Surveillance of seasonal respiratory viruses among Chilean patients during the COVID-19 pandemic

Surveillance, respiratory viruses, SARS-CoV-2, Influenza virus, RSV, Rhinovirus 28 29 30 31 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. The Study 32 SARS-CoV-2 has generated over 122 million cases worldwide. Non-pharmaceuticals 33 interventions such as confinements and lockdowns started in Chile on March 18th 2020. 34 In Europe, confinements and lockdowns have been accompanied by a decrease in the 35 circulation of other respiratory viruses such as Influenza A virus(IAV), Influenza B 36 virus(IBV) or respiratory syncytial virus(RSV) (1). Although changes i n circulation 37 patterns of respiratory viruses ha ve been reported, limited information regarding the 38 southern hemisphere is available where the SARS -CoV-2 pandemic merged with the 39 winter season. We conducted viral surveillance of respiratory viruses and we evaluated 40 their presence and establishing whether they were co-circulating with SARS-CoV-2. 41 Few south hemisphere countries reported the same pattern than Europe where non-42 pharmaceutical measures began before the winter season (2, 3) but to the best to our 43 knowledge, no report has been generated containing information from Chile. Here, we 44 collected 800 nasopharyngeal-swabs samples (NSS) from 13 health care centers 45 belonging to the north area of Santiago, Chile, between April 1st to July 31st, 2020 (Figure 46 1). All samples were collected from patients with at least one COVID-19 symptoms. 400 47 samples were determined as positive for SARS -CoV-2. 64% percent of SARS -CoV-2 48 positive individuals showed age range between 23 -57 years. In addition, women had a 49 significant incidence of positive cases, corresponding to 59% in age range group (Figure 50 2). 51 Next, based on geographic location we divided the samples in 3 groups (A, B and C) 52 Figure 1. Location (A) contains the highest number of SARS -CoV-2 cases, contributing 53 more than 50% of the positive samples analyzed in this study (Figure 1). This high 54 positivity could be explained by the population density of location A, which contains at 55 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint least 4-fold more inhabitants than locations B and C (Figure 1). Nevertheless, the health 56 centers located in B presented positivity rates higher than 61% for SARS-CoV2 (Table 1), 57 except for sub-locations 9 and 10 (Figure 1), where no positive samples were obtained 58 in the period analyzed. Location C is farthest location form downtown, however, still has 59 a positivity of 54.8% indicating a homogeneous distribution of SARS-CoV-2. 60 Taken together, our data show a high frequency of positive samples throughout the 61 healthcare centers evaluated suggesting the population density as a risk factor for SARS-62 CoV-2 transmission since location A and B concentrates more population than location 63 C. These results demonstrate that the 2020 winter season in Santiago presented a high 64 incidence of SARS-CoV-2. 65 Then, w e sought to determine in all samples whether SARS-CoV-2 was co-circulating 66 with other respiratory viruses. We chose predominant respiratory viruses in Santiago 67 (winter season) , such as : IAV, IBV, RSV and human rhinovirus (HRV) (Table 1 ). 