unit (NVU), in retina which is a complex multi-cellular structure composed of retina neurones, retinal vascular endothelial cells (ECs) with their dual basement membrane, surrounded by pericytes (PCs) and glial cells including astrocytes, muller cells and microglia [3]. The retina relies on the NVU as a structural and functional unit to regulate blood flow and energy such as oxygen and glucose in the various pathophysiologic environment. The non-neuronal cells in the NVU are critical for the survival and homeostasis of neurons and maintenance of their functions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIncreasing evidence demonstrated that the dysfunction of NVU among vascular components, neurons and glial cells can lead to many neurodegenerative and neuroinflammatory diseases, such as stroke, Alzheimer\u0026apos;s disease, Parkinson\u0026apos;s disease, and optic neuropathies [4]. As a crucial component of NVU, astrocytes can regulate the iBRB by releasing trophic factors, proinflammatory cytikines and shifting molecules structures of TJs [5]. The research suggested that in the early stage of diabetic retinopathy, the disruption of NVU occurs, leading to the decrease number of astrocytes and the impairment in the structure and function of microvasculature and neurons [6]. The previous research has confirmed attenuating iBRB injury and NVU dysfunction could rescue retinal ganglion cell (RGC) loss and optic nerve (ON) axon degeneration in animal model of glaucoma [7]. Therefore, it makes sense to investigate the mechanism of NVU in retinal neurodegeneration, neuroinflammation, Tjs and microvascular disorders.\u003c/p\u003e\n\u003cp\u003eTraumatic optic neuropathy (TON) is a rare disease that can lead to severe irreversible visual impairment, which occurs usually secondary to orbital, ocular, head, or traumatic facial injuries.\u0026nbsp;TON occurs in up to 5% of all closed head injuries and 2.5% of maxillofacial and mid-face traumas [8]. Indirect TON exhibits a higher prevalence compared to direct TON.\u0026nbsp;In general, TON is characterized by a loss of vision associated with RGC death and axonal loss of the optic nerve [9].\u0026nbsp;Three classical rat models are widely applied in studying retinal and ON injury, which were\u0026nbsp;ON transection, ON crush (ONC), and ocular blast injury\u0026nbsp;[10].\u0026nbsp;Among them,\u0026nbsp;ONC and\u0026nbsp;ocular blast injury\u0026nbsp;models are both models of indirect TON.\u0026nbsp;Instead of\u0026nbsp;ocular blast injury\u0026nbsp;model, ONC model could\u0026nbsp;avoid serious anterior and posterior segment damage and decrease mortality rate of animal. However, the drawback of the ONC model though is that it cannot calculate the force applied on the forceps to obtain crush injury [11]. Therefore, we improved the ONC model and developed a new model of ON transverse quantitative traction (ONTQT), which could both simulate\u0026nbsp;model of indirect TON and calculate the force applied on the ON by transverse quantitative traction. In previous studies, we confirmed that the survival rates of RGCs at 1, 3, 7 and 14 days post-modeling were 78.94 %, 60.07 %, 38.92 %, and 17.31 % respectively. The modeling was achieved by ON transverse traction horizontally for a duration of 20 seconds (S) with a force of 0.1 newton (N) [12]. Previous research has shown that the integrity of the NVU upon ONC was destroyed in the retina of mice and MMP-3 can attenuate neuroinflammation and neurodegeneration by tightening the glia limitans [4].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTherefore, in this study we aimed to investigate the complex interplay between RGCs, astrocytes and microvascular cells in a new optic nerve injury model of ONTQT. The study\u0026rsquo;s hypothesis is that ONTQT causes the NVU dysfunction of inner retina, including the impairment of two basement membrane constitutes of astrocyte end-feet and ECs/PCs, which accelerate the RGC loss. Following experimental TON, we investigated changes in the retinal iBRB and NVU function through ultrastructural observation and evaluation of tight junction (TJ) proteins and astrocyte end-feet proteins. Elucidating the pathophysiological sequence following ON injury is crucial for optimizing clinical management and developing novel strategies to prevent or reverse vison loss in patients with TON.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eAnimals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal procedures were approved by the Animal Ethics and Welfare Committee of Beijing Tongren Hospital Affiliated to Capital Medical University (Approval No.: TRLAWEC2022-S169). Specific pathogen-free (SPF) male Wistar rats aged 6 to 8 weeks were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. A total of 24 rats were housed in a SPF animal facility under controlled conditions (22\u0026deg;C constant temperature, 12 h light/12 h dark cycle) with free access to food and water. All animal experimental procedures were strictly in accordance with the national guidelines for the care and use of laboratory animals, including the Guide for the Care and Use of Laboratory Animals and the Beijing Laboratory Animal Welfare and Ethics Review Criteria issued by the Ministry of Science and Technology of China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eONTQT Surgery\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBefore model establishment, funduscopic examination was performed using an ophthalmoscope (Olympus Co., Ltd., Tokyo, Japan) to verify the integrity of the retina and its vasculature. The ONTQT model was established referring to a previously reported method with minor modifications [12]. Briefly, following anesthesia with 2% pentobarbital sodium (50 mg/kg, i.p.), each rat was positioned prone. The surgical field was sterilized with iodine, and a lateral canthal incision was made in the left orbit using conjunctival scissors. The oblique rectus muscle was carefully detached to expose the optic nerve (ON), which was then bluntly dissected from its sheath. For the model group (MG), a 6-0 polyester suture was looped around the ON at 2 mm posterior to the globe. The loop\u0026apos;s circumference was matched to that of the ON to avoid constriction. A digital force gauge (DNT-50, TECLOCK, Japan) was attached to the suture end, and a perpendicular traction force of 0.20 N was applied horizontally for 20 s. Post-operatively, the skin incision was closed, and the wound was disinfected with iodine and treated with topical erythromycin ointment. In the sham group (SG), the ON was surgically exposed but not subjected to traction.