The strand-selective regulation of miR-155 in response to lipopolysaccharide by CELF2, FUBP1 and KSRP proteins

preprint OA: closed
📄 Open PDF Full text JSON View at publisher

Abstract

The microRNA-155 exists in two forms, miR-155-5p and miR-155-3p, produced from either strand of the double-stranded precursor of miR-155. The more abundant and better-studied miR-155-5p has been implicated in many biological processes with dysregulated expression occurring in human diseases. miR-155-5p plays an essential role in supporting inflammatory responses in macrophages. Activating macrophages with lipopolysaccharide elevates miR-155-5p, while the anti-inflammatory cytokine interleukin-10 reduces miR-155-5p levels. Recently, miR-155-3p has also been suggested to participate in macrophage function, although its specific role is unclear. We found that LPS stimulation of macrophages results first in the elevation of miR-155-3p levels, followed by an increase in miR-155-5p levels. In this paper, we explore the mechanisms involved in the maturation of the pre-miR-155 to either miR-155-5p or miR-155-3p. We describe the contribution of three RNA-binding proteins, CELF2, FUBP1 and KSRP, to pre-miR-155 processing. Our data suggests CELF2 regulates miR-155-5p/miR-155-3p strand selection. FUBP1 may support the expression of miR-155-3p for specific subcellular functions, while KSRP appears to inhibit both miR-155-5p and miR-155-3p maturation without altering the relative expression of each strand.
Full text 78,554 characters · extracted from preprint-html · click to expand
The strand-selective regulation of miR-155 in response to lipopolysaccharide by CELF2, FUBP1 and KSRP proteins | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results The strand-selective regulation of miR-155 in response to lipopolysaccharide by CELF2, FUBP1 and KSRP proteins View ORCID Profile Jeff S. J. Yoon , Abdulwadood Baksh , Thomas C. Chamberlain , View ORCID Profile Alice L-F Mui doi: https://doi.org/10.1101/2025.03.05.641704 Jeff S. J. Yoon 1 Immunity and Infection Research Centre, Vancouver Coastal Health Research Institute , Vancouver, Canada 2 Department of Surgery, University of British Columbia , Vancouver, Canada 3 Department of Biochemistry and Molecular Biology, University of British Columbia , Vancouver, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jeff S. J. Yoon Abdulwadood Baksh 3 Department of Biochemistry and Molecular Biology, University of British Columbia , Vancouver, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Thomas C. Chamberlain 1 Immunity and Infection Research Centre, Vancouver Coastal Health Research Institute , Vancouver, Canada 2 Department of Surgery, University of British Columbia , Vancouver, Canada 3 Department of Biochemistry and Molecular Biology, University of British Columbia , Vancouver, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site Alice L-F Mui 1 Immunity and Infection Research Centre, Vancouver Coastal Health Research Institute , Vancouver, Canada 2 Department of Surgery, University of British Columbia , Vancouver, Canada 3 Department of Biochemistry and Molecular Biology, University of British Columbia , Vancouver, Canada Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Alice L-F Mui For correspondence: alice.mui{at}ubc.ca Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract The microRNA-155 exists in two forms, miR-155-5p and miR-155-3p, produced from either strand of the double-stranded precursor of miR-155. The more abundant and better-studied miR-155-5p has been implicated in many biological processes with dysregulated expression occurring in human diseases. miR-155-5p plays an essential role in supporting inflammatory responses in macrophages. Activating macrophages with lipopolysaccharide elevates miR-155-5p, while the anti-inflammatory cytokine interleukin-10 reduces miR-155-5p levels. Recently, miR-155-3p has also been suggested to participate in macrophage function, although its specific role is unclear. We found that LPS stimulation of macrophages results first in the elevation of miR-155-3p levels, followed by an increase in miR-155-5p levels. In this paper, we explore the mechanisms involved in the maturation of the pre-miR-155 to either miR-155-5p or miR-155-3p. We describe the contribution of three RNA-binding proteins, CELF2, FUBP1 and KSRP, to pre-miR-155 processing. Our data suggests CELF2 regulates miR-155-5p/miR-155-3p strand selection. FUBP1 may support the expression of miR-155-3p for specific subcellular functions, while KSRP appears to inhibit both miR-155-5p and miR-155-3p maturation without altering the relative expression of each strand. Introduction MicroRNAs (miRNAs) are short regulatory non-coding RNAs that post-transcriptionally regulate the expression of genes through sequence-specific targeting of mRNA 1 . MiR-155 is among the most extensively studied miRNAs due to its involvement in various biological and pathological processes, including immunity, inflammation and cancer 2 – 8 . The MIR155HG locus encodes miR-155, and the primary transcript of miR-155 ( pri-miR-155 ) undergoes Drosha-mediated cleavage to the precursor of miR-155 ( pre-miR-155 ) 9 . Pre-miR-155 can undergo processing into two alternate forms, the dominant strand miR-155-5p and the non-dominant strand miR-155-3p 10 , depending on which strand from the pre-miR-155 is selected. The selected strand is loaded onto the RNA-induced silencing complex (RISC) and becomes the guide strand, while the other strand undergoes degradation 11 . The 5p and 3p strands have different seed sequences and thus target different mRNAs 12 . Although miR-155-5p is the most abundant and studied strand, miR-155-3p was recently shown to have biological functions 13 – 15 . Furthermore, the dysregulated expression of miR-155-3p alone has been observed in certain cancers and diseases 16 – 21 . Activating macrophage cells is essential in the human host’s defence against pathogens 22 , 23 . We 24 and other 3 , 4 , 25 showed that activation of macrophage cells with lipopolysaccharide (LPS), a cell wall component of gram-negative bacteria, induced expression of miR-155-5p. miR-155-5p was the only strand studied and required for macrophage production of inflammatory cytokines such as tumour necrosis factor-alpha (TNFα). However, persistent macrophage activation can become harmful, leading to inflammatory diseases, cardiovascular diseases and cancers 26 – 28 . Consequently, activated macrophages also release anti-inflammatory cytokines, namely interleukin-10 (IL10), to attenuate the pro-inflammatory effects of macrophages activated by LPS 29 . IL10 is a pleiotropic cytokine characterized initially as a cytokine synthesis inhibitory factor produced by murine Th T-cells to prevent cytokine production by murine Th T-cells 29 . However, deactivating the activated macrophages is its major in vivo function 30 . IL10 receptor (IL10R) signalling uses both the Signal Transducer and Activator of Transcription 3 (STAT3) 31 – 33 and Src Homology 2 domain-containing Inositol-5 Phosphatase 1 (SHIP1)-dependent 24 , 31 , 34 pathways to deactivate macrophages 24 , 32 , 34 – 36 . We previously reported that SHIP1 could form a complex with STAT3 (SHIP1:STAT3) in response to IL10R signalling or through the exposure of cells to small molecules that bind to induce a conformational change in SHIP1 31 . The formation of the SHIP1:STAT3 complex is sufficient to inhibit macrophage production of TNFα. We also showed that IL10 inhibition of miR-155-5p required SHIP1 and STAT3 24 . We examined how IL10 interferes with the LPS-induced expression of miR-155-5p. We found that IL10 inhibits the maturation of pre-miR-155 into mature miR-155-5p 24 . We then used mass spectrometry to identify proteins that bind to pre-miR-155 to characterize the mechanism by which IL10R signalling inhibits pre-miR-155 maturation 37 . CUGBP Elav-Like Family member 2 (CELF2) protein is an RNA-binding protein known for its post-transcriptional regulation of mRNAs through alternative splicing of mRNAs 38 , 39 or polyadenylation 40 . CELF2 and its family member CELF1 also participate in microRNA regulation 41 . Treiber et al . showed that CELF2 and CELF1 proteins bind to the stem of pre-miR-140 and inhibit its maturation to miR-140 41 . In our previous study, we found that CELF2 protein associates with pre-miR-155 in an IL10-dependent manner, and deletion of CELF2 enhanced LPS-induced expression of miR-155-5p, suggesting CELF2’s role in inhibiting miR-155-5p expression 37 . Recently, Simmonds et al. showed that LPS stimulation also leads to the early expression of miR-155-3p, followed by miR-155-5p at later time points 42 . Thus, in the current study, we examined whether CELF2 and two other proteins we identified to bind pre-miR-155, Far Upstream Element Binding Protein 1 ( FUBP1 ) and KH-type Splicing Regulatory Protein ( KSRP ) 37 , 43 , might be involved in regulating miR-155-3p and miR-155-5p levels, especially the switch from expressing the miR-155-3p to the miR-155-5p strand. FUBP1 belongs to a family of RNA-binding proteins (FUBP family), including KSRP 43 . Previously, studies implicated KSRP in controlling miR-155-5p expression in macrophages 25 , 44 and dendritic cells 45 . Ruggiero et al. reported that pre-miR-155 co-immunoprecipitated with KSRP and depletion of KSRP impaired the expression of mature miR-155-5p while simultaneously causing