68 Adenovirus, Parainfluenza and Metapneumovirus were not evaluated since they are 69 considered all -year viruses (4). The results show ed three samples with co-infection 70 between IAV and SARS-CoV-2 (Table 1). This is congruent to recent studies in Ecuador 71 and brazil showing complete decrease of IAV (5, 6). Despite the co -circulation or co-72 infection between IAV and SARS-CoV-2 observed, we could not detect RSV or IBV in the 73 SARS-CoV-2 positive samples . These results suggest an impact of the non-74 pharmaceutical interventions in the circulation of seasonal viruses , as previously 75 reported in Korea and Hong Kong (7, 8). Next, we evaluated the presence of IAV, IBV and 76 RSV in the samples reported as negative for SARS-CoV-2 where five positive samples for 77 IAV and no positive samples for IBV or RSV were detected, suggesting a circulation of 78 these viruses below 1% considering the amount of samples evaluated (Table 1). This is 79 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint lower than the information from the northern hemisphere where a range between 2-80 10% has been reported (9, 10) . Taken together, these results suggest a lower co-81 circulation of IAV with SARS-CoV-2 and co-circulation below the level of detection of this 82 study for SARS-CoV-2 together with IBV or RSV. 83 Finally, we focused on HRV, responsible for more than 50% of the cold-like illnesses, with 84 a high preponderance to coinfection with other respiratory viral pathogens (11). 85 Furthermore, HRV was the predominant virus after SARS -CoV-2 detected either 86 cocirculating with SARS -CoV-2 or circulating alone (9). The presence of HRV was 87 assessed, showing that 0.25% of the samples were co-infected SARS-CoV-2/HRV. On the 88 other hand, the HRV co-circulation was 0.8% (Table 1). These results establish HRV co-89 circulation and the co-infection with SARS -CoV-2. Taken together, these results 90 demonstrate the displacement of seasonal respiratory viruses due to the presence of 91 SARS-CoV-2. Despite of this displacement , IAV and HRV are still able to keep 92 cocirculating together with SARS -CoV-2 but to a considerably lesser extent in 93 comparison with previous winter seasons. 94 95

96 To gain insights into the potential co -circulation of the most relevant seasonally 97 circulating respiratory viruses together with SARS -CoV-2, a fact on going COVID-19 98 pandemic was that the vast majority of the SARS -CoV-2 testing during the April -July 99 period was indicated only with the presence of symptoms , we arbitrarily selected 200 100 samples per month (April to July) for a total of 800 NSS from 13 health care centers 101 located in the north zone of Santiago, Chile. 102 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint We detected a high positivity rate by health care center between 30,4%-72% and we 103 observed at least twice co-infections between SARS-CoV-2/IAV or SARS-CoV-2/HRV and 104 no co-infections with IBV and RSV, which is in agreement with previously reported data 105 including the southern hemisphere (5,12). Furthermore, IAV and HRV were detected 106 from negative SARS -CoV-2 samples, whereas no presence of IBV or RSV was obtained 107 even from the negative SARS -CoV-2 samples ( Table 1). These results demonstrate the 108 displacement of the predominant seasonal respiratory viruses, which have an essential 109 impact during the winter season caused by the high circulation rate of SARS-CoV-2. A 110 similar phenomenon was observed after the 2009 Influenza A (H1N1) pandemic, which 111 generated a decrease of RSV and IAV H3N2 infections (13). The reduction or absence of 112 IAV, IBV or RSV observed in this study can be explained by the non -pharmaceutical 113 interventions such as confinement and lockdowns established before the beginning of 114 the winter season in March 2020 . A previous report showed that SARS -CoV-2 could 115 replace within three weeks the seasonal respiratory viruses circulati ng (1), while that 116 HRV co-infections are one of the most common ly observed. However, the impact that 117 HRV infection co-infecting with other respiratory viruses is still unclear due to 118 inconsistencies among different studies (11). The effect of HRV in SARS-CoV-2 infection 119 and the clinical outcome is still unknown. 