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlash visual evoked potentials (FVEP) test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe rats underwent FVEP testing 14 days post-injury. After being adapted to the dark for 15 minutes, the rats were anesthetized and fixed to the experiment station. The waveforms for each rat were recorded using an electrophysiological tester (Roland Electronics Co., Ltd., Keltern, Germany). A silver electrode was implanted beneath the skin at the midpoint of the line connecting the ear roots, which was recording electrode. The reference electrode was implanted into the midpoint of the binoculus and the ground electrode was inserted into the tail. When recording from the left eye, the right eye was covered with a self-made black eyeshade. White flash stimuli were delivered 50 times at frequency of 1 hertz (Hz) for a duration of 250 ms. To evaluate visual function, the latency (ms) and amplitude (\u0026mu;v) of the P1 and P2 waves in rats from each group were compared [13, 14]. The FVEP test of every rat were repeated four times and there were 4 rats in each group received FVEP test. After FVEP test, all rats were euthanized by an intraperitoneal overdose of pentobarbital sodium (150 mg/kg). Death was verified by respiratory and cardiac arrest before tissue collection. All procedures were performed in accordance with the institutional guidelines for animal welfare.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence protocol\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe eyeball tissue was harvested and fixed immediately in 10% formalin. The tissue was subsequently dehydrated in graded ethanol series and embedded in paraffin. Four-\u0026mu;m serial paraffin sections were cut along the vertical meridian with a microtome (CR-601ST, Jinhua Craftek lnstrument Co., Ltd., JinHua, China). Tissues were washed in PBS (3\u0026thinsp;x\u0026thinsp;5\u0026thinsp;min) and then incubated in blocking solution (10% goat serum) for 0.5\u0026thinsp;h at room temperature, followed by incubation in primary antibodies either overnight at 4\u0026thinsp;\u0026deg;C. The primary antibodies used were: glial fibrillary acidic protein (GFAP) monoclonal antibody (1:200, 60190-1-lg, Proteintech), RNA binding protein with multiple splicing (RBPMS) polyclonal antibody (1:200, 15187-1-AP, Proteintech). The next day, tissues were washed in PBS (3\u0026thinsp;\u0026times;\u0026thinsp;5\u0026thinsp;min) and incubated with secondary antibodies conjugated to PE (1:200, goat anti\u0026ndash;rabbit; Servicebio) for 1\u0026thinsp;h. Retinas were incubated with the nuclear dye DAPI for 20\u0026thinsp;min, washed in PBS (3\u0026thinsp;\u0026times;\u0026thinsp;5\u0026thinsp;min), before microscopic analysis. All sections were observed under fluorescence microscope (Nippon Kogaku, ELCIPSE-CI) and x 200, x 400 magnification photomicrograph images were captured. The results were analyzed using an imaging analysis system.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern Blot Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRetinal tissues were carefully dissected on ice and immediately lysed in RIPA lysis buffer containing a protease inhibitor cocktail. The lysates were centrifuged at 20,000 rpm for 15 min at 4\u0026deg;C (Scilogex, LLC, Rocky Hill, CT, USA), and the supernatant was collected as the total protein extract. The protein concentration in each sample was determined using a BCA Protein Assay Kit (Solarbio, Beijing, China) according to the manufacturer\u0026rsquo;s instructions. Based on the molecular weight of target proteins, equal amounts of protein samples were separated by 10%\u0026ndash;12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), then electrotransferred onto nitrocellulose (NC) membranes. The NC membranes were blocked with 5% non-fat dry milk in TBST buffer for 1 h at room temperature to block non-specific binding, followed by incubation with primary antibodies at 4\u0026deg;C overnight. The primary antibodies used were as follows: Rabbit anti-Claudin 1 (1:1000, 2H10D10, Invitrogen), Rabbit anti-Claudin 5 (1:1000, 4C3C2, Invitrogen), aquaporin-4 (AQP4) polyclonal antibody (1:1000, 16473-1-AP, Proteintech), inwardly rectifying potassium channel subtype 4.1 (Kir4.1) polyclonal antibody (1:1000, 12503-1-AP, Proteintech), Rabbit anti-tubulin (1:5000, Servicebio) and anti-beta-actin (1:5000, Servicebio). After three washes with TBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated anti-rabbit IgG secondary antibody (1:5000, Servicebio) for 1 h at room temperature. The protein bands were visualized using an enhanced chemiluminescence (ECL) detection system (Clinx Science Instruments Co., Ltd., Shanghai, China). The relative optical density of each protein band was quantified using Image J software (NIH, USA), with tubulin or beta-actin as the internal reference.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTransmission electron microscopy\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;(TEM)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEyes were isolated and fixed in 2.5% glutaraldehyde (pH 7.4) for 2h. The eye was gently secured in place by the optic nerve and the cornea removed with microdissection scissors rostral or anterior to the limbus. The lens and vitreous were then removed though the opening made by removal of the cornea. After washed three times with 0.1M phosphate buffer (pH 7.2) and fixed in 1% osmic acid at 4 ℃ for 2h. Then the samples were gradient dehydrated in a graded series of ethanol. Subsequently, the samples were embedded in Epon-Araldite resin for penetration and placed in a mold for polymerization. After the semi thin section was used for positioning, the ultrathin section was made and collected for microstructure analysis. Followed the counterstaining of 3% uranyl acetate and 2.7% lead citrate. Then observed with a JEM1400 transmission electron microscope.