APOE Genotype Differentially Modulates Prion Pathology in a Mouse Model

APOE Genotype Differentially Modulates Prion Pathology in a Mouse Model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article APOE Genotype Differentially Modulates Prion Pathology in a Mouse Model Anita M. Lizińczyk, Joanna E. Pankiewicz, William L. Cullina, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7820890/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Jan, 2026 Read the published version in Acta Neuropathologica Communications → Version 1 posted 11 You are reading this latest preprint version Abstract APOE polymorphism affects the risk of occurrence and the rate of progression in several neurodegenerative diseases including Alzheimer’s disease, primary tauopathies, α-synucleinopathy, and age-related macular degeneration, but its role in prionoses remains unestablished. Using APOE targeted replacement (TR) mice, we investigated how APOE genotype affects key neurodegenerative mechanisms involved in prion pathology. Male and female ε2/ε2 , ε3/ε3 , and ε4/ε4 APOE -TR mice were inoculated with 22L mouse-adapted scrapie strain or normal brain homogenate and monitored with behavioral testing from 10-week post inoculation (wpi.) onward. Mice were euthanized at 23 wpi. when all prion-infected animals were symptomatic, and their brains were analyzed for multiple neuropathological, biochemical, and transcriptomic metrics. ε4/ε4 22L mice featured the shortest disease latency time, the worst neurological score, and the highest load of spongiform lesions. ε2/ε2 22L mice performed significantly better than ε4/ε4 22L mice but significantly worse than ε3/ε3 22L animals. Numerous aspects of PrP proteinopathy were exacerbated in the presence of the ε4 allele including increased PrP Sc accumulation, reduced PrP solubility, and increased PrP oligomerization. These metrics were comparable between ε2/ε2 22L and ε3/ε3 22L mice. Prion pathology significantly increased brain apolipoprotein (apo) E levels, with the greatest increase in ε4/ε4 22L mice. All apoE isoforms formed complexes with conformationally altered PrP, but this interaction was the strongest in ε4/ε4 22L mice. ε4/ε4 22L mice had the highest load of reactive microglia and astrocytes and upregulation of transcriptomic markers typical of neurodegenerative microglia and astrocytes, followed by ε2/ε2 22L , with ε3/ε3 22L having the lowest. Thus, APOE polymorphism differentially regulates the progression of prion pathology attributable to two ε4 -affected mechanisms: increased conversion and accumulation of PrP Sc and worsened prion-associated neuroinflammation. Though less severely than ε4 , the ε2 allele also increased the inflammatory response, rendering disease outcome worse relative to the ε3 allele. Our findings suggest both ε4 and ε2 alleles are disadvantageous determinants in prion pathology. Alzheimer’s disease apolipoprotein E astrocytes microglia neurodegeneration neuroinflammation prion diseases prion protein Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Apolipoprotein (apo) E is a 34-kDa lipid transporting protein encoded by the APOE gene located on chromosome 19q13.32 and expressed by hepatocytes, astrocytes, immune cells of the myeloid-lineage, vascular smooth muscle cells and adipocytes [ 87 ]. APOE polymorphism includes three common alleles ε2, ε3 , and ε4 , with world-wide distribution frequencies of 6.4%, 78.3%, and 14.5%, respectively [ 35 ]. They encode respective isoforms of the apoE protein, which differ in the presence of cysteine and arginine at positions 112 and 158 and feature impactful dissimilarities in tertiary structure, lipid binding ability, and receptor-mediated clearance [ 22 , 70 ]. APOE polymorphism influences the risk of occurrence and the rate of progression in several cardiovascular and neurodegenerative diseases [ 5 , 119 ]. The presence of the ε4 allele significantly increases risk of coronary artery disease, while the ε2 allele is associated with elevated plasma triglyceride level, and increases risk of peripheral vascular disease and carotid atherosclerosis [ 32 , 101 ]. Since its discovery in the early 90’s, APOE polymorphism has remained the strongest identified genetic factor affecting risk of late-onset Alzheimer’s disease (LOAD) with the ε4 allele being associated with increased disease occurrence [ 25 , 26 , 119 ], while the ε2 allele effectively lowering the risk among ε4 allele non-carriers [ 24 , 88 ]. This strong clinical effect is canonically explained by the opposing effects of ε 4 and ε2 alleles on brain clearance of soluble β-amyloid (Aβ) peptide [ 20 ], Aβ aggregation [ 37 ], and Aβ plaque formation [ 75 , 97 ], which are critical steps in establishing early AD pathology. Irrespective of promoting LOAD’s occurrence, the ε4 allele is associated with worse outcome of once established disease, via modulation of several disease mechanisms, including spread of tau pathology [ 99 ], neuroinflammatory response [ 98 ], and endo-lysosomal system dysfunction [ 100 ], which all are potent contributors to faster rate of dementia progression among ε4 carriers compared to non-carriers [ 21 , 27 , 86 ]. Besides LOAD, APOE polymorphism also affects the risk of occurrence and the rate of progression of several other neurodegenerative diseases including primary tauopathies, α-synucleinopathies, and age-related macular degeneration, but unlike LOAD, in some of these entities not the ε4 allele but the ε2 allele has been found to produce worse outcomes [ 46 , 58 , 128 ]. Prion diseases or prionoses are neurodegenerative proteinopathies, characterized by the accumulation of disease specific scrapieform conformer (PrP Sc ), which sets off a neurodegenerative cascade including proinflammatory activation of microglia and astrocytes [ 3 , 4 , 15 , 18 , 42 , 77 ] leading to widespread synaptic and neuronal loss and an ultimately fatal outcome [ 71 , 85 , 91 ]. PrP Sc arises from the cellular prion protein (PrP C ) in a process known as recycling propagation, in which PrP Sc binds PrP C during its recycling cycle between the plasma membrane and the endosomal compartment and forces PrP C to adopt its own β-sheet-rich secondary conformation [ 40 , 41 , 48 ]. Transition between PrP C and PrP Sc conformers is gradual and associated with a number of physicochemical changes, including reduced detergent solubility, oligomerization, and acquisition of partial proteolytic resistance, which is a hallmark property of PrP Sc [ 30 , 40 , 41 , 78 , 81 , 115 ]. Prionoses affect both human and non-human mammalian species [ 2 , 91 ]. The list of human prionoses include Creutzfeldt-Jakob disease (CJD), Gerstmann Straussler Scheinker syndrome, fatal familial insomnia, variably protease-sensitive prionopathy and kuru. Sporadic CJD (sCJD) with an annual incidence approximated at one case per million is the most common of the human prionoses [ 38 , 67 , 91 ]. Given several shared characteristics between sCJD and other neurodegenerative diseases, which include strong association with aging, misfolded protein centered pathology, and chronic neuroinflammatory activation, several past studies have explored how APOE polymorphism might influence the risk of sCJD occurrence. While some initial reports suggested a modest uptick in incidence among ε4 carriers [ 6 , 118 ] this association was refuted by subsequent studies [ 72 , 95 , 126 ]. Expanding knowledge on the modulatory effects played by APOE alleles in various mechanisms of neurodegeneration and separating these mechanisms into those regulating the risk of disease occurrence from those affecting the rate of progression [ 119 ] merit a careful examination whether APOE polymorphism might influence the course of neurodegeneration in prionoses. However, the limited number of clinical cases and well-recognized complexity of human prion disease, which includes factors like codon 129 polymorphism, PrP Sc subtypes, and variable presence of Aβ co-pathology [ 33 , 79 ], render systematic analysis of the APOE polymorphism effect on disease progression in human prion entities arduous to conduct and inherently underpowered [ 126 ]. To control for these variables we used APOE targeted replacement ( APOE -TR) mice, where both murine Apoe alleles are replaced by human APOE alleles [ 110 ], and infected them with 22L mouse adapted scrapie strain, which is an established and reliable laboratory model of prion disease featuring limited variability in disease latency and neuropathological metrics [ 8 , 9 , 77 , 93 ]. Using this model, we determined the detrimental effect of the ε4 allele and to a lesser extent the ε2 allele on progression of neurodegeneration compared to the ε3 allele. Material and methods Material and reagents Unless otherwise specified, all reagents and chemicals were purchased from Sigma-Aldrich (St. Louis, MO). Information on primary and secondary antibodies used for Western immunoblotting and immunohistochemistry is provided in Tables 1 and 2 , respectively. Sequences of primers used for Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) are listed in Table 3 . All primers were made to order by Sigma-Aldrich. Table 1 List of antibodies used for Western immunoblotting Antigen Host Dilution Source Cat. # Clone β-actin Mouse 1:10,000 Sigma- Aldrich, St. Louis, MO A2228 AC-74 Cluster of differentiation (CD) 230* Mouse 1:5,000 ** BioLegend, San Diego, CA 808001 6D11 Glial fibrillary acidic protein (GFAP) Rabbit 1:15,000 Dako/Agilent Technologies, Santa Clara, CA Z0334 Human apoE Goat 1:5,000 Meridian Life Science Inc., Memphis, TN K74180B HRP-linked anti-goat IgG Donkey 1:25,000 Santa Crus Biotechnology Inc., Dallas, Tx Sc-2020 HRP-linked anti-rabbit IgG F(ab’)2 specific Donkey 1:30,000 Cytiva, Marlborough, MA NA9340 HRP-linked anti-mouse IgG F(ab’)2 specific Sheep 1:30,000 Cytiva, Marlborough, MA NA9310 * CD230 denotes prion protein (PrP) ** for Western immunoblot detection of immunoprecipitated PrP, dilution of 6D11 was increased to 1:2,000 Table 2 List of antibodies used for immunohistochemistry Antigen Host Dilution Source Cat. # Clone Cluster of differentiation (CD) 68 Rat 1:250 Abcam Inc., Cambridge, MA Ab53444 FA-11 Cluster of differentiation (CD) 230* Mouse 1:200 BioLegend, San Diego, CA 808001 6D11 Complement component 3 (C3) Rat 1:100 Hycult Biotech, Uden, Netherlands HM1045 11H9 Glial fibrillary acidic protein (GFAP) Rabbit 1:2,000 Dako/Agilent Technologies, Santa Clara, CA Z0334 Ionized calcium adaptor protein 1 (IBA1) Rabbit 1:1,000 Wako Chemicals Inc., Richmond, VA 019-19741 Alexa 594-conjugated anti-mouse IgG Goat 1:500 Jackson Immuno Research Labs, West Grove, PA 115-585-146 Alexa 488- conjugated anti-rabbit IgG Goat 1:500 Jackson Immuno Research Labs 111-545-144 Alexa 594- conjugated anti-rabbit IgG Goat 1:500 Jackson Immuno Research Labs 111-585-144 Alexa 594- conjugated anti-rat IgG Goat 1:500 Jackson Immuno Research Labs 112-585-143 * CD230 denotes prion protein (PrP) Table 3 List of primer sequences used for RT-qPCR Gene Symbol Forward Primer Sequence (5’ − 3’) Reverse Primer Sequence (5’ − 3’) Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA C3 CCAGCTCCCCATTAGCTCTG GCACTTGCCTCTTTAGGAAGTC Il1α CGCTTGAGTCGGCAAAGAAAT CTTCCCGTTGCTTGACGTTG C1qa AAAGGCAATCCAGGCAATATCA TGGTTCTGGTATGGACTCTCC Aif TCTTCGTTTTACCATCAGCC TGACACGGACGCTGGCCTGAA C3ar1 TCGATGCTGACACCAATTCAA TCCCAATAGACAAGTGAGACCAA Cx3cr1 CAGCATCGACCGGTACCTT GCTGCACTGTCCGGTTGTT Gfap GGCGCTCAATGCTGGCTTCA TCTGCCTCCAGCCTCAGGTT Ccl12 ATTTCCACATTCTATGCCTCCT ATCCAGTATGGTCCTGAAGATCA Ccl2 CACTCACCTGCTGCTACTCA GCTTGGTGACAAAAACTACAGC Tnfα TGTGCTCAGAGCTTTCAACAA CTTGATGGTGGTGCATGAGA Transgenic animals All mouse care and experimental procedures were approved by Institutional Animal Care and Use Committees of the New York University Grossman School of Medicine. Apoe −/− , ε2/ε2 , ε3/ε3 , and ε4/ε4 strains have been detailed in previous publications [ 51 , 127 ]. ε2/ε2 , ε3/ε3 , and ε4/ε4 lines are APOE targeted replacement mice, where both murine Apoe alleles are replaced by isogenic human APOE alleles and those remain expressed under the endogenous Apoe promoter. We maintain a colony of APP/PS1/Apoe −/− , APP/PS1/ε2/ε2 , APP/PS1/ε3/ε3 , and APP/PS1/ε4/ε4 mice, which are heterozygous for the APP/PS1 transgene [ 56 , 75 ]. For this project we used non-transgenic offsprings from this colony, which did not carry the APP/PS1 transgene. All animals were subjected to genomic DNA analysis. They genotyped negatively for the APP/PS1 transgene, while their APOE genotype was confirmed by restricted fragment length polymorphism of the APOE amplification product as previously described [ 56 ]. All mice used in this study were on C57BL/6 background. Experimental design Prion disease was induced by intraperitoneal inoculation with 22L mouse adapted scrapie strain following our published protocols [ 77 , 93 ]. Control animals were intraperitoneally inoculated with the normal brain homogenate (NBH). Mice were inoculated at the age of 10–12 weeks, maintaining ~ 50%:50% female: male ratio per each experimental group. Mice were euthanized at 23 weeks post inoculation (wpi.), when all 22L-inoculated groups displayed overt neurological signs of prion disease, while NBH inoculated control mice appeared healthy. A subset of 22L-inoculated mice also was euthanized at 15 wpi. when the mice remain presymptomatic, to assess accumulation of PrP Sc in the lymphoreticular system (LRS) and characterize early stage of neuroinvasion. In the manuscript, 22L-inoculated mice euthanized at 15 and 23 wpi. are alternatively referred to as presymptomatic and symptomatic animals, respectively. Prion inoculation, animals’ care, and behavioral testing The 22L prion inoculum was prepared from the brains of C57BL/6 mice, which were infected with 22L mouse adapted scrapie strain and housed in an Animal Biosafety Level 2 facility until they reached the terminal stage of prion disease. Their brains were harvested and homogenized under sterile conditions in the tissue homogenization buffer (THB) maintaining 1:10 weight to volume ratio. The THB consists of 20 mM Tris-HCL pH 7.4, 250 mM sucrose, 1 mM ethylenediaminetetraacetic acid, 1 mM egtazic acid and 10 µg/mL of Complete Proteinase Inhibitor Cocktail (cOmplete) (Roche Life Science, Indianapolis, IN). After preparation, the inoculum was immediately aliquoted, flash-frozen, and stored at -80ºC until use. NBH was prepared from the brains of healthy C57BL/6 mice following the same protocol. A single prepared batch of 22L inoculum and NBH was used for the entire study. For the inoculation, aliquots of the 22L inoculum or NBH were taken out from the cryostorage and thawed. Each animal received a single intraperitoneal injection containing 100 µL of either 22L inoculum or NBH. Remnants of the aliquots were never reused but neutralized with an excess of sodium hypochlorite and disposed. Following the inoculation mice were kept in a pathogen-free Animal Biosafety Level 2 facility with 12/12-hour light/dark cycle and ad libitum food and water access. Their general health and well-being were assessed twice a week following established standards of good husbandry practice [ 12 ]. From 10 wpi. onward, mice were evaluated weekly for the first signs of prion disease using a parallel bar crossing test, which was carried out by two independent examiners blinded to APOE genotype and inoculum type. This testing evaluates an animal’s competency to cross a series of parallel bars that are 3 mm in diameter and set 7 mm apart. An animal displaying difficulties in initiating and/or completing this task in a timely and coordinated manner for three weeks in a row is considered clinically symptomatic and the first week that the positive score is assigned is considered the onset of clinical disease. Severity of neurological symptoms were longitudinally characterized using the Total Scrapie Score (TSS), which is an equally weighted composite of the following scorable metrics: somnolence, hind limb weakness, kyphosis, walk, and body condition. These behavioral metrics are scored based on the following criteria: 0 = normal, 1 = subtle, 1.5 = mild, 2 = moderate, 2.5 = advanced, and 3 = severe [ 16 , 17 , 77 , 104 ]. Their sum constitutes the TSS, which ranges from 0 in healthy animals to 15 points in terminally sick ones. TSS was assessed on a weekly basis starting from the 100th day post-inoculation (dpi) by two independent examiners who remained blinded to the animal APOE genotype. Animal euthanasia and tissue harvesting At the conclusion of the experiment animals were euthanized by a single intraperitoneal injection of Euthasol (500 µl /kg) (Virbac AH, Inc.; Westlake, TX). Once they showed absence of pain and corneal responses, they were transcardially perfused with heparinized, ice-cold 10 mM phosphate-buffered saline (PBS) pH 7.4. Their brains were extracted from the skulls and carefully stripped from the dura and vessels under the AmScope stereoscopic microscope (AmScope, Chino, CA). The olfactory bulbs, the brain stem, and the cerebellum were removed, and the corpus callosum was dissected to separate the hemispheres. The cortical mantle including the hippocampus was dissected out from the left hemisphere and either flash-frozen and stored at -80ºC or immediately used for RNA extraction. The total RNA was extracted using RNeasy Mini Kit (Qiagen Sciences Inc., Germantown, MD) following the manufacturer-provided protocol. The resulting extract was treated with 2 U of DNAse I per brain (Qiagen Sciences Inc.), flash frozen and stored at -80ºC for transcriptomic analysis. The right brain hemisphere was cut in the frontal plane at ~ 1 mm anterior to the bregma. The rostral part was immersion-fixed in 2% phosphate-buffered formalin and embedded in paraffin. The caudal part was immersion fixed in 2% paraformaldehyde in 0.1 M phosphate buffer (PB), pH 