the accumulation of pri-miR-155 and pre-miR-155 25 . KSRP, also known as Far Upstream Element Binding Protein 2 (FUBP2), binds to the terminal loop of pre-miR-155 via four distinct hnRNPK-Homology (KH) domains and promotes its maturation 25 , 46 , 47 . We now describe the roles of CELF2, FUBP1 and KSRP in controlling the expression of miR-155-5p and 3p. We used CRISPR-Cas9 mediated silencing to construct cells deficient in CELF2, FUBP1, or KSRP. Our data suggest that CELF2 is involved in the timing of miR-155-3p expression and affects the overall strand ratio of miR-155-3p and miR-155-5p. FUBP1 specifically inhibits miR-155-3p, while KSRP inhibits the expression of both strands. Finally, we show that FUBP1 and KSRP proteins interact with pre-miR-155 via its KH3 domain. These data provide insights into dysregulated miR-155-5p and miR-155-3p observed in certain diseases. Results LPS induces the association of FUBP1 to pre-miR-155 We and others have shown that IL10 inhibits LPS-induced miR-155-5p expression in macrophage cells 24 , 37 . We further showed that IL10 inhibits the maturation of pre-miR-155 to miR-155-5p 24 and that the RNA-binding protein CELF2 contributes to the process 37 . However, our mass spectrometry-based examination of pre-miR-155-associated proteins also identified FUBP1 and KSRP as other proteins that might interact with pre-miR-155 in a stimulus (LPS ± IL10) dependent manner 37 . We analyzed pre-miR-155 pull-down samples for CELF2, FUBP1 and KSRP protein to follow up on the mass spectrometry identified protein candidates. As described in our previous study 37 , the amount of CELF2 detected in the pre-miR-155 pull-down samples is the greatest in the LPS + IL10 samples ( Fig. 1 ). LPS stimulation of the cells also increases the amount of FUBP1 protein in the pre-miR-155 pull-down samples; the addition of IL10 increases this further. KSRP levels in the pre-miR-155 pull-down samples appear to rise with LPS and further with IL10 addition. Still, these changes are not statistically significant ( Fig. 1 ). The levels of all three proteins in the total cell lysate remained constant in all stimulation conditions, suggesting that the association of these proteins with pre-miR-155 might represent post-transcriptional modifications of those proteins, which alters their ability to bind pre-miR-155. Download figure Open in new tab Fig. 1. Increased interaction of FUBP1 protein with pre-miR-155 in response to LPS stimulation. RAW264.7 cells were transfected with biotinylated pre-miR-155 oligonucleotide and stimulated with LPS ± IL10 for 2 hours before collecting the pull-down samples. Expression levels of CELF2, FUBP1 and KSRP protein interacting with pre-miR-155 oligonucleotide were determined by immunoblotting. The graph shows the CELF2, FUBP1 and KSRP band intensities in the pull-down sample normalized to the same protein in total cell lysate. One-way ANOVA with Tukey’s correction calculated the significance of the difference between the stimulations. ** p < 0.01, * p < 0.05, ns = not significant. The data are representative of 5 experiments. CELF2, FUBP1 and KSRP deficiency differentially affects miR-155-5p and miR-155-3p expression We 24 and others have shown that IL10 reduces miR-155-5p expression in LPS-stimulated macrophages 24 , 25 , 37 . To investigate the role of CELF2, FUBP1 and KSRP in LPS and IL10 action in these pathways, we used CRISPR-Cas9-mediated targeting to knock down the expression of each of the three proteins in RAW264.7 cells. We transduced CRISPR-Cas9 expressing RAW264.7 cells with lentiviruses harbouring a Blasticidin resistance gene and a guide RNA (gRNA) sequence targeting either FUBP1 or KSRP, as we described previously for CELF2 KD cells 37 . Cells were selected with 10 µg/mL Blasticidin, and the bulk drug-resistant population was used for experiments. We call CRISPR-Cas9/gRNA transduced cells “KD” for knockdown rather than KO (for knockout) because we use a bulk, uncloned population, which may contain cells with different degrees of target gene deletion. We use a bulk population to reduce the impact of insertional mutagenesis effects, which the use of cell clones would magnify. As illustrated in Fig. 2 , FUBP1 KD and KSRP KD cells express significantly less FUBP1 or KSRP protein than the control RAW264.7 cell. Download figure Open in new tab Fig. 2. Generation of FUBP1 and KSRP knockdown cells by CRISRP-Cas9 mediated gene silencing. RAW264.7/Cas9 cells transduced with FUBP1 sgRNA or KSRP sgRNA were treated with 2 µg/mL of doxycycline for 48 hours to induce knockdown of FUBP1/KSRP proteins. FUBP1 and KSRP protein expression was determined by immunoblotting. Data plotted represents FUBP1 and KSRP protein band intensity normalized to GAPDH. One-Way ANOVA with Tukey’s correction determined the comparison indicated with braces. **** p < 0.0001, *** p < 0.001, ns = not significant. The data are representative of 3-5 experiments. After confirming the reduction of FUBP1 and KSRP proteins in the KD cells, we stimulated the cells with LPS ± IL10 for 0, 2 and 4 hours, isolated RNA, and quantified the levels of miR-155-5p and miR-155-3p by qPCR. Fig. 3A shows every cell’s data normalized to the LPS-stimulated sample (2 hours) of the control RAW264.7 cells, allowing comparison among all the cells. Fig 3B graphs the same data in a time-course format for each cell type. Fig 3B shows that in RAW264.7 cells, the LPS-stimulated miR-155-3p levels are detectable at 2 hours and plateaus by 4 hours. In contrast, the LPS-stimulated miR-155-5p level significantly increases only by 4 hours and continues to rise past 4 hours (data not shown). As we described earlier 37 , IL10 inhibited the expression of miR-155-5p at 4 hours but not at 2 hours. IL10 inhibited the expression of miR-155-3p at 4 hours ( Fig 3A and Fig 3B ), but the inhibition at 2 hours was statistically significant when the comparison was within just the RAW264.7 cells ( Fig 3B ). Download figure Open in new tab Fig. 3. CELF2, FUBP1 and KSRP deficiency alters the expression of miR-155-5p and miR-155-3p in response to LPS ± IL10 stimulation. FUBP1 KD, CELF2 KD, KSRP KD or the control RAW264.7 cells were stimulated with 1 ng/mL LPS ± 1 ng/mL of IL10 for ( A ) 2 and 4 hours before total RNA extraction. The expression levels of miR-155-5p and miR-155-3p were determined by qPCR and normalized to snoRNA202 levels. The data plotted represents the expression levels of miR-155-5p and miR-155-3p levels normalized to the 2-hour LPS-stimulated control RAW264.7 cells. ( B ) The data from panel A were replotted as time courses for each cell type. miR-155-5p and miR-155-3p levels were normalized to the unstimulated sample of control RAW264.7 cells. Two-way ANOVA with Tukey’s correction determined the comparisons indicated with braces between different timepoints or cell type as * and the significance between stimulations as †. **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05, †††† p < 0.0001, ††† p < 0.001, †† p < 0.01, † p < 0.05, ns = not significant. The data are representative of 4 experiments. Plotting the ratio of miR-155-3p to miR-155-5p helps illustrate the change in the selection of miR-155-3p and miR-155-5p strands for expression. In RAW264.7 cells, LPS treatment increases the ratio of miR-155-3p to miR-155-5p ( Fig. 3A , rightmost graph), suggesting a strand selection of miR-155-3p strand over miR-155-5p. The miR-155-3p to miR-155-5p ratio is unchanged by IL10, suggesting IL10 controls miR-155 expression by inhibiting the general miR-155 maturation without altering the miR-155 strand selection. The LPS effect on the miR-155-3p to miR-155-5p ratio disappears by 4 hours. Knockdown of CELF2 protein enhanced miR-155-5p expression at 2 and 4 hours ( Fig. 3A ) compared to control RAW264.7 cells. miR-155-3p expression is slightly enhanced in CELF2 KD compared to RAW264.7 cells at 2 hours but reduced at 4 hours of LPS stimulation ( Fig. 3A ). Of note, CELF2 KD cells show a dramatic acceleration in the kinetics of miR-155-5p and miR-155-3p expression. Compared to the control and other cells, miR-155-5p expression in CELF2 KD cells appears to have already reached a plateau by 4 hours ( Fig 3B ). miR-155-3p expression peaked earlier at 2 hrs and decreased to basal expression level by 4 hours. Interestingly, the miR-155-3p/miR155-5p ratio in CEL2 KD at 2 and 4 hours ( Fig. 3A , right panel) significantly decreased compared to the control RAW264.7 cells. IL10 failed to inhibit the expression of either miR-155-5p or miR-155-3p in the CELF2 KD cells. The LPS-stimulated miR-155-3p/miR-155-5p ratio stays the same regardless of the addition of IL10. In FUBP1 KD cells, LPS-stimulated miR-155-5p expression is unchanged compared to its action in control RAW264.7 cells ( Fig. 3A ). In contrast, the level of miR-155-3p is enhanced, suggesting a selective role of FUBP1 in regulating miR-155-3p expression, but the overall ratio of miR-155-3p/miR-155-5p is unchanged. Like that observed in CELF2 KD cells, IL10 could not inhibit either miR-155-5p or miR-155-3p in FUBP1 KD cells. In the KSRP KD cells, miR-155-5p and miR-155-3p expression is significantly enhanced without a change in the relative expression. This elevation occurs without significant changes in pri-miR-155 or pre-miR-155 levels ( Supplementary Fig. 1 ). Unlike that observed in FUBP1 and CELF2 KD cells, IL10 could inhibit miR-155-5p and miR-155-3p in cells lacking