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative Real-Time PCR Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from frozen retinal tissues using a Total RNA Extractor Kit (Sangon Biotech, Shanghai, China), and the RNA purity and concentration were determined by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). First-strand cDNA was synthesized from 1\u0026nbsp;\u0026mu;g of total RNA using a PrimeScript RT Reagent Kit (Vazyme, Nanjing, China) following the manufacture\u0026rsquo;s protocol. Quantitative real-time PCR (RT-qPCR) was performed on an ABI 7300 Real-Time PCR System (Applied Biosystems, USA) using a SYBR Green qPCR Master Mix (Vazyme, Nanjing, China). The thermal cycling program was set as follows: initial denaturation at 94\u0026deg;C for 5 min, followed by 40 cycles of denaturation at 94\u0026deg;C for 15 s and annealing/extension at 60\u0026deg;C for 30 s. All qPCR reactions were performed in triplicate with three biological replicates. The primer sequences for target genes are listed in Table 1. The relative mRNA expression levels of target genes were calculated using the 2\u003csup\u003e\u0026minus;\u0026Delta;Ct\u003c/sup\u003e method, and the fold change in expression compared with the model group was determined using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method. Tubulin was used as the housekeeping gene for internal normalization. Beta-actin was used as the housekeeping gene for internal normalization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1\u0026nbsp;\u003c/strong\u003eThe mRNA sequences of primers\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 183px;\"\u003e\n \u003cp\u003eTarget\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 385px;\"\u003e\n \u003cp\u003eprimer\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 183px;\"\u003e\n \u003cp\u003eAQP4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 184px;\"\u003e\n \u003cp\u003eforward primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 202px;\"\u003e\n \u003cp\u003eCCTCTGCTTTGGACTCAGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 184px;\"\u003e\n \u003cp\u003ereverse primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 202px;\"\u003e\n \u003cp\u003eCTTTCGTGTGCACACCATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 183px;\"\u003e\n \u003cp\u003eKir4.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 184px;\"\u003e\n \u003cp\u003eforward primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 202px;\"\u003e\n \u003cp\u003eGGCTATGGCTTCCGCTACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 184px;\"\u003e\n \u003cp\u003ereverse primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 202px;\"\u003e\n \u003cp\u003eAGAATGGTGGTGAGCACGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 183px;\"\u003e\n \u003cp\u003eBeta-Actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 184px;\"\u003e\n \u003cp\u003eforward primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 202px;\"\u003e\n \u003cp\u003eACCCAGATCATGTTTGAGACCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 184px;\"\u003e\n \u003cp\u003ereverse primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 202px;\"\u003e\n \u003cp\u003eGACCAGAGGCATACAGGGACAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eAbbreviations: AQP4, Aquaporin-4; Kir4.1 Inwardly rectifying potassium channel subtype 4.1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experimental data were expressed as the mean \u0026plusmn; standard error of the mean (SEM). Statistical analyses were performed using SPSS 27.0 software (IBM SPSS, Shanghai, China). The normality of data distribution was tested using the Shapiro-Wilk test. For two-group comparisons, an independent-sample t-test was applied for normally distributed data; otherwise, the Mann-Whitney U test was used. A two-tailed P value \u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eA decline in visual function in rats following ONTQT\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the visual function of the optic nerve, we record the F-VEP at 14 days post-modeling (Figure 2). In terms of P1 peak latency, there was no statistically significant difference between the MG group and SG group on the 14th day after injury (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026gt; 0.05). However, the peak latency of P2 was prolonged at 14 days post ONTQT injury (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05). In addition, the MG exhibited a significantly decreased amplitude in N1-P1 and N2-P2 compared to the SG (\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt; 0.05). These changes indicated that ONTQT surgery decreased visual function of rats.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eModifications in the Components of NVU within the Retina Following ONT\u003c/strong\u003e\u003cstrong\u003eQT\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;in a Rat\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo observe the structure of the NVU in the inner retina, we conducted TEM on retinal tissue from rats 14 days post-modeling. In the TEM (Figure 2), we can find the NVU consists of two main components. Firstly, ECs, which are covered by the endothelial basement membrane and sealed tightly by vascular tight junctions, form the BRB. Secondly, the end - feet of astrocytes and muller glia along with the glial basement membrane make up the glia limitans. These two NVU barriers encircle a perivascular space. The present ultrastructural study showed that microvessel of inner retina after ONTQT exhibited irregularity of luminal circularity compared to that of sham group. Remodeling of PCs can be easily observed in the MG sample, which exhibits rounded nuclei and hypertrophic changes accompanied by increased lysosomes, vacuoles, and vesicles. Few Endothelial cell swellings and vacuole formations can be seen in the MG. Furthermore, structural changes of the basement membranes of NVU, including degradation, diffusion and thickening have been found in the retina of MG. Moreover, astrocyte swellings and end-foot detachments were observed in the MG and the perivascular astrocyte showed swollen, cytoplasmic vacuolation and cytoplasmic. Besides, most of the TJs appeared intact as a series of electron-dense zones sealing intercellular clefts in SG. By contrast, ultrastructural abnormalities of TJs were observed in MG.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLoss of RGCs and glia activitation in retina of rats after ONT\u003c/strong\u003e\u003cstrong\u003eQT\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ganglion cell layer (GCL) contained a monolayer of RGCs. The expression of RBPMS, as a marker of RGCs, was used to evaluate the survival of RGCs. We uesd immunofluorescence assays with antibodies against RBPMS in the retina of rats and estimated the expression of RBPMS in GCL 14-day after modeling.