7.4 at 4ºC for a week and then dehydrated in a solution of 2% dimethyl sulfoxide and 20% glycerol in 0.1 M PB, pH 7.4 at 4°C until sectioning. Western immunoblot analyses Brain homogenate samples were removed from cryostorage, thawed, weighted, and homogenized in the THB maintaining 1:10 tissue weight to the THB volume ratio. A three-step homogenization protocol was followed where the tissue was first manually fragmented by grinding with a pestle, then triturated by repeated passing through a 28-gauge needle and finally sonicated. The remaining cellular fragments were cleared by centrifugation at 10,000 x g and 4ºC for 3 min. The protein concentration in the resulting supernatant was measured by bicinchoninic acid (BCA) method using Pierce™ Micro BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s protocol. Samples containing 5 µg of the total protein were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions using 10% gels. Resolved protein was transferred onto nitrocellulose membranes, which were blocked overnight in 5% non-fat milk at 4ºC and then incubated with primary and then horse radish peroxidase-conjugated secondary antibodies listed in Table 1 . The membranes were treated with SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher Scientific) and apposed to HyBlot CL® autoradiography films (Thomas Scientific, LLC, Swedesboro, NJ), which then were developed. For immunoblotting of the apoE protein the Western blot protocol was modified by increasing the amount of the total protein in electrophoresed samples to 20 µg and using 5% soy milk for the overnight block. To confirm equal protein load, the nitrocellulose membranes were stripped with Restore™ Western Blot Stripping Buffer (Thermo Fisher Scientific) and immunoblotted against β-actin. Autoradiography films were digitized at the resolution of 600 dots per inch and saved in TIFF format. Protein band optical densities (OD) were quantified using NIH ImageJ v2.1.0/1.53c (Bethesda, MD) following our previously established protocols [ 7 , 77 , 78 ]. For PrP protein analysis, OD of its three bands was totaled. PrP detection Aliquots of brain homogenate containing 10 µg of total protein were diluted with 10 mM PBS to the final protein concentration of 1 µg/µL and treated with Proteinase K (PK) (Roche Life Science) at 37ºC for 45 min. maintaining 10:1 protein to enzyme weight ratio. PK activity was quenched by adding 4 µL of 100 mM phenylmethylsulfonyl fluoride (PMSF) per sample and placing the samples in ice bath for 5 min. Samples were centrifuged at 20,000 x g and 4ºC for 45 min. Resulting pellets were resuspended in 20 µL of 10 mM PBS and 20 µl of sample buffer containing β-mercaptoethanol, boiled, and resolved on 12.5% SDS-PAGE. Following Western blot transfer, the PrP protein was immunodetected and densitometrically quantified as described above. To detect the presence of PrP Sc in the LRS we homogenized spleen tissue, which was first cut up into small pieces using a thin surgical blade and then thoroughly sonicated in Dulbecco’s phosphate buffered saline (DPBS) without Ca 2+ and Mg 2+ and supplemented with 10 µg/mL cOmplete. Remnants of unhomogenized tissue were cleared by centrifugation at 10,000 x g and 4ºC for 3 min. and the protein concentration in the resulting supernatant was measured by the BCA method. Samples containing 500 µg of total protein were diluted with DPBS to obtain the final volume of 100 µL, mixed with equal volume of 4% Sarkosyl in DPBS, and incubated at 37ºC for 10 min. with constant agitation in a ThermoMixer® C (Eppendorf North America, Enfield, CT). Then, Benzon nuclease and MgCl 2 were added to the final concentrations of 50 U/mL and 1 mmol/L, respectively, and the samples were incubated again at 37ºC for 30 min. To enhance sensitivity of PrP Sc detection, the total protein in the sample was precipitated with sodium phosphotungustic acid (NaPTA) [ 93 , 94 ]. A 4% stock solution of NaPTA was prepared in 170 mmol/L MgCl 2 and added to achieve the final NaPTA concentration of 0.3% in the sample. Samples were incubated at 37ºC for 30 min. in a ThermoMixer® C and then centrifuged at 15,800 x g and 4ºC for 30 min. Resulting pellets were resuspended in 50 µL of 0.1% Sarkosyl in DPBS and sonicated for 30 sec. [ 93 , 120 ]. Ten µL of sarkosyl solubilized pellet was mixed with 38 µL of PBS and digested by adding 2 µL of 1 µg/µL PK solution at 37ºC for 45 min. PK activity was quenched by adding 6 µL of 100 mM PMSF per sample and placing the samples in ice bath for 5 min. PK-digested samples were centrifugated at 20,000 x g and 4ºC for 45 min. Resulting supernatant was discarded while the pellets were resuspended in 20 µL of 10 mM PBS and 20 µL of sample buffer containing β-mercaptoethanol, boiled, and resolved on 12.5% SDS-PAGE. Following Western blot transfer, the PrP protein was immunodetected and densitometrically quantified as described above. PrP detergent solubility assay Fifty microliters of brain homogenate were mixed with 50 µL THB containing 1% Triton X-100 and 1% sodium deoxycholate and incubated on ice for 60 min. The samples were sonicated for 30 sec., incubated at 37ºC for 60 min., and centrifuged at 10,000 x g at 4ºC for 3 min. Protein concentration in the supernatant was assayed using the BCA method. Aliquots containing 100 µg of protein were diluted with 10 mM PBS to achieve 1µg/µL protein concentration and subjected to ultracentrifugation at 150,000 x g and 4ºC for 60 min. using the TLA120.2 fixed-angle rotor in Optima TL ultracentrifuge (Beckman Coulter, Indianapolis, IN). Ultracentrifugated supernatant containing detergent soluble PrP fraction was transferred into new tubes, while the pellets containing detergent insoluble PrP fraction were solubilized by sonication in 100 µL of THB containing 0.5% Triton X-100 and 0.5% sodium deoxycholate. Ten microliters of the supernatant or 10 µL of the solubilized pellet were mixed with an equal volume of sample buffer containing β-mercaptoethanol, boiled, and resolved on 12.5% SDS-PAGE. Following Western blot transfer, the PrP protein was immunodetected and densitometrically quantified as described above. Characterization of PrP oligomers Brain homogenate samples containing 600 µg of total protein were diluted with 10 mM PBS to the final volume of 200 µL, mixed with 20 µL of 10% Sarkosyl and incubated on ice for 30 min. Then they were loaded on the top of the sucrose density gradient, which was formed in polyallomer centrifuge tubes by carefully layering 300 µL of 60%, 50%, 40%, 30%, 20% and 10% sucrose solution prepared in deionized water. Velocity sedimentation was performed using TLS-55 swinging-bucket rotor in an Optima TL ultracentrifuge (Beckman Coulter, Indianapolis, IN) at 200,000 x g and 4ºC for 90 min. Fourteen fractions (145 µL each) were collected from the top to the bottom of each ultracentrifugated sample. Twenty microliters from each fraction were mixed with an equal volume of sample buffer containing β-mercaptoethanol, boiled, and resolved on 12.5% SDS-PAGE. Following Western blot transfer, the PrP protein was immunodetected and densitometrically quantified as described above. OD of the PrP signal in each fraction was converted to percentage value using the sum of OD values in all 14 fractions as denominator. Bovine serum albumin (molecular weight 68 kDa), alcohol dehydrogenase (150 kDa) and apoferritin (443 kDa) were used as molecular weight markers. They were subjected to the same velocity sedimentation, SDS-PAGE, and Western blot protocols as PrP oligomers and detected with InstantBlue Coomassie Protein Stain (ThermoFisher Scientific). Immunoprecipitation and characterization of PrP/apoE complexes M-280 Sheep anti-mouse IgG magnetic Dyanabeads™ (Thermo Fisher Scientific) were coated with anti-human apoE monoclonal antibody (mAb) HJ15.3 [ 44 , 60 , 103 ]. For each immunoprecipitated brain homogenate sample a 50 µL of manufacturer provided bead solution was mixed with 15 µg of the antibody and incubated in room temperature for 3 hrs. HJ15.3 coated beads were added to samples of brain homogenate containing 400 µg of total protein in 400 µL volume and incubated overnight at 4ºC with constant mixing on a Roto-Bot programmable rotator (Benchmark Scientific, Sayreville, NJ). On the following day, the beads were magnetically separated, washed with 10 mM PBS pH 7.4, and incubated in a solution containing 0.05 M Tris-HCL pH 8.0, 0.15 M NaCl and 2% Sarkosyl for 30 min. in room temperature with constant mixing to remove nonspecifically bound brain proteins. This step was followed by additional 30-min. and 5-min. incubations in 0.05 M Tris-HCl solution pH 8.0 containing 0.5 M NaCl and 1% Sarkosyl in room temperature, with constant mixing. Finally, the beads were magnetically separated and resuspended in 20 µL of 10 mM PBS and 20 µL of sample buffer containing β-mercaptoethanol, boiled, and resolved on 12.5% SDS-PAGE. Following Western blot transfer, the PrP protein was immunodetected as described above. To confirm the presence of the apoE protein in immunoprecipitated complexes, the nitrocellulose membranes were stripped with Restore™ Western Blot Stripping Buffer (Thermo Fisher Scientific) and immunoblotted with anti-human ApoE goat polyclonal antibody (Table 1 ). Histology, immunochemistry, and quantitative neuropathology Paraffin blocks containing the rostral portion of the right hemisphere were cut into 5-µm-thick coronal sections, which were then stained with hematoxylin-eosin. The load of spongiform lesions in the M1 primary motor cortex was quantified at three approximated bregma levels (+ 1.0 mm, + 1.2 mm, and + 1.4 mm) following our previously published protocols [ 77 ]]. The caudal portion of the right hemisphere was cut serially using a freezing microtome (Leica Microsystems, Weltzer, Germany) into 40-µm-thick coronal sections, which were alternately collected into 10 series and stored in a cryoprotectant solution consisting of 30% ethylene glycol and 30% sucrose in 0.1M PB, pH 7.4. Randomly selected series of sections were immunostained against the following antigens [ 1 ] cluster of differentiation (CD) 230 (a.k.a. prion protein [PrP]), [ 2 ] ionized calcium adaptor protein 1 (IBA1), [ 3 ] cluster of differentiation (CD) 68, [ 4 ] glial fibrillary acidic protein (GFAP), and [ 5 ] complement component 3 (C3) in combination with GFAP. An antigen retrieval protocol was used for all immunostainings and involved incubating the sections in 10 mM sodium citrate pH 6.0 with 0.05% Tween 20 at 85ºC for 15 min. For anti-CD230 immunostaining, sections were additionally incubated in 98% formic acid at room temperature for 10 min. to disrupt β-sheet-pleated secondary structure of the PrP Sc conformer. Non-specific staining was reduced using a blocking mixture which contained 10% normal goat serum, 1% bovine serum albumin and 0.3% Triton X-100 in 10 mM PBS pH 7.4 in room temperature for two hours. For mouse-derived primary antibodies, the mouse-on-mouse blocking reagent (Vector Laboratories; Burlingame, CA) was added to the blocking mixture at the amount of 1.5 µL per 1mL. The list of primary antibodies and fluorochrome-conjugated secondary antibodies, along with their working dilutions is provided in Table 2 . Double anti-GFAP/anti-C3 immunostaining was performed using a mixture of primary antibodies to respective antigens, followed by a mixture of fluorochrome-conjugated secondary antibodies. All immunostainings were carried out on free floating sections. Sections were washed thrice with excess 10 mM PBS pH 7.4 and 0.1% Triton X-100 between each step of the protocol. Immunostained sections were carried onto glass histological slides, briefly air-dried, and coverslipped using Depex mounting medium (Thermo Fisher Scientific, Waltham, MA). They were digitized and subjected to quantitative analysis following our published protocols [ 75 – 77 ]. Quantitative metrics included [ 1 ] integrated density (ID) of anti-CD230 (PrP) immunostaining, the load of [ 2 ] IBA1 + and [ 3 ] CD68 + microglia, [ 4 ] the load of GFAP + astrocytes, and [ 5 ] ratio of C3 + to GFAP + immunostaining in astrocytes. All quantitative analyses were performed in the S1 primary somatosensory cortex at three approximated bregma levels (0.0 mm, -0.4 mm, and − 0.8 mm). NanoStringTM nCounter® analysis of glial transcript Aliquots of previously isolated total RNA were removed from − 80ºC cryostorage and assayed for purity and integrity using a 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA). Only samples with the RNA Integrity Number ≥ 7 were used for gene expression analysis. RNA concentration in the samples was determined by NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific). The nCounter Mouse Glial Profiling Panel (NanoString Technologies, Inc., Seattle, WA) was used to assess the expression of 770 glia specific genes in samples containing 100 ng of total RNA. This analysis was carried out by the Genome Technology Center at NYU Grossman School of Medicine using nCounter MAX Analysis System. Gene expression data were analyzed using nSolver Analysis Software v4.0 (NanoString Technologies Inc.) and included only genes consistently producing a read of ≥ 25 counts per brain. Raw counts were normalized using 13 internal reference genes as described before [ 77 ]. Gene expression heatmaps were created using the nSolver Analysis Software v4.0, which also was used for cluster analysis of individual animals. In addition, we computed a fold change for each analyzed gene in 22L-infected animals relative to their APOE -matched NBH inoculated controls. Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) analysis Two micrograms of total RNA per brain were reverse transcribed into cDNA using an iScript™ Advanced cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA). Sequences of primers used to determine the expression of target and housekeeping genes are listed in Table 3 . Their amplification efficiency was vetted and optimized to remain within the 90% to 110% range. The qPCR was performed using SsoAdvanced Universal SYBR Green Supermix on the CFX96 Real-Time System (Bio-Rad Laboratories). Differences in gene expression were analyzed using ΔΔCt method [ 65 , 77 ]. Statistical analysis Disease latency time was analyzed using Kaplan-Meier estimator and the differences across APOE genotypes were compared using Log-Rank test. Differences in the total scrapie score and its components were tracked longitudinally and analyzed by repeated measures analysis of variance (ANOVA). Data distribution of individual, quantitative metrics was vetted using Kolmogorov-Smirnov and Shapiro-Wilk tests to assess conformity with the normal distribution pattern. Differences across multiple data sets were first analyzed with one-way ANOVA, which was followed by Holm-Sidak’s post hoc test, comparing pairs of individual experimental groups. Sex differences within individual experimental groups were tested with the help of unpaired t-test with Welch’s correction. Differences in the PrP signal distribution across 14 fractions resulting from sucrose density gradient centrifugation of brain homogenate were determined using the Kolmogorov-Smirnov test between each pair of experimental groups. GraphPad Prism (v10.4.1 for Windows, GraphPad Software, Boston, MA) was used for all statistical analyses and graph making. Results APOE genotype modulates latency, symptom progression, and pathology burden in a mouse model of prion disease The latency period of prion disease was determined through serial locomotor testing, and the differences across animals of different APOE genotypes were compared using the Kaplan-Meier estimator. The ε4/ε4 22L mice were the first to show neurological signs of the prion disease with a median latency of 115.0 days in females and 113.5 days in males. The ε2/ε2 22L mice were second to be affected with a median latency of 135.0 days in females and 131.5 days in males, followed by ε3/ε3 22L mice, where the median latency was 136.0 days for both sexes. Differences across APOE genotypes both for female and male animals were statistically significant (Fig. 1 a), while female and male mice of the same APOE genotype showed no significant differences (Supplementary File 1; Fig. S1 ). To quantify progression and severity of neurological symptoms we conducted serial assessments using the Total Scrapie Score (TSS) in a subset of 22L-infected mice. The TSS is a 15-point cumulative scale, accounting for five scorable behavioral metrics: animal alertness (somnolence), hind limb weakness, posture (kyphosis), walking competency, and body condition. Both ε4/ε4 22L females and males showed the most aggressive tempo of disease progression compared to mice of other APOE genotypes. At 23 weeks post inoculation (wpi.), which was the final time point of the experiment, ε4/ε4 22L females scored on average 13.8 ± 0.1 pts. on the TSS scale ( p < 0.0001 vs. ε2/ε2 22L and ε3/ε3 22L ), while ε4/ε4 22L males scored 13.1 ± 0.1 pts. ( p < 0.0001 vs. ε2/ε2 22L and ε3/ε3 22L ) (Fig. 1 b). ε2/ε2 22L mice scored worse than ε3/ε3 22L mice, with females and males scoring an average of 9.8 ± 0.1 pts. ( p < 0.0001 vs. ε3/ε3 22L ) and 9.7 ± 0.2 pts. ( p > ε2 > ε3 APOE allele gradient effect was consistent across all five individual components of the TSS, with the most prominent differences in respect to alertness, walk, and body condition (Supplementary File 1: Fig. S2 a, b). Differences in the TSS and its individual components between APOE genotype matched female and male mice were not statistically significant. To ensure that differences in disease latency and the tempo of symptoms progression across mice of different APOE genotypes are not caused by variable accumulation of PrP Sc in the LRS, we assayed the level of PK-resistant PrP Sc in the spleen homogenate. In presymptomatic 22L-infected mice, which