Matrine inhibits invasion and migration of gallbladder cancer via regulating the PI3K/AKT signaling pathway

Matrine inhibits invasion and migration of gallbladder cancer via regulating the PI3K/AKT signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Matrine inhibits invasion and migration of gallbladder cancer via regulating the PI3K/AKT signaling pathway Rong-Liang Mo, Zhuang Li, Peng Zhang, Ming-Hui Sheng, Gen-Cheng Han, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4137130/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Gallbladder cancer (GBC) is a common malignant cancer in the biliary system, which poses a serious threat to human health. It is urgent to explore ideal drugs for the treatment of GBC. Matrine is the main active ingredient of sophora flavescentis , with a wide range of biological activities encompassing anti-inflammatory, antiviral, immunomodulatory and anti-tumor. However, the underlying mechanism by which Matrine treats GBC is still unclear. The purpose of this study is to investigate the anti-tumor effects of Matrine on GBC in vivo and in vitro , and to clarify the potential regulatory mechanisms. Here, in this primer, we found that Matrine has a significant killing effect on GBC through CCK8 and flow cytometry, including arrest of cell cycle, inhibition of GBC cell, and induction of apoptosis. Further studies in vivo confirmed that the inhibitory function of Matrine on tumor growth in NOZ xenografted nude mouse. At the same time, Matrine also significantly suppressed the migration and invasion of GBC cells through scratch and Transwell experiments. In addition, by detecting the mRNA and protein levels of epithelial-mesenchymal transition (EMT) and matrix metalloproteinases, Matrine furtherly substantiated the suppression of invasion and migration of GBC. From a mechanistic perspective, Matrine effectively decreased the abundance of p-PI3K and p-AKT protein in vivo and in vitro . More importantly, PI3K activator (740 Y-P) antagonized the anti-tumor effect of Matrine, while PI3K inhibitor (LY294002) increased the sensitivity of Matrine for GBC. Based on the above findings, we conclude that Matrine inhibits the invasion and migration of GBC by regulating PI3K/AKT signaling pathway. Our results indicate the crucial role and regulatory mechanism of Matrine in suppressing the growth of GBC, which provides a theoretical basis for Matrine to be a candidate drug for the treatment and research of GBC. Gallbladder cancer Matrine EMT PI3K/AKT signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Gallbladder cancer (GBC), a type of disease with high fatality rate, is the most common primary invasive neoplasm in the biliary tract (Kam et al. 2021 ). Due to concealed physiological location of the gallbladder, located on the lower surface of the liver, and the patient's early remediable stage when specific symptoms are rarely appearance (Vega et al. 2022 ). Therefore, most GBC is typically diagnosed incidentally in tissue specimens after symptomatic gallstone resection at advanced stage (Schepis et al. 2022 ). In addition, the highly invasive behavior and limited treatment options in advanced GBC, resulting in the poor prognosis (Sturm et al. 2022 ). Regardless of the calculous or non-calculous origin of GBC, long-term chronic inflammation is a pivotal driving factor for GBC (Sharma et al. 2017 ; Nepal et al. 2021 ). It is worth noting that many transcriptional regulatory factors, such as snail, slug, and twist, induce epithelial-mesenchymal transition (EMT) by downregulating the expression of epithelial markers and upregulating mesenchymal markers (Tripathi et al. 2023 ). More importantly, tumor cell metastasis is the main cause of tumor death and recurrence, which is closely related to the loss of cell adhesion caused by EMT activation (Akhmetkaliyev et al. 2023 ). The Phosphatidylinositol 3-kinase (PI3K)/AKT pathway is one of the most vital pathways for GBC metastasis, which plays a crucial role in the occurrence and development of GBC (Zhang et al. 2020 ; Zhang et al. 2021 ; Wei et al. 2021 ). Through transmembrane or intracellular activation, GBC cells initiate a phosphorylation cascade from PI3K activation, such as AKT activation, ultimately acquiring malignant tumor properties that involves promoting tumor cell proliferation, migration, invasion, and EMT transformation (Zhou et al. 2019 ; Tong et al. 2021 ). Surgical resection is the only treatment with a therapeutic intention for GBC, but the indications for resection are limited and the effectiveness of most chemotherapy or adjuvant therapies is low (Hu et al. 2022). Additionally, the consequences of chemotherapy, such as poor prognosis, susceptibility to recurrence, significant adverse events, vulnerability to drug resistance and low overall survival, seriously threaten the health and quality of life of patients with cancer (Roa et al. 2022 ). In order to prolong the survival period and improve the quality of life of GBC patients, there is an urgent to explore more efficient and safe treatment pathways. Traditional Chinese medicine (TCM) has been developed for thousands of years. Among them, multiple TCM monomers have natural advantages such as multiple targets, high efficiency, safety, reduction of drug resistance and adverse reactions (Moreira et al. 2023 ; Zou et al. 2024 ). Matrine is a tetracyclic quinoline alkaloid extracted from natural leguminous sophora plants such as sophora flavescens , sophora alopecuroides , and sophora root . It exists in both solid and liquid states, with the most common of which is crystalline α- Matrine (Wang et al. 2021 ; Li et al. 2023 ). Matrine has the dual advantages of Chinese medicine and chemotherapy agents. On the one hand, Matrine is a traditional Chinese herb, which has the advantages of definite pharmacological action, including mild therapeutic effects and high safety (Wang et al. 2023 ). On the other hand, Matrine, as a monomer, has a wide range of pharmacological effects, such as cardiovascular protection, anti-tumor, anti-inflammatory, immune regulation, antibacterial, and antiviral effects (You et al. 2020 ; Zhang et al. 2020 ; Zhang et al. 2023 ), especially in the field of anti-tumor. Matrine has a highly anti-tumor ability for a variety of tumors. In briefly, it suppresses the expression of EMT, Matrix metalloproteinase 2 (MMP2) and Matrix metalloproteinase 9 (MMP9) by downregulating PI3K/Akt signaling pathway, ultimately inhibiting migration, invasion and proliferation of cancer cells (Huang et al. 2017 ; Liao et al. 2017 ; Liu et al. 2017 ; Li et al. 2018 ). In addition, Matrine can induce apoptosis and cell cycle arrest (Lin et al. 2019 ; Chen et al. 2021 ). Furthermore, Matrine can not only reverse multidrug resistance (Zhang et al. 2020 ), but also inhibit the growth of xenografts in tumor mouse models (Wang et al. 2021 ), with good anti-tumor activity. Of note, Matrine injection has been used as an adjuvant therapy for anti-tumor in clinical practice (Li et al. 2023 ). However, there are few studies on Matrine for GBC. In this study, we explore whether Matrine inhibits the occurrence and development of GBC by inhibiting EMT, and its potential mechanisms. Materials and methods Preparation and management of chemical reagents Matrine (Cat. No. HY-N0164), LY294002 (PI3K inhibitor, Cat. No. HY-10108), and 740 Y-P (PI3K activator, Cat. No. HY-P0175) were all purchased from MedChemExpress (USA). Matrine, LY294002, and 740 Y-P were dissolved in DMSO to prepare stock solutions, with 0.1% final concentration of DMSO. All stock solutions were packaged and stored at -80 ℃ for long-term storage. Cell culture GBC-SD cell line, a human GBC cell line, was purchased from Procell (Wuhan, China, Cat. No. CL-0085), while NOZ cell line (Cat. No. MZ-2106) of human GBC and HGBEC cell line (Cat. No. MZ-3197) of human gallbladder epithelial immortalized was both obtained from Ningbo, China. Whelab Bioscience Limited Corporation (Shanghai, China, Cat. No. C1546) provided SGC-996 cell line of the other human GBC. NOZ cells were cultured in DMEM medium containing 10% concentrations of fetal bovine serum (FBS, Wisent, Cat. No. 085–150), 100 U/ml penicillin (Beyotime, Cat. No. C0222), and 100 µg/ml streptomycin (Beyotime, Cat. No. C0222), while SGC-996 and GBC-SD cells were maintained in PRMI 1640 complete medium. The specialized medium was used for culturing HGBEC cells. All cells were cultured at 37 ℃ with 5% carbon dioxide. CCK8 assay Cell viability was evaluated according to Cell Counting Kit-8 (MedChemExpress, Cat. No. HY-K0301) provided by the vender. The cells (HGBEC, GBC-SD, NOZ and SGC-996) were seeded in 96-well plates overnight and treated with different concentrations of Matrine (0–80 µM) for 12–72 hours, or treated with LY294002 (0–80 µM)/740 Y-P(0–80 µM) for 24 hours. Then CCK8 solution with concentration of 10% was added to each well and incubated at 37 ℃ for 4 hours. Finally, the absorbance of 450 nm was detected by Multiskan SkyHigh ThermoFisher, USA. Cells treated with 0.1% DMSO solutions were used as control. The IC50 value and survival rate of cells were calculated and the survival curve was drawn, with using GraphPad Prism 8 software. Cell cycle detection The Cell Cycle and Apoptosis Analysis Kit (Beyond, Cat. No. C1052) was used for detecting the cell cycle. Firstly, the NOZ and SGC-996 cells were seeded in a 6-well plate, then starved overnight in serum-free medium, subsequently treated with 5 and 10 µM of Matrine for 24 hours. Cells treated with 0.1% DMSO solutions were served as negative control. Next, the cells were resuspended with pre-cooled 75% ethanol to form a single-cell suspension, fixed overnight at 4°C, and incubated with PI/RNase staining buffer at 37°C in dark environment for 30 minutes. Finally, the percentage of cell cycle was measured by using flow cytometry (BD FACSCelesta, USA). All flow cytometry of results were analyzed by employing FlowJo V10 software (Tree Star, Ashland, OR, USA). Cell apoptosis detection Annexin V-FITC/PI Apoptosis Detection Kit (Bestbio, Cat. No. BB-4101) for apoptosis detection. Following the NOZ and SGC-996 cells were treated with method of “cell cycle detection”, they were resuspended into single-cell suspension with Annexin V binding buffer, and incubated with Annexin V-FITC and PI for 15 minutes at 2–8°C in dark conditions. Finally, the distribution percentage of apoptotic cells was determined by flow cytometry. Wound healing assay The NOZ and SGC-996 cells were inoculated in a 6-well plate. When the cells reached 100% confluence, they attached to the wall were scraped with a sterile needle tip and rinsed with PBS to remove the suspended cells. Then the cells remained were treated with different concentrations of Matrine(5 and 10 µM) for 24 hours, condition of the cells was photographed under optical microscope (Olympus, Cat. No. CKX53) at 0 and 24 hours. Subsequently calculation for the percentage of wound healing. Cells treated with 0.1% DMSO solutions were utilized as negative control. Transwell invasion assay Transwell assay kit (Corning, Cat. No. 3422-A) was used to assess invasion of cell. In short, Matrix (Corning, Cat. No. 356234) and serum-free medium was added to the upper cavity of Transwell at a ratio of 1:10 dilution, then incubated at 37 ℃ for 4 hours to coagulate the dilution. Next, 600 µl complete medium with FBS of 10% concentrations was pre-added to the lower cavity of each well, subsequently 100 µl with NOZ and SGC-996 cells containing serum-free medium were seeded into the upper cavity. Then the cells were exposed with 5 and 10 µM Matrine for 24h, removed the medium, and fixed with 4% paraformaldehyde (Beyotime, Cat. No. P0099) for 60 minutes. Subsequently, after staining with 0.1% Crystal Violet (Biosharp, Cat. No. BL802A) for 30 minutes, three fields were randomly selected to take photos under a microscope and count the invading cells. Cells treated with 0.1% DMSO solutions were served as negative controls. Quantitative real‑time polymerase chain reaction (qRT˗PCR) Total RNA of tissue or drug-treated cells was extracted by MagZol LS Reagent (Magentec, Cat. No. R4802), then reverse-transcribed into cDNA using 5× Hieff Canace PCR Master Mix (Yeasen, Cat. No. 10137ES08). The qRT-PCR was performed by using fluorescence quantitative PCR instrument (Roche, Cat. No. LightCycler 480) and 2 x Hieff Union qPCR TaqMan Probe Master Mix (Yeasen, Cat. No. 11205-A. GAPDH was served as control to calculate the relative expression of target gene by employing 2^ −ΔΔCt methods. The primer sequences related to human and mouse species are shown in Table 1 and Table 2 , respectively. Table 1 Human species Primer name Forward primer (5'to3') Reverse primer (5'to3') snail ACTGCAACAAGGAATACCTCAG GCACTGGTACTTCTTGACATCTG slug TGTGACAAGGAATATGTGAGCC TGAGCCCTCAGATTTGACCTG twist GTCCGCAGTCTTACGAGGAG GCTTGAGGGTCTGAATCTTGCT N-cadherin AGCCAACCTTAACTGAGGAGT GGCAAGTTGATTGGAGGGATG E-cadherin ATTTTTCCCTCGACACCCGAT TCCCAGGCGTAGACCAAGA Vimentin TGCCGTTGAAGCTGCTAACTA CCAGAGGGAGTGAATCCAGATTA MMP2 GATACCCCTTTGACGGTAAGGA CCTTCTCCCAAGGTCCATAGC MMP9 GGGACGCAGACATCGTCATC TCGTCATCGTCGAAATGGGC GAPDH CAGGAGGCATTGCTGATGAT GAAGGCTGGGGCTCATTT Table 2 Mouse species Primer name Forward primer (5'to3') Reverse primer (5'to3') snail CACACGCTGCCTTGTGTCT GGTCAGCAAAAGCACGGTT slug TGGTCAAGAAACATTTCAACGCC GGTGAGGATCTCTGGTTTTGGTA twist GGACAAGCTGAGCAAGATTCA CGGAGAAGGCGTAGCTGAG N-cadherin AGCGCAGTCTTACCGAAGG TCGCTGCTTTCATACTGAACTTT E-cadherin CAGGTCTCCTCATGGCTTTGC CTTCCGAAAAGAAGGCTGTCC Vimentin CGGCTGCGAGAGAAATTGC CCACTTTCCGTTCAAGGTCAAG MMP2 CAAGTTCCCCGGCGATGTC TTCTGGTCAAGGTCACCTGTC MMP9 CTGGACAGCCAGACACTAAAG CTCGCGGCAAGTCTTCAGAG GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA Western blot NOZ and SGC-996 cells were treated with 5 and 10 µM Matrine for 24 hours. In a parallel trial, cells were pretreated with LY294002 (1.25 µM)/740 Y-P (2.5 µM) for 4 hours prior to treating with Matrine (10 µM) for 24 hours. RIPA Lysis Buffer (Beyotime, Cat. No. P0013B) containing 1mM of Phenoxymethylsulfonyl fluoride (Solarbio, Cat. No. P0100) and Phosphatase inhibitor cocktail A (Beyotime, Cat. No. P1081) was added to cells and tissues for protein extraction. BCA Protein Assay Kit (Beyotime, Cat. No. P0012S) was adopted for protein quantification, followed by SDS-PAGE (6–15%) electrophoresis. The protein was then transferred to the PVDF membrane (Sigmaaldrich, Cat. No. IPVH00010). After 5% skimmed milk was blocked at room temperature for 2 hours, the membranes containing protein were subsequently incubated with primary antibody at 4℃ overnight and secondary antibodies at room temperature for 1 hours. NcmECL Ultra Enhanced Chemiluminescent kit (Ncmbio, Cat. No. P10300) and Gel imaging system (Bltlux, Cat. No. GelView 6000Plu) was used for developing, and the protein bands were analyzed by Image J software. The relevant antibodies information used can be found in Table 3 . Table 3 Antibody name Dilution ratio Cat No. Company GAPDH N-cadherin E-cadherin Vimentin MMP2 MMP9 p-PI3K PI3K p-AKT AKT 1:10000 1:5000 1:50000 1:5000 1:500 1:1000 1:1000 1:1000 1:5000 1:10000 10494-1-AP 22018-1-AP 20874-1-AP 10366-1-AP WL03224 WL03096 AF3241 60225-1-Ig 66444-1-Ig 60203-2-Ig Proteintech, Wuhan, China Proteintech, Wuhan, China Proteintech, Wuhan, China Proteintech, Wuhan, China Wanleibio, Shanghai, China Wanleibio, Shanghai, China Affinity, JiangSu, China Proteintech, Wuhan, China Proteintech, Wuhan, China Proteintech, Wuhan, China Tissue specimens of human GBC Tumor tissues and adjacent gallbladder tissues were taken from 6 patients with GBC at the Laparoscopic Center of Anhui Provincial General Hospital of the Chinese People's Armed Police Force in 2021. This study was approved by the Ethics Review Committee of the Anhui Provincial General Hospital of the Chinese People's Armed Police Force, as well as informed consent from all patients or their families. Xenograft gallbladder cancer model Hangzhou Ziyuan Laboratory Animal Technology Co., LTD provided 12 female BALB/c-Nude mice (3–4 weeks old, SPF grade) with production license No. SCXK (Zhejiang) 2019⁃0004. These mice were fed randomly under SPF conditions, with free access to food and water. The experiment was conducted after the mice had been adapted for one week. All animal experiments are carried out in accordance with the "Guidelines for the Care and Use of Experimental Animals". NOZ cells (5×10 6 cells per solutions of 100 µl) were injected into the right axillary region subcutaneously of BALB/c-Nude mice. When the tumor grew to 50mm 3 , the mice were randomly distributed into 3 groups (TC: model control group, Matrine-L: low-dose Matrine intervention group, Matrine-H: high-dose Matrine intervention group). Intraperitoneal injections, and the changes of body weight and tumor volume were monitored every 3 days, for a total of 11 times. After 33d feeding, the mice were euthanized, half of the tumor tissues were then stored at -80 ℃, and subsequently the remaining tumor tissues or normal tissues (heart, liver, spleen, kidney and lung) were fixed with 4% paraformaldehyde (Solarbio, Cat. No. P1110) for follow-up experiments. The calculation formula of tumor volume is 1/2× tumor length (mm)× tumor width 2 (mm 2 ). Pharmaceutical administration Matrine was prepared by sequentially adding DMSO (Solarbio, Cat. No. D8371), PEG400 (Solarbio, Cat. No. P8530), and PBS, with precisely weighed Matrine, leading to a final solution comprising 10% DMSO, 50% PEG400, and 40% PBS. Mice in the intervention group were intraperitoneally injected with 0.2 mL Matrine (5 and 10mg/kg), and the TC group was administered with 0.2 mL solvent. The intervention group and TC group received a total of 11 injections. HE staining After the tumor tissues were fixed with 4% paraformaldehyde, dehydrated, embedded, and made into 2-µm-thick continuous sections. Following this, the sections were stained with hematoxylin (Solarbio, Cat. No. H8070), dehydrated with ethanol step by step, eosin Y (Solarbio, Cat. No. G1100) contrast staining, xylene blue (Solarbio, Cat. No. A8360) transparent, and then obstructed with neutral balsam (Solarbio, Cat. No. G8590). Finally, histopathological changes of mice in each group were observed by optical microscope. Statistical analysis All experiments were conducted independently at least 3 times. The experimental results were systematically analyzed using Graphpad Prism 8 software, with data presented as standard error of mean. The comparison of independent sample was tested by T-test, while one-way ANOVA analysis was conducted for intergroup comparison. p < 0.05 indicates that the difference of experimental data was statistically significant. Results Matrine blocked the cell cycle of GBC cells, promoted their apoptosis and inhibited their growth. The chemical structure of Matrine is shown in Fig. 1 A. In order to determine the optimal conditions of Matrine, this study selected three human GBC cell lines (GBC-SD, SGC-996, and NOZ) and one human gallbladder epithelial cell line (HGBEC) for CCK8 assay. According to Fig. 1 B, Matrine significantly inhibited the proliferation activity of GBC-SD, SGC-996 and NOZ cells at high concentration (10–80 µmol/L) for 24–72 hours, along with a dose-dependent and time-dependent relationship, among which NOZ and SGC-996 cells were more sensitive to Matrine. Therefore, NOZ and SGC-996 were selected for subsequent experiments. Notably, GBC-SD cells acquired resistance after Matrine exposed to 48 hours. In addition, Matrine barely affected the viability of HGBEC cells at a low concentration (0–10 µmol/L) for 12–24 hours, indicating that the effects of concentration and time were within the safe range (Fig. 1 B). Interestingly, the IC50 values of Matrine at 24 hours for HGBEC, GBC-SD, SGC-996, and NOZ cells were 64.55 µmol/L, 44.83 µmol/L, 7.923 µmol/L and 6.74 µmol/L, respectively. Especially, the IC50 values of NOZ and SGC-996 cells were much smaller than that of GBC-SD and HGBEC cells, which strongly suggested that Matrine had a more potent influence on NOZ and SGC-996 (Fig. 1 B). Based on the comprehensive analysis of CCK8 results, the concentration (IC50: 5µmol/L, 2X IC50: 10µmol/L) and time of Matrine for 24h was selected as the optimal conditions for the follow-up experiment. Moreover, the impact of Matrine on the cell cycle of GBC cells was detected by flow cytometry. Figure 1 C showed that compared with the control group, Matrine respectively induced NOZ and SGC-996 cells to be arrested in S and G2/M phase, resulting in inhibitory effect of DNA replication and cell division, with a dose-dependent manner. To further investigate whether Matrine affects apoptosis of NOZ and SGC-996 cells, as shown in Fig. 1 D, compared with the control group, Matrine enhanced apoptosis of NOZ and SGC-996 cells in a dose-dependent manner. The apoptotic rates of NOZ and SGC-996 cells treated with high concentrations of Matrine were 89.03 ± 0.32% and 26.73 ± 2.57%, respectively. Based on the above results, we found that Matrine blocked the cell cycle of GBC cells, promoted its apoptosis, and inhibited its growth. Figure 1 Matrine blocked the cell cycle of GBC cells, promoted their apoptosis, and suppressed their growth in vitro . (A) Matrine structure diagram. (B) CCK8 assay was used to determine cell viability. HGBEC, GBC-SD, SGC-996, and NOZ cells were exposed to different concentrations of Matrine for 12–72 hours. (C-D) Flow cytometry was used for detecting cell cycle and apoptosis of NOZ and SGC-996 cells treated with Matrine (0, 5 and 10 µM) for 24 hours. (The data are displayed as the standard error of the mean and reflect three independent trials; no annotation represents comparison with 0 µM Matrine; * p < 0.05, ** p < 0.01, and *** p < 0.001.) Matrine inhibited the invasion and migration of GBC cells Activation of EMT plays a key role in the progression of GBC (Cao et al. 2022 ), and metastasis of tumor cell is the major cause of tumor development, death, and recurrence (Lengrand et al. 2023 ). To explore whether Matrine affects the invasion and migration of NOZ and SGC-996 cells. Subsequently, we tested it with a scratch experiment. The results showed that compared with the control group, Matrine suppressed the migration of NOZ and SGC-996 cells in a dose-dependent way, with high concentration of suppressive rates of 83.33 ± 6.88% and 68.67 ± 3.76%, respectively (Fig. 2 A). In addition, Transwell assay indicated that Matrine largely inhibited the invasion of NOZ and SGC-996 cells in a dose-dependent manner (Fig. 2 B). Next, the mRNA levels of EMT-related transcriptional factor (snail, slug and twist, Vimentin, N-cadherin, and E-cadherin) and matrix metalloproteinases in NOZ and SGC-996 cells were measured by qRT-PCR. Compared with the control group, Matrine significantly decreased snail, slug, twist, Vimentin, N-cadherin, MMP2 and MMP9 mRNA levels, while increased mRNA expression of E-cadherin (Fig. 2 C). More importantly, at the protein level, Matrine significantly downregulated the abundances of Vimentin, N-cadherin, MMP2 and MMP9 in GBC cells, while upregulated the levels of E-cadherin protein (Fig. 2 D). Notably, the inhibitory effect of Matrine on GBC cells was consistent with the previous gene level. These results indicated that Matrine inhibited the invasion and migration of GBC cells at both the genetic and protein levels. This suggested that Matrine exerted its effects in regulating EMT and matrix metalloproteinase-related proteins, providing molecular evidence for its anti-tumor effects. Figure 2 Matrine inhibited the invasion and migration of GBC cells in vitro . NOZ and SGC-996 cells treated with different concentrations of Matrine for 24 hours. (A) Wound healing assay for migration of GBC cells. (B) Transwell assay for invasion of GBC cells, with a scale bar of 200 micrometers. (C) mRNA expression of snail, slug, twist, Vimentin, N-cadherin, E-cadherin, MMP2 and MMP9 in GBC cells was detected using qRT-PCR. GAPDH as an internal control. (D) Protein expression of Vimentin, N-cadherin, E-cadherin, MMP2 and MMP9 in GBC cells was determined by employing Western blot. (The data indicate the standard error of the mean and reflect three independent trials; no comments represent comparison with 0 µM Matrine; * p < 0.05, ** p < 0.01, and *** p < 0.001, ns indicates no significantly statistical difference.) Invasion and migration were abnormally active in GBC To further validate NOZ and SGC-996 cells as experimental cell line in this study. Surprisingly, results of qRT-PCR showed that compared to HGBEC cells, mRNA levels of EMT-related transcriptional factors (snail, slug, twist) and genes (Vimentin, N-cadherin) in GBC cells (GBC-SD, SGC-996 and NOZ) were increased, while the mRNA levels of E-cadherin were downregulated, with NOZ and SGC-996 showing more significant changes (Fig. 3 A). This fully proved the rationality of NOZ and SGC-996 as experimental cell line for subsequent experiments. Next, mRNA levels of EMT-associated transcriptional factors (snail, slug, twist) and genes (Vimentin, N-cadherin, and E-cadherin) were detected at the genetic level in 6 pairs of GBC tissues. We found that compared to adjacent normal tissue, the mRNA levels of snail, slug, twist, Vimentin and N-cadherin mRNA levels in GBC tissues were significantly higher than those in normal tissues, while the expression level of E-cadherin mRNA was markedly lower than that of normal tissues (Fig. 3 B). Consistent with these results, compared with normal gallbladder tissues, the protein levels of Vimentin and N-cadherin in GBC tissues increased, in contrast the protein levels of E-cadherin decreased (Fig. 3 C). These results suggested that the abnormal driving force of EMT was closely related to the progression of GBC. Figure 3 Expression of EMT in GBC. (A) Compared with HGBEC cells, the mRNA levels of snail, slug, twist, Vimentin, N-cadherin and E-cadherin in GBC cells were analyzed by qRT-PCR. GAPDH was used as an internal control. (B) mRNA levels of Vimentin, N-cadherin and E-cadherin in GBC specimens (n = 6) and paired gallbladder tissues measured by qRT-PCR. GAPDH was viewed as internal control. (C) Western blot was used to analyze the protein levels of Vimentin, N-cadherin and E-cadherin in GBC specimens (n = 6) and adjacent normal tissues. GAPDH as an internal control. (The data are presented as the standard error of mean and represent three independent experiments; * p < 0.05, ** p < 0.01, and *** p < 0.001, ns indicates no significantly statistical difference.) Matrine inhibited the invasion and migration of GBC by regulating the PI3K/AKT signaling pathway The PI3K/AKT signaling pathway promotes the occurrence of EMT (Ang et al. 2023 ). To further explore the underlying mechanism of Matrine against GBC, we investigated whether Matrine regulates the invasion and migration of GBC through PI3K/AKT signaling pathway, thereby affecting the progression of GBC. At the protein level, as shown in Fig. 4 A, compared with the control group, Matrine dramatically inhibited the protein expression of p-PI3K and p-AKT in NOZ and SGC-996 cells, along with a dose-dependent relationship to some extent. Additionally, in order to fully confirm the anti-cancer effect of Matrine in regulating PI3K/AKT, we used 740 Y-P (PI3K activator) and LY294002 (PI3K inhibitor). Then, the effects of 740 Y-P/LY294002 on the viability of NOZ and SGC-996 cells were further explored. The results of CCK8 showed that (Fig. S1), the IC50 values of NOZ and SGC-996 cells at 24 hours treated with 740 Y-P were 9.91µmol/L and 9.32µmol/L, respectively. Subsequently, the IC50 values of NOZ and SGC-996 treated with LY294002 severally were 6.43µmol/L and 9.86µmol/L. It was worth noting that 740 Y-P almost did not affect the proliferation of NOZ and SGC-996 cells at low concentration (0–5 µmol/L) for 24h. Meanwhile, LY294002 had the same effect of 740 Y-P at low concentrations (0-2.5 µmol/L) on NOZ and SGC-996 cells for 24h. Based on the results of CCK8 analysis, 740 Y-P (2.5 µmol/L) and LY294002 (1.25 µmol/L) were selected as the optimal concentrations for follow-up experiments, due to did not alter the viability of GBC cells. As shown in Fig. 4 B, at the genetic levels, in NOZ and SGC-996 cells, compared with Matrine group, Matrine + 740 Y-P group antagonized the anti-cancer effect of Matrine, such as increasing the mRNA levels of N-cadherin, Vimentin, MMP2 and MMP9, while decreasing the expression of E-cadherin mRNA. In addition, compared with the Matrine group, Matrine + LY294002 group enhanced the anti-cancer effect of Matrine to a certain extent, including down-regulating the mRNA levels of N-cadherin, Vimentin, MMP2 and MMP9. At the same time, E-cadherin mRNA expression was up-regulated (Fig. 4 B). Next, we examined the anti-cancer mechanism of Matrine at the protein level. As shown in Fig. 4 C-D, consistent with the genetic results, 740 Y-P similarly counteracted the Matrine's anti-cancer efficiency in NOZ and SGC-996 cells, while LY294002 also increased the sensitivity of Matrine to GBC. These results indicated that Matrine inhibited the phosphorylation of PI3K and AKT, and suppressed the invasion and migration of GBC by regulating the PI3K/AKT signaling pathway, thus playing an anti-GBC role. Figure S1 The effects of different concentrations of 740 Y-P or LY294002 on proliferation of NOZ and SGC-996 cells for 24 hours. Figure 4 Matrine modulated the PI3K/AKT signaling pathway. NOZ and SGC-996 cells were affected with LY294002 (1.25 µM) or 740 Y-P (2.5 µM) for 4 hours, followed by treatment with Matrine (10 µM) for 24 hours. (A) The effects of Matrine on the PI3K/AKT proteins in GBC cells. (B) The impacts of LY294002 or 740 Y-P (and) or Matrine on the PI3K/AKT mRNA levels in GBC cells. (C) The impacts of LY294002 or 740 Y-P (and) or Matrine on the PI3K/AKT, EMT, MMP2, and MMP9 proteins in NOZ cells. GAPDH was served as an internal control. (D) Western blot was utilized for exploring the PI3K/AKT, EMT, MMP2, and MMP9 proteins in SGC-996 cells. GAPDH as an internal control. (The data are presented as the standard error of the mean and represent three independent experiments; no annotation displays comparison with 0 µM Matrine; * p < 0.05, ** p < 0.01, and *** p < 0.001, ns indicates no significantly statistical difference.) The antitumor effect of matrine depended on the PI3K/AKT signaling pathway To determine whether Matrine has the same anti-cancer effect in vivo and in vitro . We successfully constructed a xenograft mouse model of GBC using NOZ cells. HE staining showed that there were no abnormal results in the heart, liver, spleen, kidney and lung of the intervention group and the control group, indicating that no toxic symptoms or abnormal actions were observed in each group during the experiment (Fig. 5 A). In addition, there was no difference in body weight among the groups (Fig. 5 B), which further validated that no abnormal activity was observed in any group of mice. Subsequently, with the increase of administration times and dose of Matrine, tumor volume (Fig. 5 C) and tumor weight (Fig. 5 D) in the Matrine group gradually decreased, and there was a significant difference in tumor appearance among all groups (Fig. 5 E). It was worth noting that after Matrine intervention, the cell lysis, the nucleus fragmentation, intercellular cavities and varying degrees of necrosis appeared, with a dose-dependent relationship (Fig. 5 F). More importantly, Matrine significantly inhibited the mRNA expression of N-cadherin, Vimentin, MMP2 and MMP9 at the genetic level, while increasing the mRNA level of E-cadherin (Figure. 5G). What is even more surprising is that, at the protein level (Fig. 5 H), aligned with the genetic results, Matrine exhibited the same anti-cancer effect, and significantly inhibited the phosphorylation levels of PI3K and AKT. Based on the above analysis, Matrine inhibited PI3K/AKT signaling pathway and suppressed invasion and migration of GBC, and thus blocked tumor progression. Figure 5 The effects of Matrine depended on PI3K/AKT signaling pathway. (A) HE staining of heart, liver, spleen, lung, and kidney in nude mice, scale bar = 100 µm. (B) Body weight, (C) tumor volume, (D) tumor weight, (E) images, and (F) HE staining of the NOZ cells xenograft model treated with the vehicle (TC) and different concentrations of Matrine, scale bar = 100 µm. (G) The mRNA levels of EMT, MMP2, and MMP9 in tumor issues were detected by qRT-PCR. GAPDH as an internal control. (H) The protein expressions of PI3K/AKT, EMT, MMP2, and MMP9 in tumor tissues were analyzed by Western blot. GAPDH is served as internal control. (The data are shown as the standard error of the mean, based on three independent experiments; no annotation embodies comparison with TC group; * p <0.05, ** p <0.01, and *** p <0.001, while ns indicates no statistically significant difference). Discussion GBC is the most common malignant biliary tract cancer (BTC) and is one of the most biologically aggressive tumors with high mortality rates, with a median 5-year overall survival rate of 18% (Goetze et al. 2015; Roa et al. 2022 ). Like other forms of BTC, surgical resection is the only possible therapeutic method (Queiroz et al. 2023 ). Early GBC is typically asymptomatic and potentially curable (Schmidt et al. 2019 ). Unfortunately, only 10% of GBC is considered resectable (Roa et al. 2022 ). Advanced GBC is characterized by a highly invasive phenotype and extensive resistance to radiotherapy and chemotherapy, with poor prognosis (Vega et al. 2022 ). Both early and advanced GBC are mostly diagnosed by chance during or after surgery. However, the recurrence rate of GBC resection is disproportionately high (Vega et al. 2022 ). In addition, the nursing standard after radical resection of GBC is capecitabine (Primrose et al. 2019 ). Notably, the ABC-02 and BT-22 trials recommend that the combination with chemotherapy regimen of gemcitabine and cisplatin as the first-line therapy for patients with primary unresectable BTC, including GBC (Valle et al. 2010 ). The FOLFOX ( folinic acid , fluorouracil , and oxaliplatin ) regimen is a second-line chemotherapeutic option (Lamarca et al. 2021 ). Unfortunately, the adverse reaction and drug resistance to radiotherapy and chemotherapy regimens has seriously hindered the progress of treatment. In order to improve the quality of life and prolong survival of GBC patients, there is an urgent to explore safer and more efficient new treatment options. TCM has been developed for thousands of years, in which monomers and their extracts have specific pharmacological effects, such as multi-target, high efficiency, safety, strong specificity, reducing drug resistance and adverse reactions, especially in the field of anti-tumor with naturally unique advantages (Liao et al. 2023 ). For instance, astragalus polysaccharides (APs) was used in the treatment of triple-negative breast cancer by inhibiting the PI3K/AKT/Bcl-2 pathway, effectively inhibiting the proliferation of cancer cells, interfering with invasion and promoting apoptosis Du et al. 2022 ). Fang et al. ( 2023 ) reported that astragaloside IV suppressed