\u0026nbsp;As shown in Figure 4A, the number of of RGC labeled RBPMS in GCL was reduced in the injured retinal tissues (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). To evaluate the activity of glia, GFAP immunofluorescence staining was conducted. Figure 4C displays GFAP, as an astrocyte marker, was over-expression in the injured retinal sctions post 14-day ONTQT (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The results illustrate that the modeling of ONTQT significantly promotes the death of RGCs, whereas it enhances the activation of glial cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eONT\u003c/strong\u003e\u003cstrong\u003eQT\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;results in a downregulation of tight junction molecules (TJMs) in the retina.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe maintenance of epithelial-tight junctional integrity by TJMs is essential for protecting the NVU in the retina, where claudins are the primary transmembrane molecules that facilitate epithelial contact. To investigate the expression of TJMs in the retinal NVU, western blot analysis was performed. As shown in Figure 5A and Figure 5B, the relative expression of claudin-1 and claudin-5 was reduced in ONTQT retina compared to those in the sham group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Furthermore, astrocytes are integral components of the Neurovascular Unit (NVU) and play a crucial role in its maintenance. The mRNA expression levels of\u0026nbsp;astrocyte end-foot markers, such as AQP4 and Kir4.1, was conducted using qRT-PCR\u0026nbsp;analysis. Figures 5C and 5D reveal that there was a significant increase in the mRNA level of AQP4\u0026nbsp;(\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas the mRNA level of Kir4.1 was decreased in the retina 14 days post-ONC compared to those observed in the sham group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe retina is a portion of the central nervous system, as well as a highly vascularized tissue [15]. Retinal cells have a high metabolic rate and are extremely sensitive to glucose and oxygen deprivation. The retinal microvasculature supplies nutrients and oxygen to the retinal cells, playing a critical role in maintaining the visual function of the neural retina [16]. Therefore, the microenvironment of the retina must be tightly regulated, and is separated from the systemic circulation by the BRB [17]. The retinal microvasculatures contain the two main cellular constituents of ECs and PCs, sharing the same basement membrane on the blood vessel walls [18]. The basement membrane covered by ECs and PCs constitutes one of the NVU barriers, which tightly sealed by vascular TJs. On the other hand, the glial basement membrane constitutes another barrier within the NVU, comprising the end feet of astrocytes and muller glia [4]. The NVU plays a role in maintaining the overall integrity of the iBRB, whereas the TJMs located between retinal endothelial cells are the essential molecular structures responsible for the maintenance of iBRB [19]. The TJMs are formed by different types of intracellular proteins and transmembrane adhesion proteins, including the tight-junction-associated MARVEL proteins, claudin family members and junctional adhesion molecules (JAMs) [20]. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe claudin family of proteins are transmembrane proteins that allow for the maintenance of tight junction integrity, which have at least 27 known members [21]. Claudins are essential for TJs formation, cell-to-cell adhesion, and the regulation of TJs permeability [1]. In the retina, claudin-1 and -5 are distributed in the plasma membranes of large and small vessels, and are specifically expressed in retinal vascular endothelial cells [22]. Claudin-5 is the most highly expressed claudin protein in endothelial cells of retinal NVU [23]. Claudin-5 expression promotes the sealing of tight junctions, and as a consequence, decreased vessel permeability, and thus enhanced endothelial barrier function [19]. Diabetic retinopathy (DR) is characterized by increased iBRB permeability. Previous studies have shown that redistribution of claudin-5 and claudin-1 occurs in the diabetic retina, along with increased vascular permeability [24-26]. Inflammation has been implicated in the pathogenesis of DR and inflammatory cytokines like VEGF, TNF-\u0026alpha;, IL-6 and IL-1\u0026beta; further decreased claudin-5 expression in the retinas of diabetic animals [24, 27]. Besides, inducible endothelial-specific claudin-5 knockdown mice show severe neuroinflammation within 2 weeks after the initiation of knockdown [28]. Furthermore, previous study has shown that expression of TJM claudin-5 showed a trend towards decreased expression within the first 4 days after optic nerve crush [4]. In our study, the expression of claudin-5 and claudin-1 in the retina was significantly downregulated in rats at 14 day following optic nerve injury, indicating the increase permeability of iBRB and the disruption of the NVU in the retina. \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAs an essential component of the visual system, astrocytes perform various functions, including providing nutrients, regulating ionic balance, neurotransmission, supplying the BRB, structural support, and synaptic plasticity [29]. In response to various insults, including glaucoma, ischemia, optic neuritis, optic nerve crush, and optic nerve transection, quiescent astrocytes enter a reactive state, the main feature of which is the activation of astrocytes typically exhibiting increased GFAP expression [30]. In retina, astrocytes are located at the inner surface of the retina and M\u0026uuml;ller glial cells vertically span the entire thickness of the retina, all of which co-regulate the function of NVU. As a barrier within the NVU, astrocytic end-feet, which compose the glial basement membrane, envelop the ECs and PCs that constitute the blood vessel lumen in the retina [31]. The study first systematically reveals the multi-dimensional pathological changes in the retinal NVU after ONTQT. Under TEM, ultrastructural abnormalities of NVU at 14\u003csup\u003eth\u003c/sup\u003e day following ONTQT include irregularity of luminal circularity, PCs remodeling, astrocyte swellings, detachments of astrocyte end-foot, structural changes like degradation, diffusion and thickening of the basement membranes of NVU, all of which were consistent with previous studies in CNS injuries model [32, 33]. However, swollen ECs were not distinct in the retina of NVU at 14\u003csup\u003eth\u003c/sup\u003e day following ONTQT, which may relate to the observe time. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the eyes, AQP4 is found to be expressed in the retinal astrocytes and M\u0026uuml;ller glial cells, with the highest expression occurring in the end feet membranes, which are major in transcellular water transport and in regulating cellular volume [34].In the mammalian retina, Kir4.1 is mostly expressed in the end feet of retinal M\u0026uuml;ller glial cells and is the main potassium channel in M\u0026uuml;ller cells, whose polarised expression allows K+influx into muller cells from the extracellular space [35]. Water movement into and out of muller cells relies on the co-expression of Kir4.1 and AQP4 on muller cells, which allows water to follow K+ from perisynaptic spaces to blood vessels [36]. AQP4 and Kir4.1 in retinal muller cells play important roles in controlling retinal potassium. water homeostasis, as well as maintaining the integrality of iBRB [37]. Several studies have suggested that AQP4 and Kir4.1 levels of retina vary depending on the different damages and the stage of injury. In diabetic rat both BRB disruption and retinal oedema were also observed in these retinas as well as the increased AQP4 levels and decreased Kir4.1 levels\u0026nbsp;[38]. In retinal injury induced by hypobaric hypoxia, the breakdown of the iBRB leads to retinal edema and increased expression of GFAP in muller cells, accompanied by an increase in retinal AQP4 expression and a decrease in Kir4.1 expression [36]. The previous research illustrated that AQP4 and Kir4.1 protein levels and mRNA expressions in retina decreased at days 2, 7, and 14 following optic nerve crush [39]. In our research, mRNA expressions of AQP4 in retina increased at days 14 following ONTQT injury, which is consistent with some studies [3, 36, 38]. The increasing number of reactive astrocytes in the inner retina following ONTQT may account for the rising mRNA level of AQP4. The astrocyte edema observed under TEM in the MG is probably associated with the increased expression of AQP4, which selectively transports water into cells. The decline mRNA expressions of Kir4.1 in our research indicates the intracellular potassium accumulation, which can lead to increased intracellular and extracellular osmotic pressure in astrocytes. Water is transported into cells through AQP4 driven by osmotic pressure, causing the oedema of astrocytes and muller cell [36]. However, the mRNA expression cannot completely represent the function of the protein. Retinal pathologies are accompanied by alterations of amounts and/or spatial distribution of AQP4 or Kir4.1 [35]. Muller cell oedema due to the regulation or redistribution of Kir4.1 and AQP4 has been reported to be involved in the development and progression of a variety of retinal diseases, including diabetic macular oedema, retinal vein occlusion and uveitis [36].\u003c/p\u003e\n\u003cp\u003eFirstly, the ON traction stimulates an acute local response in the injury epicenter and exacerbated glial activation immediately [40] so that increased GFAP expression of retina was exhibited following ONTQT. In the research, the reactive astrocyte with the abnormal mRNA expression of AQP4 and Kir4.1 cannot balance the potassium and water homeostasis resulting in the astrocyte swellings and detachments of astrocyte end-feet. Furthermore, another barrier of NVU was impaired, which was the basement membrane covered by ECs and PCs and tightly sealed by vascular TJs. The expression of TJs proteins like claundin-1 and claudin-5 decreased and under TEM the degradation, diffusion and thickening of the basement membranes of NVU can be observed. Finally, the disfunction of NVU boost the RGC loss in the inner retina, which was exhibited by the decrease number of RBPMS-positive RGC following ONTQT. Meanwhile, the RGC loss resulted in the visual disfunction tested by FVEP at the 14\u003csup\u003eth\u003c/sup\u003e day following ONTQT.\u0026nbsp;\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, ONTQT as a new model of indirect TON can reliably induce ON injuries and RGC loss. The research reveals that there is a link between the dysfunction of NVU and the death of RGCs at 14\u003csup\u003eth\u003c/sup\u003e day following ON injury. The mechanisms of iBRB breakdown after ONTQT are relative to the downregulation of the TJs like claudin-1 and claudin-5, as well as the redistribution in the perivascular macroglial end feet markers like AQP4 and Kir4.1. The two barriers of NVU, constituted by the ECs and PCs and the end feet of astrocytes and muller glia, are critical for RGCs protection after optic nerve injury. However, we are lack of experiments at different time points after ONTQT. The expression of TJ proteins and perivascular macroglial end feet markers may show varying outcomes in the early stages following optic nerve injury. The further investigation should be developed in the future.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eNVU Neurovascular unit\u003c/p\u003e\n\u003cp\u003eON Optic nerve\u003c/p\u003e\n\u003cp\u003eONTQT Optic nerve transverse quantitative traction\u003c/p\u003e\n\u003cp\u003eSG Sham group\u003c/p\u003e\n\u003cp\u003eMG Model group\u003c/p\u003e\n\u003cp\u003eFVEP Flash visual evoked potentials\u003c/p\u003e\n\u003cp\u003eTEM Transmission electron microscopy\u003c/p\u003e\n\u003cp\u003eTJs Tight junctions\u003c/p\u003e\n\u003cp\u003eRGC Retinal ganglion cell\u003c/p\u003e\n\u003cp\u003eTON Traumatic optic neuropathy\u003c/p\u003e\n\u003cp\u003eONC Optic nerve crush\u003c/p\u003e\n\u003cp\u003eRBPMS RNA binding protein with multiple splicing\u003c/p\u003e\n\u003cp\u003eGFAP Glial fibrillary acidic protein\u003c/p\u003e\n\u003cp\u003eAQP4 Aquaporin-4\u003c/p\u003e\n\u003cp\u003eKir4.1 Inwardly rectifying potassium channel subtype 4.1\u003c/p\u003e\n\u003cp\u003eBRB Blood-retinal barrier\u003c/p\u003e\n\u003cp\u003eiBRB Inner blood-retina barrier\u003c/p\u003e\n\u003cp\u003eoBRB Outer blood-retina barrier\u003c/p\u003e\n\u003cp\u003eRPE Retinal pigment epithelial\u003c/p\u003e\n\u003cp\u003eGCL Ganglion cell layer\u003c/p\u003e\n\u003cp\u003eTJMs Tight junction molecules\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eECs endothelial cells\u003c/p\u003e\n\u003cp\u003ePCs pericytes\u003c/p\u003e\n\u003cp\u003eJAMs Junctional adhesion molecules\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Ethics and Welfare Review of Laboratory Animals in Beijing Tongren Hospital Affiliated to Capital Medical University (No. TRLAWEC2022-S169) gave approval for the animal care and experiments. The rats in research were carried out in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23) revised 1996.