were killed at 15 wpi., PrP Sc was readily detectable in the spleen, but its level did not significantly differ across APOE genotypes (Supplementary File 1: Fig. S3 a, b). In NBH-inoculated control animals no PK-resistant PrP Sc signal was detectable. To determine the effect of the APOE genotype on the burden of prion pathology in the brain we quantified the load of spongiform lesions in the M1 motor cortex. Presymptomatic 22L-infected mice showed only a limited number of spongiform lesions. In contrast, symptomatic mice, euthanized at 23 wpi. featured numerous spongiform lesions, which load was significantly affected by the APOE genotype. In ε4/ε4 22L mice the spongiform lesion load was 1.24- and 1.44-fold higher than that in ε2/ε2 22L and ε3/ε3 22L animals ( p < 0.0001), respectively; with the difference between the two latter groups being significant ( p < 0.05) (Fig. 1 c, d). We also analyzed, the integrated density (ID) of anti-PrP immunostaining in the S1 somatosensory cortex. Not presymptomatic, but symptomatic 22L-infected mice showed a significant increase in the anti-PrP ID values relative to NBH controls, and this effect was APOE genotype dependent (Fig. 1 e, f). ε4/ε4 22L mice had 2.0 and 2.6- fold higher values of anti-PrP ID compared to ε2/ε2 22L and ε3/ε3 22L animals ( p < 0.0001), respectively; with the difference between the latter two groups not reaching statistical significance. Differences in the spongiform lesion load and the anti-PrP ID values between female and male animals for matching APOE genotypes, inoculum type, and the survival time were not statistically significant (Supplementary File 1: Fig. S4 a, b). The APOE ε4 allele is associated with greater PrP accumulation, PrP Sc conversion, and aggregation Prion pathology is invariably associated with an increase in the brain total PrP protein level and the appearance of its PK-resistant conformer PrP Sc . The total PrP level showed no differences across NBH-inoculated control mice of various APOE genotypes and no significant increase in presymptomatic 22L-infected mice, at 15 wpi. In contrast, symptomatic 22L-infected mice, euthanized at 23 wpi., featured a marked increase in the total brain PrP level by ~ 4- to ~ 5- folds compared to APOE matched NBH controls ( p < 0.0001) (Fig. 2 a, b). The highest total PrP level was found in ε4/ε4 22L mice, and it was 1.2- and 1.3-fold higher than those in ε2/ε2 22L ( p < 0.01) and ε3/ε3 22L ( p < 0.0001) animals, respectively; with the difference between the two latter groups not reaching statistical significance. The PrP Sc conformer was undetectable by the PK-digestion assay in the brains of NBH-controls and presymptomatic 22L-infected mice. In contrast, in symptomatic 22L-infected mice PrP Sc was abundantly detected, and its level was significantly potentiated by the presence of the ε4 allele (Fig. 2 c, d). ε4/ε4 22L mice featured 1.24- and 1.37-fold higher PrP Sc level compared to ε2/ε2 22L ( p < 0.01) and ε3/ε3 22L mice ( p < 0.001), respectively; with the difference between the two latter groups not reaching statistical significance. Using the detergent solubility assay, we characterized solubility changes the PrP protein undergoes during the PrP C to PrP Sc transformation. Brains from NBH and presymptomatic 22L-infected mice showed no evidence of detergent insoluble PrP protein. In symptomatic, 22L-infected mice detergent insoluble PrP, was not only abundantly present, but its amount well exceeded that detected in the detergent soluble fraction. The highest ratio of detergent insoluble to detergent soluble PrP was in ε4/ε4 22L mice (9.4 ± 0.8) and it was significantly higher than those in ε2/ε2 22L mice (6.7 ± 0.4) ( p < 0.001) and in ε3/ε3 22L mice (5.7 ± 0.7) ( p < 0.0001) (Fig. 2 e, f). The difference between ε2/ε2 22L and ε3/ε3 22L mice was not statistically significant. Differences in the total PrP level, PrP Sc level, and the insoluble to soluble PrP ratio between female and male mice for matching APOE genotype, inoculum, and survival time were not statistically significant (Supplementary File 1: Fig. S5 a-c). We also investigated the effect of APOE genotype on PrP oligomerization by subjecting brain cortex homogenate to sucrose gradient centrifugation. The resulting 14 fractions were individually collected and resolved using SDS-PAGE under reducing conditions and immunoblotted for PrP (Fig. 3 a, b). Brains from NBH-inoculated and symptomatic, 22L-infected ε2/ε2 , ε3/ε3 , and ε4/ε4 mice were examined along with those from Apoe −/− mice. In NBH controls, the PrP signal was detectable only in fractions 1–4 and its distribution showed no statistically significant differences across APOE genotype (Fig. 3 c; Supplementary File 2: Table S1 ). In contrast, in 22L-infected mice, the PrP signal was detected across all 14 fractions, and its distribution bore a significant ε4 effect (Fig. 3 d). The ε4/ε4 22L mice featured the most pronounced, right-sided shift in the PrP signal distribution across the 14 fractions compared to any other 22L-infected APOE genotype or Apoe −/− animals ( p < 0.0001). Differences in the PrP signal distribution pattern between Apoe −/− 22L and ε2/ε2 22L or ε3/ε3 22L mice were insignificant. A statistically significant difference was noted only between ε2/ε2 22L and ε3/ε3 22L mice ( p < 0.01) owing to the most left-sided shift in the signal distribution in the latter group. To better visualize the ε4 effect in 22L-infected mice we grouped the fractions into four clusters 1–4, 5–7, 8–10, and 11–14, and showed the proportional contribution of each cluster to the total PrP signal in all 14 fractions using pie charts (Fig. 3 e). In ε4/ε4 22L mice, the cluster 11–14 contributed 25.7% of the total PrP signal, while for comparison in ε2/ε2 22L , ε3/ε3 22L , and Apoe −/− 22L groups its contribution ranged from 12.4% to 13.8%. Conversely, the cluster 1–4 in ε4/ε4 22L mice constituted 32.3% of the total PrP signal, while in ε2/ε2 22L , ε3/ε3 22L , and Apoe −/− 22L groups its contribution ranged from 41.7% to 49.8%. This experiment demonstrates that while PrP oligomerization is an inherent feature of the prion proteinopathy, it is promoted only in the presence of the ε4 allele, as there are no significant differences between Apoe −/− 22L and ε2/ε2 22L or ε3/ε3 22L animals. Increase in the apoE protein level and formation of the PrP/apoE complexes during prion infection is APOE genotype dependent Consistently with previously published data, we found a significant effect of the APOE genotype on the brain apoE protein level in NBH control mice. ε2/ε2 NBH animals featured 1.2- and 1.5- fold higher apoE level compared to ε3/ε3 NBH ( p < 0.05) and ε4/ε4 NBH mice ( p < 0.0001) (Fig. 4 a; Supplementary File 1: Fig. S6), respectively; with the difference between ε3/ε3 NBH and ε4/ε4 NBH mice being statistically significant ( p < 0.01). Prion infection gave rise to a significant increase in the brain apoE level in symptomatic (23 wpi.) but not in presymptomatic (15 wpi.) animals (Fig. 4 a, b). The magnitude of this increase varied across APOE genotypes, and it was the highest in ε4/ε4 22L mice, where the level of apoE protein rose 1.6-fold relative to ε4/ε4 NBH controls ( p < 0.0001). Both in ε2/ε2 22L and ε3/ε3 22L mice the increase in apoE level was 1.3-fold relative to ε2/ε2 NBH ( p < 0.01) and ε3/ε3 NBH ( p < 0.05) controls, respectively. Animal sex had no significant effect on the brain apoE level, neither in NBH-controls nor in 22L-infected mice (Supplementary File 1: Fig. S7). To determine whether apoE directly interacts with PrP, we immunoprecipitated the apoE/PrP complexes from the brain cortex homogenate using magnetic beads coated with HJ15.3 mAb, which reacts with the human apoE sequence. Captured complexes were resolved on SDS-PAGE under reducing conditions and the resulting monomeric PrP was detected using anti-CD230 clone 6D11 mAb (Fig. 4 c). The PrP signal was detected in symptomatic ε2/ε2 22L , ε3/ε3 22L , and ε4/ε4 22L mice, but not in NBH-inoculated controls. Optical density (OD) of the PrP protein band released from the complexes in ε4/ε4 22L mice was ~ 1.6-fold higher compared to ε2/ε2 22L or ε3/ε3 22L mice ( p < 0.0001) (Fig. 4 d), while the difference between the latter two groups was not statistically significant. We also quantified the PrP/apoE OD ratio by dividing the PrP protein band OD by that of apoE, which was detected on the same membrane as PrP, following membrane stripping and re-probing with goat polyclonal anti-human apoE antibody. The PrP/apoE OD ratio in ε4/ε4 22L mice was 2.8- and 1.7- fold higher than those in ε2/ε2 22L and ε3/ε3 22L mice ( p < 0.05) (Fig. 4 e), respectively, while the difference between the latter two groups was not statistically significant. As additional negative experimental controls, we used brain cortex homogenate from Apoe −/− NBH and Apoe −/− 22L animals, in which no apoE/PrP complexes were detected. Our findings indicate that the apoE protein directly interacts with PrP but only in prion disease and not under physiological conditions. Microglia activation is differentially regulated by the APOE genotype Microglia activation was characterized by unbiased quantification of IBA1- and CD68-positive microglia load in the S1 somatosensory cortex alongside transcriptomic analysis of microglia specific genes. Presymptomatic, 22L-infected mice (15 wpi.) already showed a modest, but statistically insignificant increase in the IBA1 and CD68 load relative to NBH-inoculated controls. A robust and significant increase in the IBA1 and CD68 load was observed in symptomatic 22L-infected mice (23 wpi.), and this effect was APOE genotype dependent (Fig. 5 a-d). The strongest activation of microglia was noted in ε4/ε4 22L mice, which had a 1.32- and 1.64-fold greater IBA1 load relative to the ε2/ε2 22L ( p < 0.0001) and ε3/ε3 22L ( p < 0.0001) mice, respectively. Likewise, ε4/ε4 22L mice showed 1.04-fold and 1.17-fold greater CD68 load relative to ε2/ε2 22L (non-significant) and ε3/ε3 22L ( p < 0.05) mice, respectively. The value of IBA1 load in ε2/ε2 22L mice was significantly higher than that in ε3/ε3 22L mice ( p < 0.0001), while the difference in the CD68 load insignificantly favored ε2/ε2 22L animals. It is noteworthy that the increase in the IBA1 load in symptomatic 22L-infected mice relative to their APOE -matched NBH controls ranged between 1.7-fold and 2.8-fold, while the increase in the CD68 load ranged between 16.4-fold and 22.7-fold. Differences in the IBA1 and CD68 load values between female and male animals for matching APOE genotypes, inoculum type, and the survival time were not statistically significant (Supplementary File 1: Fig. S8 a, b). Transcriptomic analysis included microglial genes, which were significantly upregulated in at least one APOE genotype within the symptomatic 22L-infected group compared to APOE -matched NBH controls (Supplementary File 2: Table S2 ). Significantly upregulated genes were grouped into three functional categories 1) activated microglia markers ( Aif1, Csf1r, Cst7, P2ry12, Siglech , and Tmem119 ), 2) genes involved in immune response ( C1qa, C1qb, C1qc, C4a/b, C3ar1, Csf3r, Csf1 , and Ccl3 ), 3) and those encoding various microglia recognition receptors ( Axl, Cx3cr1, Fcrls, Clec7a, Mertk, P2ry6, Stab1 , Trem2 , and Tyrobp ). Hierarchical cluster analysis of all genes showed no systematic clustering across individual NBH animals. In contrast, 22L-infected animals featured a strong hierarchical signal (Fig. 6 a). First, the animals clustered within their APOE genotypes, and then ε2/ε2 22L and ε4/ε4 22L animals clustered together separate from ε3/ε3 22L animals. We also compared differences in the fold increase of individual gene expression across APOE genotypes. ε4/ε4 22L mice showed significantly higher upregulations of all genes compared to ε3/ε3 22L mice and Aif1, C1qa, C1qb, C1qc, C4a/b, C3ar1, Csf1, Fcrls, Mertk, P2ry6, Stab1 genes compared to ε2/ε2 22L mice (Fig. 6 b-d). Aif1, Cst7, P2ry12, Tmem119, C1qb, C1qc, Ccl3, Cx3cr1, Fcrls, Clec7a, Trem2 , and Tyrobp genes were expressed at significantly higher level in ε2/ε2 22L mice compared to ε3/ε3 22L mice. Cst7, C4a/b, Ccl3 , and Clec7a were found to be upregulated at particularly high level (≥ 10-fold relative to NBH controls) in at least one of the APOE genotypes (Supplementary File 2: Table S2 ). APOE genotype differentially modulates activation of astrocytes during prion infection Astrocytic activation was characterized by determining changes in the GFAP protein level by quantitative immunoblotting, unbiased quantification of GFAP and C3-positive astrocyte load in the S1 somatosensory cortex and transcriptomic analysis of astrocyte specific genes. GFAP protein level showed no differences across APOE genotypes in NBH-inoculated controls. In presymptomatic 22L-infected mice (15 wpi.), it was modestly, albeit insignificantly increased (1.1-1.2-fold), while in symptomatic 22L-infected mice (23 wpi.) its level ranged between 2.2-fold and 3.1-fold relative to APOE -matched NBH controls ( p < 0.0001) (Fig. 7 a, b). Differences across APOE genotypes in symptomatic 22L-infected mice were statistically significant with ε4/ε4 22L mice featuring 1.3- and 1.4-fold higher GFAP protein level compared to ε2/ε2 22L ( p < 0.001) and ε3/ε3 22L mice ( p < 0.0001), respectively; while the difference between the latter two groups was not significant. The load of GFAP positive astrocytes in the S1 somatosensory cortex was already significantly increased in presymptomatic 22L-infected mice (15 wpi.) ( p < 0.0001) (Fig. 7 c, d), but without any significant APOE genotype effect. Symptomatic 22L-infected mice (23 wpi.) featured further increase in the GFAP load, which ranged between 20.1- and 32.1-fold relative to NBH controls ( p < 0.0001). ε4/ε4 22L mice had a 1.3- and 1.4-fold higher GFAP load compared to ε2/ε2 22L ( p < 0.0001) and ε3/ε3 22L mice ( p < 0.0001), respectively, and the difference between the latter two groups was statistically significant ( p < 0.01). We also quantified the load of C3-positive astrocytes and analyzed it in relation to the GFAP load (Fig. 7 e, f). In NBH-inoculated control mice, C3-positive astrocytes were absent. For the first time, expression of C3 in astrocytes was noted in presymptomatic 22L-infected mice, where the C3/GFAP ratio ranged between 0.08 and 0.11 across APOE genotypes ( p < 0.01 to p < 0.0001 vs. NBH). In symptomatic 22L-infected mice, the C3 expression increased further with C3/GFAP ratio reaching values of 0.49 to 0.71 across APOE genotypes ( p < 0.0001 vs. NBH or 22L at 15 wpi). Differences in the C3/GFAP ratio showed a significant APOE -genotype effect in symptomatic but not in presymptomatic animals. Symptomatic ε4/ε4 22L mice featured 1.2- and 1.4-fold higher values of the C3/GFAP ratio compared to ε2/ε2 22L ( p < 0.0001) and ε3/ε3 22L mice ( p < 0.0001), respectively; with the difference between the latter two groups also being statistically significant ( p < 0.05). There were no statistically significant differences in respect to the GFAP protein level, the GFAP-positive astrocyte load, and the C3/GFAP ratio between female and male animals for matching APOE genotype, inoculum type, and survival time (Supplementary File 1: Fig. S9 a-c). Transcriptomic analysis included those astrocytic genes, which were significantly upregulated in at least one APOE genotype in symptomatic 22L-infected mice relative to their APOE -matched NBH controls (Supplementary File 2; Tab S3). Analyzed genes were grouped into four functional categories: 1) markers of reactive astrocytes ( Aldh1l1, Aqp4, Gfap, Serpina3n, Slc1a3, Sox9, Vim ), 2) genes involved in antigen presenting and processing ( H2-D1, H2-T23, Tap1 ), 3) genes involved in immune response ( Ccl12, Cd14 ), and 4) those encoding astrocytic markers, whose expression is induced by interferons ( Stat1, Stat2, Stat3, Gbp2, Psmb8 ). Hierarchical cluster analysis of all genes showed no systematic clustering across individual NBH-inoculated animals. ε3/ε3 22L mice clustered separately from ε2/ε2 22L and ε4/ε4 22L mice, which clustered together. All NBH animals clustered separately from 22L-infected animals (Fig. 8 a). We also compared differences in the fold increase of individual genes across APOE genotypes. ε4/ε4 22L mice showed significantly greater expression of all genes compared to ε3/ε3 22L mice except for Tap1 and Gbp2 (Fig. 8 b-e). ε4/ε4 22L mice also showed significantly greater expression of Aldh1l1, Gfap, Serpina3n, Vim, H2-D1, H2-T23, Ccl12, Stat2 , and Stat3 compared to ε2/ε2 22L mice. Aldh1l1, Aqp4, Tap1, Ccl12, Cd14 , and Psmb8 genes were upregulated at significantly higher level in ε2/ε2 22L mice compared to ε3/ε3 22L mice. Gfap, Serpina3n, Vim , and Ccl12 were upregulated at particularly high level (≥ 10-fold relative to NBH controls) in at least one of the APOE genotypes (Supplementary File 2: Table S3 ). APOE genotype differentially regulates reciprocal proinflammatory crosstalk between microglia and astrocytes Chronically reactive microglia secrete a triad of cytokines IL1-α, TNFα, and C1QA, which stimulate reactive astrocytes. These in turn secrete C3, which reciprocally stimulates neurodegenerative microglia. We explored the effect of APOE genotype on this pathway in prion infected mice using qRT-PCR (Fig. 9 a-c). We compared the expression of Il1α , Tnfα , C1qa , and C3 genes alongside expression of genes which are considered transcriptomic markers of neurodegenerative microglia phenotype ( Aif1 , C3ar1 , and Cx3cr1 ) and those specifically associated with chronically reactive astrocytes ( Gfap , Ccl12 , and Ccl2 ). No changes in expression level of any of these genes were found in presymptomatic 22L-inoculated mice (15 wpi.) compared to NBH-inoculated controls for matching APOE genotypes. In contrast, symptomatic 22L-inoculated