KSRP. Expression of miR-155 target genes in CELF2, FUBP1 and KSRP KD cells To assess the biological relevance of the changes in miR-155-5p and miR-155-3p changes., we examined the levels of Arg2, (a validated miR-155-5p target) 48 , 49 ; and Apbb2 ( a predicted target of miR-155-3p) 50 , 51 and Myd88, (a target of both miR-155 strands) 52 , 53 . The expression of the miR-155 targets should be decreased in cells where miR-155 levels are increased compared to RAW264.7 cells and conversely increased in cells where miR-155 levels are decreased. As expected, Arg2 levels are lower in the CELF2 and KSRP KD cells ( Fig 4 ), where miR-155-5p is higher ( Fig 3A , 4-hour data). Apbb2 levels are higher ( Fig 4 ) in CELF2 KD cells, where miR-155-3p levels are lower ( Fig 3A , 4-hour data) than in RAW264.7 cells. As expected, myd88 levels are lower in all three KD cell types ( Fig 4 ) since either miR-155-5p or miR-155-3p strands are elevated in all three protein KD cells( Fig 3A ). Download figure Open in new tab Fig. 4. Expression of miR-155 target genes in CELF2 KD, FUBP1 KD, KSRP KD, or the control RAW264.7 cells. Cells were stimulated with 1 ng/mL of LPS 4 hours before total cell extraction. The expression levels of Arg2, Apbb2 and Myd88 were determined by qPCR and normalized to GAPDH levels. Two-way ANOVA with Tukey’s correction determined the comparisons indicated with braces. **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05, ns = not significant. The data are representative of 3 experiments. IL10 regulation of inflammatory cytokine production in CELF2, FUBP1, and KSRP KD cells Previously, we and others reported that miR-155 (miR-155-5p was assessed) deficiency increases LPS-induced inflammatory cytokine production 25 , 37 . Therefore, we examined IL10’s action on TNFα production in FUBP1 and KSRP KD cells. Cells were stimulated with LPS ± 0.5 ng/mL or 10 ng/mL IL10 for 1 hour, and TNFα levels in the culture supernatants were quantified by ELISA. Fig. 5 shows that in control RAW264.7 cells, IL10 inhibits LPS-induced TNFα expression in a dose-dependent manner. However, in FUBP1 KD cells, IL10 could not decrease LPS-induced TNFα levels at all the concentrations of IL10 tested. This impairment of IL10 action suggests FUBP1 is essential for IL10 inhibition of LPS-induced TNFα. We previously showed that CELF2 deficiency partially impaired IL10-dependent TNFα inhibition 37 . In contrast, the absence of KSRP protein resulted in higher LPS-stimulated TNFα production than in RAW264.7 cells, but IL10 could inhibit TNFα levels. Download figure Open in new tab Fig. 5. FUBP1 and KSRP deficiency alters the expression of TNFα in response to LPS ± IL10. FUBP1 and KSRP KD cells were stimulated with 1 ng/mL LPS ± indicated concentration of IL10 for 1 hour before collecting the cell culture supernatant. The level of TNFα in the supernatants was determined by ELISA. Two-Way ANOVA with Tukey’s correction determined the comparisons indicated with braces. **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05, ns = not significant. The data are representative of 3-5 experiments. SHIP1 and STAT3 dependence of miR-155-5p and miR-155-3p expression We previously showed that IL10 receptor signalling requires SHIP1 and STAT3 to inhibit miR-155-5p production in LPS-stimulated macrophages 24 , 34 . However, we had not examined the expression of the alternate miR-155 strand, miR-155-3p. Thus, we extracted peritoneal macrophages (perimacs) from SHIP1 or STAT3 wild type (WT) or knockout (KO) mice, rested the cells for 2 hours, stimulated the cells with LPS ± IL10 for 4 hours, isolated RNA, and quantified the levels of miR-155-5p and miR-155-3p. Fig. 6A shows the miR-155-5p and miR-155-3p expression in perimacs from STAT3 WT/KO (both C57Bl6 background) and SHIP1 WT/KO (both Balb/C background) mice 4 hours after LPS ± IL10 stimulation. The qPCR data were normalized to the LPS-stimulated WT sample to compare the expression in WT and KO cells. In STAT3 WT and KO perimacs, the basal and LPS-stimulated levels of miR-155-3p are similar in the corresponding sample of each cell type ( Fig. 6A ). However, LPS-stimulated levels of miR-155-5p are reduced in the STAT3 KO, and IL10 could not inhibit the expression of either miR-155-5p or miR-155-3p in STAT3 KO cells and instead increased their levels in STAT3 KO cells. The effects of STAT3 deficiency on LPS and IL10 regulation of miR-155-5p and miR-155-3p can also be seen when the qPCR gene expression data were normalized to each cell type’s LPS-stimulated sample ( Fig 6B ). Download figure Open in new tab Fig. 6. STAT3 and SHIP1 dependence of miR-155-5p and miR-155-3p expression at 4 hours. Expression level in STAT3 WT and KO, or SHIP1 WT and KO cells of miR-155-5p or miR-155-3p was determined by qPCR and normalized to snoRNA202 levels. (A) Data were plotted to represent the RNA expression normalized to the LPS-stimulated sample of the STAT3 WT. (B) The data in panel A was replotted with RNA expression normalized to each cell’s own LPS-stimulated sample. Two-way ANOVA with Tukey’s correction determined the comparison between the stimulations indicated with braces. **** p < 0.0001, *** p < 0.001, ** p < 0.01, ns = not significant. The data are representative of 3 experiments. For SHIP1, the LPS-stimulated expression of both miR-155-5p and miR-155-3p is decreased in the SHIP1 KO compared to the SHIP1 WT cells ( Fig. 6A ). To see if IL10 could inhibit the LPS-induced expression of miR-155 in the SHIP1 KO, we also normalized the RNA expression data to each cell’s own LPS-stimulated sample. As Fig. 6B shows, both miR-155-5p and miR-155-3p levels are inhibited by IL10 in SHIP1 KO cells, but the degree of inhibition is impaired compared to SHIP1 WT. These observations suggest that SHIP1 is required for IL10 inhibition of miR-155-5p and the LPS-induced expression of both miR-155-5p and miR-155-3p. We then examined the kinetics of miR-155-5p and miR-155-3p expression at 0, 1, 2 and 4 hours ( Fig. 7 ). The qPCR data were normalized to the 0 hr time point of the appropriate WT cell control. In STAT3 WT cells stimulated with LPS, miR-155-3p rises rapidly and reaches a plateau at 2 hours, while miR-155-5p rises more slowly but continues to rise towards 4 hours. The presence of IL10 (LPS + IL10) reduced the levels of miR-155-3p but not miR-155-5p in STAT3 WT cells. The different miR-155-5p and miR-155-3p kinetics resemble those observed by Simmonds et al. in human peripheral blood-derived macrophages 42 . In STAT3 KO cells, miR-155-5p and miR-155-3p levels stimulated by LPS show similar kinetics to the STAT3 WT. Remarkably, the presence of IL10 (LPS + IL10) enhanced rather than inhibited the expression of both miR-155-5p and miR-155-3p. We did not look at longer time points because the effect of autocrine cytokines will contribute to gene expression at longer stimulation times. Download figure Open in new tab Fig. 7. Kinetics of miR-155-5p and miR-155-3p expression in STAT3/SHIP1 WT and KO cells. The expression level in SHIP1 WT and KO cells of miR-155-5p or miR-155-3p was determined by qPCR and normalized to snoRNA202 levels. (A) Kinetics of miR-155-5p and miR-155-3p expression with RNA normalized to the WT 0-hour sample. (B) The data plotted represents the comparison of LPS-stimulated miR-155 levels at 4 hours between different cell types. (C) The data plotted represents the ratio of miR-155-3p and miR-155-5p. Two-way ANOVA with Tukey’s correction determined the significance of the difference in values (if any) in the LPS ± IL10 stimulated sample at the same time point. **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05, ns = not significant. The data are representative of 3 experiments. In SHIP1 WT cells, LPS-stimulated miR-155-3p can be detected by 1 hour and continues to rise towards 4 hours. LPS induced high levels of miR-155-5p at 4 hours. In SHIP1 WT cells, IL10 inhibited the LPS-stimulated expression of miR-155-3p and miR-155-5p at all time points. For SHIP1 KO cells, the basal level of both miR-155 strands is elevated, and the LPS-induced miR-155-5p is significantly reduced compared to WT. The LPS-induced miR-155-3p levels are similar to those in SHIP1 WT cells; however, miR-155-3p can no longer be detected at 4 hours. IL10 was impaired in reducing miR-155-5p levels but completely failed to inhibit miR-155-3p levels at all time points. As Fig. 7A shows, the kinetics of both miR-155-5p and miR-155-3p in the SHIP1 WT cells are slightly delayed compared to those in STAT3 WT cells. SHIP1 WT cells also have considerably lower miR-155-5p levels ( Fig. 7B ) compared to STAT3 WT, and an miR-155-3p/miR-155-5p ratio is about twofold ( Fig. 7C ) higher than the STAT3 WT cells. Furthermore, STAT3 WT shows no difference in the ratio of miR-155 strands between LPS and IL10 stimulation, but SHIP1 WT shows a significant increase in the ratio in IL10 stimulation. This difference might reflect the different genetic backgrounds of the SHIP1 WT/KO (Balb/C) and STAT3 WT/KO (C57BL/6) mice. The KH3 domains of both FUBP1 and KSRP interact with pre-miR-155 The RNA-binding domains of the FUBP family of RNA-binding proteins have been studied 54 . Previous studies have shown that the RNA-binding protein KSRP interacts with pri-miR-155 and pre-miR-155 to regulate miR-155 expression 25 , 45 . KSRP and FUBP1 proteins have a conserved architecture of 4 tandem KH domains to interact with RNA/DNA 55 . However, KSRP