120 Considering that the vast majority of the SARS-CoV-2 testing during the April-July period 121 was indicated only with the presence of symptoms, potential bacterial infections or co-122 infections cannot be ruled out in this study. The presence of bacterial infections during 123 the SARS -CoV-2 pandemic has been previously reported (14-16). A previous study 124 identified S. Pneumoniae, K. pneumoniae and H. influe nza among the bacteria 125 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint cocirculating with SARS -CoV-2 (16). However, the detection of bacteria is beyond the 126 scope of the study 127 In conclusion, the data shows the impact of SARS -CoV-2 over the co-circulation of 128 seasonal respiratory viruses like IAV, IBV, and RSV in Chile. Our results suggest that the 129 emergence of SARS -CoV-2 in addition with different non -pharmaceutical measures 130 adopted worldwide have a detrimental impact on the circulation at least of seasonal 131 respiratory viruses. Furthermore, our data allow us to foresee t he circulation of 132 respiratory viruses in the 2021 winter season in the southern hemisphere. 133 134 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint Conflict of interest 135 The authors declare that there are no conflicts of interest associated with this work 136 137 Ethical statement 138 The study described here was approved by the Ethic s Committee of the Faculty of 139 Medicine at Universidad de Chile (Project Nº 036-2020). The samples were de-identified 140 and not considered as human samples. 141 142 Acknowledgments and Funding 143 The authors are supported by Instituto Antártico Chileno (INACH) RT_35-19 (GB-P), ANID 144 Chile through Fondecyt grants Nº 11200228 (GB) 1181656 (AG), 1190156 (RS -R), 145 1180798 (FV-E); Postdoctoral fellowship N° SECTEI/138/2019 from Mexico City (LA-P). 146 Authors would like to thank the Science , Technology, Knowledge and Innovation 147 Ministry of Chile for articulating and coordinating support from the scientific 148 community. Also, we want to thank the diagnostic group of the University of Chile 149 150 Authors contributions. 151 Conceptualization: LAP, CJC and GB, Data curation: LAP, RT, PA, AG, FV-E and GB, Formal 152 analysis: LAP and GB, Funding acquisition: GB , Investigation: LAP, RT, PA, SV and GB , 153 Methodology: LAP, CJC, FAV-E, AG, RS-R and GB, Project administration: LAP, CJC, FV-E, 154 AG, RS-R and GB. 155 Supervision: LAP, FAV -E, AG, RS -R and GB , Validation: LAP, CJC, and GB , Visualization: 156 LAP, CJC, and GB , Writing-original & draft: CJC, and GB, Writing-review & editing: LAP, 157 CJC, FAV-E, AG, RS-R and GB, All authors approved the final version of the manuscript. 158 Gonzalo Barriga had full data access to all data in this study and takes complete 159 responsibility for the integrity of the data and the accuracy of the data analysis. 160 161 Transparency statement 162 Gonzalo Barriga affirms that this manuscript is an honest, accurate, and transparent 163 account of the study being reported; that no important aspects of the study have been 164 omitted; and that any discrepancies from the study as planned have been explained 165 166 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint Data availability statement 167 The authors confirm that the data supporting the findings of this study and its 168 supplementary materials. 169 170 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint

171 172 1. Leuzinger K, Roloff T, Gosert R, Sogaard K, Naegele K, Rentsch K, et al. 173 Epidemiology of SARS -CoV-2 Emergence Amidst Community -Acquired Respiratory 174 Viruses. J Infect Dis. 2020 Jul 29. 175 2. Ortiz-Prado E, Simbana-Rivera K, Barreno LG, Diaz AM, Barreto A, Moya no C, et 176 al. Epidemiological, socio-demographic and clinical features of the early phase of the 177 COVID-19 epidemic in Ecuador. PLoS Negl Trop Dis. 2021 Jan;15(1):e0008958. 178 3. Goes LGB, Zerbinati RM, Tateno AF, de Souza AV, Ebach F, Corman VM, et al. 179 Typical epidemiology of respiratory virus infections in a Brazilian slum. J Med Virol. 2020 180 Aug;92(8):1316-21. 181 4. Moriyama M, Hugentobler WJ, Iwasaki A. Seasonality of Respiratory Viral 182 Infections. Annu Rev Virol. 2020 Mar 20. 183 5. Yue H, Zhang M, Xing L, Wang K, Rao X, Liu H, et al. The epidemiology and clinical 184 characteristics of co -infection of SARS -CoV-2 and influenza viruses in patients during 185 COVID-19 outbreak. J Med Virol. 2020 Jun 12. 186 6. Konala VM, Adapa S, Naramala S, Chenna A, Lamichhane S, Garlapati PR, et al. A 187 Case Series of Patients Coinfected With Influenza and COVID -19. J Investig Med High 188 Impact Case Rep. 2020 Jan-Dec;8:2324709620934674. 189 7. Cowling BJ, Ali ST, Ng TWY, Tsang TK, Li JCM, Fong MW, et al. Impact assessment 190 of non-pharmaceutical interventions against coronavirus disease 2019 and influenza in 191 Hong Kong: an observational study. Lancet Public Health. 2020 May;5(5):e279-e88. 192 8. Choe YJ, Lee JK. The Impact of Social Distancing on the Transmission of Influenza 193 Virus, South Korea, 2020. Osong Public Health Res Perspect. 2020 Jun;11(3):91-2. 194 9. Nowak MD, Sordillo EM, Gitman MR, Paniz Mondolfi AE. Co -infection in SARS -195 CoV-2 infected Patients: Where Are Influenza Virus and Rhinovirus/Enterovirus? J Med 196 Virol. 2020 Apr 30. 197 10. Mutnal MB, Arroliga AC, Walker K, Mohammad A, Brigmon MM, Beaver RM, et 198 al. Early trends for SARS-CoV-2 infection in central and north Texas and impact on other 199 circulating respiratory viruses. J Med Virol. 2020 May 15. 200 11. Jacobs SE, Lamson DM, St George K, Walsh TJ. Human rhino viruses. Clin 201 Microbiol Rev. 2013 Jan;26(1):135-62. 202 12. Wu X, Cai Y, Huang X, Yu X, Zhao L, Wang F, et al. Co -infection with SARS-CoV-2 203 and Influenza A Virus in Patient with Pneumonia, China. Emerg Infect Dis. 2020 204 Jun;26(6):1324-6. 205 13. Yang L, Chan KH, Suen LK, Chan KP, Wang X, Cao P, et al. Impact of the 2009 H1N1 206 Pandemic on Age-Specific Epidemic Curves of Other Respiratory Viruses: A Comparison 207 of Pre-Pandemic, Pandemic and Post-Pandemic Periods in a Subtropical City. PLoS One. 208 2015;10(4):e0125447. 209 14. Langford BJ, So M, Raybardhan S, Leung V, Westwood D, MacFadden DR, et al. 210 Bacterial co-infection and secondary infection in patients with COVID -19: a living rapid 211 review and meta-analysis. Clin Microbiol Infect. 2020 Jul 22. 212 15. Lehmann CJ, Pho MT, Pitr ak D, Ridgway JP, Pettit NN. Community Acquired Co -213 infection in COVID -19: A Retrospective Observational Experience. Clin Infect Dis. 2020 214 Jul 1. 215 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint 16. Zhu X, Ge Y, Wu T, Zhao K, Chen Y, Wu B, et al. Co -infection with respiratory 216 pathogens among COVID-2019 cases. Virus Res. 2020 Aug;285:198005. 217 218 219 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint 220 Figure 1: Geographical distribution of the samples analyzed in this study. Distribution of 221 the thirteen-health care center from where the samples were obtained. The figure 222 shows the number of samples by health care center (black number below white circle). 223 Red flag shows health cares center with SARS-CoV-2 positive cases, green flag shows 224 health cares with SARS -CoV-2 negative cases, the human shape indicate population by 225 location (A, B and C). 