mice (23 wpi.) showed significant upregulation of all interrogated genes with significant differences across the APOE genotypes. The highest expression of all the genes was found in ε4/ε4 22L mice with differences between ε4/ε4 22L mice and ε2/ε2 22L and ε3/ε3 22L mice being statistically significant for all genes ( p < 0.05 to p < 0.0001) except for Cx3cr1 ( ε4/ε4 22L vs. ε3/ε3 22L ). Expression of Il1α , C1qa , C3, Aif1 , Cx3cr1 and Ccl12 genes was significantly higher in ε2/ε2 22L mice compared to ε3/ε3 22L animals ( p < 0.05 to p < 0.01). Discussion By infecting APOE -TR mice with 22L mouse adapted scrapie strain, we identified a differential effect of human APOE alleles on prion induced neurodegeneration. ε4/ε4 22L mice featured the shortest disease latency, the fastest progression of neurological symptoms, the worst neurological score at the end of the study, and the highest load of spongiform lesions, PrP Sc level, and neuroinflammatory response. In addition, we found that ε2/ε2 22L mice performed worse in respect to behavioral, neuropathological, and neuroinflammatory metrics compared to ε3/ε3 22L animals, which suggests the ε2 allele might be a disadvantageous rather than protective determinant in prion pathology. Examination of spleens and brains of presymptomatic mice euthanized at 15 wpi., showed no evidence of differential effect of APOE alleles on PrP Sc accumulation in the LRS or early brain pathology. This indicates prion neuroinvasion is independent of the APOE polymorphism and the variance we observed in disease outcomes results from differential effect of the APOE polymorphism on ensuing brain pathology. This is an important observation since apoE is expressed by the spleen’s dendritic cells [ 5 ]], which are known to replicate PrP Sc and constitute its reservoirs outside the central nervous system [ 10 , 83 ]. Conformational transformation of PrP C into PrP Sc is central to prion pathogenesis and involves several physicochemical changes within the PrP protein, which include reduced detergent solubility, oligomerization, acquisition of proteolytic resistance, and accumulation [ 30 , 40 , 41 , 78 , 81 , 115 ]. ε4/ε4 22L mice featured significantly higher level of the total brain PrP, confirmed both by quantitative immunohistochemistry and Western immunoblotting, PK-resistant PrP Sc , and insoluble PrP fraction compared to ε2/ε2 22L and ε3/ε3 22L animals, in which values of these metrics were similar. Characterization of PrP oligomeric assemblies performed using sucrose density gradient centrifugation of brain homogenate detected PrP signal only in fractions 1–4 in NBH inoculated controls while in 22L infected mice the PrP signal was predominantly present in fractions 8–14. Apoe −/− 22L , ε2/ε2 22L , and ε3/ε3 22L mice showed similar pattern of PrP signal distribution across all 14 fractions, what suggests apoE is not a prerequisite for PrP oligomer formation since these are detectable in Apoe −/− 22L mice. However, ε4/ε4 22L animals featured a distinctly different PrP distribution pattern characterized by significantly increased signal in fractions 11–14, which represent higher order oligomers (+ 10-mers). This finding indicates that apoE4 isoform effectively promotes PrP oligomerization. Consistent with several published studies, we found the brain level of apoE protein is APOE genotype dependent, with ε2/ε2 NBH and ε4/ε4 NBH animals representing opposite ends of the spectrum [ 28 , 63 , 109 , 116 ]. The mechanism(s) underlying this phenomenon have not been fully elucidated, though differential receptor mediated clearance of various apoE isoforms has been postulated to play a central role. We previously showed that prion pathology is associated both with an increase in the brain apoE level and cell-type shift in apoE expression [ 77 ]. While under physiological conditions the bulk of brain apoE is produced by resting or A0 astrocytes, their activation is associated with reduced apoE expression [ 77 ]. Conversely, while resting (M0) microglia do not produce apoE, de-repression of apoE translation is an unique characteristic of their reactive states commonly referred to as disease-associated microglia (DAM) or microglia neurodegenerative phenotype (MGnD) [ 49 , 53 ]. In all three APOE -TR lines, prion pathology was associated with increase in the total brain apoE level, but the magnitude of this effect was APOE -genotype dependent. While ε2/ε2 22L , and ε3/ε3 22L mice featured a similar fold change relative to their APOE genotype matched NBH controls, the relative increase in ε4/ε4 22L mice was significantly higher. Notably ε4/ε4 22L animals featured the highest degree of microglia and astrocyte activation compared to ε2/ε2 22L , and ε3/ε3 22L mice, what reasonably can explain the highest relative increase in apoE level in this line. Using immunoprecipitation assay, we found apoE protein and disease-altered PrP form complexes, which become dissociated under reducing conditions. ApoE/PrP complexes were immunoprecipitated using HJ15.3 anti-apoE clone [ 44 , 60 , 103 ] and detected using 6D11 anti-PrP clone [ 93 , 102 ]. Interestingly, the immunoprecipitation experiment did not work in reverse where 6D11 and HJ15.3 clones were used as the capture and the detection antibodies, respectively. This suggests, binding of apoE to PrP might hinder the 6D11 epitope comprised of residues 97–100 (QWNK) of murine PrP [ 102 ]. This epitope is known to be conserved between mouse and human sequences and corresponds to residues 98–101 of the latter [ 93 ], which implies similar interaction between apoE and PrP might take place in human prionoses. It is noteworthy that the 6D11 PrP epitope also was proposed to interact with Aβ oligomers, while its hindrance was shown to prevent binding of Aβ oligomers to excitatory synapses and reduce intraneuronal tau phosphorylation and aggregation [ 57 , 117 ]. The amount of PrP, which was released from immunoprecipitated complexes under reducing conditions was similar between ε2/ε2 22L , and ε3/ε3 22L mice but significantly higher in ε4/ε4 22L animals. This increased ratio between apoE and PrP in ε4/ε4 22L mice suggests stronger interaction between PrP and apoE4 than between PrP and other apoE isoforms and might explain the propensity for increased formation of large order oligomers observed in ε4/ε4 22L animals. Since no apoE/PrP complexes were detected in NBH-inoculated control, it is likely that disease specific changes in the PrP protein conformation and/or changes in its physicochemical properties constitute prerequisites for the interaction with apoE. Taking it together, we found numerous aspects of PrP proteinopathy that were significantly enhanced in the presence of the ε4 allele including elevated levels of the total PrP, PrP Sc , detergent insoluble PrP, enhanced PrP oligomerization and evidence of increased complexing of pathologically altered PrP with apoE, which constitute one important mechanism, through which the ε4 allele negatively affects the outcome of prion disease. The isoform-specific interaction between apoE and various disease-specific misfolded proteins is a recognized mechanism through which apoE propagates aggregation and deposition of these proteins. Besides a well-established effect of apoE directly interacting with Aβ and particularly apoE4 promoting Aβ oligomerization and fibrillization [ 66 , 92 , 96 , 106 , 108 ], there is evidence derived both from transgenic animal and in vitro studies apoE4 may directly promote α-synuclein aggregation [ 31 , 36 ]. In contrast, in vitro studies have identified that recombinant as well as lipidated, apoE2 and to a lesser extent apoE3, but not apoE4 form complexes with recombinant human tau [ 105 , 107 , 128 ]. Prion pathology is inherently associated with early and robust inflammatory activation of astrocytes and microglia [ 3 , 4 , 15 , 18 , 42 , 77 ]. In fact, GFAP-reactive astrogliosis was the first neuropathological metric clearly showing a significant increase in presymptomatic APOE -TR mice at 15 wpi. We found a strong APOE genotype effect on the magnitude of microglia and astrocyte activation both reflected by differences in the load of activated microglia and astrocytes and differences in microglia and astrocyte specific transcript. Characterization of the transcript using a nanoStringTM nCounter® analysis showed significant upregulation in a number of microglia specific genes, canonically categorized as markers of microglia activation ( Aif1, Csf1r, Cst7, and Siglech ), genes involved in immune response ( C1qa, C1qb, C1qc, C4a/b, C3ar1, Csf3r, Csf1 , and Ccl3 ), and those encoding various microglia recognition receptors ( Axl, Cx3cr1, Fcrls, Clec7a, Mertk, P2ry6, Stab1 , Trem2 , and Tyrobp ). Similarly, several categories of astrocyte specific genes were upregulated including reactive astrocyte markers ( Aldh1l1, Aqp4, Gfap, Serpina3n, Slc1a3, Sox9, Vim ), genes involved in antigen presenting and processing ( H2-D1, H2-T23, Tap1 ), genes involved in immune response ( Ccl12, Cd14 ), and those encoding astrocytic markers, which expression is induced by interferons ( Stat1, Stat2, Stat3, Gbp2, Psmb8 ). Nearly all these genes were expressed in ε4/ε4 22L mice at a significantly higher level than in ε2/ε2 22L , and ε3/ε3 22L mice, while majority of them also showed significantly higher expression in ε2/ε2 22L mice compared with ε3/ε3 22L animals. This ε4 > ε2 > ε3 allele gradient effect could be demonstrated both through cluster analysis of microglia and astrocyte specific gene sets and comparison of individual gene expression through one-way ANOVA. Among significantly upregulated microglia genes we found P2ry12 , and Tmem119 , which together with Cx3cr1 encoding fractalkine receptor are canonically categorized as microglia homeostatic (M0) genes. Their expression is controlled by TGFβ signaling [ 13 ]] and they become commonly downregulated in microglia adopting DAM or MGnD states [ 14 , 39 , 49 , 53 , 84 ]. However, there also is prior evidence for modest increase in P2ry12, Tmem119 and Cx3cr1 transcript in mouse prion models, especially in bulk RNA transcript analysis, what suggests a disease-specific effect on their expression [ 11 , 42 , 55 , 77 ]. Several genes were found to be expressed more than 10-folds higher in prion infected mice compared to NBH controls in at least one APOE genotype. This list both includes genes specific for microglia Cst7, C4a/b, Ccl3 , and Clec7a and for astrocytes Gfap, Serpina3n, Vim , and Ccl12. Cst7 encodes cystatin F, which is an endosomal cysteine protease inhibitor, and its upregulation has been confirmed across several prion and AD studies most likely as a function of ongoing lysosomal pathology [ 29 , 43 , 74 , 77 ]. C4a/b encodes isotypes of the complement component C4 and Ccl3 encodes macrophage inflammatory protein 1α, which both are critically involved in mounting the inflammatory cascade initiated by MGnD [ 15 , 73 ]. Upregulation of Clec7a is a hallmark of adopting by microglia DAM or MGnD reactive state [ 14 , 49 , 53 ] and the gene encodes Dectin-1 representing the C-type lectin receptor involved in the immune system's recognition and acting as the phagocytosis regulator. Its inhibition was found to attenuate neurodegeneration and excessive synapse elimination by MGnD in P301S tau mutant mice [ 123 ]. Gfap and Vim encode intermediate filament proteins of the astrocyte cytoskeleton, and their upregulation is recognized as universal marker of astrocytic activation [ 52 ]. Serpina3n encodes Serpin 3 protein (a.k.a. α1-antichymotrypsin), which functions as serine peptidase inhibitor during complement cascade activation, apoptosis and inflammation and its expression is particularly increased in response to IL-1, TNF, and IL-6. Upregulation of Serpina3n has been documented both in transmissible prion mouse models and AD transgenic mice and it is closely linked to chronic inflammatory response featured by these models [ 125 ]. Ccl12 encodes CC motif chemokine ligand 12, also known as monocyte chemotactic protein 5 (MCP-5), a small protein, which plays a role in recruiting peripheral immune cells to the site of damage and inflammation and its upregulation previously has been shown in prion disease [ 19 ]. Stimulation between chronically reactive microglia and astrocytes in neurodegeneration is bidirectional [ 82 ]. To ascertain the effect of APOE genotype on this process we used RT-qPCR to quantify expression of Il1α , Tnfα , C1qa encoding respective cytokines IL1α, TNFα and C1QA, which are secreted by MGnD microglia and stimulate acquisition of the chronic reactive state by astrocytes and the C3 gene encoding complement component 3 protein (C3), which is expressed by reactive astrocytes and reciprocally advances MGnD phenotype [ 42 , 61 , 62 ]. We also used RT-qPCR to quantify expression of specific MGnD markers Aif1 encoding IBA1, C3ar1 encoding C3 specific receptor, and Cx3cr1 . Reactive astrocyte markers included Gfap , Ccl12 , and Ccl2 , which encodes CC motif chemokine ligand 2. Both CC motif chemokine ligands 12 and 2 are astrocytic secretans that can attract immune cells like microglia to the site of chronic inflammation [ 50 ]. Propensity of astrocytes to secrete chemotactic molecules like CC2 and CC12 and proinflammatory factors like C3 suggest they may not only passively contribute to neuroinflammation but rather function as effector cells performing classical innate immune functions and driving the neuroinflammatory cascade [ 23 , 89 ]. These proinflammatory functions of astrocytes appear to play a particularly important role in prionoses, where paradoxical exacerbation of pathology was observed in microglia deficient mice as it was driven by uninhibited proinflammatory response of astrocytes [ 11 ]. In line with the concept of astrocyte-driving neurodegeneration selective removal of astrocytic apoE4 was found to protect against tau mediated neurodegeneration in P301S tau mutant mice [ 121 ]. All genes interrogated using RT-qPCR were significantly upregulated in 22L inoculated mice at 23 wpi. but not at 15 wpi. Their transcript level was the highest in ε4/ε4 22L mice followed by ε2/ε2 22L and ε3/ε3 22L animals. Thus, using various transcriptomic approaches we found the strongest proinflammatory effect and evidence for microglia-astrocyte co-stimulatory activation in the setting of the ε4 allele and to a lesser extent in the setting of the ε2 allele compared to the ε3 allele, where the inflammatory response was the least pronounced. This increased neuroinflammatory response associated with the ε2 allele is most likely responsible for reduced disease latency, accelerated tempo of symptoms progression and increased burden of pathology observed in ε2/ε2 22L mice compared to ε3/ε3 22L animals. The APOE polymorphism influences immune response both systemically and within the CNS owing it to the expression of apoE in multiple myeloid-lineage cells, including macrophages, dendritic cells, and microglia [ 5 , 64 , 80 ]. Consistently with the main finding of this study, the ε4 allele has been generally acknowledged as associated with the strongest inflammatory response, while the immunoregulatory properties of the ε2 allele have been reported with variable results depending on cell type and inflammatory stimulus. In respect to the systemic response, both ε2 and ε4 alleles were found to produce stronger inflammatory effect compared to the ε3 allele [ 45 , 54 , 114 ]. In respect to CNS-specific studies, intraventricular injection of lipopolysaccharide (LPS) into APOE -TR mice [ 129 ], or in vitro stimulation of microglia isolated from these animals using LPS [ 69 ] yielded aggravated and attenuated response in the context to ε4 and ε2 alleles compared to the ε3 allele, respectively. In stark contrast, in vitro LPS challenge of astrocytes isolates from APOE -TR mice produced the highest release of pro-inflammatory cytokines and upregulation of nuclear factor-kappa B subunit expression in the context of the ε2 allele [ 68 ]. Interestingly a recent study examining how APOE genotype modulates cell-type-specific transcriptomic changes in AD brains revealed that ε4 carriers feature the strongest upregulation of microglia specific genes and most of pro-inflammatory pathways, it also found ε2 carriers exhibit strong inflammatory response especially involving IL-6 and IL-1β pathways, which suggests a role of both alleles in promoting inflammatory response in the context of AD pathology [ 59 ]. Several bi-transgenic mouse models were generated based on APOE- TR mice to directly study the effect of the APOE polymorphism on CNS pathology induced by accumulation of disease specific misfolded proteins. In models of Aβ deposition, Aβ plaque load clearly was modified in the rank order of ε4 > > ε3 > ε2 [ 75 , 90 ], with ε4 mice featuring the strongest peri-plaque proinflammatory microglia activation [ 90 ]. Interestingly modeling of tau pathology has been reported with variable results depending on the model used. Crossing of P301S tau mutant mice [ 47 ] with APOE-TR mice exacerbated tau accumulation and produced the strongest tau-associated inflammatory response in ε4 mice, while both the tau pathology load and innate immune response in ε2 and ε3 mice were comparable [ 99 ]. In contrast, following adeno-associated virus delivery of the P301L tau mutant into the lateral ventricle of APOE- TR mice the greatest accumulation of pathology was found in ε2 mice, while ε4 allele showed a protective effect compared to ε3 mice [ 128 ]. These variable outcomes could be explained by differences in neuroinflammatory response, which in the P301S model is inherently upregulated, and it was further exacerbated by the presence of the ε4 allele [ 47 ], differences in the size of expressed human tau protein, and specific mutations used in different models, and