mainly interacts with RNA via its third KH domain (KH3), and substituting the key GXXG residues of the KH domain with GDDG significantly decreased the interaction of KSRP with RNA 47 . Therefore, to test whether FUBP1 interacts with pre-miR-155 through its KH3 domain, we generated recombinant WT and KH3 domain GDDG mutants for FUBP1 and KSRP ( Fig. 8A ). We then measured the interaction of these recombinant proteins to pre-miR-155 using biolayer interferometry (BLI). Fig. 8B and 8C show that KSRP WT and FUBP1 WT interact with pre-miR-155, but the KH3 GDDG mutants of KSRP and FUBP1 do not. Download figure Open in new tab Fig. 8. The KH3 domain of KSRP and FUBP1 are essential for interacting with pre-miR-155. KSRP/FUBP1 WT or KSRP/FUBP1 KH3 GDDG mutant proteins were expressed and purified as described in the material and methods. (A) Coomassie Blue staining of the gel assessed the purity of the purified protein. (B) BLI biosensors loaded with biotinylated pre-miR-155 were dipped in wells containing KSRP WT, KSRP KH3 GDDG mutant, FUBP1 WT, FUBP1 KH3 GDDG mutant proteins for 10 minutes, followed by a dissociation step in the assay buffer for 20 minutes. (C) Data plotted to represent the BLI response of indicated proteins with biotinylated pre-miR-155. Unpaired Student’s t-test determined the comparison between the WT and KH3 GDDG mutant. **** p < 0.0001. The data are representative of 3-5 experiments. Discussion Most investigators have focused on studying miR-155-5p because it is the dominant miR-155 strand 3 , 6 , 7 , 35 . Simmonds et al. were the first to report that LPS-induced miR-155-3p is incorporated in RISC in human macrophages, indicating the non-dominant miR-155-3p is regulated and biologically functional 42 . The miR-155-3p expression peaks at earlier LPS stimulation (4 hours) and disappears by 24 hours 42 , 45 . In contrast, miR-155-5p levels do not rise until about 2-4 hours and remain detectable in higher numbers at 24 hours 42 , 45 . Therefore, dissecting the strand-specific control of miR-155-3p and miR-155-5p levels in the cells may provide further information on the mechanisms involved in host immune defence 56 . Moreover, the dysregulation of miR-155-3p has been reported in various cancer and disease cells. The dysregulated level of miR-155-3p in the cancer and disease cell may be due to increased expression of the MIR155HG gene 57 , increasing both miR-155-5p and miR-155-3p strands 58 – 61 . However, there are also cases where only the miR-155-3p is upregulated in the cancer and disease cells, indicating strand-specific control of miR-155-3p 13 , 15 , 62 , 63 . Furthermore, the two strands of miR-155 have different targets but overlapping targets 58 , 59 . Therefore, the ratio of the strands expressed and target availability may be important factors determining the overall effects of miR-155 dysregulation on cancer growth 64 and diseases 65 . Role of CELF2, FUBP1 and KSRP in controlling expression of miR-155-5p and miR-155-3p Our examination of the CELF2, FUBP1, and KSRP KD cells revealed different miR-155-5p and miR-155-3p expression patterns compared to the control RAW264.7 cells. (1) Without CELF2 protein, LPS-induced expression of miR-155-5p increases significantly compared to control RAW264.7 cells at 2 and 4 hours. In contrast, miR-155-3p is modestly increased at 2 hours and decreased compared to control RAW264.7 cells at 4 hours. The resulting decrease in the miR-155-3p/miR-155-5p ratio suggests that the CELF2 protein plays a role in strand switching to miR-155-3p from miR-155-5p ( Fig. 3 ). (2) Knocking down FUBP1 protein increased miR-155-3p expression, but the overall cellular ratio of miR-155-3p/miR-155-5p remains unchanged. This observation suggests that the FUBP1-mediated miR-155-3p molecules may have subcellular compartment/location-specific functions, as reported for other miRNAs 66 . (3) The absence of KSRP protein resulted in a substantial increase in the levels of both strands of miR-155. KSRP may thus be a general inhibitor of the miR-155 maturation process. Our previous studies showed that the CELF2 protein inhibits miR-155 maturation 37 , similar to the CELF2 function on miR-140 maturation 41 . However, our current studies showed that the CELF2 protein differentially regulates the miR-155 strands ( Fig. 3 and 4 ). Without CELF2 protein, miR-155-5p is enhanced, but miR-155-3p is reduced ( Fig. 3 and 4 ). We have also looked at the levels of the primary transcript of miR-155 (pri-miR-155) and the precursor of miR-155 (pre-miR-155) in these cells ( Supplementary Fig. 1 ). The pri-miR-155 and pre-miR-155 levels in CELF2 KD cells were indifferent to the control cell, stating that the change in miR-155 levels occurs at the stage of maturation of miR-155. These observations suggest that the CELF2 protein regulates miR-155-3p expression and is an essential strand-switching factor, choosing miR-155-3p over miR-155-5p at early time points by LPS stimulation. CELF2 protein has been described to possess anti-tumour functions, where low expression of CELF2 protein was detected in various cancer cells. Overexpression of CELF2 showed a reduction in the size of the tumour cells 67 – 70 . Interestingly, the levels of miR-155-5p and miR-155-3p in cancer cells have been reported to be predominantly upregulated 58 , 60 . A higher level of CELF2 protein may explain the high level of miR-155-3p in these cancer cells 53 , 58 , 60 , 64 . Therefore, future studies investigating the correlation between the miR-155-5p and miR-155-3p levels and CELF2 expression levels in various cancer types will provide more information on miR-155 regulation and how CELF2 protein contributes to it. Ruggiero et al. reported that KSRP binds pre-miR-155 and is required to process pre-miR-155 to miR-155-5p 25 . They showed that in the absence of KSRP protein, miR-155-5p levels are reduced, and miR-155-3p levels are increased, proposing the role of KSRP as a selective miR-155-5p regulator 25 . Our work partly agrees with data from Ruggiero et al., as KSRP KD shows an increased miR-155-3p level. However, our data show increased miR-155-5p levels at 4 hours of LPS stimulation. Our work suggests that the KSRP protein functions as a general inhibitor of the maturation of miR-155. Thus, both strands of miR-155 are increased in KSRP KD cells. The discrepancy in data may be due to the difference in concentration of LPS used or the different methods of generating the knockdown cell lines. We used a physiologically relevant concentration of 1 ng/mL LPS, while Ruggiero et al. used the super-physiological concentration of 100 ng/mL of LPS. Very high ligand concentrations can change the kinetics of gene expression and/or set up feedback effects not seen at lower ligand concentrations. Further work is underway to examine these possibilities. FUBP1 has not been previously described to participate in miRNA processing. Based on our work, the role of FUBP1 in miR-155 regulation is specific to miR-155-3p ( Fig. 3 ). Furthermore, our work indicates the KH3 domain of FUBP1 participates in binding to pre-miR-155, analogous to the requirement of the KSRP KH3 domain for miR-155-5p binding 25 . The KH3 domain of FUBP1 and KSRP share 79% sequence homology ( Fig. 11A ). Thus, KSRP and FUBP1 may recognize the same or similar sequences in pre-miR-155. The consensus recognition motif for the KSRP KH3 domain (GGGG) 71 and FUBP1 KH3 domain (UUGUG) 72 both appear at the 3′ end of the miR-155-5p sequence of pre-miR-155 ( Fig. 11B ). Interestingly, the sequence recognition motif for CELF2 protein (UGU-N-UGU) 73 exactly overlaps two of three expected FUBP1 recognition motifs in the pre-miR-155 sequence, suggesting the possibility of FUBP1 to compete for CELF2 instead of KSRP protein. IL10R signaling control of miR-155-5p and miR-155-3p expression As a next step in investigating how these three proteins coordinate their control of miR-155-5p and miR-155-3p, we also examined the IL10-regulated SHIP1 and STAT3 dependence of miR-155-5p and miR155-3p expression IL10 signalling downstream of the IL10R involves both STAT3 and SHIP1:STAT3 pathways 31 . Our studies showed that in the absence of STAT3 protein, IL10 no longer inhibits either miR-155-5p or miR-155-3p production but instead enhances expression of both by 4 hours and 2 hours, respectively ( Fig. 7A ). In the absence of SHIP1, the LPS-induced level of both miR-155 strands is significantly reduced, IL10-dependent inhibition of miR-155-5p is partly impaired and IL10-dependent inhibition of miR-155-3p is abolished ( Fig. 6B ). Our data suggests that STAT3 and SHIP1 underlie miR-155 regulation by the IL10R pathway, as summarized in Fig. 9 . We found in WT mouse macrophages that LPS-induced miR-155-3p expression increases more quickly than miR-155-5p ( Fig. 7 ). In the C57BL/6 mouse (STAT3 WT), miR-155-3p reaches a plateau at around 2 hours. In the Balb/C mouse (SHIP1 WT), the miR-155-3p level continuously rises to 4 hours. The difference in miR-155-3p kinetics between STAT3 WT and SHIP1 WT may be due to the difference in mouse strain (C57BL/6 vs Balb/C) and may contribute to the described differing immune response in these strains 74 , 75 . Download figure Open in new tab Fig. 9. Schematic representation of miR-155 regulation. Schematic diagram representing the regulation of miR-155-5p and miR-155-3p expression in response to LPS and IL10. The proteins in blue font represent the protein