viability, migration, and invasion of liver cancer cell by mediating the Nrf2/HO-1 signaling pathway. Dihydroartemisinin (DHA) impaired the growth, metastasis, and angiogenesis of colon cancer through GSK-3 β/ The TCF7/MMP9 pathway and its synergistic effect with capecitabine (Dai et al. 2024 ). Matrine reduced Bcl-2 levels, activated caspase3, and induced cancer cell apoptosis in papillary thyroid cancer cells, ultimately suppressing tumor growth in vivo (Fu et al. 2020 ). Notably, we found that Matrine inhibited the viability of GBC cells in a dose-dependent manner, such as GBC-SD, NOZ, and SGC-996 cells. Among them, the inhibitory effects of NOZ and SGC-996 were more outstanding than GBC-SD, thereby NOZ and SGC-96 cell lines were selected for follow-up experiments. In addition, in order to determine whether Matrine has potential toxic effects on mice. The HE staining showed that there were not pathological phenomena in the heart, liver, spleen, kidney, and lung tissues, whether in either Matrine treatment group or TC group. Additionally, no significant difference was observed in body weight between the Matrine and TC groups. This fully demonstrated that the concentration of Matrine used during the experiment was within a safe range. Notably, in vivo experiments, compared with TC group, Matrine inhibited tumor growth in a dose-dependent relationship, along with remarkable changes in tumor weight, volume, and appearance. More importantly, Matrine significantly induced apoptosis and cell cycle arrest in NOZ and SGC-996 cells with a dose-dependent manner. Furthermore, in vivo experiments, HE staining results of tumor tissue expressed that the Matrine treated group exhibited cell lysis, nuclear fragmentation, and the intercellular cavities and varying degrees of necrosis, with a dose-dependent relationship. These results indicated that Matrine had a pronounced killing effect on GBC cells. EMT is a reversible biological process that causes epithelial cells to temporarily transition to a quasi-interstitial state (Fontana et al. 2024 ). During this process, epithelial cells gradually transition from their polygonal and pebble-shaped appearance to a spindle-shaped interstitial morphology, including dissolution of cell-cell connections and loss of apical-basal polarity, as well as enhancing cell migration and motility (Iser et al. 2022 ). It is worth noting that the mesenchymal cells produced by this process can be restored to epithelial state through the mesenchymal epithelial transition (MET) process (Verstappe et al. 2023). Zhang et al. ( 2021 ) reported that the malignant progression of the vast majority of tumors is associated with abnormal activation of EMT. In addition, the degradation of basement membrane and extracellular matrix (ECM) is crucial for tumor invasion and metastasis (Jiang et al. 2022 ). The imbalance of MMP2 and MMP9 promotes tumor cells to break through the extracellular matrix by degrading it, which contributes to tumor invasion and metastasis (Padežnik et al. 2023 ). It is worth noting that our results indicated that compared to adjacent normal gallbladder tissue, the mRNA and protein levels of N-cadherin and Vimentin in tumor tissue were abnormally increased, while the expressions of E-cadherin mRNA and protein were significantly reduced. In addition, it is found that after activation of the EMT program, the expression of EMT-related transcription factors, such as snail, slug, and twist increase. This process promotes the expression of interstitial cell markers, embracing Vimentin and N-cadherin, while inhibiting the expression of epithelial cell markers, such as E-cadherin (Kielbik et al. 2023 ). Surprisingly, we found that compared to HGBEC cells, the levels of EMT-related transcription genes (snail, slug, twist, Vimentin, and N-cadherin) in GBC-SD, NOZ, and SGC-996 cells were significantly increased, while the expression of E-cadherin was significantly decreased. Notably, among these cells, NOZ and SGC-996 cells are more pronounced. These findings demonstrated that EMT enabled individual tumor cells to acquire features related with malignant tumor during tumor progression. More importantly, at the mRNA level, Matrine could significantly inhibit the expression of snail, slug, twist, MMP2, MMP9, Vimentin, and N-cadherin, while upregulating the expression of E-cadherin in a dose-dependent manner. Surprisingly, Matrine has the same anti-cancer effect as mRNA at the protein level, such as inhibiting the abundance of MMP2, MMP9, Vimentin, and N-cadherin while increasing the expression of E-cadherin. Further in vivo experimental results confirmed that Matrine remarkably impaired the mRNA and protein expression of MMP2, MMP9, Vimentin, and N-cadherin, while upregulating the mRNA and protein levels of E-cadherin. In addition, Transwell and scratch experiments both displayed that Matrine could significantly induce inhibition of the EMT process in NOZ and SGC-996 cells in a dose-dependent manner. These results confirmed that Matrine exerted anti-cancer effects by suppressing the migration and invasion of GBC cells. This not only provides ideas for exploring treatment options for GBC, but also contributes to the molecular basis. PI3K is a lipid kinase family that exhibits both serine/threonine kinase activity and phosphatidylinositol kinase activity (He et al. 2021 ). AKT is an important downstream signaling molecule of PI3K, with a kinase domain at the carboxyl terminal and a pleckstrin homology domain at the amino terminal (Glaviano et al. 2023 ). Under normal circumstances, the activated PI3K catalyzes the intracellular PIP2 into PIP3, which acts as a second messenger and interacts with the pleckstrin homology domain of AKT, thereby activating AKT (Tewari et al. 2019). The abnormal activation of the PI3K/AKT signaling pathway promotes abnormal proliferation, apoptosis inhibition, migration, invasion, and metastasis of various cancer cells, playing a crucial role in the occurrence and progression of cancer cells (Yu et al. 2022 ). Notably, Matrine inhibited the expression of p-PI3K and p-AKT in a dose-dependent manner at the protein level. Further in vivo experiments indicated that Matrine downregulated the abundance of p-PI3K and p-AKT protein with increasing administration time and concentration. To further confirm whether Matrine exerts anti-cancer effects through the PI3K/AKT signaling pathway. We used 740 Y-P, PI3K activator, and LY294002, PI3K inhibitor. The results of qPCR showed that in NOZ and SGC-996 cells, compared to the Matrine treatment group, the Matrine combined with 740 Y-P group suppressed the anti-cancer effect of Matrine to a certain extent, including increasing the expression of MMP2, MMP9, Vimentin, and N-cadherin while reducing the level of E-cadherin; However, the combination of Matrine and LY294002 significantly enhanced Matrine's anti-cancer sensitivity, downregulating the expression of MMP2, MMP9, Vimentin, and N-cadherin, while upregulating the level of E-cadherin. Fortunately, at the protein level, the efficacy of 740 Y-P and LY294002 is consistent with the genetic level. In addition, compared with the Matrine treatment group, the Matrine + 740 Y-P group significantly antagonized the anti-cancer effect of Matrine, increasing the expression of p-PI3K and p-AKT proteins. However, the Matrine + LY294002 group significantly enhanced the anti-cancer effect of Matrine on GBC cells, inhibiting the levels of p-PI3K and p-AKT proteins. These results fully demonstrated that Matrine impaired the invasion and migration of GBC cells through the PI3K/AKT signaling pathway, thereby inhibiting tumor growth. Conclusion In summary, this study proved that Matrine exerted anti-tumor effects by inhibiting the PI3K/AKT signaling pathway, inducing inhibition of EMT process, inhibition of cell viability, inducing apoptosis and cell cycle arrest. Further in vivo studies have confirmed that Matrine could suppress tumor growth in xenograft nude mice. This study provides a theoretical basis for Matrine to become a candidate drug for the treatment and research, and contributes to identify new targets and strategies for the treatment of GBC. Abbreviations GBC Gallbladder cancer EMT Epithelial-mesenchymal transition MMP2 Matrix metalloproteinase 2 MMP9 Matrix metalloproteinase 9 PI3K Phosphatidylinositol 3-kinase TCM Traditional Chinese medicine BTC Biliary tract cancer APs Astragalus polysaccharides DHA Dihydroartemisinin MET Mesenchymal epithelial transition ECM Extracellular matrix 740 Y-P PI3K activator LY294002 PI3K inhibitor Declarations Authors contributions M.R.L, H.G.C and S.D.Q designed the experiment, and wrote the articles. M.R.L, L.Z, S.M.H and Z.P performed most of the experiments and analyzed the data. H.G.C and S.M.H assisted in revising manuscript. S.D.Q provided fund support. All data were generated in-house, and no paper mill was used. All authors agree to be accountable for all aspects of work ensuring integrity and accuracy. Additionally, all authors have read and approved the final manuscript. Finding This work was approved by the Fund of Armed police equipment research of China (number: ZZKY20233109); Armed police Force discipline top talent fund (number: ZG2020901); Armed police Force high-level science and technology personnel fund (number: ZG202193); Anhui Provincial Health Commission scientific research project (number: AHWJ2023BAa20148). Data availability Data will be made available on request. Ethical statement All animal researches were performed according to A the Experimental Animal Ethics Committee of Anhui University of Traditional Chinese Medicine (license number: AU AHUCM-mouce-2024017). Competing interests All authors declare that they have no competing interests. References Akhmetkaliyev A, Alibrahim N, Shafiee D, Eugene T (2023) EMT/MET plasticity in cancer and go-or-grow decisions in quiescence: the two sides of the same coin? Mol Cancer 22(1):90 Ang HL, Mohan CD, Shanmugam MK, Leong HC, Makvandi P, Rangappa KS, Bishayee A, Kuma AP, Sethi G (2023) Mechanism of epithelial-mesenchymal transition in cancer and its regulation by natural compounds. Med Res Rev 43(4):1141–1200 Cao L, Bridle KR, Shrestha R, Prithviraj P, Crawford DHG, Jayachandran A (2022) CD73 and PD-L1 as potential therapeutic targets in gallbladder cancer. Int J Mol Sci 23(3) Chen MH, Gu YY, Zhang AL, Sze DMY, Mo SL, May BH (2021) Biological effects and mechanisms of matrine and other constituents of Sophora flavescens in colorectal cancer. Pharmacol Res 171:105778 Dai X, Chen W, Qiao Y, Chen XH, Chen YH, Zhang K, Zhang QS, Duan XX, Li X, Zhao JM, Tian F, Liu KD, Dong ZM, Lu J (2024) Dihydroartemisinin inhibits the development of colorectal cancer by GSK-3β/TCF7/MMP9 pathway and synergies with capecitabine. Cancer Lett 582:216596 Du Y, Wan H, Huang P, Yang JH, He Y (2022) A critical review of astragalus polysaccharides: from therapeutic mechanisms to pharmaceutics. Biomed Pharmacother 147:112654 Fang Gong Y, Hou S, Xu JC, Chen Y, Zhu LL, Xu YY, Chen YQ, Li MM, Li LL, Yang JJ, Yang Y (2023) Amelioratory effects of astragaloside IV on hepatocarcinogenesis via Nrf2-mediated pSmad3C/3L transformation. Phytomedicine 117:154903 Fontana R, Mestre-Farrera A, Yang J (2024) Update on Epithelial-Mesenchymal plasticity in cancer progression. Annu Rev Patho 19:133–156 Fu S, Zhao N, Jing G, Yang XM, Liu JF, Zhen DH, Tang XL (2020) Matrine induces papillary thyroid cancer cell apoptosis in vitro and suppresses tumor growth in vivo by downregulating miR-182-5p. Biomed Pharmacother 128:110327 Glaviano A, Foo ASC, Lam HY, Yap KCH, Jacot W, Jones RH, Eng HY, Nair MG, Makvandi P, Geoerger B, Kulke MH, Baird RD, Prabhu JS, Carbone D, Pecoraro C, The DBL, Sethi G, Cavalieri V, Lin KH, Javidi-Sharifi NR, Toska E, Davids MS, Brown JR, Diana P, Stebbing J, Fruman DA, Kumar AP (2023) PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer. Mol Cancer 22(1):138 Goetze TO (2015) Gallbladder carcinoma: prognostic factors and therapeutic options. World J Gastroenterol 21(43):12211–12217 He Y, Sun MM, Zhang GG, Yang J, Chen KS, Xu WW, Li B (2021) Targeting PI3K/Akt signal transduction for cancer therapy. Signal Transduct Target Ther 6(1):425. 10.1038/s41392-021-00828-5 Hu ZI, Lim KH (2022) Evolving paradigms in the systemic treatment of advanced gallbladder cancer: updates in year 2022. Cancers (Basel) 14(5) Huang H, Du T, Xu G, Lai YM, Fan XX, Chen XJ, Li WJ, Yue F, Li Q, Liu L, Li KW (2017) Matrine suppresses invasion of castration-resistant prostate cancer cells by downregulating MMP-2/9 via NF-κB signaling pathway. Int J Oncol 50(2):640–648 Iser IC, Vedovatto S, Oliveira FD, Beckenkamp LR, Lenz G, Wink MR (2022) The crossroads of adenosinergic pathway and epithelial-mesenchymal plasticity in cancer. Semin Cancer Biol 86(Pt2):202–213 Jiang Y, Zhang H, Wang J, Liu YL, Luo T, Hua H (2022) Targeting extracellular matrix stiffness and mechanotransducers to improve cancer therapy. J Hematol Oncol 15(1):34 Kam AE, Masood A, Shroff RT (2021) Current and emerging therapies for advanced biliary tract cancers. Lancet Gastroenterol Hepatol 6(11):956–969 Kielbik M, Przygodzka P, Szulc-Kielbik I, Klink M (2023) Snail transcription factors as key regulators of chemoresistance, stemness and metastasis of ovarian cancer cells. Biochim Biophys Acta Rev Cancer 1878(6):189003 Lamarca A, Palmer DH, Wasan HS, Ross PJ, Ma YT, Arora A, Falk S, Gillmore R, Wadsley J, Patel K, Anthoney A, Maraveyas A, Iveson T, Waters JS, Hobbs C, Barber S, Ryder WD, Ramage J, Davies LM, Bridgewater JA, Valle JW (2021) Advanced biliary cancer working group second-line FOLFOX chemotherapy versus active symptom control for advanced biliary tract cancer (ABC-06): a phase 3, open-label, randomised, controlled trial. Lancet Oncol 22(5):690–701 Lengrand J, Pastushenko I, Vanuytven S, Song Y, Venet D, Sarate RM, Bellina M, Moers V, Boinet A, Sifrim A, Rama N, Ducarouge B, Herck JV, Dubois C, Scozzaro S, Lemaire S, Gieskes S, Bonni S, Collin A, Braissand N, Allard J, Zindy E, Decaestecker C, Sotiriou C, Salmon I, Mehlen P, Voet T, Bernet A, Blanpain C (2023) Pharmacological targeting of netrin-1 inhibits EMT in cancer. Nature 620(7973):402–408 Li Q, Huang H, He Z (2018) Regulatory effects of antitumor agent matrine on FOXO and PI3K-AKT pathway in castration-resistant prostate cancer cells. Sci China Life Sci 61(5):550–558 Li C, Niu D, Zhu R, Yan XY, Qu HR, Zhang YL, Zheng YL (2023) Adjunctive effect of compound Kushen injection for cancer: an overview of systematic reviews. J Ethnopharmacol 317:116778 Li J, Wei S, Marabada D, Wang ZZ, Huang Q (2023) Research progress of natural Matrine compounds and synthetic Matrine derivatives. Molecules 28(15) Liao XZ, Tao LT, Liu JH, Gu YY, Xie J, Chen YL, Lin MG, Liu TL, Wang DM, Guo HY, Mo SL (2017) Matrine combined with cisplatin synergistically inhibited urothelial bladder cancer cells via down-regulating VEGF/PI3K/Akt signaling pathway. Cancer Cell Int 17:124 Liao Y, Gui Y, Li Q, Li QZ, An J, Wang D (2023) The signaling pathways and targets of natural products from traditional Chinese medicine treating gastric cancer provide new candidate therapeutic strategies. Biochim Biophys Acta Rev Cancer 1878(6):188998 Lin G, Wu Y, Cai F, Li Z, Su SX, Wang J, Cao JL, Ma LD (2019) Matrine promotes human myeloid leukemia cells apoptosis through warburg effect mediated by Hexokinase 2. Front Pharmacol 10:1069 Liu Y, Qi Y, Bai ZH, Ni CX, Ren QH, Xu WH, Xu J, Hu HG, Qiu L, Li JZ, He ZG, Zhang JP (2017) A novel matrine derivate inhibits differentiated human hepatoma cells and hepatic cancer stem-like cells by suppressing PI3K/AKT signaling pathways. Acta Pharmacol Sin 38(1):120–132 Moreira J, Machado M, Dias-Teixeira M, Ferraz R, Delerue-Matos C, Grosso C (2023) The neuroprotective effect of traditional Chinese medicinal plants-A critical review. Acta Pharm Sin B 13(8):3208–3237 Nepal C, Zhu B, O'Rourke CJ, Bhatt DK, Lee D, Song L, Wang DF, Dyke ALV, Choo-Wosoba H, Liu ZW, Hildesheim A, Goldstein AM, Dean M, LaFuente-Barquero J, Lawrence S, Mutreja K, Olanich ME, Ferreccio C, Roa JC, Rashid A, Hsing AW, Gao YT, Chanock SJ, Araya JC, Andersen JB, Koshiol J (2021) Integrative molecular characterisation of gallbladder cancer reveals micro-environment-associated subtypes. J Hepatol 74(5):1132–1144 Padežnik T, Oleksy A, Cokan A, Takač I, Sobočan M (2023) Changes in the extracellular matrix in endometrial and cervical cancer: A systematic review. Int J Mol Sci 24(6) Primrose JN, Fox RP, Palmer DH, Malik HZ, Prasad R, Mirza D, Anthony A, Corrie P, Falk S, Finch-Jones M, Wasan H, Ross P, Wall L, Wadsley J, Evans JTR, Stocken D, Praseedom R, Ma YT, Davidson B, Neoptolemos JP, Iveson T, Raftery J, Zhu SH, Cunningham D, Garden OJ, Stubbs C, Valle JW, Bridgewater J (2019) Capecitabine compared with observation in resected biliary tract cancer (BILCAP): a randomised, controlled, multicentre, phase 3 study. Lancet Oncol 20(5):663–673 Queiroz MM, Lima NF, Castria TBD (2023) Immunotherapy and targeted therapy for advanced biliary tract cancer: Adding new flavors to the pizza. Cancers (Basel) 15(7) Roa JC, García P, Kapoor VK, Maithel SK, Javle M, Koshiol J (2022) Gallbladder cancer. Nat Rev Dis Primers 8(1):69 Schepis T, Boškoski I, Tringali A, Vincenzo B (2022) Palliation in gallbladder cancer: The role of gastrointestinal endoscopy. Cancers (Basel) 14(7) Schmidt MA, Marcano-Bonilla L, Roberts LR (2019) Gallbladder cancer: epidemiology and genetic risk associations. Chin Clin Oncol 8(4):31 Sharma A, Sharma KL, Gupta A, Yadav A, Kumar A (2017) Gallbladder cancer