possibly by existence of direct interaction between tau and apoE isoforms postulated in the P301L tau model [ 128 ]. Crossing of A53T α-synucleinopathy model mice onto the APOE -TR lines, exacerbated behavioral and pathological metrics in animals expressing the ε4 allele, while the ε2 allele attenuated α-synuclein pathology [ 31 ]. It is noteworthy, that in this model transcriptomic markers of microglia and astrocyte activation showed no differences across animals expressing various APOE alleles. Study using a Cx3cr1 GFP/GFP mouse model of macular degeneration showed exacerbation of the pathology readouts including subretinal inflammatory response in the setting of the ε2 allele and a protective effect of the ε4 allele compared to the ε3 allele [ 58 ]. In summary, APOE -TR mouse studies have demonstrated both ε2 and ε4 allele can exacerbate neurodegeneration in a pathology specific context. The effect of APOE polymorphism on various neurodegenerative diseases also was investigated through a number epidemiological and neuropathological studies carried out in affected patients. Presence of the ε4 allele has been invariably found to elevate occurrence of LOAD, which risk is 3-4-fold and 12-15-fold increased among carries of a single and two ε4 copies, compared to ε3 homozygotes, respectively [ 25 ]. In contrast, the ε2 allele strongly protects against LOAD [ 24 ] and the likelihood of LOAD among ε2 homozygotes was found to be exceptionally low [ 88 ]. Irrespective of its effect on increasing the risk of LOAD occurrence, the ε4 allele in allele dose-dependent manner accelerates the tempo of cognitive decline, brain atrophy, and accumulation of neurofibrillary tangle (NFT) pathology in patients with established disease [ 1 , 21 , 99 , 112 , 113 ]. Information on how the ε2 allele may affect progression of established LOAD is limited due to low number of affected ε2 carriers who also do not carry the ε4 allele; however, available data suggest NFT pathology load in ε2/ε3 patients is reduced compared to ε3/ε3 and ε3/ε4 individuals [ 124 ]. The ε4 allele also has been associated with a greater severity of Lewy body pathology when controlling for co-associated AD pathology [ 34 ]. In contrast, several studies have found ε2 carriers and in particular ε2/ε2 homozygotes to present with increased risk and elevated pathology load in primary tauopathies, including progressive-supranuclear palsy [ 122 , 128 ], corticobasal degeneration [ 128 ] and very late onset NFT-predominant dementia [ 46 ]. Likewise, the ε2 allele was implicated as a potential risk factor in aged-related macular degeneration [ 111 ]. While in prion diseases epidemiological studies showed no clear effect of APOE polymorphism on the risk of disease occurrence [ 72 , 95 , 126 ], clinical and neuropathological studies evaluating possible effects of APOE polymorphism on the rate of prion disease progression and pathology burden have not been done due to limited number of available cases, disease diversity, and restrictions related to infection precaution concerning work with human prion material [ 33 , 79 , 126 ]. Therefore, we examined the effect of APOE polymorphism on prion pathology using APOE -TR mice we infected with 22L mouse adapted scrapie strain and while we found no effect of the APOE genotype on extra-CNS PrP Sc accumulation and neuroinvasion, the ensuing brain pathology was significantly intensified in the presence of the ε4 allele and to lesser extent in the presence of the ε2 allele. Conclusions Findings of our study indicate that APOE polymorphism differentially regulates the progression of prion pathology. We identified two mechanisms attributable to detrimental effect endowed by the ε4 allele, which are increased conversion and accumulation of the PrP Sc conformer and worsening of prion-associated neuroinflammation, while the ε2 allele was found to be associated with increased inflammatory response. Our findings suggest both ε4 and ε2 alleles are disadvantageous determinants in prion pathology (Fig. 10 ). Abbreviations Ab: b-amyloid; ANOVA: analysis of variance; apoE: apolipoprotein E protein; Apoe: apoE gene (murine); APOE : apoE gene (human); BCA: bicinchoninic acid; C3: complement component 3; CD68: cluster of differentiation 68; CD230: cluster of differentiation 230 (a.k.a PrP); CJD: Creutzfeldt-Jakob disease; CNS: central nervous system; DAM: disease associated microglia; DPBS: Dulbecco’s phosphate buffered saline; dpi: days post inoculation; GFAP: glial fibrillary acidic protein; Iba1: Ionized calcium binding adaptor molecule; ID: integrated density; IFN: interferon; LOAD: late onset Alzheimer’s disease; LPS: lipopolysaccharide; LRS: lymphoreticular system; M1: primary motor cortex; MGnD: microglial neurodegenerative phenotype; NaPTA: sodium phosphotungustic acid; NBH: normal brain homogenate; NFT: neurofibrillary tangle; OD: optical density; PK: proteinase K; LRS: lymphoreticular system; PrP: prion protein, PrP Sc : scrapieform conformer of prion protein; RT-qPCR: Reverse Transcription Quantitative Polymerase Chain Reaction; S1: primary somatosensory cortex; SEM: standard error; SDS-PAGE: sodium dodecyl sulfate-polyacrylamide gel electrophoresis; THB: tissue homogenization buffer; TR: target replacement; TSS: Total Scrapie Score; wpi: weeks post inoculation; Declarations Ethics Approval and Consent to participate All mouse care and experimental procedures were approved by Institutional Animal Care and Use Committees of the New York University Grossman School of Medicine. Consent for publication N/A Competing interest The authors declare no competing financial and/or non-financial interests in relation to the work described. Authors’ information N/A Funding This work was supported by grants from the National Institute on Aging R01 AG067478, R01 AG0758401, and RF1 AG088226 and by the funding from The Fisher Center for Alzheimer’s Research Foundation Author Contribution M.J.S., A.M.L and J.E.P. conceived of the project and designed the experiments. A.M.L, J.E.P., W.L.C. and L.A.F. conducted the research. P.MS. provided unique material, A.M.L., J.E.P., and M.J.S. analyzed the data, designed figures and wrote the manuscript. All authors have read and approved the final version of the manuscript. Acknowledgement The authors would like to thank Dr. D. M. Holtzman from Washington University School of Medicine (St. Louis, MO) for sharing HJ15.3 monoclonal antibody against human apoE. We also would like to acknowledge the staff of NYU Langone's Genome Technology Center (RRID: SCR_017929) for their assistance with processing of NanoString nCounter® chips. Data Availability Raw images and datasets generated and analyzed during the current study are available from the corresponding author upon a reasonable request. In addition, NanoString nCounter® datasets of microglia and astrocyte transcript can be accessed through the Gene Expression Omnibus Repository, [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE307182](https:/www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE307182) . References Agosta F, Vossel KA, Miller BL, Migliaccio R, Bonasera SJ, Filippi M et al (2009) Apolipoprotein E epsilon4 is associated with disease-specific effects on brain atrophy in Alzheimer's disease and frontotemporal dementia. Proc Natl Acad Sci U S A 106(6):2018–2022 Aguilar-Calvo P, Garcia C, Espinosa JC, Andreoletti O, Torres JM (2015) Prion and prion-like diseases in animals. Virus Res 207:82–93 Aguzzi A, Liu Y (2017) A role for astroglia in prion diseases. J Exp Med 214(12):3477–3479 Aguzzi A, Zhu C (2017) Microglia in prion diseases. J Clin Invest 127(9):3230–3239 Alagarsamy J, Jaeschke A, Hui DY (2022) Apolipoprotein E in Cardiometabolic and Neurological Health and Diseases. Int J Mol Sci 23(17) Amouyel P, Vidal O, Launay JM, Laplanche JL (1994) The apolipoprotein E alleles as major susceptibility factors for Creutzfeldt-Jakob disease. Lancet 344(8933):1315–1318 Asuni AA, Guridi M, Pankiewicz JE, Sanchez S, Sadowski MJ (2014) Modulation of amyloid precursor protein expression reduces beta-amyloid deposition in a mouse model. Ann Neurol 75(5):684–699 Asuni AA, Guridi M, Sanchez S, Sadowski MJ (2015) Antioxidant peroxiredoxin 6 protein rescues toxicity due to oxidative stress and cellular hypoxia in vitro, and attenuates prion-related pathology in vivo. Neurochem Int 90:152–165 Asuni AA, Pankiewicz JE, Sadowski MJ (2013) Differential molecular chaperone response associated with various mouse adapted scrapie strains. Neurosci Lett 538:26–31 Aucouturier P, Geissmann F, Damotte D, Saborio GP, Meeker HC, Kascsak R et al (2001) Infected dendritic cells are sufficient for prion transmission to the CNS in mouse scrapie. J Clin Invest 108:703–708 Bradford BM, McGuire LI, Hume DA, Pridans C, Mabbott NA (2022) Microglia deficiency accelerates prion disease but does not enhance prion accumulation in the brain. Glia 70(11):2169–2187 Burkholder T, Foltz C, Karlsson E, Linton CG, Smith JM (2012) Health Evaluation of Experimental Laboratory Mice. Curr Protoc Mouse Biol 2:145–165 Butovsky O, Jedrychowski MP, Moore CS, Cialic R, Lanser AJ, Gabriely G et al (2014) Identification of a unique TGF-beta-dependent molecular and functional signature in microglia. Nat Neurosci 17(1):131–143 Butovsky O, Weiner HL (2018) Microglial signatures and their role in health and disease. Nat Rev Neurosci 19(10):622–635 Carroll JA, Chesebro B (2019) Neuroinflammation, Microglia, and Cell-Association during Prion Disease. Viruses. 11(1) Carroll JA, Race B, Phillips K, Striebel JF, Chesebro B (2017) Statins are ineffective at reducing neuroinflammation or prolonging survival in scrapie-infected mice. J Gen Virol 98(8):2190–2199 Carroll JA, Race B, Williams K, Striebel J, Chesebro B (2018) Microglia Are Critical in Host Defense against Prion Disease. J Virol. 92(15) Carroll JA, Race B, Williams K, Striebel J, Chesebro B (2020) RNA-seq and network analysis reveal unique glial gene expression signatures during prion infection. Mol Brain 13(1):71 Carroll JA, Striebel JF, Rangel A, Woods T, Phillips K, Peterson KE et al (2016) Prion Strain Differences in Accumulation of PrPSc on Neurons and Glia Are Associated with Similar Expression Profiles of Neuroinflammatory Genes: Comparison of Three Prion Strains. PLoS Pathog 12(4):e1005551 Castellano JM, Kim J, Stewart FR, Jiang H, DeMattos RB, Patterson BW et al (2011) Human apoE Isoforms Differentially Regulate Brain Amyloid-β Peptide Clearance. SciTranslMed 3(89):89ra57 Chen XR, Shao Y, Sadowski MJ, Alzheimer's Disease Neuroimaging I (2021) Segmented Linear Mixed Model Analysis Reveals Association of the APOEvarepsilon4 Allele with Faster Rate of Alzheimer's Disease Dementia Progression. J Alzheimers Dis 82(3):921–937 Chen Y, Strickland MR, Soranno A, Holtzman DM (2021) Apolipoprotein E: Structural Insights and Links to Alzheimer Disease Pathogenesis. Neuron 109(2):205–221 Colombo E, Farina C (2016) Astrocytes: Key Regulators of Neuroinflammation. Trends Immunol 37(9):608–620 Corder EH, Saunders AM, Risch NJ, Strittmatter WJ, Schmechel DE, Gaskell PC Jr. et al (1994) Protective effect of apolipoprotein E type 2 allele for late onset Alzheimer disease. Nat Gen 7(2):180–184 Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC Jr., Rimmler JB et al (1995) Apolipoprotein E, survival in Alzheimer's disease patients, and the competing risks of death and Alzheimer's disease. Neurol 45(7):1323–1328 Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, Small GW et al (1993) Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families. Science 261(5123):921–923 Cosentino S, Scarmeas N, Helzner E, Glymour MM, Brandt J, Albert M et al (2008) APOE epsilon 4 allele predicts faster cognitive decline in mild Alzheimer disease. Neurology 70(19 Pt 2):1842–1849 Cruchaga C, Kauwe JS, Nowotny P, Bales K, Pickering EH, Mayo K et al (2012) Cerebrospinal fluid APOE levels: an endophenotype for genetic studies for Alzheimer's disease. Hum Mol Genet 21(20):4558–4571 Daniels MJD, Lefevre L, Szymkowiak S, Drake A, McCulloch L, Tzioras M et al (2023) Cystatin F (Cst7) drives sex-dependent changes in microglia in an amyloid-driven model of Alzheimer's disease. Elife. 12 Daude N, Lehmann S, Harris DA (1997) Identification of intermediate steps in the conversion of a mutant prion protein to a scrapie-like form in cultured cells. J Biol Chem 272(17):11604–11612 Davis AA, Inman CE, Wargel ZM, Dube U, Freeberg BM, Galluppi A et al (2020) APOE genotype regulates pathology and disease progression in synucleinopathy. Sci Transl Med 12(529) de Andrade M, Thandi I, Brown S, Gotto A Jr., Patsch W, Boerwinkle E (1995) Relationship of the apolipoprotein E polymorphism with carotid artery atherosclerosis. Am J Hum Genet 56(6):1379–1390 DeArmond SJ, Kretzschmar H, Prusiner SB (2002) Prion diseases. In: Graham DI, Lantos P (eds) Greenfield's Neuropathology. seventh ed. Arnold, London, pp 273–324 Dickson DW, Heckman MG, Murray ME, Soto AI, Walton RL, Diehl NN et al (2018) APOE epsilon4 is associated with severity of Lewy body pathology independent of Alzheimer pathology. Neurology 91(12):e1182–e95 Eisenberg DT, Kuzawa CW, Hayes MG (2010) Worldwide allele frequencies of the human apolipoprotein E gene: climate, local adaptations, and evolutionary history. Am J Phys Anthropol 143(1):100–111 Emamzadeh FN, Aojula H, McHugh PC, Allsop D (2016) Effects of different isoforms of apoE on aggregation of the alpha-synuclein protein implicated in Parkinson's disease. Neurosci Lett 618:146–151 Garai K, Verghese PB, Baban B, Holtzman DM, Frieden C (2014) The Binding of Apolipoprotein E to Oligomers and Fibrils of Amyloid-beta Alters the Kinetics of Amyloid Aggregation. Biochemistry Geschwind MD (2015) Prion Diseases. Continuum (MinneapMinn). 21(6 Neuroinfectious Disease):1612-38 Hammond TR, Marsh SE, Stevens B (2019) Immune Signaling in Neurodegeneration. Immunity 50(4):955–974 Harris DA (1999) Cell biological studies of the prion protein. Curr Issues Mol Biol 1(1–2):65–75 Harris DA (1999) Cellular biology of prion diseases. Clin Microbiol Rev 12(3):429–444 Hartmann K, Sepulveda-Falla D, Rose IVL, Madore C, Muth C, Matschke J et al (2019) Complement 3(+)-astrocytes are highly abundant in prion diseases, but their abolishment led to an accelerated disease course and early dysregulation of microglia. Acta Neuropathol Commun 7(1):83 Hemonnot-Girard AL, Meersseman C, Pastore M, Garcia V, Linck N, Rey C et al (2022) Comparative analysis of transcriptome remodeling in plaque-associated and plaque-distant microglia during amyloid-beta pathology progression in mice. J Neuroinflammation 19(1):234 Huynh TV, Wang C, Tran AC, Tabor GT, Mahan TE, Francis CM et al (2019) Lack of hepatic apoE does not influence early Abeta deposition: observations from a new APOE knock-in model. Mol Neurodegener 14(1):37 Igel E, Haller A, Wolfkiel PR, Orr-Asman M, Jaeschke A, Hui DY (2021) Distinct pro-inflammatory properties of myeloid cell-derived apolipoprotein E2 and E4 in atherosclerosis promotion. J Biol Chem 297(3):101106 Ikeda K, Akiyama H, Arai T, Sahara N, Mori H, Usami M et al (1997) A subset of senile dementia with high incidence of the apolipoprotein E epsilon2 allele. Ann Neurol 41(5):693–695 Ishihara T, Hong M, Zhang B, Nakagawa Y, Lee MK, Trojanowski JQ, Lee VM (1999) Age-dependent emergence and progression of a tauopathy in transgenic mice overexpressing the shortest human tau isoform. Neuron 24(3):751–762 Jeffrey M, McGovern G, Siso S, Gonzalez L (2011) Cellular and sub-cellular pathology of animal prion diseases: relationship between morphological changes, accumulation of abnormal prion protein and clinical disease. Acta Neuropathol 121(1):113–134 Keren-Shaul H, Spinrad A, Weiner A, Matcovitch-Natan O, Dvir-Szternfeld R, Ulland TK et al (2017) A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease. Cell 169(7):1276–90e17 Kim RY, Hoffman AS, Itoh N, Ao Y, Spence R, Sofroniew MV, Voskuhl RR (2014) Astrocyte CCL2 sustains immune cell infiltration in chronic experimental autoimmune encephalomyelitis. J Neuroimmunol 274(1–2):53–61 Knouff C, Hinsdale ME, Mezdour H, Altenburg MK, Watanabe M, Quarfordt SH et al (1999) Apo E structure determines VLDL clearance and atherosclerosis risk in mice. J Clin Invest 103(11):1579–1586 Kraft AW, Hu X, Yoon H, Yan P, Xiao Q, Wang Y et al (2013) Attenuating astrocyte activation accelerates plaque pathogenesis in APP/PS1 mice. FASEB J 27(1):187–198 Krasemann S, Madore C, Cialic R, Baufeld C, Calcagno N, El Fatimy R et al (2017) The TREM2-APOE Pathway Drives the Transcriptional Phenotype of Dysfunctional Microglia in Neurodegenerative Diseases. Immunity 47(3):566–581 e9 Kuhel DG, Konaniah ES, Basford JE, McVey C, Goodin CT, Chatterjee TK et al (2013) Apolipoprotein E2 accentuates postprandial inflammation and diet-induced obesity to promote hyperinsulinemia in mice. Diabetes 62(2):382–391 Kushwaha R, Sinha A, Makarava N, Molesworth K, Baskakov IV (2021) Non-cell autonomous astrocyte-mediated neuronal toxicity in prion diseases. Acta Neuropathol Commun 9(1):22 Kuszczyk MA, Sanchez S, Pankiewicz J, Kim J, Duszczyk M, Guridi M et al (2013) Blocking the Interaction between Apolipoprotein E and Abeta Reduces Intraneuronal Accumulation of Abeta and Inhibits Synaptic Degeneration. AmJ Pathol 182(5):1750–1768 Lauren J, Gimbel DA, Nygaard HB, Gilbert JW, Strittmatter SM (2009) Cellular prion protein mediates impairment of synaptic plasticity by amyloid-beta oligomers. Nature 457(7233):1128–1132 Levy O, Lavalette S, Hu SJ, Housset M, Raoul W, Eandi C et al (2015) APOE Isoforms Control Pathogenic Subretinal Inflammation in Age-Related Macular Degeneration. J Neurosci 35(40):13568–13576 Li Z, Martens YA, Ren Y, Jin Y, Sekiya H, Doss SV et al (2025) APOE genotype determines cell-type-specific pathological landscape of Alzheimer's disease. Neuron 113(9):1380–1397 e7 Liao F, Zhang TJ, Jiang H, Lefton KB, Robinson GO, Vassar R et al (2015) Murine versus human apolipoprotein E4: differential facilitation of and co-localization in cerebral amyloid angiopathy and amyloid plaques in APP transgenic mouse models. Acta Neuropathol Commun 3:70 Liddelow SA, Barres BA (2017) Reactive Astrocytes: Production, Function, and Therapeutic Potential. Immunity 46(6):957–967 Liddelow SA, Guttenplan KA, Clarke LE, Bennett FC, Bohlen CJ, Schirmer L et al (2017) Neurotoxic reactive astrocytes are induced by activated microglia. Nature 541(7638):481–487 Liemisa B, Newbury SF, Novy MJ, Pasato JA, Morales-Corraliza J, Peng KY, Mathews PM (2023) Brain apolipoprotein E levels in mice challenged by a Western diet increase in an allele-dependent manner. Aging Brain 4:100102 Lin PB, Holtzman DM (2024) Current insights into apolipoprotein E and the immune response in Alzheimer's disease. Immunol Rev 327(1):43–52 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402–408 Ma J, Yee A, Brewer HB Jr., Das S, Potter H (1994) Amyloid-associated proteins alpha 1-antichymotrypsin and apolipoprotein E promote assembly of Alzheimer beta-protein into filaments. Nature 372(6501):92–94 Mackenzie G, Will R (2017) Creutzfeldt-Jakob disease: recent developments. F1000Research. 