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003cstrong\u003evailability\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;of Data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data used to support the findings of this study are available from the corresponding author upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interest\u003c/strong\u003e\u003cstrong\u003es\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that there is no conflict of interest regarding the publication of this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research is funded by the National Natural Science Foundation of China (NO.82205194).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003cstrong\u003euthor\u003c/strong\u003e\u003cstrong\u003es\u0026rsquo;\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;contribution\u003c/strong\u003e\u003cstrong\u003es\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQiong Wu: Writing - original draft, Writing - review \u0026amp; editing, Methodology, Investigation, Formal analysis, Data curation, Project administration, Funding acquisition. Hui Wang: Writing - review \u0026amp; editing, Formal analysis. Hongjuan Liu: Software, Supervision. Luyin Zhang: Methodology, Validation. Qiping Wei: Writing - review \u0026amp; editing, Methodology.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAckonwledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThanks for the laboratory equipment provided by University of Capital Medical University.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eO\u0026apos;Leary F, Campbell M: \u003cstrong\u003eThe blood-retina barrier in health and disease\u003c/strong\u003e. \u003cem\u003eFebs j \u003c/em\u003e2023, \u003cstrong\u003e290\u003c/strong\u003e(4):878-891.\u003c/li\u003e\n\u003cli\u003eNaylor A, Hopkins A, Hudson N, Campbell M: \u003cstrong\u003eTight Junctions of the Outer Blood Retina Barrier\u003c/strong\u003e. \u003cem\u003eInt J Mol Sci \u003c/em\u003e2019, \u003cstrong\u003e21\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eAlbargothy MJ, Azizah NN, Stewart SL, Troendle EP, Steel DHW, Curtis TM, Taggart MJ: \u003cstrong\u003eInvestigation of heterocellular features of the mouse retinal neurovascular unit by 3D electron microscopy\u003c/strong\u003e. \u003cem\u003eJ Anat \u003c/em\u003e2023, \u003cstrong\u003e243\u003c/strong\u003e(2):245-257.\u003c/li\u003e\n\u003cli\u003eLefevere E, Salinas-Navarro M, Andries L, Noterdaeme L, Etienne I, Van Wonterghem E, Vinckier S, Davis BM, Van Bergen T, Van Hove I\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTightening the retinal glia limitans attenuates neuroinflammation after optic nerve injury\u003c/strong\u003e. \u003cem\u003eGlia \u003c/em\u003e2020, \u003cstrong\u003e68\u003c/strong\u003e(12):2643-2660.\u003c/li\u003e\n\u003cli\u003eHorng S, Therattil A, Moyon S, Gordon A, Kim K, Argaw AT, Hara Y, Mariani JN, Sawai S, Flodby P\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAstrocytic tight junctions control inflammatory CNS lesion pathogenesis\u003c/strong\u003e. \u003cem\u003eJ Clin Invest \u003c/em\u003e2017, \u003cstrong\u003e127\u003c/strong\u003e(8):3136-3151.\u003c/li\u003e\n\u003cli\u003eNian S, Lo ACY, Mi Y, Ren K, Yang D: \u003cstrong\u003eNeurovascular unit in diabetic retinopathy: pathophysiological roles and potential therapeutical targets\u003c/strong\u003e. \u003cem\u003eEye Vis (Lond) \u003c/em\u003e2021, \u003cstrong\u003e8\u003c/strong\u003e(1):15.\u003c/li\u003e\n\u003cli\u003eAlarcon-Martinez L, Shiga Y, Villafranca-Baughman D, Cueva Vargas JL, Vidal Paredes IA, Quintero H, Fortune B, Danesh-Meyer H, Di Polo A: \u003cstrong\u003eNeurovascular dysfunction in glaucoma\u003c/strong\u003e. \u003cem\u003eProg Retin Eye Res \u003c/em\u003e2023, \u003cstrong\u003e97\u003c/strong\u003e:101217.\u003c/li\u003e\n\u003cli\u003eKarimi S, Arabi A, Ansari I, Shahraki T, Safi S: \u003cstrong\u003eA Systematic Literature Review on Traumatic Optic Neuropathy\u003c/strong\u003e. \u003cem\u003eJ Ophthalmol \u003c/em\u003e2021, \u003cstrong\u003e2021\u003c/strong\u003e:5553885.\u003c/li\u003e\n\u003cli\u003eRyan AK, Asemota BI, Heisler-Taylor T, Mello C, Rodriguez L, Sponsel WE, Racine J, Rex TS, Glickman RD, Reilly MA: \u003cstrong\u003eTorsion-Induced Traumatic Optic Neuropathy (TITON): A Physiologically Relevant Animal Model of Traumatic Optic Neuropathy\u003c/strong\u003e. \u003cem\u003ebioRxiv \u003c/em\u003e2025.\u003c/li\u003e\n\u003cli\u003eBastakis GG, Ktena N, Karagogeos D, Savvaki M: \u003cstrong\u003eModels and treatments for traumatic optic neuropathy and demyelinating optic neuritis\u003c/strong\u003e. \u003cem\u003eDev Neurobiol \u003c/em\u003e2019, \u003cstrong\u003e79\u003c/strong\u003e(8):819-836.\u003c/li\u003e\n\u003cli\u003eLevkovitch-Verbin H: \u003cstrong\u003eAnimal models of optic nerve diseases\u003c/strong\u003e. \u003cem\u003eEye (Lond) \u003c/em\u003e2004, \u003cstrong\u003e18\u003c/strong\u003e(11):1066-1074.\u003c/li\u003e\n\u003cli\u003eWu Q, Gu X, Liu X, Yan X, Liao L, Zhou J: \u003cstrong\u003eAstragalus membranaceus Injection Protects Retinal Ganglion Cells by Regulating the Nerve Growth Factor Signaling Pathway in Experimental Rat Traumatic Optic Neuropathy\u003c/strong\u003e. \u003cem\u003eEvid Based Complement Alternat Med \u003c/em\u003e2020, \u003cstrong\u003e2020\u003c/strong\u003e:2429843.\u003c/li\u003e\n\u003cli\u003eYi Z, Chen L, Wang X, Chen C, Xing Y: \u003cstrong\u003eProtective Effects of Intravitreal Injection of the Rho-Kinase Inhibitor Y-27632 in a Rodent Model of Nonarteritic Anterior Ischemic Optic Neuropathy (rAION)\u003c/strong\u003e. \u003cem\u003eJ Ophthalmol \u003c/em\u003e2020, \u003cstrong\u003e2020\u003c/strong\u003e:1485425.\u003c/li\u003e\n\u003cli\u003eRocha LR, Nguyen Huu VA, Palomino La Torre C, Xu Q, Jabari M, Krawczyk M, Weinreb RN, Skowronska-Krawczyk D: \u003cstrong\u003eEarly removal of senescent cells protects retinal ganglion cells loss in experimental ocular hypertension\u003c/strong\u003e. \u003cem\u003eAging Cell \u003c/em\u003e2020, \u003cstrong\u003e19\u003c/strong\u003e(2):e13089.\u003c/li\u003e\n\u003cli\u003eKurihara T: \u003cstrong\u003eDevelopment and pathological changes of neurovascular unit regulated by hypoxia response in the retina\u003c/strong\u003e. \u003cem\u003eProg Brain Res \u003c/em\u003e2016, \u003cstrong\u003e225\u003c/strong\u003e:201-211.