required for the shown action, and the proteins in orange font represent proteins that suppress the shown action. We had previously examined the kinetics of IL10 inhibition of LPS-induced expression of TNFα 31 . We showed that the early (2 hours) only needed STAT3. In the current study, we support the previous findings 42 of miR-155-3p kinetics by LPS being earlier (2-4 hours) than miR-155-5p (>4 hours). Furthermore, in the absence of STAT3 or SHIP1 protein, IL10-dependent inhibition of miR-155-3p is abolished, whereas, for miR-155-5p, SHIP1 KO only resulted in partial impairment of IL10-dependent inhibition of miR-155-3p ( Fig. 7A ). These observations suggest that IL10 inhibition of miR-155-3p may be necessary for IL10 inhibiting the early (SHIP1:STAT3 dependent) phase of TNFα production. In contrast, miR-155-5p inhibits the late (STAT3-dependent) phase of TNFα expression. However, the mechanism by which STAT3 or SHIP1:STAT3 complexes control miR-155-5p and miR-155-3p remains to be determined. One possibility is that both lead to protein expression that participates in the control of pre-miR-155 processing. In fact, since the absence of STAT3 results in IL10 enhancing rather than reducing LPS-induced miR-155-5p and miR-155-3p levels, we predict these STAT3-induced proteins may suppress pre-miR-155 processing ( Fig. 10 ). Download figure Open in new tab Fig. 10. Schematic representation of IL10R downstream signalin g process and potential mechanism on a different phases of pro-inflammatory response. Schematic diagram of IL10R downstream signaling pathway affecting various stages of pro-inflammatory response. Download figure Open in new tab Fig. 11. Schematic representation of FUBP1/KSRP /CELF2 regulation, homology, and interaction. (A) The sequence alignment of the KH3 domain of FUBP1 and KSRP protein. Sequences in black and red indicate matching and mismatching sequences, respectively. (B) Schematic diagram showing the predicted interaction site of FUBP1, CELF2 and KSRP to pre-miR-155. The bases of pre-miR-155 are in gray; blue bases show the miR-155-5p sequence, and black bases indicate the miR-155-3p sequence. Work is underway to determine how CELF2, SHIP1, and STAT3-dependent pathways affect miR-155 strand selection. Two strands of miRNA can be produced from a single precursor molecule of miRNA, but only one strand is selected to load into the RNA-induced silencing complex 76 . Strand selection of miRNAs may occur due to a change in the cleavage site of Dicer 77 or through actions of RNA editing enzymes on the pri/pre-miR-155 molecule 76 that affects the thermodynamic stability of the strands or its interaction with RNA binding proteins. Altered thermodynamic stability or Dicer cut site may result in selective processing of one or the other strand into the one that becomes the guide strand 78 . In the case of miR-155, the CELF2 protein shows the characteristics of strand selection, favouring the miR-155-3p expression and FUBP1 favouring miR-155-5p expression. We will also investigate whether RNA editing participates in miR-155-5p vs miR-155-3p expression and whether these participate in the aberrant expression of miR-155-5p vs miR-155-3p observed in certain cancers 53 , 58 , 60 , 64 . These investigations will also provide insight into regulating other miRNAs’ expression, including those described as regulated by CELF2 and KSRP 41 , 44 , 79 – 81 . Materials and Methods Mouse colonies SHIP1 WT or SHIP1 KO (in the BALB/c background) mice were provided by Dr. Gerald Krystal (BC Cancer Research Centre, Vancouver, BC). STAT3 WT and KO mice (in the C57BL/6 background) were generated as described 31 . All mice were maintained following the animal care protocols approved by the University of British Columbia Animal Care Committee. Cell lines The murine cell line RAW264.7 (ATCC TIB-71) was maintained in Roswell Park Memorial Institute 1640 medium (RPMI-1640, SH30027, HyClone, Logan, UT) supplemented with 9% fetal bovine serum (FBS, SH30396, HyClone, Logan, UT). As described below, FUBP1 KD RAW264.7 cells were generated by transduction of RAW 264.7 expressing iCas9 (called RAW264.7 control cells). The generation of CELF2 KD RAW264.7 cells was described in Yoon et al. 37 . Construction of the FUBP1 or KSRP-pLX-sgRNA targeting vectors The FUBP1 sgRNA targeting sequence (5’ GCTAAATCCGACCATCCCATC) was designed using the CRISPR Gold online tool 82 . Oligonucleotides corresponding to this sequence were cloned into the pLX-sgRNA vector using overlap-extension PCR as described 37 . The pLX-sgRNA vector with target-specific insert was transformed into chemically competent Stbl3 E. coli cells, and colonies were selected using ampicillin. The resulting FUBP1-pLX-sgRNA construct was confirmed by sequencing. Generation of RAW 264.7 cells expressing FUBP1 or KSRP pLX-sgRNA The FUBP1-pLX-sgRNA vector was transduced into RAW264.7 cells expressing iCas9 (called RAW264.7 control cells) 37 using lentiviruses. Lentiviruses harbouring FUBP1-pLX-sgRNA were prepared by co-transfecting FUBP1-pLX-sgRNA vector into HEK293T (ATCC CRL-3216) cells with the packaging plasmid R8.9 and VSVG. 24 hours after transfection, the supernatant was collected and incubated with RAW264.7 control cells in the presence of 8 µg/mL protamine sulfate. Cells transduced with FUBP1-pLX-sgRNA viruses were selected using 10 µg/mL blasticidin2 µg/mL doxycycline was added to the culture media for up to 48 hours to induce the expression of Cas9 and knockdown of FUBP1. RNA-oligonucleotide transfection and RNA pull-down assay RAW264.7 cells (ATCC TIB-71) were seeded at 8.4 × 10 6 cells per 10 cm dish a day before the transfection. Biotinylated pre-miR-155 oligonucleotides (Biotin-UAAUUGUGAUAGGGGUUU UGGCCUCUGACUGACUCCUACCUGUUA) were obtained from Invitrogen Life Technologies (ThermoFisher Scientific, Nepean, ON). RNA oligonucleotides and Lipofectamine-3000 (L3000-015, ThermoFisher Scientific, Nepean, ON) were prepared in Opti-MEM (31985, ThermoFisher Scientific, Nepean, ON) separately. They was mixed at 1:1 (v/v) ratio, incubated at room temperature for 20 minutes to allow the formation of Lipofectamine-oligonucleotide complexes. 1 µg of RNA-oligonucleotide to 1.125 µL of Lipofectamine-3000 was used. After incubation, the RNA-Lipofectamine solution was diluted ten-fold with 9% FBS/RPMI-1640 and added to cells. The cells were incubated with the transfection solution in a chamber at 37°C supplemented with 5% CO 2 . After 6 hours, the solution was replaced with 9% FBS/RPMI-1640, and cells were allowed to recover overnight Following the 9% FBS/RPMI-1640 overnight incubation, the transfected RAW264.7 cells were stimulated with 1 ng/mL LPS ( Escherichia coli serotype 0111:B4; Millipore-Sigma, Oakville, ON) ± 50 ng/mL IL10 for the indicated length of time in a chamber at 37°C supplemented with 5% CO 2 . Following stimulation, the media was removed, and cells were chilled with cold (4°C) phosphate-buffered saline (PBS, SH30256, ThermoFisher Scientific, Nepean, ON) for 2 minutes. Next, the PBS was removed, and the cells lysed by the addition of protein solubilization buffer (PSB, 50 mM HEPES, 100 mM NaF, 10 mM NaPPi, 2 mM NaVO 4 , 2 mM NaMoO 4 , 4 mM EDTA, 0.125% Triton X-100, protease inhibitor cocktail (11836145001, Millipore-Sigma, Oakville, ON), and 0.5 mM Tris(2-carboxyethyl)phosphine (TCEP, M115, Soltec Ventures, Beverly, MA)). Cell lysates were collected with a cell scraper and gently agitated at 4°C for 30 minutes. Insoluble material was removed by centrifugation at 12,000 RPM for 20 minutes at 4°C. Clarified cell lysates were added to streptavidin magnetic beads (1164786001, Millipore-Sigma, Oakville, ON) in 1.5 mL microfuge tubes and incubated for 90 minutes at 4°C on a nutator. The tubes were then briefly centrifuged at 5,000 RPM, and magnetic beads were immobilized using a magnetic tube stand (12321D, ThermoFisher Scientific, Nepean, ON). Lysates were removed, and the beads were resuspended in the wash buffer (0.1% Tween-20 containing PSB) and rocked for 5 minutes at 4°C on a nutator. The washing was repeated 3 times. The proteins were eluted by boiling 2x SDS-PAGE sample buffer (0.125 M Tris, pH 6.8, 5% 2-mercaptoethanol, bromophenol blue, 13.5% glycerol, 4.5 % SDS) for immunoblot analysis. Immunoblot analysis Proteins were separated by 10% SDS-PAGE, followed by electroblotting onto polyvinylidene fluoride (PVDF) membrane (IPFL00010, Millipore-Sigma, Oakville, ON). The membranes were blocked in 3% bovine serum albumin (BSA), then probed with the following primary antibodies overnight: 1:1000 KSRP (ab140648, Abcam, Toronto, ON), 0.1 µg/mL GAPDH (G9545, Millipore-Sigma, Oakville, ON), 1 µg/mL Myd88(Sc-74532, Santa Cruz, Dallas, TX), 1 µg/mL Actin (A2066, Sigma, Oakville, ON) and 1 µg/mL FUBP1 or KSRP (Sc-136137, Santa Cruz, Dallas, TX). The membranes were washed three times in Tris-buffered saline containing 0.05% Tween-20 (TBST), incubated with either Alexa Fluor 660 anti-mouse IgG (A21055) or Alexa Fluor 680 anti-rabbit IgG (A21109, Invitrogen, Burlington, ON), and imaged using a LI-COR Odyssey Imager. Isolation of and stimulation of mouse peritoneal macrophages Primary peritoneal macrophages (perimacs) were isolated from mice by peritoneal lavage with 3 mL of sterile PBS. Perimacs were seeded at 2.0 × 10 6 cells per well in a 6-well tissue culture plate or 1.18 × 10 6 cells per well in a 24-well tissue culture plate in Iscove’s Modified Dulbecco’s Medium (IMDM, SH30228, HyClone, Logan, UT) supplemented with 10% FCS. Cells were allowed to adhere for 2 hours, rinsed with room temperature PBS to remove non-adhered cells, and fresh media was added. The media was changed after 1 hour, and the cells were stimulated with 1 ng/mL LPS ± 1 ng/mL IL10 for 1, 2, or 4 hours. Triplicate wells were used for each stimulation condition. RNA extraction and qPCR Total RNA was extracted using Tri-Reagent (T9424, Millipore-Sigma, Oakville, ON) according to the manufacturer’s instructions. 