6:2053 Maezawa I, Maeda N, Montine TJ, Montine KS (2006) Apolipoprotein E-specific innate immune response in astrocytes from targeted replacement mice. J Neuroinflammation 3:10 Maezawa I, Nivison M, Montine KS, Maeda N, Montine TJ (2006) Neurotoxicity from innate immune response is greatest with targeted replacement of E4 allele of apolipoprotein E gene and is mediated by microglial p38MAPK. FASEB J 20(6):797–799 Mahley RW, Weisgraber KH, Huang Y (2009) Apolipoprotein E: structure determines function, from atherosclerosis to Alzheimer's disease to AIDS. J Lipid Res 50:S183–S8 Mercer RCC, Harris DA (2023) Mechanisms of prion-induced toxicity. Cell Tissue Res 392(1):81–96 Nakagawa Y, Kitamoto T, Furukawa H, Ogomori K, Tateishi J (1995) Apolipoprotein E in Creutzfeldt-Jakob disease. Lancet 345(8941):68 Nimmo J, Byrne RAJ, Daskoulidou N, Watkins LM, Carpanini SM, Zelek WM, Morgan BP (2024) The complement system in neurodegenerative diseases. Clin Sci (Lond) 138(6):387–412 Nuvolone M, Schmid N, Miele G, Sorce S, Moos R, Schori C et al (2017) Cystatin F is a biomarker of prion pathogenesis in mice. PLoS ONE 12(2):e0171923 Pankiewicz JE, Baquero-Buitrago J, Sanchez S, Lopez-Contreras J, Kim J, Sullivan PM et al (2017) APOE Genotype Differentially Modulates Effects of Anti-A beta, Passive Immunization in APP Transgenic Mice. Mol Neurodegener 12(1):12 Pankiewicz JE, Diaz JR, Marta-Ariza M, Lizinczyk AM, Franco LA, Sadowski MJ (2020) Peroxiredoxin 6 mediates protective function of astrocytes in Abeta proteostasis. Mol Neurodegener 15(1):50 Pankiewicz JE, Lizinczyk AM, Franco LA, Diaz JR, Marta-Ariza M, Sadowski MJ (2021) Absence of Apolipoprotein E is associated with exacerbation of prion pathology and promotes microglial neurodegenerative phenotype. Acta Neuropathol Commun 9(1):157 Pankiewicz JE, Sanchez S, Kirshenbaum K, Kascsak RB, Kascsak RJ, Sadowski MJ (2019) Anti-prion Protein Antibody 6D11 Restores Cellular Proteostasis of Prion Protein Through Disrupting Recycling Propagation of PrP(Sc) and Targeting PrP(Sc) for Lysosomal Degradation. Mol Neurobiol 56(3):2073–2091 Parchi P, Giese A, Capellari S, Brown P, Schulz-Schaeffer W, Windl O et al (1999) Classification of sporadic Creutzfeldt-Jakob disease based on molecular and phenotypic analysis of 300 subjects. Ann Neurol 46(2):224–233 Parhizkar S, Holtzman DM (2022) APOE mediated neuroinflammation and neurodegeneration in Alzheimer's disease. Semin Immunol 59:101594 Pastrana MA, Sajnani G, Onisko B, Castilla J, Morales R, Soto C, Requena JR (2006) Isolation and characterization of a proteinase K-sensitive PrPSc fraction. Biochemistry 45(51):15710–15717 Patani R, Hardingham GE, Liddelow SA (2023) Functional roles of reactive astrocytes in neuroinflammation and neurodegeneration. Nat Rev Neurol 19(7):395–409 Prinz M, Heikenwalder M, Junt T, Schwarz P, Glatzel M, Heppner FL et al (2003) Positioning of follicular dendritic cells within the spleen controls prion neuroinvasion. Nature 425(6961):957–962 Prinz M, Jung S, Priller J (2019) Microglia Biology: One Century of Evolving Concepts. Cell 179(2):292–311 Prusiner SB (2001) Neurodegenerative diseases and prions. N Engl J Med 344(20):1516–1526 Qian J, Zhang Y, Betensky RA, Hyman BT, Serrano-Pozo A (2023) Neuropathology-Independent Association Between APOE Genotype and Cognitive Decline Rate in the Normal Aging-Early Alzheimer Continuum. Neurol Genet 9(1):e200055 Rall SC Jr., Weisgraber KH, Mahley RW (1986) Isolation and characterization of apolipoprotein E. Methods Enzymol 128:273–287 Reiman EM, Arboleda-Velasquez JF, Quiroz YT, Huentelman MJ, Beach TG, Caselli RJ et al (2020) Exceptionally low likelihood of Alzheimer's dementia in APOE2 homozygotes from a 5,000-person neuropathological study. Nat Commun 11(1):667 Rodgers KR, Lin Y, Langan TJ, Iwakura Y, Chou RC (2020) Innate Immune Functions of Astrocytes are Dependent Upon Tumor Necrosis Factor-Alpha. Sci Rep 10(1):7047 Rodriguez GA, Tai LM, LaDu MJ, Rebeck GW (2014) Human APOE4 increases microglia reactivity at Abeta plaques in a mouse model of Abeta deposition. J Neuroinflammation 11:111 Sadowski M, Kumar A, Wisniewski T (2008) Prion diseases. In: Bradley WG, editor. Neurology in Clinical Practice,. 5th Edition ed: Butterworth-Heinemann; pp. 1567-81 Sadowski M, Pankiewicz J, Scholtzova H, Ripellino JA, Li YS, Schmidt SD et al (2004) A synthetic peptide blocking the apolipoprotein E/beta-amyloid binding mitigates beta-amyloid toxicity and fibril formation in vitro and reduces beta-amyloid plaques in transgenic mice. Am J Pathol 165(3):937–948 Sadowski MJ, Pankiewicz J, Prelli F, Scholtzova H, Spinner DS, Kascsak RB et al (2009) Anti-PrP Mab 6D11 Suppresses PrP Sc Replication in Prion Infected Myeloid Precursor Line FDC-P1/22L and in the Lymphoreticular System In Vivo . Neurobiol Dis 34(2):267–278 Safar J, Wille H, Itri V, Groth D, Serban A, Torchia M et al (1998) Eight prion strains have PrPSc molecules with different conformations. Nat Med 4(10):1157–1165 Salvatore M, Seeber AC, Nacmias B, Petraroli R, D'Alessandro M, Sorbi S, Pocchiari M (1995) Apolipoprotein E in sporadic and familial Creutzfeldt-Jakob disease. Neurosci Lett 199(2):95–98 Sanan DA, Weisgraber KH, Russell SJ, Mahley RW, Huang D, Saunders A et al (1994) Apolipoprotein E associates with beta amyloid peptide of Alzheimer's disease to form novel monofibrils. Isoform apoE4 associates more efficiently than apoE3. J Clin Invest 94(2):860–869 Schmechel DE, Saunders AM, Strittmatter WJ, Crain BJ, Hulette CM, Joo SH et al (1993) Increased amyloid beta-peptide deposition in cerebral cortex as a consequence of apolipoprotein E genotype in late-onset Alzheimer disease. Proc Natl Acad Sci (USA) 90(20):9649–9653 Shi Y, Manis M, Long J, Wang K, Sullivan PM, Remolina Serrano J et al (2019) Microglia drive APOE-dependent neurodegeneration in a tauopathy mouse model. J Exp Med 216(11):2546–2561 Shi Y, Yamada K, Liddelow SA, Smith ST, Zhao L, Luo W et al (2017) ApoE4 markedly exacerbates tau-mediated neurodegeneration in a mouse model of tauopathy. Nature 549(7673):523–527 Simonovitch S, Schmukler E, Bespalko A, Iram T, Frenkel D, Holtzman DM et al (2016) Impaired Autophagy in APOE4 Astrocytes. J Alzheimers Dis 51(3):915–927 Song Y, Stampfer MJ, Liu S (2004) Meta-analysis: apolipoprotein E genotypes and risk for coronary heart disease. Ann Intern Med 141(2):137–147 Spinner DR, Kascsak RB, LaFauci G, Meeker HC, Ye X, Flory MJ et al (2007) CpG oligodeoxynucleotide-enhanced humoral immune response and production of antibodies to prion protein PrPSc in mice immunized with 139A scrapie-associated fibrils. J Leukoc Biol 81(6):1374–1385 Strickland MR, Rau MJ, Summers B, Basore K, Wulf J 2nd, Jiang H et al (2024) Apolipoprotein E secreted by astrocytes forms antiparallel dimers in discoidal lipoproteins. Neuron 112(7):1100–9e5 Striebel JF, Race B, Carroll JA, Phillips K, Chesebro B (2016) Knockout of fractalkine receptor Cx3cr1 does not alter disease or microglial activation in prion-infected mice. J Gen Virol 97(6):1481–1487 Strittmatter WJ, Saunders AM, Goedert M, Weisgraber KH, Dong LM, Jakes R et al (1994) Isoform-specific interactions of apolipoprotein E with microtubule-associated protein tau: implications for Alzheimer disease. Proc Natl Acad Sci (USA) 91(23):11183–11186 Strittmatter WJ, Saunders AM, Schmechel D, Pericak-Vance M, Enghild J, Salvesen GS, Roses AD (1993) Apolipoprotein E: high-avidity binding to beta-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proc Natl Acad Sci (USA) 90(5):1977–1981 Strittmatter WJ, Weisgraber KH, Goedert M, Saunders AM, Huang D, Corder EH et al (1994) Hypothesis: microtubule instability and paired helical filament formation in the Alzheimer disease brain are related to apolipoprotein E genotype. Exp Neurol 125(2):163–171 Strittmatter WJ, Weisgraber KH, Huang DY, Dong LM, Salvesen GS, Pericak-Vance M et al (1993) Binding of human apolipoprotein E to synthetic amyloid beta peptide: isoform-specific effects and implications for late-onset Alzheimer disease. Proc Natl Acad Sci (USA) 90(17):8098–8102 Sullivan PM, Han B, Liu F, Mace BE, Ervin JF, Wu S et al (2011) Reduced levels of human apoE4 protein in an animal model of cognitive impairment. Neurobiol Aging 32(5):791–801 Sullivan PM, Mezdour H, Aratani Y, Knouff C, Najib J, Reddick RL et al (1997) Targeted replacement of the mouse apolipoprotein E gene with the common human APOE3 allele enhances diet-induced hypercholesterolemia and atherosclerosis. J Biol Chem 272(29):17972–17980 Thakkinstian A, Han P, McEvoy M, Smith W, Hoh J, Magnusson K et al (2006) Systematic review and meta-analysis of the association between complement factor H Y402H polymorphisms and age-related macular degeneration. Hum Mol Genet 15(18):2784–2790 Therriault J, Benedet AL, Pascoal TA, Mathotaarachchi S, Chamoun M, Savard M et al (2019) Association of Apolipoprotein E epsilon4 With Medial Temporal Tau Independent of Amyloid-beta. JAMA Neurol Therriault J, Benedet AL, Pascoal TA, Mathotaarachchi S, Savard M, Chamoun M et al (2021) APOEepsilon4 potentiates the relationship between amyloid-beta and tau pathologies. Mol Psychiatry 26(10):5977–5988 Tsoi LM, Wong KY, Liu YM, Ho YY (2007) Apoprotein E isoform-dependent expression and secretion of pro-inflammatory cytokines TNF-alpha and IL-6 in macrophages. Arch Biochem Biophys 460(1):33–40 Tzaban S, Friedlander G, Schonberger O, Horonchik L, Yedidia Y, Shaked G et al (2002) Protease-sensitive scrapie prion protein in aggregates of heterogeneous sizes. Biochemistry 41(42):12868–12875 Ulrich JD, Burchett JM, Restivo JL, Schuler DR, Verghese PB, Mahan TE et al (2013) In vivo measurement of apolipoprotein E from the brain interstitial fluid using microdialysis. Mol Neurodegener 8:13 Um JW, Nygaard HB, Heiss JK, Kostylev MA, Stagi M, Vortmeyer A et al (2012) Alzheimer amyloid-beta oligomer bound to postsynaptic prion protein activates Fyn to impair neurons. Nat Neurosci 15(9):1227–1235 Van Everbroeck B, Croes EA, Pals P, Dermaut B, Jansen G, van Duijn CM et al (2001) Influence of the prion protein and the apolipoprotein E genotype on the Creutzfeldt-Jakob Disease phenotype. Neurosci Lett 313(1–2):69–72 Verghese PB, Castellano JM, Holtzman DM (2011) Apolipoprotein E in Alzheimer's disease and other neurological disorders. Lancet Neurol 10(3):241–252 Wadsworth JDF, Joiner S, Hill AF, Campbell TA, Desbruslais M, Luthert PJ, Collinge J (2001) Tissue distribution of protease resistant prion protein in variant Creutzfeldt-Jakob disease using a highly sensitive immunoblotting assay. Lancet 358(9277):171–180 Wang C, Xiong M, Gratuze M, Bao X, Shi Y, Andhey PS et al (2021) Selective removal of astrocytic APOE4 strongly protects against tau-mediated neurodegeneration and decreases synaptic phagocytosis by microglia. Neuron 109(10):1657–1674 e7 Wang H, Chang TS, Dombroski BA, Cheng PL, Patil V, Valiente-Banuet L et al (2024) Whole-genome sequencing analysis reveals new susceptibility loci and structural variants associated with progressive supranuclear palsy. Mol Neurodegener 19(1):61 Yang S, Wang J, Cao Y, Zhang Y, Sun Z, Wan P et al (2025) Clec7a Signaling in Microglia Promotes Synapse Loss Associated with Tauopathy. Int J Mol Sci. 26(7) Young CB, Johns E, Kennedy G, Belloy ME, Insel PS, Greicius MD et al (2023) APOE effects on regional tau in preclinical Alzheimer's disease. Mol Neurodegener 18(1):1 Zattoni M, Mearelli M, Vanni S, Colini Baldeschi A, Tran TH, Ferracin C et al (2022) Serpin Signatures in Prion and Alzheimer's Diseases. Mol Neurobiol 59(6):3778–3799 Zerr I, Helmhold M, Poser S, Armstrong VW, Weber T (1996) Apolipoprotein E phenotype frequency and cerebrospinal fluid concentration are not associated with Creutzfeldt-Jakob disease. ArchNeurol 53(12):1233–1238 Zhang H, Reddick RL, Piedrahita JA, Maeda N (1992) Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science 258:468–471 Zhao N, Liu CC, Van Ingelgom AJ, Linares C, Kurti A, Knight JA et al (2018) APOE epsilon2 is associated with increased tau pathology in primary tauopathy. Nat Commun 9(1):4388 Zhu Y, Nwabuisi-Heath E, Dumanis SB, Tai LM, Yu C, Rebeck GW, LaDu MJ (2012) APOE genotype alters glial activation and loss of synaptic markers in mice. Glia 60(4):559–569 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFile1LizinczyAMetal.pdf SupplementaryFile2LizinczykAMetal.pdf SupplementaryFile3LizinczykAMetal.pdf Cite Share Download PDF Status: Published Journal Publication published 21 Jan, 2026 Read the published version in Acta Neuropathologica Communications → Version 1 posted Editorial decision: Revision requested 16 Nov, 2025 Reviews received at journal 05 Nov, 2025 Reviews received at journal 04 Nov, 2025 Reviews received at journal 03 Nov, 2025 Reviewers agreed at journal 23 Oct, 2025 Reviewers agreed at journal 23 Oct, 2025 Reviewers agreed at journal 21 Oct, 2025 Reviewers invited by journal 20 Oct, 2025 Editor assigned by journal 18 Oct, 2025 Submission checks completed at journal 15 Oct, 2025 First submitted to journal 09 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7820890","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":535725450,"identity":"16440254-fee9-4c47-b5e3-1946089c2a30","order_by":0,"name":"Anita M. Lizińczyk","email":"","orcid":"","institution":"New York University Grossman School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Anita","middleName":"M.","lastName":"Lizińczyk","suffix":""},{"id":535725451,"identity":"e6cdaaf1-815d-4cb4-83aa-559d7db9d455","order_by":1,"name":"Joanna E. Pankiewicz","email":"","orcid":"","institution":"New York University Grossman School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Joanna","middleName":"E.","lastName":"Pankiewicz","suffix":""},{"id":535725452,"identity":"008f18fe-cd18-4b9b-8d94-600afd03feb6","order_by":2,"name":"William L. Cullina","email":"","orcid":"","institution":"New York University Grossman School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"William","middleName":"L.","lastName":"Cullina","suffix":""},{"id":535725453,"identity":"8441424b-254a-450b-b323-3ecf8416c3ad","order_by":3,"name":"Leor A. Franco","email":"","orcid":"","institution":"New York University Grossman School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Leor","middleName":"A.","lastName":"Franco","suffix":""},{"id":535725454,"identity":"940438cb-7d6b-40d8-a54e-6107dbb5612f","order_by":4,"name":"Patrick M. Sullivan","email":"","orcid":"","institution":"Duke University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Patrick","middleName":"M.","lastName":"Sullivan","suffix":""},{"id":535725455,"identity":"98bbde6f-8bfe-4cf4-a0f9-e0130ac37ef9","order_by":5,"name":"Martin J. Sadowski","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABRklEQVRIie2RP0vDQByGLwh1aanjBTF+hQuBaEHIV8lRSJYUHB00XBHOpTp38yukk3W7EGiWK64RBxuEOAl1S/0D3rUZCk3qKpgH8nI57rn3RwJATc0fBDERNgDWMgGDmkiFbVM6DChEHMakUAy5u1WxpLIqWirS/UUx4+nrLB0Du33Vnag5P3bvoIfYYnyhHe0S5eXsY1Phrk4wBxbkmbPfTGDvfuih8JrHRmfAdvTpzabCHIVgKqZLPPMJzGEvSERLi05wkNgNtT/YUNBDtlJuhfKYz6GLhBJ+S+V5Vq4kRYu43EzEYLZUohY9Fy2goZK8RMmUIaYQj3jmfjY51AOenUYHlBmI40u9T0oGc8D7gp5YWtyN9HziH6K4O0rfqK+hOApT8lX1reHaes+WGYlH/DGFVinrtJlMv3irbKmpqan5P/wAuaiEasL4eDwAAAAASUVORK5CYII=","orcid":"","institution":"New York University Grossman School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Martin","middleName":"J.","lastName":"Sadowski","suffix":""}],"badges":[],"createdAt":"2025-10-09 21:08:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7820890/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7820890/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s40478-025-02207-5","type":"published","date":"2026-01-21T15:59:11+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":94795279,"identity":"2cc5afde-07cf-4527-90ab-847db6f14b38","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":354418,"visible":true,"origin":"","legend":"","description":"","filename":"LizinczykAMetal.docx","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/abdc6cc0fc898d6426e5b4b7.docx"},{"id":94824594,"identity":"bc57d6b6-881a-4387-ba18-673df9888f55","added_by":"auto","created_at":"2025-10-31 06:49:09","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22675,"visible":true,"origin":"","legend":"","description":"","filename":"TablesLizinczykAMetal.docx","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/d9c06112449d67be2c51fbaa.docx"},{"id":94826180,"identity":"38529550-3385-4406-823e-93b8652e8621","added_by":"auto","created_at":"2025-10-31 06:51:13","extension":"json","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9044,"visible":true,"origin":"","legend":"","description":"","filename":"645854cc49be405380699e8e06a6cd98.json","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/60f1f8514510bae706ffe419.json"},{"id":94795287,"identity":"6d643fd1-cb52-413c-b165-dd0c61c658f9","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2855704,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile1LizinczyAMetal.