epidemiology, pathogenesis and molecular genetics: Recent update. World J Gastroenterol 23(22):3978–3998 Sturm N, Schuhbaur JS, Hüttner F, Perkhofer L, Ettrich TJ (2022) Gallbladder cancer: Current multimodality treatment concepts and future directions. Cancers (Basel) 14(22) Tewari D, Patni P, Bishayee A, Sah AN, Bishayee A (2022) Natural products targeting the PI3K-Akt-mTOR signaling pathway in cancer: A novel therapeutic strategy. Semin Cancer Biol 80:1–17 Tong C, Wang Y, Li J, Cen WD, Zhang WG, Zhu ZY, Yu JH, Lu BC (2021) Pterostilbene inhibits gallbladder cancer progression by suppressing the PI3K/Akt pathway. Sci Rep 11(1):4391 Tripathi K, Maurya N, Goel A, Singhai A, Garg M (2023) Immunohistochemical expressions of EMT markers in pan-RAS-pERK1/2-positive tumors improve diagnosis and prognosis assessment of non-muscle invasive bladder cancer and muscle invasive bladder cancer patients. Mol Cell Biochem 478(6):1169–1190 Valle J, Wasan H, Palmer DH, Cunningham D, Anthoney A, Maraveyas A, Madhusudan S, Iveson T, Hughes S, Pereira SP, Roughton M (2010) Cisplatin plus gemcitabine versus gemcitabine for biliary tract cancer. N Engl J Med 362(14):1273–1281 Vega EA, Mellado S, Salehi O, Freeman R, Conrad C (2022) Treatment of resectable gallbladder cancer. Cancers (Basel) 14(6) Verstappe J, Berx G (2023) A role for partial epithelial-to-mesenchymal transition in enabling stemness in homeostasis and cancer. Semin Cancer Biol 90:15–28 Wang Q, Li Y, Li KW, Zhou CZ (2022) Sophoridine: A review of its pharmacology, pharmacokinetics and toxicity. Phytomedicine 95:153756 Wang S, Fu JL, Hao HF, Jiao YN, Li PP, Han SY (2021) Metabolic reprogramming by traditional Chinese medicine and its role in effective cancer therapy. Pharmacol Res 170:105728 Wang S, Yang S, Yang X, Deng D, Li J, Dong MQ (2023) Research progress of traditional Chinese medicine monomers in reversing multidrug resistance of breast cancer. Am J Chin Med 51(3):575–594 Wei D, Rui B, Qingquan F, Chen C, Ping HY, Xiaoling S, Hao W, Jun G (2021) KIF11 promotes cell proliferation via ERBB2/PI3K/AKT signaling pathway in gallbladder cancer. Int J Biol Sci 17(2):514–526 You L, Yang C, Du Y, Wang WP, Sun MY, Liu J, Ma BR, Pang LN, Zeng YW, Zhang ZQ, Dong X, Yin XB, Ni J (2020) A systematic review of the pharmacology, toxicology and pharmacokinetics of Matrine. Front Pharmacol 11:01067 Yu L, Wei J, Liu P (2022) Attacking the PI3K/Akt/mTOR signaling pathway for targeted therapeutic treatment in human cancer. Semin Cancer Bio 85:69–94 Zhang H, Chen L, Sun X, Yang QJ, Wan LL, Guo C (2020) Matrine: A promising natural product with various pharmacological activities. Front Pharmacol 11:588 Zhang Y, Du P, Li Y, Zhu Q, Song XL, Liu SB, Hao JQ, Liu LG, Liu FT, Hu YP, Jiang L, Ma Q, Lu W, Liu YB (2020) TASP1 promotes gallbladder cancer cell proliferation and metastasis by up-regulating FAM49B via PI3K/AKT Pathway. Int J Biol Sci 16(5):739–751 Zhang F, Xiang S, Cao Y, Li ML, Ma Q, Liang HB, Li HF, Ye YY, Zhang YJ, Jiang L, Hu YP, Zhou J, Wang XF, Zhang Y, Nie L, Liang X, Gong W, Liu YB (2021) Correction: EIF3D promotes gallbladder cancer development by stabilizing GRK2 kinase and activating PI3K-AKT signaling pathway. Cell Death Dis 13(1):19 Zhang N, Ng AS, Cai S, Li Q, Yang L, Kerr D (2021) Novel therapeutic strategies: targeting epithelial-mesenchymal transition in colorectal cancer. Lancet Oncol 22(8):e358–e368 Zhang X, Gao Y, Zhou Y, Liu ZM, Liu RX (2023) Pharmacological mechanism of natural drugs and their active ingredients in the treatment of arrhythmia via calcium channel regulation. Biomed Pharmacother 160:114413 Zhou Z, Peng Y, Wu X, Meng SY, Yu W, Zhao JH, Zhang HY, Wang J, Li WB (2019) CCL18 secreted from M2 macrophages promotes migration and invasion via the PI3K/Akt pathway in gallbladder cancer. Cell Oncol (Dordr) 42(1):81–92 Zou Y, Wang S, Zhang H, Gu YX, Chen HJ, Huang ZH, Yang FF, Li WQ, Chen C, Men LH, Tian QC, Xie T (2024) The triangular relationship between traditional Chinese medicines, intestinal flora, and colorectal cancer. Med Res Rev 44(2):539–567 Additional Declarations No competing interests reported. Supplementary Files Figure.S1.tif Fig. S1 The effects of different concentrations of 740 Y-P or LY294002 on proliferation of NOZ and SGC-996 cells for 24 hours. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 29 Apr, 2024 Reviews received at journal 25 Apr, 2024 Reviewers agreed at journal 25 Apr, 2024 Reviews received at journal 19 Apr, 2024 Reviewers agreed at journal 19 Apr, 2024 Reviewers agreed at journal 01 Apr, 2024 Reviewers invited by journal 21 Mar, 2024 Submission checks completed at journal 21 Mar, 2024 Editor assigned by journal 21 Mar, 2024 First submitted to journal 20 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4137130","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":283032113,"identity":"e6605f85-52a3-4ccb-8d30-d19f8803c991","order_by":0,"name":"Rong-Liang Mo","email":"","orcid":"","institution":"Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Rong-Liang","middleName":"","lastName":"Mo","suffix":""},{"id":283032114,"identity":"3200edf3-22ff-458a-9ff0-c8459b54d7c9","order_by":1,"name":"Zhuang Li","email":"","orcid":"","institution":"The Chinese People's Armed Police Forces Anhui Provincial Corps Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhuang","middleName":"","lastName":"Li","suffix":""},{"id":283032115,"identity":"dc55b986-8699-4ee9-8bdb-8cccf4608cba","order_by":2,"name":"Peng Zhang","email":"","orcid":"","institution":"Anhui University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Zhang","suffix":""},{"id":283032116,"identity":"efc72da5-4589-4a13-9d06-b30aaf738388","order_by":3,"name":"Ming-Hui Sheng","email":"","orcid":"","institution":"The Chinese People's Armed Police Forces Anhui Provincial Corps Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ming-Hui","middleName":"","lastName":"Sheng","suffix":""},{"id":283032117,"identity":"b8c30ae0-1621-4ae5-8150-ed8c5fa9a6b3","order_by":4,"name":"Gen-Cheng Han","email":"","orcid":"","institution":"Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Gen-Cheng","middleName":"","lastName":"Han","suffix":""},{"id":283032118,"identity":"e8fc8982-a492-4511-9e67-07cf9b679ccf","order_by":5,"name":"Deng-Qun Sun","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIiWNgGAWjYJACCTjrQYWEHD9pWhLOWBhLNpCkJbGtInEDIS3yM3IP3vi4o1Z2w+32ZxKJ8yQYNzAwP3x0A48Wgxt5yZYzzxw33nDnjJlE4jYJZnMGNmPjHHxaJHLMpHnbjiVuuJHDBtLCZtnAwyaNT4v8DKCWv2At6UCHzZHgMThAQAvDDaAWxrYaoJYEoMMaJCQIajE488bYsrftgPHMGznGFgnHJAwkmwn4Rb49x/DGz7Y62b4b6Q9vfKipq+9nb374GK/DIOAwYwMDAwskgpgJKweBOpAW5g/EKR4Fo2AUjIKRBgCx7E/wIj5AFAAAAABJRU5ErkJggg==","orcid":"","institution":"The Chinese People's Armed Police Forces Anhui Provincial Corps Hospital","correspondingAuthor":true,"prefix":"","firstName":"Deng-Qun","middleName":"","lastName":"Sun","suffix":""}],"badges":[],"createdAt":"2024-03-20 12:32:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4137130/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4137130/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53374397,"identity":"7ed3e6a4-a4f6-4cb6-8f25-d125704b8eb8","added_by":"auto","created_at":"2024-03-25 08:44:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":762404,"visible":true,"origin":"","legend":"\u003cp\u003eMatrine blocked the cell cycle of GBC cells, promoted their apoptosis, and suppressed their growth \u003cem\u003ein vitro\u003c/em\u003e. (A) Matrine structure diagram. (B) CCK8 assay was used to determine cell viability. HGBEC, GBC-SD, SGC-996, and NOZ cells were exposed to different concentrations of Matrine for 12-72 hours. (C-D) Flow cytometry was used for detecting cell cycle and apoptosis of NOZ and SGC-996 cells treated with Matrine (0, 5 and 10 μM) for 24 hours. (The data are displayed as the standard error of the mean and reflect three independent trials; no annotation represents comparison with 0 μM Matrine; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.)\u003c/p\u003e","description":"","filename":"Figure.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4137130/v1/50022e6679a1d2187032791d.png"},{"id":53374400,"identity":"09095008-2b18-43d2-b69d-f89ea64a2be4","added_by":"auto","created_at":"2024-03-25 08:44:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3223672,"visible":true,"origin":"","legend":"\u003cp\u003eMatrine inhibited the invasion and migration of GBC cells \u003cem\u003ein vitro\u003c/em\u003e. NOZ and SGC-996 cells treated with different concentrations of Matrine for 24 hours. (A) Wound healing assay for migration of GBC cells. (B) Transwell assay for invasion of GBC cells, with a scale bar of 200 micrometers. (C) mRNA expression of snail, slug, twist, Vimentin, N-cadherin, E-cadherin, MMP2 and MMP9 in GBC cells was detected using qRT-PCR. GAPDH as an internal control. (D) Protein expression of Vimentin, N-cadherin, E-cadherin, MMP2 and MMP9 in GBC cells was determined by employing Western blot. (The data indicate the standard error of the mean and reflect three independent trials; no comments represent comparison with 0 μM Matrine; *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ns indicates no significantly statistical difference.)\u003c/p\u003e","description":"","filename":"Figure.2.png","url":"https://assets-eu.researchsquare.com/files/rs-4137130/v1/985d74b49b44e0e420699bc9.png"},{"id":53374401,"identity":"4df81adc-4bfd-4c26-881b-bbaf40468374","added_by":"auto","created_at":"2024-03-25 08:44:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":289835,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of EMT in GBC. (A) Compared with HGBEC cells, the mRNA levels of snail, slug, twist, Vimentin, N-cadherin and E-cadherin in GBC cells were analyzed by qRT-PCR. GAPDH was used as an internal control. (B) mRNA levels of Vimentin, N-cadherin and E-cadherin in GBC specimens (n=6) and paired gallbladder tissues measured by qRT-PCR. GAPDH was viewed as internal control. (C) Western blot was used to analyze the protein levels of Vimentin, N-cadherin and E-cadherinin GBC specimens (n=6) and adjacent normal tissues. GAPDH as an internal control. (The data are presented as the standard error of mean and represent three independent experiments; *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, and ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ns indicates no significantly statistical difference.)\u003c/p\u003e","description":"","filename":"Figure.3.png","url":"https://assets-eu.researchsquare.com/files/rs-4137130/v1/7d93f7cb96a1947ee90cb21f.png"},{"id":53374399,"identity":"3a9c3e8a-c518-4439-8ed6-43ebfe09e9bc","added_by":"auto","created_at":"2024-03-25 08:44:42","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":825927,"visible":true,"origin":"","legend":"\u003cp\u003eMatrine modulated the PI3K/AKT signaling pathway. NOZ and SGC-996 cells were affected with LY294002 (1.25 μM) or 740 Y-P (2.5 μM) for 4 hours, followed by treatment with Matrine (10 μM) for 24 hours. (A) The effects of Matrine on the PI3K/AKT proteins in GBC cells. (B) The impacts of LY294002 or 740 Y-P (and) or Matrine on the PI3K/AKT mRNA levels in GBC cells. (C) The impacts of LY294002 or 740 Y-P (and) or Matrine on the PI3K/AKT, EMT, MMP2, and MMP9 proteins in NOZ cells. GAPDH was served as an internal control. (D) Western blot was utilized for exploring the PI3K/AKT, EMT, MMP2, and MMP9 proteins in SGC-996 cells. GAPDH as an internal control. (The data are presented as the standard error of the mean and represent three independent experiments; no annotation displays comparison with 0 μM Matrine; *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ns indicates no significantly statistical difference.)\u003c/p\u003e","description":"","filename":"Figure.4.png","url":"https://assets-eu.researchsquare.com/files/rs-4137130/v1/38f67f23e7202b1067bd2211.png"},{"id":53374402,"identity":"5e260978-d7e0-41d6-95d4-84b5226364b4","added_by":"auto","created_at":"2024-03-25 08:44:42","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":4006707,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of Matrine depended on PI3K/AKT signaling pathway. (A) HE staining of heart, liver, spleen, lung, and kidney in nude mice, scale bar=100 μm. (B) Body weight, (C) tumor volume, (D) tumor weight, (E) images, and (F) HE staining of the NOZ cells xenograft model treated with the vehicle (TC) and different concentrations of Matrine, scale bar=100 μm. (G) The mRNA levels of EMT, MMP2, and MMP9 in tumor issues were detected by qRT-PCR. GAPDH as an internal control. (H) The protein expressions of PI3K/AKT, EMT, MMP2, and MMP9 in tumor tissues were analyzed by Western blot. GAPDH is served as internal control. (The data are shown as the standard error of the mean, based on three independent experiments; no annotation embodies comparison with TC group; *\u003cem\u003ep\u003c/em\u003e＜0.05, **\u003cem\u003ep\u003c/em\u003e＜0.01, and ***\u003cem\u003ep\u003c/em\u003e＜0.001, while ns indicates no statistically significant difference).\u003c/p\u003e","description":"","filename":"Figure.5.png","url":"https://assets-eu.researchsquare.com/files/rs-4137130/v1/1e0fe0114a5d9a5ce2d3fab2.png"},{"id":53374726,"identity":"e2edb940-9f34-4eee-b7a1-ff34b2407617","added_by":"auto","created_at":"2024-03-25 08:52:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2464975,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4137130/v1/48258482-3b20-42f7-8f81-746c6fab8794.pdf"},{"id":53374398,"identity":"25c9b4b3-e6ab-4004-8e7d-ba6e6b89c63a","added_by":"auto","created_at":"2024-03-25 08:44:42","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":203124,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S1 \u003c/strong\u003eThe effects of different concentrations of 740 Y-P or LY294002 on proliferation of NOZ and SGC-996 cells for 24 hours.\u003c/p\u003e","description":"","filename":"Figure.S1.tif","url":"https://assets-eu.researchsquare.com/files/rs-4137130/v1/6a1d4ec1e40e51e19a7aa381.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Matrine inhibits invasion and migration of gallbladder cancer via regulating the PI3K/AKT signaling pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGallbladder cancer (GBC), a type of disease with high fatality rate, is the most common primary invasive neoplasm in the biliary tract (Kam et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Due to concealed physiological location of the gallbladder, located on the lower surface of the liver, and the patient's early remediable stage when specific symptoms are rarely appearance (Vega et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Therefore, most GBC is typically diagnosed incidentally in tissue specimens after symptomatic gallstone resection at advanced stage (Schepis et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In addition, the highly invasive behavior and limited treatment options in advanced GBC, resulting in the poor prognosis (Sturm et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Regardless of the calculous or non-calculous origin of GBC, long-term chronic inflammation is a pivotal driving factor for GBC (Sharma et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Nepal et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). It is worth noting that many transcriptional regulatory factors, such as snail, slug, and twist, induce epithelial-mesenchymal transition (EMT) by downregulating the expression of epithelial markers and upregulating mesenchymal markers (Tripathi et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). More importantly, tumor cell metastasis is the main cause of tumor death and recurrence, which is closely related to the loss of cell adhesion caused by EMT activation (Akhmetkaliyev et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The Phosphatidylinositol 3-kinase (PI3K)/AKT pathway is one of the most vital pathways for GBC metastasis, which plays a crucial role in the occurrence and development of GBC (Zhang et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Wei et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Through transmembrane or intracellular activation, GBC cells initiate a phosphorylation cascade from PI3K activation, such as AKT activation, ultimately acquiring malignant tumor properties that involves promoting tumor cell proliferation, migration, invasion, and EMT transformation (Zhou et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Tong et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSurgical resection is the only treatment with a therapeutic intention for GBC, but the indications for resection are limited and the effectiveness of most chemotherapy or adjuvant therapies is low (Hu et al. 2022). Additionally, the consequences of chemotherapy, such as poor prognosis, susceptibility to recurrence, significant adverse events, vulnerability to drug resistance and low overall survival, seriously threaten the health and quality of life of patients with cancer (Roa et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In order to prolong the survival period and improve the quality of life of GBC patients, there is an urgent to explore more efficient and safe treatment pathways. Traditional Chinese medicine (TCM) has been developed for thousands of years. Among them, multiple TCM monomers have natural advantages such as multiple targets, high efficiency, safety, reduction of drug resistance and adverse reactions (Moreira et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Zou et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMatrine is a tetracyclic quinoline alkaloid extracted from natural leguminous sophora plants such as \u003cem\u003esophora flavescens\u003c/em\u003e, \u003cem\u003esophora alopecuroides\u003c/em\u003e, and \u003cem\u003esophora root\u003c/em\u003e. It exists in both solid and liquid states, with the most common of which is crystalline α- Matrine (Wang et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Matrine has the dual advantages of Chinese medicine and chemotherapy agents. On the one hand, Matrine is a traditional Chinese herb, which has the advantages of definite pharmacological action, including mild therapeutic effects and high safety (Wang et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). On the other hand, Matrine, as a monomer, has a wide range of pharmacological effects, such as cardiovascular protection, anti-tumor, anti-inflammatory, immune regulation, antibacterial, and antiviral effects (You et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), especially in the field of anti-tumor. Matrine has a highly anti-tumor ability for a variety of tumors. In briefly, it suppresses the expression of EMT, Matrix metalloproteinase 2 (MMP2) and Matrix metalloproteinase 9 (MMP9) by downregulating PI3K/Akt signaling pathway, ultimately inhibiting migration, invasion and proliferation of cancer cells (Huang et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Liao et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In addition, Matrine can induce apoptosis and cell cycle arrest (Lin et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Furthermore, Matrine can not only reverse multidrug resistance (Zhang et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), but also inhibit the growth of xenografts in tumor mouse models (Wang et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), with good anti-tumor activity. Of note, Matrine injection has been used as an adjuvant therapy for anti-tumor in clinical practice (Li et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). However, there are few studies on Matrine for GBC. In this study, we explore whether Matrine inhibits the occurrence and development of GBC by inhibiting EMT, and its potential mechanisms.