1-3 µg of RNA was treated with RNase-free DNase I (04716728001, Millipore-Sigma, Oakville, ON) for 20 minutes at 37°C, followed by the addition of 0.1 M EDTA to a final concentration of 8 mM to inactivate DNase I. For measurement of miR-155-5p, miR-155-3p, and small nucleolar RNA MBII-202 (snoRNA202) levels, 20 ng of DNase I treated RNA was used to generate cDNAs using the miRNA TaqMan Reverse Transcription Kit (4366597, ThermoFisher Scientific, Nepean, ON), Multiscribe™ reverse transcriptase (4319983, ThermoFisher Scientific, Nepean, ON), and miR-155-5p (002571), miR-155-3p (464539_mat) or snoRNA202 (001232, ThermoFisher Scientific, Nepean, ON) primers according to the manufacturer’s instructions. qPCR quantification of miR-155-5p and miR-155-3p and snoRNA202 cDNA was performed using the TaqMan fast advanced master mix (4444557, ThermoFisher Scientific, Nepean, ON) and the appropriate TaqMan probes on a StepOne Plus™ instrument (4376582, Invitrogen, Burlington, ON). miRNA levels were analyzed using the comparative CT method with snoRNA202 as the normalization control. For measurement of pri-miR-155, pre-miR-155, and GAPDH, 200 ng of DNase I treated RNA were reverse transcribed using SuperScript™ IV reverse transcriptase (18090200, ThermoFisher Scientific, Nepean, ON), oligodT primer (18418020, ThermoFisher Scientific, Nepean, ON) and random hexamers. qPCR quantification of pri-miR-155, pre-miR-155, and GAPDH were achieved with primers for pri-miR-155, pre-miR-155, and GAPDH in conjunction with the SYBR Green master mix (100029284, ThermoFisher Scientific, Nepean, ON). RNA levels were analyzed using the comparative CT method with GAPDH as the normalization control. Molecular cloning of FUBP1 and KSRP The open reading frame (ORF) of mouse FUBP1 and KSRP was obtained by PCR on cDNA generated from RNA isolated from SHIP1 WT perimacs. The FUBP1/KSRP ORF was inserted into the Gateway entry vector (pENTR1A, Invitrogen, Burlington, ON) via restriction digest and ligation. The products were transformed into DH5α E. coli chemically competent cells, and colonies were selected using 50 µg/mL of kanamycin. The sequences of the FUBP1/KSRP pENTR1A vectors were confirmed by sequencing. Using site-directed mutagenesis, the GXXG sequences in the third KH domain of FUBP1 and KSRP were mutated to the GDDG sequence. PCR with non-overlapping primers (5′ phosphorylated forward primer with desired mutation and non-overlapping reverse primer) was used to generate FUBP1/KSRP daughter plasmids containing the desired mutation. The resulting PCR product was extracted with phenol-chloroform, treated with Dpn I to remove the parental vector, daughter plasmids ligated with T4 ligase, and transformed into DH5α chemically competent cells. The FUBP1/KSRP WT and KH3 GDDG mutant pENTR1A vectors were transferred to lentiviral vector FUGWBW using Gateway LR reactions as described 31 . Recombinant FUBP1 and KSRP Protein Expression HEK293T cells were transfected with FUBWBW vectors encoding FUBP1/KSRP WT or KH3 GDDG mutant proteins. After transfection (48 hours), the cells were lysed with the lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM imidazole, 1% NP-40, protease inhibitor cocktail, and 10 mM TCEP). The lysates were incubated for 45 minutes at 4°C on a nutator, then centrifuged at 12000 rpm for 20 minutes, and the supernatants were transferred to tubes containing cobalt affinity beads (TALON metal affinity resin, #635504, Takara Bio, Mountain View, CA). The cell lysates were incubated with the beads for 2 hours, and the beads were washed three times with wash buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM Imidazole, 0.1% NP-40, 0.5 mM TCEP) before eluting with the elution buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 150 mM imidazole, 0.5 mM TCEP, and 0.02% Tween-20). Measurement of TNF α production Cells were seeded at 2.0 × 10 4 cells per well in a 96-well tissue culture plate and allowed to adhere overnight. The media was changed the next day, 1 hour before stimulation. Cells were stimulated with 1 ng/mL of LPS ± indicated concentration of IL10 for 1 hour. Triplicate wells were used for each stimulation condition. The supernatant was collected, and secreted TNFα protein levels were measured using a BD OptEIA Mouse TNFα Enzyme-Linked Immunosorbent Assay (ELISA) kit (558534, BD Bio-sciences, Mississauga, ON). Biolayer interferometry The binding affinity between the FUBP1 or KSRP proteins to pre-miR-155 was examined using biolayer interferometry with super-streptavidin (SSA) biosensor tips (18-5057, ForteBio, Fremont, CA). SSA biosensor tips were hydrated in BLI assay buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.5 mM TCEP, 0.2% Tween-20) before coating with biotinylated pre-miR-155 and blocking with 0.1% BSA. The kinetic measurements were done at 30°C with an orbital flow of 1000 rpm. A 60-second baseline was established using BLI assay buffer. The pre-miR-155 coated biosensors were then dipped into wells containing KSRP or FUBP1 protein, and association was monitored for 600 seconds. The sensors were then transferred to wells containing only BLI assay buffer, and protein dissociation was monitored for 600 seconds. The raw data were analyzed using the Octet Red Data Analysis software (ver. 8.2). Statistical analysis Band intensities were quantified in immunoblots using LI-COR Odyssey imaging system and Image Studio™ Lite software (LI-COR Biosciences, Lincoln, NE). Graph-Pad Prism 6 (GraphPad Software Inc., La Jolla, CA) performed all statistical analyses. Statistical details can be found in figure legends. Values are presented as means ± standard deviations. Unpaired Student’s t -tests were used where appropriate to generate two-tailed P values. Two-way ANOVA was performed where required with appropriate multiple comparison tests. The differences were considered significant when p ≤ 0.05. Ethical statement The perimacs were derived from mice in accordance with the animal care protocol (A21-0203) approved by the University of British Columbia Animal Care Committee. The cell culture experiments are done in accordance with UBC Biosafety requirements (B16-0206). Data availability statement All data not provided in the manuscript and the supplementary information are available from the authors upon request. Author contributions Conceptualization, J.Y., and A.M.; methodology, J.Y.; validation, J.Y., T.C. and A.M.; formal analysis, J.Y.; investigation, J.Y., A.W., and A.M.; Resources, J.Y., and T.C.; data curation, J.Y., and A.W..; writing—original draft preparation, J.Y., and A.W.; writing— review and editing, J.Y., T.C. and A.M.; visualization, J.Y.; supervision, A.M.; project administration, T.C., and A.M.; funding acquisition, A.M. All authors have read and agreed to the published version of the manuscript. Funding This research was supported by operating grants from the Natural Science of Engineering Research Council (RGPIN-2014-05662) and the Canadian Institutes of Health Research (MOP-133415). Competing interests The authors declare no conflict of interest. The funders had no role in the study’s design, in the collection, analyses, or interpretation of data, in the writing of the manuscript, or in the decision to publish the results. Acknowledgements We thank Dr. Nada Lallous from Vancouver Prostate Centre for providing help with the BLI experiments and Dr. Gerald Krystal for the SHIP1 WT and KO mice. We also thank Mike K. Wu for their advice on the RNA pull-down experiments. References ↵ Lee , Y. , Jeon , K. , Lee , J. T. , Kim , S. & Kim , V. N. MicroRNA maturation: stepwise processing and subcellular localization . EMBO J 21 , 4663 – 4670 ( 2002 ). doi: 10.1093/emboj/cdf476 OpenUrl Abstract / FREE Full Text ↵ Calame , K. MicroRNA-155 function in B Cells . Immunity 27 , 825 – 827 ( 2007 ). doi: 10.1016/j.immuni.2007.11.010 OpenUrl CrossRef PubMed Web of Science ↵ O’Connell , R. M. , Taganov , K. D. , Boldin , M. P. , Cheng , G. & Baltimore , D. MicroRNA-155 is induced during the macrophage inflammatory response . Proc Natl U S A 104 , 1604 – 1609 ( 2007 ). doi: 10.1073/pnas.0610731104 OpenUrl Abstract / FREE Full Text ↵ Tili , E. et al. Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-alpha stimulation and their possible roles in regulating the response to endotoxin shock . J Immunol 179 , 5082 – 5089 ( 2007 ). doi: 10.4049/jimmunol.179.8.5082 OpenUrl Abstract / FREE Full Text Ceppi , M. et al. MicroRNA-155 modulates the interleukin-1 signaling pathway in activated human monocyte-derived dendritic cells . Proc Natl Acad Sci U S A 106 , 2735 – 2740 ( 2009 ). doi: 10.1073/pnas.0811073106 OpenUrl Abstract / FREE Full Text ↵ Faraoni , I. , Antonetti , F. R. , Cardone , J. & Bonmassar , E. miR-155 gene: a typical multifunctional microRNA . Biochim Biophys Acta 1792 , 497 – 505 ( 2009 ). doi: 10.1016/j.bbadis.2009.02.013 OpenUrl CrossRef PubMed Web of Science ↵ Tili , E. , Croce , C. M. & Michaille , J. J. miR-155: on the crosstalk between inflammation and cancer . Int Rev Immunol 28 , 264 – 284 ( 2009 ). doi: 10.1080/08830180903093796 OpenUrl CrossRef PubMed Web of Science ↵ Kalkusova , K. , Taborska , P. , Stakheev , D. & Smrz , D. The Role of miR-155 in Antitumor Immunity . Cancers (Basel) 14 ( 2022 ). doi: 10.3390/cancers14215414 OpenUrl CrossRef ↵ Mahesh , G. & Biswas , R. MicroRNA-155: A Master Regulator of Inflammation . Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 39 , 321 – 330 ( 2019 ). doi: 10.1089/jir.2018.0155 OpenUrl CrossRef ↵ Elton , T. S. , Selemon , H. , Elton , S. M. & Parinandi , N. L. Regulation of the MIR155 host gene in physiological and pathological processes . Gene 532 , 1 – 12 ( 2013 ). doi: 10.1016/j.gene.2012.12.009 OpenUrl CrossRef PubMed Web of Science ↵ Meijer , H. A. , Smith , E. M. & Bushell , M. Regulation of miRNA strand selection: follow the leader? Biochem Soc Trans 42 , 1135 – 1140 ( 2014 ). doi: 10.1042/BST20140142 OpenUrl Abstract / FREE Full Text ↵ Kehl , T. et al. About miRNAs, miRNA seeds, target genes and target pathways . Oncotarget 8 , 107167 – 107175 ( 2017 ). doi: 10.18632/oncotarget.22363 OpenUrl CrossRef PubMed ↵ Gao , X. et al. Pulmonary Silicosis Alters MicroRNA Expression in Rat Lung and miR-411-3p Exerts Anti-fibrotic Effects by Inhibiting MRTF-A/SRF Signaling . Mol Ther Nucleic Acids 20 , 851 – 865 ( 2020 ). doi: 10.1016/j.omtn.2020.05.005 OpenUrl CrossRef PubMed Choi , E. J. et al. Differential microRNA expression following infection with a mouse-adapted, highly virulent avian H5N2 virus . BMC Microbiol 14 , 252 ( 2014 ). doi: 10.1186/s12866-014-0252-0 OpenUrl CrossRef PubMed ↵ Pisanu , C. et al. Whole Genome Expression Analyses of miRNAs and mRNAs Suggest the Involvement of miR-320a and miR-155-3p and their Targeted Genes in Lithium Response in Bipolar Disorder . Int J Mol Sci 20 ( 2019 ). doi: 10.3390/ijms20236040 OpenUrl CrossRef ↵ Mitra , R. , Adams , C. M. , Jiang , W. , Greenawalt , E. & Eischen , C. M. Pan-cancer analysis reveals cooperativity of both strands of microRNA that regulate tumorigenesis and patient survival . Nat Commun 11 , 968 ( 2020 ). doi: 10.1038/s41467-020-14713-2 OpenUrl CrossRef PubMed Wu , M. et al. MiR-155-5p promotes oral cancer progression by targeting chromatin remodeling gene ARID2 . Biomed Pharmacother 122 , 109696 ( 2020 ). doi: 10.1016/j.biopha.2019.109696 OpenUrl CrossRef PubMed Li , Y. et al. MicroRNA-155-5p promotes tumor progression and contributes to paclitaxel resistance via TP53INP1 in human breast cancer . Pathol Res Pract 220 , 153405 ( 2021 ). doi: 10.1016/j.prp.2021.153405 OpenUrl CrossRef PubMed Dawson , O. & Piccinini , A. M. miR-155-3p: processing by-product or rising star in immunity and cancer? Open biology 12 , 220070 ( 2022 ). doi: 10.1098/rsob.220070 OpenUrl CrossRef PubMed Kalantzakos , T. et al. MicroRNA-155-5p Targets JADE-1, Promoting Proliferation, Migration, and Invasion in Clear Cell Renal Cell Carcinoma Cells . Int J Mol Sci 24 ( 2023 ). doi: 10.3390/ijms24097825 OpenUrl CrossRef ↵ Maheswari , R. et al. Exploring miR-155-5p and miR-1246 as Diagnostic and Prognostic Markers in Oral Squamous cell carcinoma . Mol Biol Rep 51 , 341 ( 2024 ). doi: 10.1007/s11033-024-09234-w OpenUrl CrossRef PubMed ↵ Parameswaran , N. & Patial , S. Tumor necrosis factor-α signaling in macrophages . Crit Rev Eukaryot Gene Expr 20 , 87 – 103 ( 2010 ). OpenUrl CrossRef PubMed ↵ Rauh , M. J. et al. The role of SHIP1 in macrophage programming and activation . Biochem Soc Trans 32 , 785 – 788 ( 2004 ). doi: 10.1042/BST0320785 OpenUrl Abstract / FREE Full Text ↵ Cheung , S. T. , So , E. Y. , Chang , D. , Ming-Lum , A. & Mui , A. L. Interleukin-10 inhibits lipopolysaccharide induced miR-155 precursor stability and maturation . PloS one 8 , e71336 ( 2013 ). doi: 10.1371/journal.pone.0071336 OpenUrl CrossRef PubMed ↵ Ruggiero , T. et al. LPS induces KH-type splicing regulatory protein-dependent processing of microRNA-155 precursors in macrophages . FASEB J 23 , 2898 – 2908 ( 2009 ). doi: 10.1096/fj.09-131342 OpenUrl CrossRef PubMed Web of Science ↵ Chandan , K. , Gupta , M. & Sarwat , M. Role of Host and Pathogen-Derived MicroRNAs in Immune Regulation During Infectious and Inflammatory Diseases . Front Immunol 10 , 3081 ( 2019 ). doi: 10.3389/fimmu.2019.03081 OpenUrl CrossRef Chen , L. et al. Inflammatory responses and inflammation-associated diseases in organs . Oncotarget 9 , 7204 – 7218 ( 2018 ). doi: 10.18632/oncotarget.23208 OpenUrl CrossRef PubMed ↵ Mantovani , A. , Allavena , P. , Sica , A. & Balkwill , F. Cancer-related inflammation . Nature 454 , 436 – 444 ( 2008 ). doi: 10.1038/nature07205 OpenUrl CrossRef PubMed Web of Science ↵ Moore , K. W. , de Waal Malefyt , R. , Coffman , R. L. & O’Garra , A. Interleukin-10 and the interleukin-10 receptor . Annu Rev Immunol 19 , 683 – 765 ( 2001 ). doi: 10.1146/annurev.immunol.19.1.683 OpenUrl CrossRef PubMed Web of Science ↵ Armstrong , L. , Jordan , N. & Millar , A. Interleukin 10 (IL-10) regulation of tumour necrosis factor alpha (TNF-alpha) from human alveolar macrophages and peripheral blood monocytes . Thorax 51 , 143 – 149 ( 1996 ). doi: 10.1136/thx.51.2.143 OpenUrl Abstract / FREE Full Text ↵ Chamberlain , T. C. et al. Interleukin-10 and Small Molecule SHIP1 Allosteric Regulators Trigger Anti-inflammatory Effects through SHIP1/STAT3 Complexes . iScience 23 , 101433 ( 2020 ). doi: 10.1016/j.isci.2020.101433 OpenUrl CrossRef ↵ Murray , P. J. STAT3-mediated anti-inflammatory signalling . Biochem Soc Trans 34 , 1028 – 1031 ( 2006 ). doi: 10.1042/BST0341028 OpenUrl Abstract / FREE Full Text ↵ Zhong , Z. , Wen , Z. & Darnell , J. E. Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6 . Science 264 , 95 – 98 ( 1994 ). OpenUrl Abstract / FREE Full Text ↵ Chan , C. S. et al. Interleukin-10 inhibits lipopolysaccharide-induced tumor necrosis factor-alpha translation through a SHIP1-dependent pathway . J Biol Chem 287 , 38020 – 38027 ( 2012 ). doi: 10.1074/jbc.M112.348599 OpenUrl Abstract / FREE Full Text ↵ McCoy, C. E. e t a lIL . -10 inhibits miR-155 induction by toll-like receptors . J Biol Chem 285 , 20492 – 20498 ( 2010 ). doi: 10.1074/jbc.M110.102111 OpenUrl Abstract / FREE Full Text ↵ El Kasmi , K. C. , et al. General nature of the STAT3-activated anti-inflammatory response . J Immunol 177 , 7880 – 7888 ( 2006 ). OpenUrl Abstract / FREE Full Text ↵ Yoon , J. S. J. et al. Interleukin-10 control of pre-miR155 maturation involves CELF2 . PloS one 15 , e0231639 ( 2020 ). doi: 10.1371/journal.pone.0231639 OpenUrl CrossRef PubMed ↵ Piqué , L. et al. Epigenetic inactivation of the splicing RNA-binding protein CELF2 in human breast cancer . Oncogene 38 , 7106 – 7112 ( 2019 ). doi: 10.1038/s41388-019-0936-x OpenUrl CrossRef PubMed ↵ Mallory , M. J. et al. Induced transcription and stability of CELF2 mRNA drives widespread alternative splicing during T-cell signaling . Proc Natl Acad Sci U S A 112 , E2139 – 2148 ( 2015 ). doi: 10.1073/pnas.1423695112 OpenUrl Abstract / FREE Full Text ↵ Chatrikhi , R. et al. RNA Binding Protein CELF2 Regulates Signal-Induced Alternative Polyadenylation by Competing with Enhancers of the Polyadenylation Machinery . Cell Rep 28 , 2795 – 2806.e2793 ( 2019 ). doi: 10.1016/j.celrep.2019.08.022 OpenUrl CrossRef PubMed ↵ Treiber , T. et al. A Compendium of RNA-Binding Proteins that Regulate MicroRNA Biogenesis . Mol Cell 66 , 270 – 284.e213 ( 2017 ). doi: 10.1016/j.molcel.2017.03.014 OpenUrl CrossRef PubMed ↵ Simmonds , R. E. Transient up-regulation of miR-155-3p by lipopolysaccharide in primary human monocyte-derived macrophages results in RISC incorporation but does not alter TNF expression . Wellcome Open Res 4 , 43 ( 2019 ). doi: 10.12688/wellcomeopenres.15065.2 OpenUrl CrossRef PubMed ↵ Li , H. et al. Far upstream element-binding protein 1 and RNA secondary structure both mediate second-step splicing repression . Proc Natl Acad Sci U S A 110 , E2687 – 2695 ( 2013 ). doi: 10.1073/pnas.1310607110 OpenUrl Abstract / FREE Full Text ↵ Trabucchi , M. et al. The RNA-binding protein KSRP promotes the biogenesis of a subset of microRNAs . Nature 459 , 1010 – 1014 ( 2009 ). doi: 10.1038/nature08025 OpenUrl CrossRef PubMed Web of Science ↵ Zhou , H. et al. miR-155 and its star-form partner miR-155* cooperatively regulate type I interferon production by human plasmacytoid dendritic cells . Blood 116 , 5885 – 5894 ( 2010 ). doi: 10.1182/blood-2010-04-280156 OpenUrl Abstract / FREE Full Text ↵ King , P. H. & Chen , C. Y. Role of KSRP in control of type I interferon and cytokine expression . J Interferon Cytokine Res 34 , 267 – 274 ( 2014 ). doi: 10.1089/jir.2013.0143 OpenUrl CrossRef PubMed ↵ Hollingworth , D. et al. KH domains with impaired nucleic acid binding as a tool for functional analysis . Nucleic Acids Res 40 , 6873 – 6886 ( 2012 ). doi: 10.1093/nar/gks368 OpenUrl CrossRef PubMed Web of Science ↵ Dowling , J. K. et al. Mitochondrial arginase-2 is essential for IL-10 metabolic reprogramming of inflammatory macrophages . Nat Commun 12 , 1460 ( 2021 ). doi: 10.1038/s41467-021-21617-2 OpenUrl CrossRef PubMed ↵ Dunand-Sauthier , I. et al. Repression of arginase-2 expression in dendritic cells by microRNA-155 is critical for promoting T cell proliferation . J Immunol 193 , 1690 – 1700 ( 2014 ). doi: 10.4049/jimmunol.1301913 OpenUrl Abstract / FREE Full Text ↵ Chen , Y. & Wang , X. miRDB: an online database for prediction of functional microRNA targets . Nucleic Acids Res 48 , D127 – d131 ( 2020 ). doi: 10.1093/nar/gkz757 OpenUrl CrossRef PubMed ↵ Agarwal , V. , Bell , G. W. , Nam , J. W. & Bartel , D. P. Predicting effective microRNA target sites in mammalian mRNAs . Elife 4 ( 2015 ). doi: 10.7554/eLife.05005 OpenUrl CrossRef PubMed ↵ Tang , B. et al. Identification of MyD88 as a novel target of miR-155, involved in negative regulation of Helicobacter pylori-induced inflammation . FEBS Lett 584 , 1481 – 1486 ( 2010 ). doi: 10.1016/j.febslet.2010.02.063 OpenUrl CrossRef PubMed Web of Science ↵ Zhang , L. et al. MiR-155-3p acts as a tumor suppressor and reverses paclitaxel resistance via negative regulation of MYD88 in human breast cancer . Gene 700 , 85 – 95 ( 2019 ). doi: 10.1016/j.gene.2019.02.066 OpenUrl CrossRef PubMed ↵ Valverde , R. , Edwards , L. & Regan , L. Structure and function of KH domains . FEBS J 275 , 2712 – 2726 ( 2008 ). doi: 10.1111/j.1742-4658.2008.06411.x OpenUrl CrossRef PubMed ↵ Davis-Smyth , T. , Duncan , R. C. , Zheng , T. , Michelotti , G. & Levens , D. The far upstream element-binding proteins comprise an ancient family of single-strand DNA-binding transactivators . J Biol Chem 271 , 31679 – 31687 ( 1996 ). doi: 10.1074/jbc.271.49.31679 OpenUrl Abstract / FREE Full Text ↵ Montagne , K. , Furukawa , K. S. , Taninaka , Y. , Ngao , B. & Ushida , T. Modulation of the long non-coding RNA Mir155hg by high, but not moderate, hydrostatic pressure in cartilage precursor cells . PLoS One 17 , e0275682 ( 2022 ). doi: 10.1371/journal.pone.0275682 OpenUrl CrossRef PubMed ↵ Wu , X. et al. Blocking MIR155HG/miR-155 axis inhibits mesenchymal transition in glioma . Neuro Oncol 19 , 1195 – 1205 ( 2017 ). doi: 10.1093/neuonc/nox017 OpenUrl CrossRef PubMed ↵ Ren , X. Y. , Han , Y. D. & Lin , Q. Long non-coding RNA MIR155HG knockdown suppresses cell proliferation, migration and invasion in NSCLC by upregulating TP53INP1 directly targeted by miR-155-3p and miR-155-5p . Eur Rev Med Pharmacol Sci 24 , 4822 – 4835 ( 2020 ). doi: 10.26355/eurrev_202005_21171 OpenUrl CrossRef PubMed ↵ Mycko , M. P. , Cichalewska , M. , Cwiklinska , H. & Selmaj , K. W. miR-155-3p Drives the Development of Autoimmune Demyelination by Regulation of Heat Shock Protein 40 . J Neurosci 35 , 16504 – 16515 ( 2015 ). doi: 10.1523/JNEUROSCI.2830-15.2015 OpenUrl Abstract / FREE Full Text ↵ Tao , M. , Zhou , Y. , Jin , Y. & Pu , J. Blocking lncRNA MIR155HG/miR-155-5p/-3p inhibits proliferation, invasion and migration of clear cell renal cell carcinoma . PATHOLOGY RESEARCH AND PRACTICE 216 ( 2020 ). doi: 10.1016/j.prp.2019.152803 OpenUrl CrossRef ↵ Plank , M. W. et al. MicroRNA Expression Is Altered in an Ovalbumin-Induced Asthma Model and Targeting miR-155 with Antagomirs Reveals Cellular Specificity . PLoS One 10 , e0144810 ( 2015 ). doi: 10.1371/journal.pone.0144810 OpenUrl CrossRef PubMed ↵ Xue , H. et al. A novel tumor-promoting mechanism of IL6 and the therapeutic efficacy of tocilizumab: Hypoxia-induced IL6 is a potent autophagy initiator in glioblastoma via the p-STAT3-MIR155-3p-CREBRF pathway . Autophagy 12 , 1129 – 1152 ( 2016 ). doi: 10.1080/15548627.2016.1178446 OpenUrl CrossRef PubMed ↵ Soleimani , M. et al. Circulating microRNA-155-3p levels predicts response to first line immunotherapy in patients with metastatic renal cell carcinoma . Sci Rep 14 , 8603 ( 2024 ). doi: 10.1038/s41598-024-59337-4 OpenUrl CrossRef PubMed ↵ Tang , B. et al. MicroRNA-155-3p promotes hepatocellular carcinoma formation by suppressing FBXW7 expression . J Exp Clin Cancer Res 35 , 93 ( 2016 ). doi: 10.1186/s13046-016-0371-6 OpenUrl CrossRef PubMed ↵ Ling , X. et al. Involment of RAS/ERK1/2 signaling and MEF2C in miR-155-3p inhibition-triggered cardiomyocyte differentiation of embryonic stem cell . Oncotarget 8 , 84403 – 84416 ( 2017 ). doi: 10.18632/oncotarget.21218 OpenUrl CrossRef PubMed ↵ Makarova , J. A. , et al. Intracellular and extracellular microRNA: An update on localization and biological role . Prog Histochem Cytochem 51 , 33 – 49 ( 2016 ). doi: 10.1016/j.proghi.2016.06.001 OpenUrl CrossRef PubMed ↵ Zhou , L. & Xie , X. RNA-binding protein CELF2 inhibits breast cancer cell invasion and angiogenesis by downregulating NFATc1 . Exp Ther Med 22 , 898 ( 2021 ). doi: 10.3892/etm.2021.10330 OpenUrl CrossRef PubMed Yeung , Y. T. et al. CELF2 suppresses non-small cell lung carcinoma growth by inhibiting the PREX2-PTEN interaction . Carcinogenesis 41 , 377 – 389 ( 2020 ). doi: 10.1093/carcin/bgz113 OpenUrl CrossRef PubMed Wang , L. et al. CELF2 is a candidate prognostic and immunotherapy biomarker in triple-negative breast cancer and lung squamous cell carcinoma: A pan-cancer analysis . J Cell Mol Med 25 , 7559 – 7574 ( 2021 ). doi: 10.1111/jcmm.16791 OpenUrl CrossRef PubMed ↵ Ramalingam , S. , Ramamoorthy , P. , Subramaniam , D. & Anant , S. Reduced Expression of RNA Binding Protein CELF2, a Putative Tumor Suppressor Gene in Colon Cancer . Immunogastroenterology 1 , 27 – 33 ( 2012 ). doi: 10.7178/ig.1.1.7 OpenUrl CrossRef PubMed ↵ García-Mayoral , M. F. , Díaz-Moreno , I. , Hollingworth , D. & Ramos , A. The sequence selectivity of KSRP explains its flexibility in the recognition of the RNA targets . Nucleic Acids Res 36 , 5290 – 5296 ( 2008 ). doi: 10.1093/nar/gkn509 OpenUrl CrossRef PubMed Web of Science ↵ Miro , J. et al. FUBP1: a new protagonist in splicing regulation of the DMD gene . Nucleic Acids Res 43 , 2378 – 2389 ( 2015 ). doi: 10.1093/nar/gkv086 OpenUrl CrossRef PubMed ↵ Edwards , J. et al. Sequence determinants for the tandem recognition of UGU and CUG rich RNA elements by the two N--terminal RRMs of CELF1 . Nucleic Acids Res 39 , 8638 – 8650 ( 2011 ). doi: 10.1093/nar/gkr510 OpenUrl CrossRef PubMed Web of Science ↵ Mills , C. D. , Kincaid , K. , Alt , J. M. , Heilman , M. J. & Hill , A. M. M-1/M-2 macrophages and the Th1/Th2 paradigm . J Immunol 164 , 6166 – 6173 ( 2000 ). doi: 10.4049/jimmunol.164.12.6166 OpenUrl Abstract / FREE Full Text ↵ Fornefett , J. et al. Comparative analysis of humoral immune responses and pathologies of BALB/c and C57BL/6 wildtype mice experimentally infected with a highly virulent Rodentibacter pneumotropicus (Pasteurella pneumotropica) strain . BMC Microbiol 18 , 45 ( 2018 ). doi: 10.1186/s12866-018-1186-8 OpenUrl CrossRef ↵ Medley , J. C. , Panzade , G. & Zinovyeva , A. Y. microRNA strand selection: Unwinding the rules . Wiley interdisciplinary reviews. RNA 12 , e1627 ( 2021 ). doi: 10.1002/wrna.1627 OpenUrl CrossRef PubMed ↵ Kim , H. et al. A Mechanism for microRNA Arm Switching Regulated by Uridylation . Mol Cell 78 , 1224 – 1236.e1225 ( 2020 ). doi: 10.1016/j.molcel.2020.04.030 OpenUrl CrossRef PubMed ↵ Lee , Y. Y. , Lee , H. , Kim , H. , Kim , V. N. & Roh , S. H. Structure of the human DICER-pre-miRNA complex in a dicing state . Nature 615 , 331 – 338 ( 2023 ). doi: 10.1038/s41586-023-05723-3 OpenUrl CrossRef PubMed ↵ Michlewski , G. & Caceres , J. F. Antagonistic role of hnRNP A1 and KSRP in the regulation of let-7a biogenesis . Nat Struct Mol Biol 17 , 1011 – 1018 ( 2010 ). doi: 10.1038/nsmb.1874 OpenUrl CrossRef PubMed Chou , C. F. et al. KSRP ablation enhances brown fat gene program in white adipose tissue through reduced miR-150 expression . Diabetes 63 , 2949 – 2961 ( 2014 ). doi: 10.2337/db13-1901 OpenUrl Abstract / FREE Full Text ↵ Lin , Y. Y. et al. KSRP and MicroRNA 145 are negative regulators of lipolysis in white adipose tissue . Mol Cell Biol 34 , 2339 – 2349 ( 2014 ). doi: 10.1128/MCB.00042-14 OpenUrl Abstract / FREE Full Text ↵ Chu , V. T. et al. Efficient CRISPR-mediated mutagenesis in primary immune cells using CrispRGold and a C57BL/6 Cas9 transgenic mouse line . Proc Natl Acad Sci U S A 113 , 12514 – 12519 ( 2016 ). doi: 10.1073/pnas.1613884113 OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted March 11, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following The strand-selective regulation of miR-155 in response to lipopolysaccharide by CELF2, FUBP1 and KSRP proteins Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share The strand-selective regulation of miR-155 in response to lipopolysaccharide by CELF2, FUBP1 and KSRP proteins Jeff S. J. Yoon , Abdulwadood Baksh , Thomas C. Chamberlain , Alice L-F Mui bioRxiv 2025.03.05.641704; doi: https://doi.org/10.1101/2025.03.05.641704 Share This Article: Copy Citation Tools The strand-selective regulation of miR-155 in response to lipopolysaccharide by CELF2, FUBP1 and KSRP proteins Jeff S. J. Yoon , Abdulwadood Baksh , Thomas C. Chamberlain , Alice L-F Mui bioRxiv 2025.03.05.641704; doi: https://doi.org/10.1101/2025.03.05.641704 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Immunology Subject Areas All Articles Animal Behavior and Cognition (7637) Biochemistry (17705) Bioengineering (13899) Bioinformatics (41968) Biophysics (21460) Cancer Biology (18603) Cell Biology (25526) Clinical Trials (138) Developmental Biology (13385) Ecology (19910) Epidemiology (2067) Evolutionary Biology (24328) Genetics (15614) Genomics (22513) Immunology (17741) Microbiology (40423) Molecular Biology (17193) Neuroscience (88646) Paleontology (667) Pathology (2835) Pharmacology and Toxicology (4827) Physiology (7647) Plant Biology (15160) Scientific Communication and Education (2046) Synthetic Biology (4302) Systems Biology (9825) Zoology (2271)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00