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/e40df732def5a483e117acfa.pdf"},{"id":94824728,"identity":"1255dfac-d483-4138-b3cf-58295e946ce5","added_by":"auto","created_at":"2025-10-31 06:49:15","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":171125,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile2LizinczykAMetal.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/c6336cb9ace37b006ba6c91d.pdf"},{"id":94795294,"identity":"99586be3-3d2c-46ce-86fc-bfe5cde808b0","added_by":"auto","created_at":"2025-10-30 19:39:21","extension":"pdf","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":213828775,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile3LizinczykAMetald1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/bf461ae5b185ae6b7e0a09a0.pdf"},{"id":94824721,"identity":"be61369e-f1b5-4176-84aa-edf73b519d7b","added_by":"auto","created_at":"2025-10-31 06:49:15","extension":"xml","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":335207,"visible":true,"origin":"","legend":"","description":"","filename":"645854cc49be405380699e8e06a6cd981enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/17bb81ef845df01444e978f1.xml"},{"id":94795293,"identity":"1b1cf09d-80f2-4ee3-8979-a2698f7c54c4","added_by":"auto","created_at":"2025-10-30 19:39:19","extension":"pdf","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6925393,"visible":true,"origin":"","legend":"","description":"","filename":"FiguresLizinczykAMetal.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/fdcde6510b897eff44068518.pdf"},{"id":94795291,"identity":"6e88a19b-b5c4-4394-8436-d2b0a29fa63c","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":336481,"visible":true,"origin":"","legend":"","description":"","filename":"645854cc49be405380699e8e06a6cd981structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/cbf9e5244cef8d4bd53dbaff.xml"},{"id":94795292,"identity":"f2d52020-90f7-45b4-a0de-997dc3da7b27","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"html","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":365919,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/41d671e53c7283f3cd580821.html"},{"id":94795280,"identity":"bbc85a76-5869-4950-95d8-1f4724f08997","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1501120,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAPOE\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e genotype differentially affects prion disease latency time, symptoms severity, and pathology burden. (a)\u003c/strong\u003e Plots of Kaplan-Meier estimates of the prion disease latency time and \u003cstrong\u003e(b)\u003c/strong\u003e those of the total scrapie score for animals of indicated sex, the \u003cem\u003eAPOE\u003c/em\u003e genotype, and inoculum (22L or NBH). X-axes denote number of days post inoculation (dpi). \u003cstrong\u003e(c) \u003c/strong\u003eMicrographs of the coronal sections through the M1 motor cortex (bregma +1.4mm), which were stained with hematoxylin/eosin and demonstrate severity of spongiform lesion and \u003cstrong\u003e(e) \u003c/strong\u003ethose through the S1 somatosensory cortex (bregma 0.0mm), which were immunostained against the prion protein. \u003cstrong\u003e(d) \u003c/strong\u003eUnbiased quantification of the spongiform lesion load in the M1 cortex and \u003cstrong\u003e(f) \u003c/strong\u003ethat of integrated density (ID) of anti-PrP immunostaining in the S1 cortex\u003cstrong\u003e. \u003c/strong\u003eAnimals are grouped by the \u003cem\u003eAPOE\u003c/em\u003e genotype, inoculum (NBH or 22L), and survival time expressed as the number of weeks post inoculation (wpi). \u003cstrong\u003e(a) \u003c/strong\u003eKaplan-Meier estimates n=8-14 or n=12-23 animals per \u003cem\u003eAPOE\u003c/em\u003e genotype for NBH and 22L inoculated groups, respectively. †\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 denotes significance between \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e or \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, while ‡\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05 or ‡\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001 between \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (Log-Rank test). Differences between 22L and NBH groups are not shown, but they are significant at \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 for any pairwise comparison. \u003cstrong\u003e(b) \u003c/strong\u003eValues represent\u003cstrong\u003e \u003c/strong\u003emean ± SEM from 4-12 animals per sex and \u003cem\u003eAPOE\u003c/em\u003e genotype. †\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001\u003csup\u003e \u003c/sup\u003edenotes\u003csup\u003e \u003c/sup\u003esignificance between \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e or \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, while ‡\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 between \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e\u003cem\u003e \u003c/em\u003eand\u003cem\u003e ε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (repeated measures ANOVA). \u003cstrong\u003e(d, f) \u003c/strong\u003eValues represent\u003cstrong\u003e \u003c/strong\u003emean + SEM from n=5-9 and n=8-12 animals per \u003cem\u003eAPOE\u003c/em\u003e genotype in NBH\u003csub\u003e23wpi\u003c/sub\u003e and 22L\u003csub\u003e15wpi\u003c/sub\u003e groups and 22L\u003csub\u003e23wpi\u003c/sub\u003e groups, respectively.\u0026nbsp; \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 (one-way ANOVA); *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, and ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 (Holm’s-Sidak’s post hoc). Non-significant differences not shown. \u003cstrong\u003e(e)\u003c/strong\u003e Roman numerals denote neuronal layers of the isocortex. Scale bars: 50mm in \u003cstrong\u003e(c)\u003c/strong\u003e and 100mm in \u003cstrong\u003e(e)\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"FiguresLizinczykAMetal1.png","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/28774f2db8563e9372d22252.png"},{"id":94795273,"identity":"259a3090-6843-4e1c-8338-f8aa5a0982fc","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":544408,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAPOE ε4\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e allele is associated with increased PrP\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003eSc\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e accumulation.\u003c/strong\u003e Shown are immunoblot analyses for \u003cstrong\u003e(a) \u003c/strong\u003ethe total PrP protein, \u003cstrong\u003e(c) \u003c/strong\u003eproteinase K (PK) resistant PrP\u003csup\u003eSc\u003c/sup\u003e conformer,\u003cstrong\u003e \u003c/strong\u003eand \u003cstrong\u003e(e) \u003c/strong\u003etotal PrP\u003cstrong\u003e \u003c/strong\u003eseparated into\u003cstrong\u003e \u003c/strong\u003edetergent insoluble and soluble\u003cstrong\u003e \u003c/strong\u003efractions in the brain cortex homogenate from mice of indicated \u003cem\u003eAPOE\u003c/em\u003e genotypes, which were inoculated with normal brain homogenate (NBH) or 22L scrapie strain and killed 15 or 23 weeks post inoculation (wpi).\u0026nbsp; Also included are an immunoblot for β-actin in \u003cstrong\u003e(a) \u003c/strong\u003eand a PK undigested sample of brain cortex homogenate\u003cstrong\u003e \u003c/strong\u003ein \u003cstrong\u003e(c), \u003c/strong\u003ewhich were used as controls for equal protein load and protein-band weigh-shift resulting from PK digestion, respectively.\u003cstrong\u003e \u003c/strong\u003eShown are results of densitometric quantification of the protein band optical densities (OD) for \u003cstrong\u003e(b) \u003c/strong\u003ethe total PrP protein,\u003cstrong\u003e (d) \u003c/strong\u003ethe PrP\u003csup\u003eSc\u003c/sup\u003e conformer, and \u003cstrong\u003e(f)\u003c/strong\u003e the insoluble / soluble PrP ratio.\u0026nbsp; These analyses show a significant increase in the total PrP level, the appearance of PrP\u003csup\u003eSc\u003c/sup\u003e and detergent insoluble PrP in 22L\u003csub\u003e23wpi\u003c/sub\u003e groups compared to NBH\u003csub\u003e23wpi\u003c/sub\u003e and 22L\u003csub\u003e15wpi\u003c/sub\u003e animals.\u0026nbsp; The greatest increase in all three metrics is seen in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice at 23 wpi. \u003cstrong\u003e(b, d, f)\u003c/strong\u003e Shown are mean\u003cstrong\u003e \u003c/strong\u003evalues\u003cstrong\u003e \u003c/strong\u003e+ SEM from 6 to 10 mice per \u003cem\u003eAPOE\u003c/em\u003e genotype in NBH\u003csub\u003e23wpi\u003c/sub\u003e and 22L\u003csub\u003e15wpi\u003c/sub\u003e groups and from 10 to 16 mice per \u003cem\u003eAPOE\u003c/em\u003e genotype in 22L\u003csub\u003e23wpi \u003c/sub\u003egroups along with data points representing single female and male animals. \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 (one-way ANOVA); **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001, and ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 for post-hoc comparison (Holm’s-Sidak’s test). Non-significant differences are not shown on the graphs.\u003c/p\u003e","description":"","filename":"FiguresLizinczykAMetal2.png","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/56e5b356039a18c1a33c86ea.png"},{"id":94795277,"identity":"961dcb8d-18b6-41b8-9fca-fc26bf65f785","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":743160,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e APOE ε4 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eallele is associated with increased PrP oligomerization\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e. \u003c/strong\u003e\u003c/em\u003eShown is immunoblot analysis of the PrP protein in the brain homogenate, which was separated into 14 fractions by velocity sedimentation using a 10%-60% sucrose gradient.\u0026nbsp; Mice of indicated \u003cem\u003eAPOE\u003c/em\u003e genotypes were inoculated with \u003cstrong\u003e(a)\u003c/strong\u003e normal brain homogenate (NBH) or \u003cstrong\u003e(b)\u003c/strong\u003e 22L scrapie strain and killed 23 weeks post inoculation (wpi). Molecular weight markers: bovine serum albumin (BSA) (68 kDa), alcohol dehydrogenase (ADH) (150 kDa) and apoferritin (APO) (443 kDa) were detected within indicated fractions. Shown are the results of densitometric analysis of the PrP protein band optical densities (OD) detected across the 14 fractions in NBH \u003cstrong\u003e(c)\u003c/strong\u003e or 22L inoculated animals \u003cstrong\u003e(d)\u003c/strong\u003e. Values represent a percentage of the prion protein band OD in each fraction relative to the sum of OD in 1-14 fractions. Shown is mean + SEM from 3-8 animals per \u003cem\u003eAPOE\u003c/em\u003e genotype and inoculum. In NBH inoculated animals PrP is detectable only in fractions 1-4, while in 22L infected mice also in fractions 8-10 and 11-14, what indicates formation of PrP oligomeric complexes during prion infection. This effect is \u003cem\u003eAPOE\u003c/em\u003e genotype dependent with \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice showing the highest level of PrP oligomers in fractions 11-14. Two-sample Kolmogorov-Smirnov test was used for pairwise analysis of differences in the distribution of the PrP signal across the 14 fractions: \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 for \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e vs. \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e or \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01 for \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e vs. \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e. Differences between \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e or \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e vs. \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e\u003csub\u003e22L \u003c/sub\u003ewere not significant. See Supplementary File 2, Table S1. \u003cstrong\u003e(e) \u003c/strong\u003ePie chart visualization of the \u003cem\u003eAPOE\u003c/em\u003e genotype effect on the PrP oligomerization in 22L infected mice. PrP OD signals in fractions 1-4, 5-7, 8-10, and 11-14 were summed, averaged across individual animals, and expressed as fractions of the total.\u003c/p\u003e","description":"","filename":"FiguresLizinczykAMetal3.png","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/572d64700bd678c5ca5886d5.png"},{"id":94795274,"identity":"0f6d9a2e-c1df-42df-81b3-8908cc75b180","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":539417,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eApoE protein accumulates during prion infection and forms complexes with PrP in the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAPOE\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e allele dependent manner. (a) \u003c/strong\u003eShown are immunoblot analyses of the apoE protein level in the brain cortex in animals of indicated \u003cem\u003eAPOE\u003c/em\u003e genotype, inoculum type, and survival time. Also included are immunoblots for b-actin used as a loading control in all experiments. \u003cstrong\u003e(b) \u003c/strong\u003eDensitometric quantification of apoE protein band optical densities (OD) in 22L infected mice at 15 and 23 weeks post inoculation (wpi) expressed relative to NBH-inoculated controls for matching \u003cem\u003eAPOE\u003c/em\u003e genotype. Significant increase in the apoE level is seen in 22L infected mice at 23 wpi but not at 15 wpi and is the highest in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals. \u003cstrong\u003e(c) \u003c/strong\u003eShown are immunoblot analyses of PrP/apoE complexes in mice of indicated \u003cem\u003eAPOE\u003c/em\u003e genotype, inoculum type, and survival time. The complexes were immunoprecipitated using the HJ15.3 anti-apoE mAb from the brain cortex homogenate, resolved by SDS-PAGE under reducing conditions, and dissociated PrP was detected using 6D11 anti-CD230 clone. Included are immunoblots for apoE on membranes, which were stripped and re-probed using goat polyclonal anti-human apoE antibody. Shown are the results of densitometric quantification of \u003cstrong\u003e(d)\u003c/strong\u003e PrP protein band optical densities (OD) and \u003cstrong\u003e(e)\u003c/strong\u003e the ratio of PrP to apoE OD in PrP/apoE complexes immunoprecipitated with HJ15.3 anti-apoE mAb. Values represent mean\u003cstrong\u003e \u003c/strong\u003e+ SEM from 8 to10 mice per group in \u003cstrong\u003e(b)\u003c/strong\u003e and from 4 to 6 mice per group in \u003cstrong\u003e(d) \u003c/strong\u003eand \u003cstrong\u003e(e) \u003c/strong\u003ealong with data points for single female and male animals. \u003cstrong\u003e(b)\u003c/strong\u003e, \u003cstrong\u003e(d), \u003c/strong\u003eand \u003cstrong\u003e(e) \u003c/strong\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 (one-way ANOVA); *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, and ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 for post-hoc comparison (Holm’s-Sidak’s test). Non-significant differences are not shown on the graphs.\u003c/p\u003e","description":"","filename":"FiguresLizinczykAMetal4.png","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/ad7e61d44364dc8e9ba8c974.png"},{"id":94824926,"identity":"85d976b5-b690-4fe1-902e-deabe7919f57","added_by":"auto","created_at":"2025-10-31 06:49:34","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1034124,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eAPOE\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e genotype differentially affects microglia activation during prion infection. \u003c/strong\u003eShown are\u003cstrong\u003e \u003c/strong\u003erepresentative micrographs of the coronal sections through the S1 somatosensory cortex (bregma 0.0 mm), which were immunostained against microglia specific markers:\u003cstrong\u003e (a) \u003c/strong\u003eionized calcium adaptor protein 1 (IBA1) and \u003cstrong\u003e(c) \u003c/strong\u003ecluster of differentiation 68 (CD68) in mice of indicated \u003cem\u003eAPOE\u003c/em\u003e genotype, inoculum type, and survival time. Unbiased quantification of \u003cstrong\u003e(b) \u003c/strong\u003eIBA1 and \u003cstrong\u003e(d) \u003c/strong\u003eCD68 positive microglia load in the S1 somatosensory cortex.\u0026nbsp; Values represent mean\u003cstrong\u003e \u003c/strong\u003e+ SEM from 6 to 8 mice per \u003cem\u003eAPOE\u003c/em\u003e genotype in NBH\u003csub\u003e23wpi\u003c/sub\u003e and 22L\u003csub\u003e15wpi\u003c/sub\u003e groups and from 11 to 14 mice per \u003cem\u003eAPOE\u003c/em\u003e genotype in 22L\u003csub\u003e23wpi \u003c/sub\u003egroups. Data points represent single female and male animals. \u003cstrong\u003e(b), (d) \u003c/strong\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 (one-way ANOVA); *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, and ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 for post-hoc comparison (Holm’s-Sidak’s test). Non-significant differences are not indicated on the graphs.