\u003c/li\u003e\n\u003cli\u003eHuang H: \u003cstrong\u003ePericyte-Endothelial Interactions in the Retinal Microvasculature\u003c/strong\u003e. \u003cem\u003eInt J Mol Sci \u003c/em\u003e2020, \u003cstrong\u003e21\u003c/strong\u003e(19).\u003c/li\u003e\n\u003cli\u003eCunha-Vaz J, Bernardes R, Lobo C: \u003cstrong\u003eBlood-retinal barrier\u003c/strong\u003e. \u003cem\u003eEur J Ophthalmol \u003c/em\u003e2011, \u003cstrong\u003e21 Suppl 6\u003c/strong\u003e:S3-9.\u003c/li\u003e\n\u003cli\u003eZhou LY, Liu ZG, Sun YQ, Li YZ, Teng ZQ, Liu CM: \u003cstrong\u003ePreserving blood-retinal barrier integrity: a path to retinal ganglion cell protection in glaucoma and traumatic optic neuropathy\u003c/strong\u003e. \u003cem\u003eCell Regen \u003c/em\u003e2025, \u003cstrong\u003e14\u003c/strong\u003e(1):13.\u003c/li\u003e\n\u003cli\u003eKakogiannos N, Ferrari L, Giampietro C, Scalise AA, Maderna C, Rav\u0026agrave; M, Taddei A, Lampugnani MG, Pisati F, Malinverno M\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eJAM-A Acts via C/EBP-\u0026alpha; to Promote Claudin-5 Expression and Enhance Endothelial Barrier Function\u003c/strong\u003e. \u003cem\u003eCirc Res \u003c/em\u003e2020, \u003cstrong\u003e127\u003c/strong\u003e(8):1056-1073.\u003c/li\u003e\n\u003cli\u003eCampbell M, Humphries P: \u003cstrong\u003eThe blood-retina barrier: tight junctions and barrier modulation\u003c/strong\u003e. \u003cem\u003eAdv Exp Med Biol \u003c/em\u003e2012, \u003cstrong\u003e763\u003c/strong\u003e:70-84.\u003c/li\u003e\n\u003cli\u003eHudson N, Celkova L, Hopkins A, Greene C, Storti F, Ozaki E, Fahey E, Theodoropoulou S, Kenna PF, Humphries MM\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eDysregulated claudin-5 cycling in the inner retina causes retinal pigment epithelial cell atrophy\u003c/strong\u003e. \u003cem\u003eJCI Insight \u003c/em\u003e2019, \u003cstrong\u003e4\u003c/strong\u003e(15).\u003c/li\u003e\n\u003cli\u003eLuo Y, Xiao W, Zhu X, Mao Y, Liu X, Chen X, Huang J, Tang S, Rizzolo LJ: \u003cstrong\u003eDifferential expression of claudins in retinas during normal development and the angiogenesis of oxygen-induced retinopathy\u003c/strong\u003e. \u003cem\u003eInvest Ophthalmol Vis Sci \u003c/em\u003e2011, \u003cstrong\u003e52\u003c/strong\u003e(10):7556-7564.\u003c/li\u003e\n\u003cli\u003eHashimoto Y, Campbell M: \u003cstrong\u003eKey Claudins at the Blood-Retina Barriers\u003c/strong\u003e. \u003cem\u003eAdv Exp Med Biol \u003c/em\u003e2025, \u003cstrong\u003e1468\u003c/strong\u003e:447-451.\u003c/li\u003e\n\u003cli\u003eArima M, Nakao S, Yamaguchi M, Feng H, Fujii Y, Shibata K, Wada I, Kaizu Y, Ahmadieh H, Ishibashi T\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eClaudin-5 Redistribution Induced by Inflammation Leads to Anti-VEGF-Resistant Diabetic Macular Edema\u003c/strong\u003e. \u003cem\u003eDiabetes \u003c/em\u003e2020, \u003cstrong\u003e69\u003c/strong\u003e(5):981-999.\u003c/li\u003e\n\u003cli\u003eArima M, Cui D, Kimura T, Sonoda KH, Ishibashi T, Matsuda S, Ikeda E: \u003cstrong\u003eBasigin can be a therapeutic target to restore the retinal vascular barrier function in the mouse model of diabetic retinopathy\u003c/strong\u003e. \u003cem\u003eSci Rep \u003c/em\u003e2016, \u003cstrong\u003e6\u003c/strong\u003e:38445.\u003c/li\u003e\n\u003cli\u003eXu X, Xu S, Gao Y, He S, He J, Chen X, Guo J, Zhang X: \u003cstrong\u003eRemote ischemic conditioning slows blood-retinal barrier damage in type 1 diabetic rats\u003c/strong\u003e. \u003cem\u003eBrain Res \u003c/em\u003e2025, \u003cstrong\u003e1846\u003c/strong\u003e:149253.\u003c/li\u003e\n\u003cli\u003eGon\u0026ccedil;alves A, Marques C, Leal E, Ribeiro CF, Reis F, Ambr\u0026oacute;sio AF, Fernandes R: \u003cstrong\u003eDipeptidyl peptidase-IV inhibition prevents blood-retinal barrier breakdown, inflammation and neuronal cell death in the retina of type 1 diabetic rats\u003c/strong\u003e. \u003cem\u003eBiochim Biophys Acta \u003c/em\u003e2014, \u003cstrong\u003e1842\u003c/strong\u003e(9):1454-1463.\u003c/li\u003e\n\u003cli\u003eGreene C, Kealy J, Humphries MM, Gong Y, Hou J, Hudson N, Cassidy LM, Martiniano R, Shashi V, Hooper SR\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eDose-dependent expression of claudin-5 is a modifying factor in schizophrenia\u003c/strong\u003e. \u003cem\u003eMol Psychiatry \u003c/em\u003e2018, \u003cstrong\u003e23\u003c/strong\u003e(11):2156-2166.\u003c/li\u003e\n\u003cli\u003eYazdankhah M, Shang P, Ghosh S, Hose S, Liu H, Weiss J, Fitting CS, Bhutto IA, Zigler JS, Jr., Qian J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eRole of glia in optic nerve\u003c/strong\u003e. \u003cem\u003eProg Retin Eye Res \u003c/em\u003e2021, \u003cstrong\u003e81\u003c/strong\u003e:100886.\u003c/li\u003e\n\u003cli\u003eYang X-T, Huang G-H, Feng D-F, Chen K: \u003cstrong\u003eInsight into astrocyte activation after optic nerve injury\u003c/strong\u003e. \u003cem\u003eJournal of Neuroscience Research \u003c/em\u003e2015, \u003cstrong\u003e93\u003c/strong\u003e(4):539-548.\u003c/li\u003e\n\u003cli\u003eHudson N, Campbell M: \u003cstrong\u003eTight Junctions of the Neurovascular Unit\u003c/strong\u003e. \u003cem\u003eFront Mol Neurosci \u003c/em\u003e2021, \u003cstrong\u003e14\u003c/strong\u003e:752781.\u003c/li\u003e\n\u003cli\u003eLi C, Chen S, Siedhoff HR, Grant D, Liu P, Balderrama A, Jackson M, Zuckerman A, Greenlief CM, Kobeissy F\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eLow-intensity open-field blast exposure effects on neurovascular unit ultrastructure in mice\u003c/strong\u003e. \u003cem\u003eActa Neuropathol Commun \u003c/em\u003e2023, \u003cstrong\u003e11\u003c/strong\u003e(1):144.\u003c/li\u003e\n\u003cli\u003eErickson MA, Shulyatnikova T, Banks WA, Hayden MR: \u003cstrong\u003eUltrastructural Remodeling of the Blood-Brain Barrier and Neurovascular Unit by Lipopolysaccharide-Induced Neuroinflammation\u003c/strong\u003e. \u003cem\u003eInt J Mol Sci \u003c/em\u003e2023, \u003cstrong\u003e24\u003c/strong\u003e(2). \u003c/li\u003e\n\u003cli\u003eGoodyear MJ, Crewther SG, Junghans BM: \u003cstrong\u003eA role for aquaporin-4 in fluid regulation in the inner retina\u003c/strong\u003e. \u003cem\u003eVis Neurosci \u003c/em\u003e2009, \u003cstrong\u003e26\u003c/strong\u003e(2):159-165.\u003c/li\u003e\n\u003cli\u003eZhao M, Bousquet E, Valamanesh F, Farman N, Jeanny JC, Jaisser F, Behar-Cohen FF: \u003cstrong\u003eDifferential regulations of AQP4 and Kir4.1 by triamcinolone acetonide and dexamethasone in the healthy and inflamed retina\u003c/strong\u003e. \u003cem\u003eInvest Ophthalmol Vis Sci \u003c/em\u003e2011, \u003cstrong\u003e52\u003c/strong\u003e(9):6340-6347.