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePreparation and management of chemical reagents\u003c/h2\u003e \u003cp\u003eMatrine (Cat. No. HY-N0164), LY294002 (PI3K inhibitor, Cat. No. HY-10108), and 740 Y-P (PI3K activator, Cat. No. HY-P0175) were all purchased from MedChemExpress (USA). Matrine, LY294002, and 740 Y-P were dissolved in DMSO to prepare stock solutions, with 0.1% final concentration of DMSO. All stock solutions were packaged and stored at -80 ℃ for long-term storage.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eGBC-SD cell line, a human GBC cell line, was purchased from Procell (Wuhan, China, Cat. No. CL-0085), while NOZ cell line (Cat. No. MZ-2106) of human GBC and HGBEC cell line (Cat. No. MZ-3197) of human gallbladder epithelial immortalized was both obtained from Ningbo, China. Whelab Bioscience Limited Corporation (Shanghai, China, Cat. No. C1546) provided SGC-996 cell line of the other human GBC. NOZ cells were cultured in DMEM medium containing 10% concentrations of fetal bovine serum (FBS, Wisent, Cat. No. 085\u0026ndash;150), 100 U/ml penicillin (Beyotime, Cat. No. C0222), and 100 \u0026micro;g/ml streptomycin (Beyotime, Cat. No. C0222), while SGC-996 and GBC-SD cells were maintained in PRMI 1640 complete medium. The specialized medium was used for culturing HGBEC cells. All cells were cultured at 37 ℃ with 5% carbon dioxide.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCCK8 assay\u003c/h2\u003e \u003cp\u003eCell viability was evaluated according to Cell Counting Kit-8 (MedChemExpress, Cat. No. HY-K0301) provided by the vender. The cells (HGBEC, GBC-SD, NOZ and SGC-996) were seeded in 96-well plates overnight and treated with different concentrations of Matrine (0\u0026ndash;80 \u0026micro;M) for 12\u0026ndash;72 hours, or treated with LY294002 (0\u0026ndash;80 \u0026micro;M)/740 Y-P(0\u0026ndash;80 \u0026micro;M) for 24 hours. Then CCK8 solution with concentration of 10% was added to each well and incubated at 37 ℃ for 4 hours. Finally, the absorbance of 450 nm was detected by Multiskan SkyHigh ThermoFisher, USA. Cells treated with 0.1% DMSO solutions were used as control. The IC50 value and survival rate of cells were calculated and the survival curve was drawn, with using GraphPad Prism 8 software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCell cycle detection\u003c/h2\u003e \u003cp\u003eThe Cell Cycle and Apoptosis Analysis Kit (Beyond, Cat. No. C1052) was used for detecting the cell cycle. Firstly, the NOZ and SGC-996 cells were seeded in a 6-well plate, then starved overnight in serum-free medium, subsequently treated with 5 and 10 \u0026micro;M of Matrine for 24 hours. Cells treated with 0.1% DMSO solutions were served as negative control. Next, the cells were resuspended with pre-cooled 75% ethanol to form a single-cell suspension, fixed overnight at 4\u0026deg;C, and incubated with PI/RNase staining buffer at 37\u0026deg;C in dark environment for 30 minutes. Finally, the percentage of cell cycle was measured by using flow cytometry (BD FACSCelesta, USA). All flow cytometry of results were analyzed by employing FlowJo V10 software (Tree Star, Ashland, OR, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCell apoptosis detection\u003c/h2\u003e \u003cp\u003eAnnexin V-FITC/PI Apoptosis Detection Kit (Bestbio, Cat. No. BB-4101) for apoptosis detection. Following the NOZ and SGC-996 cells were treated with method of \u0026ldquo;cell cycle detection\u0026rdquo;, they were resuspended into single-cell suspension with Annexin V binding buffer, and incubated with Annexin V-FITC and PI for 15 minutes at 2\u0026ndash;8\u0026deg;C in dark conditions. Finally, the distribution percentage of apoptotic cells was determined by flow cytometry.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWound healing assay\u003c/h2\u003e \u003cp\u003eThe NOZ and SGC-996 cells were inoculated in a 6-well plate. When the cells reached 100% confluence, they attached to the wall were scraped with a sterile needle tip and rinsed with PBS to remove the suspended cells. Then the cells remained were treated with different concentrations of Matrine(5 and 10 \u0026micro;M) for 24 hours, condition of the cells was photographed under optical microscope (Olympus, Cat. No. CKX53) at 0 and 24 hours. Subsequently calculation for the percentage of wound healing. Cells treated with 0.1% DMSO solutions were utilized as negative control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eTranswell invasion assay\u003c/h2\u003e \u003cp\u003eTranswell assay kit (Corning, Cat. No. 3422-A) was used to assess invasion of cell. In short, Matrix (Corning, Cat. No. 356234) and serum-free medium was added to the upper cavity of Transwell at a ratio of 1:10 dilution, then incubated at 37 ℃ for 4 hours to coagulate the dilution. Next, 600 \u0026micro;l complete medium with FBS of 10% concentrations was pre-added to the lower cavity of each well, subsequently 100 \u0026micro;l with NOZ and SGC-996 cells containing serum-free medium were seeded into the upper cavity. Then the cells were exposed with 5 and 10 \u0026micro;M Matrine for 24h, removed the medium, and fixed with 4% paraformaldehyde (Beyotime, Cat. No. P0099) for 60 minutes. Subsequently, after staining with 0.1% Crystal Violet (Biosharp, Cat. No. BL802A) for 30 minutes, three fields were randomly selected to take photos under a microscope and count the invading cells. Cells treated with 0.1% DMSO solutions were served as negative controls.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real‑time polymerase chain reaction (qRT˗PCR)\u003c/h2\u003e \u003cp\u003eTotal RNA of tissue or drug-treated cells was extracted by MagZol LS Reagent (Magentec, Cat. No. R4802), then reverse-transcribed into cDNA using 5\u0026times; Hieff Canace PCR Master Mix (Yeasen, Cat. No. 10137ES08). The qRT-PCR was performed by using fluorescence quantitative PCR instrument (Roche, Cat. No. LightCycler 480) and 2 x Hieff Union qPCR TaqMan Probe Master Mix (Yeasen, Cat. No. 11205-A. GAPDH was served as control to calculate the relative expression of target gene by employing 2^\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e methods. The primer sequences related to human and mouse species are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, respectively.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eHuman species\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer (5'to3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer (5'to3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esnail\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTGCAACAAGGAATACCTCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCACTGGTACTTCTTGACATCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eslug\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTGACAAGGAATATGTGAGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAGCCCTCAGATTTGACCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003etwist\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCCGCAGTCTTACGAGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTTGAGGGTCTGAATCTTGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN-cadherin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCCAACCTTAACTGAGGAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCAAGTTGATTGGAGGGATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE-cadherin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATTTTTCCCTCGACACCCGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCCAGGCGTAGACCAAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVimentin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCCGTTGAAGCTGCTAACTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGAGGGAGTGAATCCAGATTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATACCCCTTTGACGGTAAGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTTCTCCCAAGGTCCATAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGACGCAGACATCGTCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGTCATCGTCGAAATGGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGAGGCATTGCTGATGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAGGCTGGGGCTCATTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMouse species\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer (5'to3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer (5'to3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esnail\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACACGCTGCCTTGTGTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTCAGCAAAAGCACGGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eslug\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGTCAAGAAACATTTCAACGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGAGGATCTCTGGTTTTGGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003etwist\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGACAAGCTGAGCAAGATTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGAGAAGGCGTAGCTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN-cadherin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCGCAGTCTTACCGAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGCTGCTTTCATACTGAACTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE-cadherin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGTCTCCTCATGGCTTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCCGAAAAGAAGGCTGTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVimentin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGCTGCGAGAGAAATTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACTTTCCGTTCAAGGTCAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAGTTCCCCGGCGATGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTGGTCAAGGTCACCTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGACAGCCAGACACTAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCGCGGCAAGTCTTCAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGTCGGTGTGAACGGATTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTAGACCATGTAGTTGAGGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eNOZ and SGC-996 cells were treated with 5 and 10 \u0026micro;M Matrine for 24 hours. In a parallel trial, cells were pretreated with LY294002 (1.25 \u0026micro;M)/740 Y-P (2.5 \u0026micro;M) for 4 hours prior to treating with Matrine (10 \u0026micro;M) for 24 hours. RIPA Lysis Buffer (Beyotime, Cat. No. P0013B) containing 1mM of Phenoxymethylsulfonyl fluoride (Solarbio, Cat. No. P0100) and Phosphatase inhibitor cocktail A (Beyotime, Cat. No. P1081) was added to cells and tissues for protein extraction. BCA Protein Assay Kit (Beyotime, Cat. No. P0012S) was adopted for protein quantification, followed by SDS-PAGE (6\u0026ndash;15%) electrophoresis. The protein was then transferred to the PVDF membrane (Sigmaaldrich, Cat. No. IPVH00010). After 5% skimmed milk was blocked at room temperature for 2 hours, the membranes containing protein were subsequently incubated with primary antibody at 4℃ overnight and secondary antibodies at room temperature for 1 hours. NcmECL Ultra Enhanced Chemiluminescent kit (Ncmbio, Cat. No. P10300) and Gel imaging system (Bltlux, Cat. No. GelView 6000Plu) was used for developing, and the protein bands were analyzed by Image J software. The relevant antibodies information used can be found in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e\u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibody name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDilution ratio\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCat No.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCompany\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003cp\u003eN-cadherin\u003c/p\u003e \u003cp\u003eE-cadherin\u003c/p\u003e \u003cp\u003eVimentin\u003c/p\u003e \u003cp\u003eMMP2\u003c/p\u003e \u003cp\u003eMMP9\u003c/p\u003e \u003cp\u003ep-PI3K\u003c/p\u003e \u003cp\u003ePI3K\u003c/p\u003e \u003cp\u003ep-AKT\u003c/p\u003e \u003cp\u003eAKT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:10000\u003c/p\u003e \u003cp\u003e1:5000\u003c/p\u003e \u003cp\u003e1:50000\u003c/p\u003e \u003cp\u003e1:5000\u003c/p\u003e \u003cp\u003e1:500\u003c/p\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003cp\u003e1:5000\u003c/p\u003e \u003cp\u003e1:10000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10494-1-AP\u003c/p\u003e \u003cp\u003e22018-1-AP\u003c/p\u003e \u003cp\u003e20874-1-AP\u003c/p\u003e \u003cp\u003e10366-1-AP\u003c/p\u003e \u003cp\u003eWL03224\u003c/p\u003e \u003cp\u003eWL03096\u003c/p\u003e \u003cp\u003eAF3241\u003c/p\u003e \u003cp\u003e60225-1-Ig\u003c/p\u003e \u003cp\u003e66444-1-Ig 60203-2-Ig\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProteintech, Wuhan, China\u003c/p\u003e \u003cp\u003eProteintech, Wuhan, China\u003c/p\u003e \u003cp\u003eProteintech, Wuhan, China\u003c/p\u003e \u003cp\u003eProteintech, Wuhan, China\u003c/p\u003e \u003cp\u003eWanleibio, Shanghai, China\u003c/p\u003e \u003cp\u003eWanleibio, Shanghai, China\u003c/p\u003e \u003cp\u003eAffinity, JiangSu, China\u003c/p\u003e \u003cp\u003eProteintech, Wuhan, China\u003c/p\u003e \u003cp\u003eProteintech, Wuhan, China\u003c/p\u003e \u003cp\u003eProteintech, Wuhan, China\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eTissue specimens of human GBC\u003c/h2\u003e \u003cp\u003eTumor tissues and adjacent gallbladder tissues were taken from 6 patients with GBC at the Laparoscopic Center of Anhui Provincial General Hospital of the Chinese People's Armed Police Force in 2021. This study was approved by the Ethics Review Committee of the Anhui Provincial General Hospital of the Chinese People's Armed Police Force, as well as informed consent from all patients or their families.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eXenograft gallbladder cancer model\u003c/h2\u003e \u003cp\u003eHangzhou Ziyuan Laboratory Animal Technology Co., LTD provided 12 female BALB/c-Nude mice (3\u0026ndash;4 weeks old, SPF grade) with production license No. SCXK (Zhejiang) 2019⁃0004. These mice were fed randomly under SPF conditions, with free access to food and water. The experiment was conducted after the mice had been adapted for one week. All animal experiments are carried out in accordance with the \"Guidelines for the Care and Use of Experimental Animals\".\u003c/p\u003e \u003cp\u003eNOZ cells (5\u0026times;10\u003csup\u003e6\u003c/sup\u003ecells \u003cem\u003eper\u003c/em\u003e solutions of 100 \u0026micro;l) were injected into the right axillary region subcutaneously of BALB/c-Nude mice. When the tumor grew to 50mm\u003csup\u003e3\u003c/sup\u003e, the mice were randomly distributed into 3 groups (TC: model control group, Matrine-L: low-dose Matrine intervention group, Matrine-H: high-dose Matrine intervention group). Intraperitoneal injections, and the changes of body weight and tumor volume were monitored every 3 days, for a total of 11 times. After 33d feeding, the mice were euthanized, half of the tumor tissues were then stored at -80 ℃, and subsequently the remaining tumor tissues or normal tissues (heart, liver, spleen, kidney and lung) were fixed with 4% paraformaldehyde (Solarbio, Cat. No. P1110) for follow-up experiments. The calculation formula of tumor volume is 1/2\u0026times; tumor length (mm)\u0026times; tumor width \u003csup\u003e2\u003c/sup\u003e(mm\u003csup\u003e2\u003c/sup\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003ePharmaceutical administration\u003c/h2\u003e \u003cp\u003eMatrine was prepared by sequentially adding DMSO (Solarbio, Cat. No. D8371), PEG400 (Solarbio, Cat. No. P8530), and PBS, with precisely weighed Matrine, leading to a final solution comprising 10% DMSO, 50% PEG400, and 40% PBS. Mice in the intervention group were intraperitoneally injected with 0.2 mL Matrine (5 and 10mg/kg), and the TC group was administered with 0.2 mL solvent. The intervention group and TC group received a total of 11 injections.