226 227 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint Table 1.- Co-circulation and co-infection of seasonal respiratory viruses together with 228 SARS-CoV-2 in the Northern area of Santiago, Chile. 229 230 Location Health care center* SARS-CoV-2 IAV IBV RSV HRV SARS-CoV-2/ IAV SARS-CoV- 2/ HRV A 1 82/140 (58.6%) 2/140 0 0 2/140 0 1/140 A 2 43/89 (49.4%) 0 0 0 1/89 0 0 A 3 28/76 (38.4%) 0 0 0 0 0 0 A 4 57/117 (47.9%) 2/117 0 0 0 2/117 0 A 5 9/13 (69.2%) 0 0 0 0 0 0 B 6 87/134 (64.9%) 1/134 0 0 0 0 0 B 7 12/22 (54.56%) 0 0 0 0 0 0 B 8 48/82 (58.5%) 0 0 0 1/82 0 0 B 9 0/28 1/28 0 0 0 0 0 B 10 0/40 1/40 0 0 0 0 0 C 11 9/14 (64.3%) 0 0 0 0 0 0 C 12 7/23 (30.4%) 0 0 0 1/23 0 1/23 C 13 18/25 (72%) 0 0 0 1/40 0 0 231 * This study includes a total cohort of 800 individuals 232 233 234 235 236 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint 237 238 Figure 2.- Number distribution of COVID-19 cases according to age group and sex. from 239 April 1st to July 31st (2020) at Santiago of Chile. 400 patients are considered positive for 240 SARS-CoV-2; however, three patients did not provide any information about age and 241 gender. In red is shows female gender and in blue is shows male gender. The numbers 242 in the columns indicate SARS-CoV-2 positive cases by month. 243 244 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint

245 Sample selection 246 247 All samples in this study were obtained with nasopharyngeal swabs come from 248 suspected Chilean population infected with SARS-CoV-2 in the north of Santiago de Chile 249 from different health centers (figure 1). The samples were collected in 2 mL of RNA -250 shield media (GenoSUR) and store at room temperature until its analysis for SARS-CoV-251 2 detection. 252 RNA extraction and Identification of respiratory viruses by RT-qPCR 253 The RNA extraction was made using the Total RNA Purification Kit (Norgen Biotek CORP); 254 following the manufacturing procedure, the RNA was a sto re at -80°C, which was used 255 to perform RT-qPCR. 256 All samples were analyzed using a specific primer (Supplementary table 1) for SARS-CoV-257 2, IAV, IBV, RSV, and HRV. All sequences have been validated, and their use is a typical 258 procedure to detect respiratory viruses from the World Health Organization (WHO). The 259 viral genome detection was made using LightCycler® Multiplex RNA Virus Master 260 (Roche) following the manufacturing procedure. The amplification and analysis plot was 261 made in a QuantStudio3 Real Time PCR System 96 wells (Thermo Fisher Scientific). The 262 HRV and IBV detection was performed by RT -PCR final point using specific primers, the 263 retrotranscription step was made using SuperScript IV Reverse Transcriptase (Thermo 264 Fisher Scientifics) and PCR was using GoTaq® DNA polymerase (Promega), the genome 265 of HRV was visualized in agarose – Seakem LE Agarose (LONZA) at 2% applying a voltage 266 of 80 Volts for 30 minutes. 267 268 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint 269 270 271 272 273 274 275 Supplementary Table 1.- Primers Sequence for SARS-CoV-2, IAV, IBV, RSV and HRV 276 Virus Forward Reverse SARS-CoV-2 5’ ATGAGCTTAGTCCTGTTG 3’ 5’ CTCCCTTTGTTGTGTTGT 3’ IAV, 5’ GACCRATCCTGTCACCTCTGA C 3’ 5’ AGGGCATTYTGGACAAAKCGTCTA 3’ IBV, 5’ GGAGCAACCAATGCCAC 3’ 5’ GTKTAGGCGGTCTTGACCAG-3’ RSV 5’ AACAGATGTAAGCAGCTCCGTTATC 3’ 5’- CGATTTTTATTGGATGCTGTACATTT 3’ aHRV 5´CAAGCACTTCTGTTTCCC 3´ 5´CACGGACACCCAAAGTAGT 3´ 277 278 279 280 281 282 283 284 285 286 287 . CC-BY-NC 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) The copyright holder for this preprint this version posted July 22, 2021. ; https://doi.org/10.1101/2021.07.16.21260648doi: medRxiv preprint