\u003c/li\u003e\n\u003cli\u003eHan C, Li Y, Zheng X, Zhang X, Li G, Zhao L, Chen Z, Yang Y, Zhang W: \u003cstrong\u003eAQP4- and Kir4.1-Mediated M\u0026uuml;ller Cell Oedema Is Involved in Retinal Injury Induced By Hypobaric Hypoxia\u003c/strong\u003e. \u003cem\u003eMol Neurobiol \u003c/em\u003e2025, \u003cstrong\u003e62\u003c/strong\u003e(2):2012-2022.\u003c/li\u003e\n\u003cli\u003eSiqueiros-Marquez L, B\u0026eacute;nard R, Vacca O, Charles-Messance H, Bola\u0026ntilde;os-Jimenez R, Guilloneau X, Sennlaub F, Monta\u0026ntilde;ez C, Sahel JA, Rendon A\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eProtection of Glial M\u0026uuml;ller Cells by Dexamethasone in a Mouse Model of Surgically Induced Blood-Retinal Barrier Breakdown\u003c/strong\u003e. \u003cem\u003eInvest Ophthalmol Vis Sci \u003c/em\u003e2017, \u003cstrong\u003e58\u003c/strong\u003e(2):876-886.\u003c/li\u003e\n\u003cli\u003eZhang Y, Xu G, Ling Q, Da C: \u003cstrong\u003eExpression of aquaporin 4 and Kir4.1 in diabetic rat retina: treatment with minocycline\u003c/strong\u003e. \u003cem\u003eJ Int Med Res \u003c/em\u003e2011, \u003cstrong\u003e39\u003c/strong\u003e(2):464-479.\u003c/li\u003e\n\u003cli\u003eDibas A, Oku H, Fukuhara M, Kurimoto T, Ikeda T, Patil RV, Sharif NA, Yorio T: \u003cstrong\u003eChanges in ocular aquaporin expression following optic nerve crush\u003c/strong\u003e. \u003cem\u003eMol Vis \u003c/em\u003e2010, \u003cstrong\u003e16\u003c/strong\u003e:330-340.\u003c/li\u003e\n\u003cli\u003eEpardo D, Balderas-M\u0026aacute;rquez JE, Rodr\u0026iacute;guez-Arzate CA, Th\u0026eacute;bault SC, Carranza M, Luna M, \u0026Aacute;vila-Mendoza J, Calder\u0026oacute;n-Vallejo D, Quintanar JL, Ar\u0026aacute;mburo C\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eGrowth Hormone Neuroprotective Effects After an Optic Nerve Crush in the Male Rat\u003c/strong\u003e. \u003cem\u003eInvest Ophthalmol Vis Sci \u003c/em\u003e2024, \u003cstrong\u003e65\u003c/strong\u003e(13):17.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-ophthalmology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"boph","sideBox":"Learn more about [BMC Ophthalmology](http://bmcophthalmol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/boph","title":"BMC Ophthalmology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Neurovascular unit, Optic nerve injury, Retinal ganglion cells, Astrocyte, Tight junctions","lastPublishedDoi":"10.21203/rs.3.rs-9014888/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9014888/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003ePurpose:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the changes in the neurovascular unit (NVU) of the retina in rats following optic nerve (ON) injury\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ON transverse quantitative traction (ONTQT) was performed to establish the model of ON and retinal injury. The rats were divided into the sham group (SG) and the model group (MG). At 14th day post-modeling, flash visual evoked potential (FVEP) test was performed to evaluate the visual function. Transmission electron microscopy (TEM) was used to observe the microstructure of retinal NVU. RNA binding protein with multiple splicing (RBPMS) immunofluorescence was applied to detect the survival retinal ganglion cell (RGC). The activity of astrocytes and Müller cells in retina was detected by glial fibrillary acidic protein (GFAP) immunofluorescence. The expression of tight junction proteins (Claudin-1, Claudin-5) and glial end feet markers aquaporin-4 (AQP4) and inwardly rectifying potassium channel subtype 4.1 (Kir4.1) in retinal tissue were test by western blot and PCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt 14th day following ONTQT, the FVEP results exhibited the prolonged peak latency of P2 and the reduced amplitudes of N1-P1 and N2-P2. TEM showed structural changes of the basement membranes in NVU and ultrastructural abnormalities of tight junctions (TJs) after ONTQT. Besides, the expression of RBPMS in GCL was down-regulated and GFAP was over-expression in the injured retinal sections. The relative expressions of claudin-1and claudin-5 declined and the mRNA levels of AQP4increased in the retina at 14 daysfollowing ONTQT. The mRNA levels of Kir4.1 was downregulated in the retina of MG.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eONTQT can be applied in the model of ON and retina injury. The dysfunction of retinal NVU may promotes the optic degeneration in rats following ONTQT, contributing to the RGCs loss and impaired visual function.\u003c/p\u003e","manuscriptTitle":"Disregulation of neurovascular unit in the retina after optic nerve injury","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-18 16:32:18","doi":"10.21203/rs.3.rs-9014888/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-09T04:20:03+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-07T05:15:57+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-30T17:26:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"110288606537859868961898518592353629568","date":"2026-03-19T16:06:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"203382863980717376023448765814089650616","date":"2026-03-17T09:10:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"137658133588757926277981096891916689132","date":"2026-03-17T04:35:46+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-16T12:55:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-11T12:37:11+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-03-11T04:39:04+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-10T22:46:06+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Ophthalmology","date":"2026-03-10T16:08:46+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-ophthalmology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"boph","sideBox":"Learn more about [BMC Ophthalmology](http://bmcophthalmol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/boph","title":"BMC Ophthalmology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6a3fc750-a581-41e6-a9e1-9df66247990c","owner":[],"postedDate":"March 18th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-04T07:08:20+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-18 16:32:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9014888","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9014888","identity":"rs-9014888","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.