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eHE staining\u003c/h2\u003e \u003cp\u003eAfter the tumor tissues were fixed with 4% paraformaldehyde, dehydrated, embedded, and made into 2-\u0026micro;m-thick continuous sections. Following this, the sections were stained with hematoxylin (Solarbio, Cat. No. H8070), dehydrated with ethanol step by step, eosin Y (Solarbio, Cat. No. G1100) contrast staining, xylene blue (Solarbio, Cat. No. A8360) transparent, and then obstructed with neutral balsam (Solarbio, Cat. No. G8590). Finally, histopathological changes of mice in each group were observed by optical microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll experiments were conducted independently at least 3 times. The experimental results were systematically analyzed using Graphpad Prism 8 software, with data presented as standard error of mean. The comparison of independent sample was tested by T-test, while one-way ANOVA analysis was conducted for intergroup comparison. \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicates that the difference of experimental data was statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eMatrine blocked the cell cycle of GBC cells, promoted their apoptosis and inhibited their growth.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe chemical structure of Matrine is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. In order to determine the optimal conditions of Matrine, this study selected three human GBC cell lines (GBC-SD, SGC-996, and NOZ) and one human gallbladder epithelial cell line (HGBEC) for CCK8 assay. According to Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, Matrine significantly inhibited the proliferation activity of GBC-SD, SGC-996 and NOZ cells at high concentration (10\u0026ndash;80 \u0026micro;mol/L) for 24\u0026ndash;72 hours, along with a dose-dependent and time-dependent relationship, among which NOZ and SGC-996 cells were more sensitive to Matrine. Therefore, NOZ and SGC-996 were selected for subsequent experiments. Notably, GBC-SD cells acquired resistance after Matrine exposed to 48 hours. In addition, Matrine barely affected the viability of HGBEC cells at a low concentration (0\u0026ndash;10 \u0026micro;mol/L) for 12\u0026ndash;24 hours, indicating that the effects of concentration and time were within the safe range (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Interestingly, the IC50 values of Matrine at 24 hours for HGBEC, GBC-SD, SGC-996, and NOZ cells were 64.55 \u0026micro;mol/L, 44.83 \u0026micro;mol/L, 7.923 \u0026micro;mol/L and 6.74 \u0026micro;mol/L, respectively. Especially, the IC50 values of NOZ and SGC-996 cells were much smaller than that of GBC-SD and HGBEC cells, which strongly suggested that Matrine had a more potent influence on NOZ and SGC-996 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Based on the comprehensive analysis of CCK8 results, the concentration (IC50: 5\u0026micro;mol/L, 2X IC50: 10\u0026micro;mol/L) and time of Matrine for 24h was selected as the optimal conditions for the follow-up experiment. Moreover, the impact of Matrine on the cell cycle of GBC cells was detected by flow cytometry. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC showed that compared with the control group, Matrine respectively induced NOZ and SGC-996 cells to be arrested in S and G2/M phase, resulting in inhibitory effect of DNA replication and cell division, with a dose-dependent manner. To further investigate whether Matrine affects apoptosis of NOZ and SGC-996 cells, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, compared with the control group, Matrine enhanced apoptosis of NOZ and SGC-996 cells in a dose-dependent manner. The apoptotic rates of NOZ and SGC-996 cells treated with high concentrations of Matrine were 89.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32% and 26.73\u0026thinsp;\u0026plusmn;\u0026thinsp;2.57%, respectively. Based on the above results, we found that Matrine blocked the cell cycle of GBC cells, promoted its apoptosis, and inhibited its growth.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e Matrine blocked the cell cycle of GBC cells, promoted their apoptosis, and suppressed their growth \u003cem\u003ein vitro\u003c/em\u003e. (A) Matrine structure diagram. (B) CCK8 assay was used to determine cell viability. HGBEC, GBC-SD, SGC-996, and NOZ cells were exposed to different concentrations of Matrine for 12\u0026ndash;72 hours. (C-D) Flow cytometry was used for detecting cell cycle and apoptosis of NOZ and SGC-996 cells treated with Matrine (0, 5 and 10 \u0026micro;M) for 24 hours. (The data are displayed as the standard error of the mean and reflect three independent trials; no annotation represents comparison with 0 \u0026micro;M Matrine; *\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001.)\u003c/p\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eMatrine inhibited the invasion and migration of GBC cells\u003c/h2\u003e \u003cp\u003eActivation of EMT plays a key role in the progression of GBC (Cao et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), and metastasis of tumor cell is the major cause of tumor development, death, and recurrence (Lengrand et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). To explore whether Matrine affects the invasion and migration of NOZ and SGC-996 cells. Subsequently, we tested it with a scratch experiment. The results showed that compared with the control group, Matrine suppressed the migration of NOZ and SGC-996 cells in a dose-dependent way, with high concentration of suppressive rates of 83.33\u0026thinsp;\u0026plusmn;\u0026thinsp;6.88% and 68.67\u0026thinsp;\u0026plusmn;\u0026thinsp;3.76%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). In addition, Transwell assay indicated that Matrine largely inhibited the invasion of NOZ and SGC-996 cells in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Next, the mRNA levels of EMT-related transcriptional factor (snail, slug and twist, Vimentin, N-cadherin, and E-cadherin) and matrix metalloproteinases in NOZ and SGC-996 cells were measured by qRT-PCR. Compared with the control group, Matrine significantly decreased snail, slug, twist, Vimentin, N-cadherin, MMP2 and MMP9 mRNA levels, while increased mRNA expression of E-cadherin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). More importantly, at the protein level, Matrine significantly downregulated the abundances of Vimentin, N-cadherin, MMP2 and MMP9 in GBC cells, while upregulated the levels of E-cadherin protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Notably, the inhibitory effect of Matrine on GBC cells was consistent with the previous gene level. These results indicated that Matrine inhibited the invasion and migration of GBC cells at both the genetic and protein levels. This suggested that Matrine exerted its effects in regulating EMT and matrix metalloproteinase-related proteins, providing molecular evidence for its anti-tumor effects.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e Matrine inhibited the invasion and migration of GBC cells \u003cem\u003ein vitro\u003c/em\u003e. NOZ and SGC-996 cells treated with different concentrations of Matrine for 24 hours. (A) Wound healing assay for migration of GBC cells. (B) Transwell assay for invasion of GBC cells, with a scale bar of 200 micrometers. (C) mRNA expression of snail, slug, twist, Vimentin, N-cadherin, E-cadherin, MMP2 and MMP9 in GBC cells was detected using qRT-PCR. GAPDH as an internal control. (D) Protein expression of Vimentin, N-cadherin, E-cadherin, MMP2 and MMP9 in GBC cells was determined by employing Western blot. (The data indicate the standard error of the mean and reflect three independent trials; no comments represent comparison with 0 \u0026micro;M Matrine; *\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, ns indicates no significantly statistical difference.)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eInvasion and migration were abnormally active in GBC\u003c/h2\u003e \u003cp\u003eTo further validate NOZ and SGC-996 cells as experimental cell line in this study. Surprisingly, results of qRT-PCR showed that compared to HGBEC cells, mRNA levels of EMT-related transcriptional factors (snail, slug, twist) and genes (Vimentin, N-cadherin) in GBC cells (GBC-SD, SGC-996 and NOZ) were increased, while the mRNA levels of E-cadherin were downregulated, with NOZ and SGC-996 showing more significant changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). This fully proved the rationality of NOZ and SGC-996 as experimental cell line for subsequent experiments. Next, mRNA levels of EMT-associated transcriptional factors (snail, slug, twist) and genes (Vimentin, N-cadherin, and E-cadherin) were detected at the genetic level in 6 pairs of GBC tissues. We found that compared to adjacent normal tissue, the mRNA levels of snail, slug, twist, Vimentin and N-cadherin mRNA levels in GBC tissues were significantly higher than those in normal tissues, while the expression level of E-cadherin mRNA was markedly lower than that of normal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Consistent with these results, compared with normal gallbladder tissues, the protein levels of Vimentin and N-cadherin in GBC tissues increased, in contrast the protein levels of E-cadherin decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). These results suggested that the abnormal driving force of EMT was closely related to the progression of GBC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e Expression of EMT in GBC. (A) Compared with HGBEC cells, the mRNA levels of snail, slug, twist, Vimentin, N-cadherin and E-cadherin in GBC cells were analyzed by qRT-PCR. GAPDH was used as an internal control. (B) mRNA levels of Vimentin, N-cadherin and E-cadherin in GBC specimens (n\u0026thinsp;=\u0026thinsp;6) and paired gallbladder tissues measured by qRT-PCR. GAPDH was viewed as internal control. (C) Western blot was used to analyze the protein levels of Vimentin, N-cadherin and E-cadherin in GBC specimens (n\u0026thinsp;=\u0026thinsp;6) and adjacent normal tissues. GAPDH as an internal control. (The data are presented as the standard error of mean and represent three independent experiments; *\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, ns indicates no significantly statistical difference.)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eMatrine inhibited the invasion and migration of GBC by regulating the PI3K/AKT signaling pathway\u003c/h2\u003e \u003cp\u003eThe PI3K/AKT signaling pathway promotes the occurrence of EMT (Ang et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). To further explore the underlying mechanism of Matrine against GBC, we investigated whether Matrine regulates the invasion and migration of GBC through PI3K/AKT signaling pathway, thereby affecting the progression of GBC. At the protein level, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, compared with the control group, Matrine dramatically inhibited the protein expression of p-PI3K and p-AKT in NOZ and SGC-996 cells, along with a dose-dependent relationship to some extent. Additionally, in order to fully confirm the anti-cancer effect of Matrine in regulating PI3K/AKT, we used 740 Y-P (PI3K activator) and LY294002 (PI3K inhibitor). Then, the effects of 740 Y-P/LY294002 on the viability of NOZ and SGC-996 cells were further explored. The results of CCK8 showed that (Fig. S1), the IC50 values of NOZ and SGC-996 cells at 24 hours treated with 740 Y-P were 9.91\u0026micro;mol/L and 9.32\u0026micro;mol/L, respectively. Subsequently, the IC50 values of NOZ and SGC-996 treated with LY294002 severally were 6.43\u0026micro;mol/L and 9.86\u0026micro;mol/L. It was worth noting that 740 Y-P almost did not affect the proliferation of NOZ and SGC-996 cells at low concentration (0\u0026ndash;5 \u0026micro;mol/L) for 24h. Meanwhile, LY294002 had the same effect of 740 Y-P at low concentrations (0-2.5 \u0026micro;mol/L) on NOZ and SGC-996 cells for 24h. Based on the results of CCK8 analysis, 740 Y-P (2.5 \u0026micro;mol/L) and LY294002 (1.25 \u0026micro;mol/L) were selected as the optimal concentrations for follow-up experiments, due to did not alter the viability of GBC cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, at the genetic levels, in NOZ and SGC-996 cells, compared with Matrine group, Matrine\u0026thinsp;+\u0026thinsp;740 Y-P group antagonized the anti-cancer effect of Matrine, such as increasing the mRNA levels of N-cadherin, Vimentin, MMP2 and MMP9, while decreasing the expression of E-cadherin mRNA. In addition, compared with the Matrine group, Matrine\u0026thinsp;+\u0026thinsp;LY294002 group enhanced the anti-cancer effect of Matrine to a certain extent, including down-regulating the mRNA levels of N-cadherin, Vimentin, MMP2 and MMP9. At the same time, E-cadherin mRNA expression was up-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Next, we examined the anti-cancer mechanism of Matrine at the protein level. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-D, consistent with the genetic results, 740 Y-P similarly counteracted the Matrine's anti-cancer efficiency in NOZ and SGC-996 cells, while LY294002 also increased the sensitivity of Matrine to GBC. These results indicated that Matrine inhibited the phosphorylation of PI3K and AKT, and suppressed the invasion and migration of GBC by regulating the PI3K/AKT signaling pathway, thus playing an anti-GBC role.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFigure S1 The effects of different concentrations of 740 Y-P or LY294002 on proliferation of NOZ and SGC-996 cells for 24 hours.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e Matrine modulated the PI3K/AKT signaling pathway. NOZ and SGC-996 cells were affected with LY294002 (1.25 \u0026micro;M) or 740 Y-P (2.5 \u0026micro;M) for 4 hours, followed by treatment with Matrine (10 \u0026micro;M) for 24 hours. (A) The effects of Matrine on the PI3K/AKT proteins in GBC cells. (B) The impacts of LY294002 or 740 Y-P (and) or Matrine on the PI3K/AKT mRNA levels in GBC cells. (C) The impacts of LY294002 or 740 Y-P (and) or Matrine on the PI3K/AKT, EMT, MMP2, and MMP9 proteins in NOZ cells. GAPDH was served as an internal control. (D) Western blot was utilized for exploring the PI3K/AKT, EMT, MMP2, and MMP9 proteins in SGC-996 cells. GAPDH as an internal control. (The data are presented as the standard error of the mean and represent three independent experiments; no annotation displays comparison with 0 \u0026micro;M Matrine; *\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, ns indicates no significantly statistical difference.)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eThe antitumor effect of matrine depended on the PI3K/AKT signaling pathway\u003c/h2\u003e \u003cp\u003eTo determine whether Matrine has the same anti-cancer effect \u003cem\u003ein vivo and in vitro\u003c/em\u003e. We successfully constructed a xenograft mouse model of GBC using NOZ cells. HE staining showed that there were no abnormal results in the heart, liver, spleen, kidney and lung of the intervention group and the control group, indicating that no toxic symptoms or abnormal actions were observed in each group during the experiment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In addition, there was no difference in body weight among the groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), which further validated that no abnormal activity was observed in any group of mice. Subsequently, with the increase of administration times and dose of Matrine, tumor volume (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eC) and tumor weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eD) in the Matrine group gradually decreased, and there was a significant difference in tumor appearance among all groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). It was worth noting that after Matrine intervention, the cell lysis, the nucleus fragmentation, intercellular cavities and varying degrees of necrosis appeared, with a dose-dependent relationship (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). More importantly, Matrine significantly inhibited the mRNA expression of N-cadherin, Vimentin, MMP2 and MMP9 at the genetic level, while increasing the mRNA level of E-cadherin (Figure. 5G). What is even more surprising is that, at the protein level (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eH), aligned with the genetic results, Matrine exhibited the same anti-cancer effect, and significantly inhibited the phosphorylation levels of PI3K and AKT. Based on the above analysis, Matrine inhibited PI3K/AKT signaling pathway and suppressed invasion and migration of GBC, and thus blocked tumor progression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003e The effects of Matrine depended on PI3K/AKT signaling pathway. (A) HE staining of heart, liver, spleen, lung, and kidney in nude mice, scale bar =\u0026thinsp;100 \u0026micro;m. (B) Body weight, (C) tumor volume, (D) tumor weight, (E) images, and (F) HE staining of the NOZ cells xenograft model treated with the vehicle (TC) and different concentrations of Matrine, scale bar =\u0026thinsp;100 \u0026micro;m. (G) The mRNA levels of EMT, MMP2, and MMP9 in tumor issues were detected by qRT-PCR. GAPDH as an internal control. (H) The protein expressions of PI3K/AKT, EMT, MMP2, and MMP9 in tumor tissues were analyzed by Western blot. GAPDH is served as internal control. (The data are shown as the standard error of the mean, based on three independent experiments; no annotation embodies comparison with TC group; *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026lt;0.001, while ns indicates no statistically significant difference).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eGBC is the most common malignant biliary tract cancer (BTC) and is one of the most biologically aggressive tumors with high mortality rates, with a median 5-year overall survival rate of 18% (Goetze et al. 2015; Roa et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Like other forms of BTC, surgical resection is the only possible therapeutic method (Queiroz et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Early GBC is typically asymptomatic and potentially curable (Schmidt et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Unfortunately, only 10% of GBC is considered resectable (Roa et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Advanced GBC is characterized by a highly invasive phenotype and extensive resistance to radiotherapy and chemotherapy, with poor prognosis (Vega et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Both early and advanced GBC are mostly diagnosed by chance during or after surgery. However, the recurrence rate of GBC resection is disproportionately high (Vega et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In addition, the nursing standard after radical resection of GBC is \u003cem\u003ecapecitabine\u003c/em\u003e (Primrose et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Notably, the ABC-02 and BT-22 trials recommend that the combination with chemotherapy regimen of \u003cem\u003egemcitabine\u003c/em\u003e and \u003cem\u003ecisplatin\u003c/em\u003e as the first-line therapy for patients with primary unresectable BTC, including GBC (Valle et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). The \u003cem\u003eFOLFOX\u003c/em\u003e (\u003cem\u003efolinic acid\u003c/em\u003e, \u003cem\u003efluorouracil\u003c/em\u003e, and \u003cem\u003eoxaliplatin\u003c/em\u003e) regimen is a second-line chemotherapeutic option (Lamarca et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Unfortunately, the adverse reaction and drug resistance to radiotherapy and chemotherapy regimens has seriously hindered the progress of treatment. In order to improve the quality of life and prolong survival of GBC patients, there is an urgent to explore safer and more efficient new treatment options.\u003c/p\u003e \u003cp\u003eTCM has been developed for thousands of years, in which monomers and their extracts have specific pharmacological effects, such as multi-target, high efficiency, safety, strong specificity, reducing drug resistance and adverse reactions, especially in the field of anti-tumor with naturally unique advantages (Liao et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). For instance, \u003cem\u003eastragalus polysaccharides (APs)\u003c/em\u003e was used in the treatment of triple-negative breast cancer by inhibiting the PI3K/AKT/Bcl-2 pathway, effectively inhibiting the proliferation of cancer cells, interfering with invasion and promoting apoptosis Du et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Fang et al. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) reported that \u003cem\u003eastragaloside IV\u003c/em\u003e suppressed viability, migration, and invasion of liver cancer cell by mediating the Nrf2/HO-1 signaling pathway. \u003cem\u003eDihydroartemisinin (DHA)\u003c/em\u003e impaired the growth, metastasis, and angiogenesis of colon cancer through GSK-3 β/ The TCF7/MMP9 pathway and its synergistic effect with \u003cem\u003ecapecitabine\u003c/em\u003e (Dai et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Matrine reduced Bcl-2 levels, activated caspase3, and induced cancer cell apoptosis in papillary thyroid cancer cells, ultimately suppressing tumor growth \u003cem\u003ein vivo\u003c/em\u003e (Fu et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Notably, we found that Matrine inhibited the viability of GBC cells in a dose-dependent manner, such as GBC-SD, NOZ, and SGC-996 cells. Among them, the inhibitory effects of NOZ and SGC-996 were more outstanding than GBC-SD, thereby NOZ and SGC-96 cell lines were selected for follow-up experiments. In addition, in order to determine whether Matrine has potential toxic effects on mice. The HE staining showed that there were not pathological phenomena in the heart, liver, spleen, kidney, and lung tissues, whether in either Matrine treatment group or TC group. Additionally, no significant difference was observed in body weight between the Matrine and TC groups. This fully demonstrated that the concentration of Matrine used during the experiment was within a safe range. Notably, \u003cem\u003ein vivo\u003c/em\u003e experiments, compared with TC group, Matrine inhibited tumor growth in a dose-dependent relationship, along with remarkable changes in tumor weight, volume, and appearance. More importantly, Matrine significantly induced apoptosis and cell cycle arrest in NOZ and SGC-996 cells with a dose-dependent manner. Furthermore, \u003cem\u003ein vivo\u003c/em\u003e experiments, HE staining results of tumor tissue expressed that the Matrine treated group exhibited cell lysis, nuclear fragmentation, and the intercellular cavities and varying degrees of necrosis, with a dose-dependent relationship. These results indicated that Matrine had a pronounced killing effect on GBC cells.\u003c/p\u003e \u003cp\u003eEMT is a reversible biological process that causes epithelial cells to temporarily transition to a quasi-interstitial state (Fontana et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). During this process, epithelial cells gradually transition from their polygonal and pebble-shaped appearance to a spindle-shaped interstitial morphology, including dissolution of cell-cell connections and loss of apical-basal polarity, as well as enhancing cell migration and motility (Iser et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). It is worth noting that the mesenchymal cells produced by this process can be restored to epithelial state through the mesenchymal epithelial transition (MET) process (Verstappe et al. 2023). Zhang et al. (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) reported that the malignant progression of the vast majority of tumors is associated with abnormal activation of EMT. In addition, the degradation of basement membrane and extracellular matrix (ECM) is crucial for tumor invasion and metastasis (Jiang et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The imbalance of MMP2 and MMP9 promotes tumor cells to break through the extracellular matrix by degrading it, which contributes to tumor invasion and metastasis (Padežnik et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). It is worth noting that our results indicated that compared to adjacent normal gallbladder tissue, the mRNA and protein levels of N-cadherin and Vimentin in tumor tissue were abnormally increased, while the expressions of E-cadherin mRNA and protein were significantly reduced. In addition, it is found that after activation of the EMT program, the expression of EMT-related transcription factors, such as snail, slug, and twist increase. This process promotes the expression of interstitial cell markers, embracing Vimentin and N-cadherin, while inhibiting the expression of epithelial cell markers, such as E-cadherin (Kielbik et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Surprisingly, we found that compared to HGBEC cells, the levels of EMT-related transcription genes (snail, slug, twist, Vimentin, and N-cadherin) in GBC-SD, NOZ, and SGC-996 cells were significantly increased, while the expression of E-cadherin was significantly decreased. Notably, among these cells, NOZ and SGC-996 cells are more pronounced. These findings demonstrated that EMT enabled individual tumor cells to acquire features related with malignant tumor during tumor progression. More importantly, at the mRNA level, Matrine could significantly inhibit the expression of snail, slug, twist, MMP2, MMP9, Vimentin, and N-cadherin, while upregulating the expression of E-cadherin in a dose-dependent manner. Surprisingly, Matrine has the same anti-cancer effect as mRNA at the protein level, such as inhibiting the abundance of MMP2, MMP9, Vimentin, and N-cadherin while increasing the expression of E-cadherin. Further \u003cem\u003ein vivo\u003c/em\u003e experimental results confirmed that Matrine remarkably impaired the mRNA and protein expression of MMP2, MMP9, Vimentin, and N-cadherin, while upregulating the mRNA and protein levels of E-cadherin. In addition, Transwell and scratch experiments both displayed that Matrine could significantly induce inhibition of the EMT process in NOZ and SGC-996 cells in a dose-dependent manner. These results confirmed that Matrine exerted anti-cancer effects by suppressing the migration and invasion of GBC cells. This not only provides ideas for exploring treatment options for GBC, but also contributes to the molecular basis.\u003c/p\u003e \u003cp\u003ePI3K is a lipid kinase family that exhibits both serine/threonine kinase activity and phosphatidylinositol kinase activity (He et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). AKT is an important downstream signaling molecule of PI3K, with a kinase domain at the carboxyl terminal and a pleckstrin homology domain at the amino terminal (Glaviano et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Under normal circumstances, the activated PI3K catalyzes the intracellular PIP2 into PIP3, which acts as a second messenger and interacts with the pleckstrin homology domain of AKT, thereby activating AKT (Tewari et al. 2019). The abnormal activation of the PI3K/AKT signaling pathway promotes abnormal proliferation, apoptosis inhibition, migration, invasion, and metastasis of various cancer cells, playing a crucial role in the occurrence and progression of cancer cells (Yu et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Notably, Matrine inhibited the expression of p-PI3K and p-AKT in a dose-dependent manner at the protein level. Further \u003cem\u003ein vivo\u003c/em\u003e experiments indicated that Matrine downregulated the abundance of p-PI3K and p-AKT protein with increasing administration time and concentration. To further confirm whether Matrine exerts anti-cancer effects through the PI3K/AKT signaling pathway. We used 740 Y-P, PI3K activator, and LY294002, PI3K inhibitor. The results of qPCR showed that in NOZ and SGC-996 cells, compared to the Matrine treatment group, the Matrine combined with 740 Y-P group suppressed the anti-cancer effect of Matrine to a certain extent, including increasing the expression of MMP2, MMP9, Vimentin, and N-cadherin while reducing the level of E-cadherin; However, the combination of Matrine and LY294002 significantly enhanced Matrine's anti-cancer sensitivity, downregulating the expression of MMP2, MMP9, Vimentin, and N-cadherin, while upregulating the level of E-cadherin. Fortunately, at the protein level, the efficacy of 740 Y-P and LY294002 is consistent with the genetic level. In addition, compared with the Matrine treatment group, the Matrine\u0026thinsp;+\u0026thinsp;740 Y-P group significantly antagonized the anti-cancer effect of Matrine, increasing the expression of p-PI3K and p-AKT proteins. However, the Matrine\u0026thinsp;+\u0026thinsp;LY294002 group significantly enhanced the anti-cancer effect of Matrine on GBC cells, inhibiting the levels of p-PI3K and p-AKT proteins. These results fully demonstrated that Matrine impaired the invasion and migration of GBC cells through the PI3K/AKT signaling pathway, thereby inhibiting tumor growth.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, this study proved that Matrine exerted anti-tumor effects by inhibiting the PI3K/AKT signaling pathway, inducing inhibition of EMT process, inhibition of cell viability, inducing apoptosis and cell cycle arrest. Further \u003cem\u003ein vivo\u003c/em\u003e studies have confirmed that Matrine could suppress tumor growth in xenograft nude mice. This study provides a theoretical basis for Matrine to become a candidate drug for the treatment and research, and contributes to identify new targets and strategies for the treatment of GBC.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eGBC \u0026nbsp; \u0026nbsp; \u0026nbsp; Gallbladder cancer\u003c/p\u003e\n\u003cp\u003eEMT \u0026nbsp; \u0026nbsp; \u0026nbsp; Epithelial-mesenchymal transition\u003c/p\u003e\n\u003cp\u003eMMP2 \u0026nbsp; \u0026nbsp; \u0026nbsp;Matrix metalloproteinase 2\u003c/p\u003e\n\u003cp\u003eMMP9 \u0026nbsp; \u0026nbsp; \u0026nbsp;Matrix metalloproteinase 9\u003c/p\u003e\n\u003cp\u003ePI3K \u0026nbsp; \u0026nbsp; \u0026nbsp; Phosphatidylinositol 3-kinase\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTCM \u0026nbsp; \u0026nbsp; \u0026nbsp; Traditional Chinese medicine\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBTC \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Biliary tract cancer\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAPs \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Astragalus polysaccharides\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDHA \u0026nbsp; \u0026nbsp; \u0026nbsp; Dihydroartemisinin\u003c/p\u003e\n\u003cp\u003eMET \u0026nbsp; \u0026nbsp; \u0026nbsp; Mesenchymal epithelial transition\u003c/p\u003e\n\u003cp\u003eECM \u0026nbsp; \u0026nbsp; \u0026nbsp; Extracellular matrix\u003c/p\u003e\n\u003cp\u003e740 Y-P \u0026nbsp; \u0026nbsp; PI3K activator\u003c/p\u003e\n\u003cp\u003eLY294002 \u0026nbsp; PI3K inhibitor\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors contributions\u0026nbsp;\u003c/strong\u003eM.R.L, H.G.C and S.D.Q designed the experiment, and wrote the articles. M.R.L, L.Z, S.M.H and Z.P performed most of the experiments and analyzed the data. H.G.C and S.M.H assisted in revising manuscript. S.D.Q provided fund support. All data were generated in-house, and no paper mill was used. All authors agree to be accountable for all aspects of work ensuring integrity and accuracy. Additionally, all authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFinding\u003c/strong\u003e This work was approved by the Fund of Armed police equipment research of China (number: ZZKY20233109); Armed police Force discipline top talent fund (number: ZG2020901); Armed police Force high-level science and technology personnel fund (number: ZG202193); Anhui Provincial Health Commission scientific research project (number: AHWJ2023BAa20148).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e Data will be made available on request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical statement\u0026nbsp;\u003c/strong\u003eAll animal researches were performed according to A the Experimental Animal Ethics Committee of Anhui University of Traditional Chinese Medicine (license number: AU AHUCM-mouce-2024017).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e All authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAkhmetkaliyev A, Alibrahim N, Shafiee D, Eugene T (2023) EMT/MET plasticity in cancer and go-or-grow decisions in quiescence: the two sides of the same coin? Mol Cancer 22(1):90\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAng HL, Mohan CD, Shanmugam MK, Leong HC, Makvandi P, Rangappa KS, Bishayee A, Kuma AP, Sethi G (2023) Mechanism of epithelial-mesenchymal transition in cancer and its regulation by natural compounds. Med Res Rev 43(4):1141\u0026ndash;1200\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao L, Bridle KR, Shrestha R, Prithviraj P, Crawford DHG, Jayachandran A (2022) CD73 and PD-L1 as potential therapeutic targets in gallbladder cancer. Int J Mol Sci 23(3)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen MH, Gu YY, Zhang AL, Sze DMY, Mo SL, May BH (2021) Biological effects and mechanisms of matrine and other constituents of Sophora flavescens in colorectal cancer. Pharmacol Res 171:105778\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai X, Chen W, Qiao Y, Chen XH, Chen YH, Zhang K, Zhang QS, Duan XX, Li X, Zhao JM, Tian F, Liu KD, Dong ZM, Lu J (2024) Dihydroartemisinin inhibits the development of colorectal cancer by GSK-3β/TCF7/MMP9 pathway and synergies with capecitabine. Cancer Lett 582:216596\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu Y, Wan H, Huang P, Yang JH, He Y (2022) A critical review of astragalus polysaccharides: from therapeutic mechanisms to pharmaceutics. Biomed Pharmacother 147:112654\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFang Gong Y, Hou S, Xu JC, Chen Y, Zhu LL, Xu YY, Chen YQ, Li MM, Li LL, Yang JJ, Yang Y (2023) Amelioratory effects of astragaloside IV on hepatocarcinogenesis via Nrf2-mediated pSmad3C/3L transformation. Phytomedicine 117:154903\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFontana R, Mestre-Farrera A, Yang J (2024) Update on Epithelial-Mesenchymal plasticity in cancer progression. Annu Rev Patho 19:133\u0026ndash;156\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu S, Zhao N, Jing G, Yang XM, Liu JF, Zhen DH, Tang XL (2020) Matrine induces papillary thyroid cancer cell apoptosis in vitro and suppresses tumor growth in vivo by downregulating miR-182-5p. Biomed Pharmacother 128:110327\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlaviano A, Foo ASC, Lam HY, Yap KCH, Jacot W, Jones RH, Eng HY, Nair MG, Makvandi P, Geoerger B, Kulke MH, Baird RD, Prabhu JS, Carbone D, Pecoraro C, The DBL, Sethi G, Cavalieri V, Lin KH, Javidi-Sharifi NR, Toska E, Davids MS, Brown JR, Diana P, Stebbing J, Fruman DA, Kumar AP (2023) PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer. Mol Cancer 22(1):138\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoetze TO (2015) Gallbladder carcinoma: prognostic factors and therapeutic options. World J Gastroenterol 21(43):12211\u0026ndash;12217\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe Y, Sun MM, Zhang GG, Yang J, Chen KS, Xu WW, Li B (2021) Targeting PI3K/Akt signal transduction for cancer therapy. Signal Transduct Target Ther 6(1):425. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-021-00828-5\u003c/span\u003e\u003cspan address=\"10.1038/s41392-021-00828-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu ZI, Lim KH (2022) Evolving paradigms in the systemic treatment of advanced gallbladder cancer: updates in year 2022. Cancers (Basel) 14(5)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang H, Du T, Xu G, Lai YM, Fan XX, Chen XJ, Li WJ, Yue F, Li Q, Liu L, Li KW (2017) Matrine suppresses invasion of castration-resistant prostate cancer cells by downregulating MMP-2/9 \u003cem\u003evia\u003c/em\u003e NF-κB signaling pathway. Int J Oncol 50(2):640\u0026ndash;648\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIser IC, Vedovatto S, Oliveira FD, Beckenkamp LR, Lenz G, Wink MR (2022) The crossroads of adenosinergic pathway and epithelial-mesenchymal plasticity in cancer. Semin Cancer Biol 86(Pt2):202\u0026ndash;213\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Y, Zhang H, Wang J, Liu YL, Luo T, Hua H (2022) Targeting extracellular matrix stiffness and mechanotransducers to improve cancer therapy. J Hematol Oncol 15(1):34\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKam AE, Masood A, Shroff RT (2021) Current and emerging therapies for advanced biliary tract cancers. Lancet Gastroenterol Hepatol 6(11):956\u0026ndash;969\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKielbik M, Przygodzka P, Szulc-Kielbik I, Klink M (2023) Snail transcription factors as key regulators of chemoresistance, stemness and metastasis of ovarian cancer cells. Biochim Biophys Acta Rev Cancer 1878(6):189003\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLamarca A, Palmer DH, Wasan HS, Ross PJ, Ma YT, Arora A, Falk S, Gillmore R, Wadsley J, Patel K, Anthoney A, Maraveyas A, Iveson T, Waters JS, Hobbs C, Barber S, Ryder WD, Ramage J, Davies LM, Bridgewater JA, Valle JW (2021) Advanced biliary cancer working group second-line FOLFOX chemotherapy versus active symptom control for advanced biliary tract cancer (ABC-06): a phase 3, open-label, randomised, controlled trial. Lancet Oncol 22(5):690\u0026ndash;701\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLengrand J, Pastushenko I, Vanuytven S, Song Y, Venet D, Sarate RM, Bellina M, Moers V, Boinet A, Sifrim A, Rama N, Ducarouge B, Herck JV, Dubois C, Scozzaro S, Lemaire S, Gieskes S, Bonni S, Collin A, Braissand N, Allard J, Zindy E, Decaestecker C, Sotiriou C, Salmon I, Mehlen P, Voet T, Bernet A, Blanpain C (2023) Pharmacological targeting of netrin-1 inhibits EMT in cancer. Nature 620(7973):402\u0026ndash;408\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Q, Huang H, He Z (2018) Regulatory effects of antitumor agent matrine on FOXO and PI3K-AKT pathway in castration-resistant prostate cancer cells. Sci China Life Sci 61(5):550\u0026ndash;558\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi C, Niu D, Zhu R, Yan XY, Qu HR, Zhang YL, Zheng YL (2023) Adjunctive effect of compound Kushen injection for cancer: an overview of systematic reviews. J Ethnopharmacol 317:116778\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Wei S, Marabada D, Wang ZZ, Huang Q (2023) Research progress of natural Matrine compounds and synthetic Matrine derivatives. Molecules 28(15)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao XZ, Tao LT, Liu JH, Gu YY, Xie J, Chen YL, Lin MG, Liu TL, Wang DM, Guo HY, Mo SL (2017) Matrine combined with cisplatin synergistically inhibited urothelial bladder cancer cells via down-regulating VEGF/PI3K/Akt signaling pathway. Cancer Cell Int 17:124\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao Y, Gui Y, Li Q, Li QZ, An J, Wang D (2023) The signaling pathways and targets of natural products from traditional Chinese medicine treating gastric cancer provide new candidate therapeutic strategies. Biochim Biophys Acta Rev Cancer 1878(6):188998\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin G, Wu Y, Cai F, Li Z, Su SX, Wang J, Cao JL, Ma LD (2019) Matrine promotes human myeloid leukemia cells apoptosis through warburg effect mediated by Hexokinase 2. Front Pharmacol 10:1069\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Qi Y, Bai ZH, Ni CX, Ren QH, Xu WH, Xu J, Hu HG, Qiu L, Li JZ, He ZG, Zhang JP (2017) A novel matrine derivate inhibits differentiated human hepatoma cells and hepatic cancer stem-like cells by suppressing PI3K/AKT signaling pathways. Acta Pharmacol Sin 38(1):120\u0026ndash;132\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoreira J, Machado M, Dias-Teixeira M, Ferraz R, Delerue-Matos C, Grosso C (2023) The neuroprotective effect of traditional Chinese medicinal plants-A critical review. Acta Pharm Sin B 13(8):3208\u0026ndash;3237\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNepal C, Zhu B, O'Rourke CJ, Bhatt DK, Lee D, Song L, Wang DF, Dyke ALV, Choo-Wosoba H, Liu ZW, Hildesheim A, Goldstein AM, Dean M, LaFuente-Barquero J, Lawrence S, Mutreja K, Olanich ME, Ferreccio C, Roa JC, Rashid A, Hsing AW, Gao YT, Chanock SJ, Araya JC, Andersen JB, Koshiol J (2021) Integrative molecular characterisation of gallbladder cancer reveals micro-environment-associated subtypes. J Hepatol 74(5):1132\u0026ndash;1144\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePadežnik T, Oleksy A, Cokan A, Takač I, Sobočan M (2023) Changes in the extracellular matrix in endometrial and cervical cancer: A systematic review. Int J Mol Sci 24(6)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrimrose JN, Fox RP, Palmer DH, Malik HZ, Prasad R, Mirza D, Anthony A, Corrie P, Falk S, Finch-Jones M, Wasan H, Ross P, Wall L, Wadsley J, Evans JTR, Stocken D, Praseedom R, Ma YT, Davidson B, Neoptolemos JP, Iveson T, Raftery J, Zhu SH, Cunningham D, Garden OJ, Stubbs C, Valle JW, Bridgewater J (2019) Capecitabine compared with observation in resected biliary tract cancer (BILCAP): a randomised, controlled, multicentre, phase 3 study. Lancet Oncol 20(5):663\u0026ndash;673\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQueiroz MM, Lima NF, Castria TBD (2023) Immunotherapy and targeted therapy for advanced biliary tract cancer: Adding new flavors to the pizza. Cancers (Basel) 15(7)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoa JC, Garc\u0026iacute;a P, Kapoor VK, Maithel SK, Javle M, Koshiol J (2022) Gallbladder cancer. Nat Rev Dis Primers 8(1):69\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchepis T, Boškoski I, Tringali A, Vincenzo B (2022) Palliation in gallbladder cancer: The role of gastrointestinal endoscopy. Cancers (Basel) 14(7)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmidt MA, Marcano-Bonilla L, Roberts LR (2019) Gallbladder cancer: epidemiology and genetic risk associations. Chin Clin Oncol 8(4):31\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma A, Sharma KL, Gupta A, Yadav A, Kumar A (2017) Gallbladder cancer epidemiology, pathogenesis and molecular genetics: Recent update. World J Gastroenterol 23(22):3978\u0026ndash;3998\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSturm N, Schuhbaur JS, H\u0026uuml;ttner F, Perkhofer L, Ettrich TJ (2022) Gallbladder cancer: Current multimodality treatment concepts and future directions. Cancers (Basel) 14(22)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTewari D, Patni P, Bishayee A, Sah AN, Bishayee A (2022) Natural products targeting the PI3K-Akt-mTOR signaling pathway in cancer: A novel therapeutic strategy. Semin Cancer Biol 80:1\u0026ndash;17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTong C, Wang Y, Li J, Cen WD, Zhang WG, Zhu ZY, Yu JH, Lu BC (2021) Pterostilbene inhibits gallbladder cancer progression by suppressing the PI3K/Akt pathway. Sci Rep 11(1):4391\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTripathi K, Maurya N, Goel A, Singhai A, Garg M (2023) Immunohistochemical expressions of EMT markers in pan-RAS-pERK1/2-positive tumors improve diagnosis and prognosis assessment of non-muscle invasive bladder cancer and muscle invasive bladder cancer patients. Mol Cell Biochem 478(6):1169\u0026ndash;1190\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValle J, Wasan H, Palmer DH, Cunningham D, Anthoney A, Maraveyas A, Madhusudan S, Iveson T, Hughes S, Pereira SP, Roughton M (2010) Cisplatin plus gemcitabine versus gemcitabine for biliary tract cancer. N Engl J Med 362(14):1273\u0026ndash;1281\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVega EA, Mellado S, Salehi O, Freeman R, Conrad C (2022) Treatment of resectable gallbladder cancer. Cancers (Basel) 14(6)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerstappe J, Berx G (2023) A role for partial epithelial-to-mesenchymal transition in enabling stemness in homeostasis and cancer. Semin Cancer Biol 90:15\u0026ndash;28\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Li Y, Li KW, Zhou CZ (2022) Sophoridine: A review of its pharmacology, pharmacokinetics and toxicity. Phytomedicine 95:153756\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S, Fu JL, Hao HF, Jiao YN, Li PP, Han SY (2021) Metabolic reprogramming by traditional Chinese medicine and its role in effective cancer therapy. Pharmacol Res 170:105728\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S, Yang S, Yang X, Deng D, Li J, Dong MQ (2023) Research progress of traditional Chinese medicine monomers in reversing multidrug resistance of breast cancer. Am J Chin Med 51(3):575\u0026ndash;594\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei D, Rui B, Qingquan F, Chen C, Ping HY, Xiaoling S, Hao W, Jun G (2021) KIF11 promotes cell proliferation via ERBB2/PI3K/AKT signaling pathway in gallbladder cancer. Int J Biol Sci 17(2):514\u0026ndash;526\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYou L, Yang C, Du Y, Wang WP, Sun MY, Liu J, Ma BR, Pang LN, Zeng YW, Zhang ZQ, Dong X, Yin XB, Ni J (2020) A systematic review of the pharmacology, toxicology and pharmacokinetics of Matrine. Front Pharmacol 11:01067\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu L, Wei J, Liu P (2022) Attacking the PI3K/Akt/mTOR signaling pathway for targeted therapeutic treatment in human cancer. Semin Cancer Bio 85:69\u0026ndash;94\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, Chen L, Sun X, Yang QJ, Wan LL, Guo C (2020) Matrine: A promising natural product with various pharmacological activities. Front Pharmacol 11:588\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Du P, Li Y, Zhu Q, Song XL, Liu SB, Hao JQ, Liu LG, Liu FT, Hu YP, Jiang L, Ma Q, Lu W, Liu YB (2020) TASP1 promotes gallbladder cancer cell proliferation and metastasis by up-regulating FAM49B via PI3K/AKT Pathway. Int J Biol Sci 16(5):739\u0026ndash;751\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang F, Xiang S, Cao Y, Li ML, Ma Q, Liang HB, Li HF, Ye YY, Zhang YJ, Jiang L, Hu YP, Zhou J, Wang XF, Zhang Y, Nie L, Liang X, Gong W, Liu YB (2021) Correction: EIF3D promotes gallbladder cancer development by stabilizing GRK2 kinase and activating PI3K-AKT signaling pathway. Cell Death Dis 13(1):19\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang N, Ng AS, Cai S, Li Q, Yang L, Kerr D (2021) Novel therapeutic strategies: targeting epithelial-mesenchymal transition in colorectal cancer. Lancet Oncol 22(8):e358\u0026ndash;e368\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Gao Y, Zhou Y, Liu ZM, Liu RX (2023) Pharmacological mechanism of natural drugs and their active ingredients in the treatment of arrhythmia via calcium channel regulation. Biomed Pharmacother 160:114413\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Z, Peng Y, Wu X, Meng SY, Yu W, Zhao JH, Zhang HY, Wang J, Li WB (2019) CCL18 secreted from M2 macrophages promotes migration and invasion via the PI3K/Akt pathway in gallbladder cancer. Cell Oncol (Dordr) 42(1):81\u0026ndash;92\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou Y, Wang S, Zhang H, Gu YX, Chen HJ, Huang ZH, Yang FF, Li WQ, Chen C, Men LH, Tian QC, Xie T (2024) The triangular relationship between traditional Chinese medicines, intestinal flora, and colorectal cancer. Med Res Rev 44(2):539\u0026ndash;567\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"naunyn-schmiedebergs-archives-of-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nsap","sideBox":"Learn more about [Naunyn-Schmiedeberg's Archives of Pharmacology](https://www.springer.com/journal/210)","snPcode":"210","submissionUrl":"https://submission.nature.com/new-submission/210/3","title":"Naunyn-Schmiedeberg's Archives of Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Gallbladder cancer, Matrine, EMT, PI3K/AKT signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-4137130/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4137130/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGallbladder cancer (GBC) is a common malignant cancer in the biliary system, which poses a serious threat to human health. It is urgent to explore ideal drugs for the treatment of GBC. Matrine is the main active ingredient of \u003cem\u003esophora flavescentis\u003c/em\u003e, with a wide range of biological activities encompassing anti-inflammatory, antiviral, immunomodulatory and anti-tumor. However, the underlying mechanism by which Matrine treats GBC is still unclear. The purpose of this study is to investigate the anti-tumor effects of Matrine on GBC \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e, and to clarify the potential regulatory mechanisms. Here, in this primer, we found that Matrine has a significant killing effect on GBC through CCK8 and flow cytometry, including arrest of cell cycle, inhibition of GBC cell, and induction of apoptosis. Further studies \u003cem\u003ein vivo\u003c/em\u003e confirmed that the inhibitory function of Matrine on tumor growth in NOZ xenografted nude mouse. At the same time, Matrine also significantly suppressed the migration and invasion of GBC cells through scratch and Transwell experiments. In addition, by detecting the mRNA and protein levels of epithelial-mesenchymal transition (EMT) and matrix metalloproteinases, Matrine furtherly substantiated the suppression of invasion and migration of GBC. From a mechanistic perspective, Matrine effectively decreased the abundance of p-PI3K and p-AKT protein \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e. More importantly, PI3K activator (740 Y-P) antagonized the anti-tumor effect of Matrine, while PI3K inhibitor (LY294002) increased the sensitivity of Matrine for GBC. Based on the above findings, we conclude that Matrine inhibits the invasion and migration of GBC by regulating PI3K/AKT signaling pathway. Our results indicate the crucial role and regulatory mechanism of Matrine in suppressing the growth of GBC, which provides a theoretical basis for Matrine to be a candidate drug for the treatment and research of GBC.\u003c/p\u003e","manuscriptTitle":"Matrine inhibits invasion and migration of gallbladder cancer via regulating the PI3K/AKT signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-25 08:44:37","doi":"10.21203/rs.3.rs-4137130/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-04-29T09:12:52+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-25T14:31:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"1f79b625-8b9e-498d-b7ef-273517f769a8","date":"2024-04-25T12:34:37+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-19T07:50:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"b922550a-d152-4bd3-bae1-673c13253b11","date":"2024-04-19T04:25:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"7e49e573-b12d-4479-aebe-2b9f220d6632","date":"2024-04-01T13:11:29+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-03-21T14:06:58+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-03-21T07:05:43+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-21T07:05:43+00:00","index":"","fulltext":""},{"type":"submitted","content":"Naunyn-Schmiedeberg's Archives of Pharmacology","date":"2024-03-20T12:31:24+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"naunyn-schmiedebergs-archives-of-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nsap","sideBox":"Learn more about [Naunyn-Schmiedeberg's Archives of Pharmacology](https://www.springer.com/journal/210)","snPcode":"210","submissionUrl":"https://submission.nature.com/new-submission/210/3","title":"Naunyn-Schmiedeberg's Archives of Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6f97abb8-eb80-4b98-a6cf-0cf14df01769","owner":[],"postedDate":"March 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-05-13T11:08:22+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-25 08:44:37","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4137130","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4137130","identity":"rs-4137130","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}