\u003cstrong\u003e \u003c/strong\u003eRoman numerals in \u003cstrong\u003e(a)\u003c/strong\u003e and \u003cstrong\u003e(c)\u003c/strong\u003e denote neuronal layers of the brain isocortex. Scale bars: 150mm in \u003cstrong\u003e(a)\u003c/strong\u003e and \u003cstrong\u003e(c)\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"FiguresLizinczykAMetal5.png","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/ce672ad69e1fc668113bb214.png"},{"id":94795282,"identity":"a1a9f371-9563-46e4-93d0-a3603d409880","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":373654,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMicroglia transcriptomic response during prion infection is differentially regulated by the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAPOE\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e genotype. (a)\u003c/strong\u003e Shown is the transcript heatmap of nanoStringTM nCounter\u003csup\u003e®\u003c/sup\u003e expression data from animals of indicated \u003cem\u003eAPOE\u003c/em\u003e genotype and inoculum type at 23 weeks post inoculation (wpi). Microglia specific genes are vertically arranged into three groups: activated microglia markers, immune response, and recognition receptors. Results of hierarchical cluster analysis for all genes are displayed above the heatmap. Shown is fold change of nanoStringTM nCounter\u003csup\u003e® \u003c/sup\u003evalues in 22L\u003csub\u003e23wpi \u003c/sub\u003eanimals relative to their \u003cem\u003eAPOE\u003c/em\u003e-matched NBH\u003csub\u003e23wpi\u003c/sub\u003e controls for\u003csup\u003e \u003c/sup\u003e\u003cstrong\u003e(b) \u003c/strong\u003eactivated microglia gene markers, \u003cstrong\u003e(c) \u003c/strong\u003emicroglia immune response genes, and \u003cstrong\u003e(d) \u003c/strong\u003erecognition receptors genes. Values represent mean + SEM from four animals per \u003cem\u003eAPOE\u003c/em\u003e genotype. \u003cstrong\u003e(b)\u003c/strong\u003e, \u003cstrong\u003e(c), \u003c/strong\u003eand \u003cstrong\u003e(d) \u003c/strong\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 for all analyzed genes except for \u003cem\u003eStab1\u003c/em\u003e \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001 (one-way ANOVA); *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001, and ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 for post-hoc comparison (Holm’s-Sidak’s test). Non-significant differences are not shown on the graphs.\u003c/p\u003e","description":"","filename":"FiguresLizinczykAMetal6.png","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/f0319e5eb7142c8b822f7688.png"},{"id":94795288,"identity":"727537a4-d7e1-4dad-b2df-3e59ff9e973c","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1006054,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePrion-related astrogliosis is differentially affected by the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAPOE\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e genotype. \u003c/strong\u003eShown are \u003cstrong\u003e(a) \u003c/strong\u003eimmunoblot analysis of the glial fibrillary acidic protein (GFAP) in the brain cortex in animals of indicated \u003cem\u003eAPOE\u003c/em\u003e genotype, inoculum type, and survival time along with immunoblots for b-actin used as a loading control and \u003cstrong\u003e(b) \u003c/strong\u003edensitometric quantification of GFAP band optical densities (OD) exemplified in \u003cstrong\u003e(a)\u003c/strong\u003e. Shown are \u003cstrong\u003e(c) \u003c/strong\u003erepresentative microphotographs of the coronal sections through the S1 somatosensory cortex (bregma 0.0 mm), which were immunostained against GFAP and \u003cstrong\u003e(d) \u003c/strong\u003eunbiased quantification of GFAP positive astrocyte load in the S1 somatosensory cortex.\u0026nbsp; Roman numerals in \u003cstrong\u003e(c) \u003c/strong\u003edenote cellular layers of the somatosensory cortex. \u003cstrong\u003e(e) \u003c/strong\u003eShown are\u003cstrong\u003e \u003c/strong\u003erepresentative high magnification microphotographs of astrocytes double immunostained for the C3 complement protein and GFAP and \u003cstrong\u003e(f) \u003c/strong\u003equantitative analysis of C3/GFAP ratio in the S1 cortex. Values in \u003cstrong\u003e(b), (d)\u003c/strong\u003e, and \u003cstrong\u003e(f) \u003c/strong\u003erepresent mean\u003cstrong\u003e \u003c/strong\u003e+ SEM from 6 to 10 mice per group except for 22L\u003csub\u003e23wpi \u003c/sub\u003egroups where the number of animals ranges from 8 to 14. Values for individual female and male animals are shown overlying the group bars. \u003cstrong\u003e(b), (d)\u003c/strong\u003e, and \u003cstrong\u003e(f) \u003c/strong\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 (one-way ANOVA); *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001 and ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 for post-hoc comparison (Holm’s-Sidak’s test). Non-significant differences are not indicated.\u0026nbsp; Scale bars: 150mm in \u003cstrong\u003e(c)\u003c/strong\u003e and 10mm in \u003cstrong\u003e(e)\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"FiguresLizinczykAMetal7.png","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/c61232837007ccb616b77f0b.png"},{"id":94795284,"identity":"3833e30c-b3d5-486d-8a53-2ee75a300c9b","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":342411,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eAPOE\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e genotype differentially regulates transcriptomic profile in astrocytes. (a)\u003c/strong\u003e Shown is the transcript heatmap of nanoStringTM nCounter\u003csup\u003e®\u003c/sup\u003e expression data from animals of indicated \u003cem\u003eAPOE\u003c/em\u003e genotype and inoculum type at 23 weeks post inoculation (wpi). Astrocyte specific genes are vertically arranged into four groups: markers of reactive astrocytes, antigen processing and presenting, immune response, and interferon (IFN) induced. Results of hierarchical cluster analysis for all genes are displayed above the heatmap. Shown is fold change of nanoStringTM nCounter\u003csup\u003e® \u003c/sup\u003evalues in 22L\u003csub\u003e23wpi \u003c/sub\u003eanimals relative to their \u003cem\u003eAPOE\u003c/em\u003e-matched NBH\u003csub\u003e23wpi\u003c/sub\u003e controls for\u003csup\u003e \u003c/sup\u003e\u003cstrong\u003e(b) \u003c/strong\u003ereactive astrocytes gene markers, \u003cstrong\u003e(c) \u003c/strong\u003eantigen processing and presenting genes, \u003cstrong\u003e(d) \u003c/strong\u003eimmune response genes and \u003cstrong\u003e(e) \u003c/strong\u003eIFN induced genes. Values represent mean + SEM from four animals per \u003cem\u003eAPOE\u003c/em\u003e genotype. \u003cstrong\u003e(b)\u003c/strong\u003e, \u003cstrong\u003e(c), (d) \u003c/strong\u003eand \u003cstrong\u003e(e) \u003c/strong\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 for all analyzed genes except for \u003cem\u003eSox9\u003c/em\u003e \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01; *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001, and ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 for post-hoc comparison (Holm’s-Sidak’s test). Non-significant differences are not shown on the graphs.\u003c/p\u003e","description":"","filename":"FiguresLizinczykAMetal8.png","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/2a644331adaad52879756df2.png"},{"id":94826144,"identity":"a1389841-2fbb-4118-9594-d9b1c2b2bfd9","added_by":"auto","created_at":"2025-10-31 06:51:11","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":327294,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eReciprocal microglia-astrocyte activation is \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAPOE\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e genotype dependent. \u003c/strong\u003eShown are fold gene expression values for \u003cstrong\u003e(a)\u003c/strong\u003e genes underlying reciprocal microglia-astrocyte pro-inflammatory activation: \u003cem\u003eC3\u003c/em\u003e, \u003cem\u003eIl1a\u003c/em\u003e, \u003cem\u003eTnfa\u003c/em\u003e and \u003cem\u003eC1qa\u003c/em\u003e, \u003cstrong\u003e(b)\u003c/strong\u003eneurodegenerative microglia markers \u003cem\u003eAif1\u003c/em\u003e, \u003cem\u003eC3ar1\u003c/em\u003e, and \u003cem\u003eCx3cr1\u003c/em\u003e, and \u003cstrong\u003e(c)\u003c/strong\u003e reactive astrocyte markers \u003cem\u003eGfap\u003c/em\u003e, \u003cem\u003eCcl12\u003c/em\u003e, and \u003cem\u003eCcl2\u003c/em\u003e. Values represent mean + SEM of qRT-PCR readouts from 4 to 11 animals of indicated \u003cem\u003eAPOE\u003c/em\u003e genotype, inoculum, and survival time. \u003cstrong\u003e(a)\u003c/strong\u003e,\u003cstrong\u003e (b)\u003c/strong\u003e,\u003cstrong\u003e \u003c/strong\u003eand \u003cstrong\u003e(c) \u003c/strong\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 (one-way ANOVA); *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001, and ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001 for post-hoc comparison (Holm’s-Sidak’s test). Non-significant differences are not indicated.\u003c/p\u003e","description":"","filename":"FiguresLizinczykAMetal9.png","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/8149d69c00e0c6089a093c27.png"},{"id":94795289,"identity":"82aebd36-e5a7-4043-b963-c8d44d38e9ed","added_by":"auto","created_at":"2025-10-30 19:39:18","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":814883,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic presentation of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAPOE\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e genotype effect in prion pathogenesis. \u003c/strong\u003eIn prion disease PrP\u003csup\u003eC\u003c/sup\u003e undergoes a series of conformational changes, which are associated with reduced solubility, increased oligomerization, and resistance to proteolytic degradation. The ensuing PrP\u003csup\u003eSc\u003c/sup\u003e conformer accumulates and causes neuronal demise. Both PrP\u003csup\u003eSc \u003c/sup\u003eand neuronal remnants activate microglia, which through secretion of C1QA, IL1a, and TNFa activate astrocytes. In turn, activated astrocytes secrete complement component 3 (C3), which reciprocally stimulate microglia through the C3ar1 receptor. This self-propagating microglia-astrocyte pro-inflammatory feedback loop is an effective driver of neuroinflammation. The \u003cem\u003eAPOE\u003c/em\u003e \u003cem\u003ee4\u003c/em\u003e allele produces a double hit effect by fostering disease specific changes in the PrP protein and increasing its accumulation and by promoting the microglia-astrocyte inflammatory response. The \u003cem\u003ee2\u003c/em\u003e allele is associated with a single hit effect. It does not influence disease specific changes in the PrP protein but promotes inflammatory response compared to the \u003cem\u003ee3\u003c/em\u003e allele. Created in BioRender.\u0026nbsp;Lizinczyk, A.M. (2025)\u0026nbsp;https://BioRender.com/2vhco40\u0026nbsp;\u003c/p\u003e","description":"","filename":"FiguresLizinczykAMetal10.png","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/a06c41b24071aa90ef47ff44.png"},{"id":101152936,"identity":"d8945d40-8216-49ca-b4ef-f26a5ca83129","added_by":"auto","created_at":"2026-01-26 16:13:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9591909,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/fd2e074f-a97f-448d-b6ee-665db19a4978.pdf"},{"id":94825683,"identity":"a8546f65-ec72-45bb-8e82-cac47defd9a3","added_by":"auto","created_at":"2025-10-31 06:50:34","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2855704,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile1LizinczyAMetal.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/401c7fa90c682e9369962ab5.pdf"},{"id":94824769,"identity":"186258fb-1ffe-4dc8-aa71-99c1650525c6","added_by":"auto","created_at":"2025-10-31 06:49:18","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":171125,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile2LizinczykAMetal.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/fc9ee3586c87801b6ffc6f71.pdf"},{"id":94795296,"identity":"655d4ee5-7e59-4860-b243-f09ae5a24cd6","added_by":"auto","created_at":"2025-10-30 19:39:26","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":213828775,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile3LizinczykAMetal.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7820890/v1/5b337d1c9fafbdceb44bdae7.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"APOE Genotype Differentially Modulates Prion Pathology in a Mouse Model","fulltext":[{"header":"Introduction","content":"\u003cp\u003eApolipoprotein (apo) E is a 34-kDa lipid transporting protein encoded by the \u003cem\u003eAPOE\u003c/em\u003e gene located on chromosome 19q13.32 and expressed by hepatocytes, astrocytes, immune cells of the myeloid-lineage, vascular smooth muscle cells and adipocytes [\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e]. \u003cem\u003eAPOE\u003c/em\u003e polymorphism includes three common alleles \u003cem\u003eε2, ε3\u003c/em\u003e, and \u003cem\u003eε4\u003c/em\u003e, with world-wide distribution frequencies of 6.4%, 78.3%, and 14.5%, respectively [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. They encode respective isoforms of the apoE protein, which differ in the presence of cysteine and arginine at positions 112 and 158 and feature impactful dissimilarities in tertiary structure, lipid binding ability, and receptor-mediated clearance [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]. \u003cem\u003eAPOE\u003c/em\u003e polymorphism influences the risk of occurrence and the rate of progression in several cardiovascular and neurodegenerative diseases [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR119\" class=\"CitationRef\"\u003e119\u003c/span\u003e]. The presence of the \u003cem\u003eε4\u003c/em\u003e allele significantly increases risk of coronary artery disease, while the \u003cem\u003eε2\u003c/em\u003e allele is associated with elevated plasma triglyceride level, and increases risk of peripheral vascular disease and carotid atherosclerosis [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR101\" class=\"CitationRef\"\u003e101\u003c/span\u003e]. Since its discovery in the early 90\u0026rsquo;s, \u003cem\u003eAPOE\u003c/em\u003e polymorphism has remained the strongest identified genetic factor affecting risk of late-onset Alzheimer\u0026rsquo;s disease (LOAD) with the \u003cem\u003eε4\u003c/em\u003e allele being associated with increased disease occurrence [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR119\" class=\"CitationRef\"\u003e119\u003c/span\u003e], while the \u003cem\u003eε2\u003c/em\u003e allele effectively lowering the risk among \u003cem\u003eε4\u003c/em\u003e allele non-carriers [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e]. This strong clinical effect is canonically explained by the opposing effects of ε\u003cem\u003e4\u003c/em\u003e and \u003cem\u003eε2\u003c/em\u003e alleles on brain clearance of soluble β-amyloid (Aβ) peptide [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], Aβ aggregation [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], and Aβ plaque formation [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e, \u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e97\u003c/span\u003e], which are critical steps in establishing early AD pathology. Irrespective of promoting LOAD\u0026rsquo;s occurrence, the \u003cem\u003eε4\u003c/em\u003e allele is associated with worse outcome of once established disease, via modulation of several disease mechanisms, including spread of tau pathology [\u003cspan citationid=\"CR99\" class=\"CitationRef\"\u003e99\u003c/span\u003e], neuroinflammatory response [\u003cspan citationid=\"CR98\" class=\"CitationRef\"\u003e98\u003c/span\u003e], and endo-lysosomal system dysfunction [\u003cspan citationid=\"CR100\" class=\"CitationRef\"\u003e100\u003c/span\u003e], which all are potent contributors to faster rate of dementia progression among \u003cem\u003eε4\u003c/em\u003e carriers compared to non-carriers [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e]. Besides LOAD, \u003cem\u003eAPOE\u003c/em\u003e polymorphism also affects the risk of occurrence and the rate of progression of several other neurodegenerative diseases including primary tauopathies, α-synucleinopathies, and age-related macular degeneration, but unlike LOAD, in some of these entities not the \u003cem\u003eε4\u003c/em\u003e allele but the \u003cem\u003eε2\u003c/em\u003e allele has been found to produce worse outcomes [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR128\" class=\"CitationRef\"\u003e128\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePrion diseases or prionoses are neurodegenerative proteinopathies, characterized by the accumulation of disease specific scrapieform conformer (PrP\u003csup\u003eSc\u003c/sup\u003e), which sets off a neurodegenerative cascade including proinflammatory activation of microglia and astrocytes [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e] leading to widespread synaptic and neuronal loss and an ultimately fatal outcome [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e, \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e, \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e]. PrP\u003csup\u003eSc\u003c/sup\u003e arises from the cellular prion protein (PrP\u003csup\u003eC\u003c/sup\u003e) in a process known as recycling propagation, in which PrP\u003csup\u003eSc\u003c/sup\u003e binds PrP\u003csup\u003eC\u003c/sup\u003e during its recycling cycle between the plasma membrane and the endosomal compartment and forces PrP\u003csup\u003eC\u003c/sup\u003e to adopt its own β-sheet-rich secondary conformation [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Transition between PrP\u003csup\u003eC\u003c/sup\u003e and PrP\u003csup\u003eSc\u003c/sup\u003e conformers is gradual and associated with a number of physicochemical changes, including reduced detergent solubility, oligomerization, and acquisition of partial proteolytic resistance, which is a hallmark property of PrP\u003csup\u003eSc\u003c/sup\u003e [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e, \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e, \u003cspan citationid=\"CR115\" class=\"CitationRef\"\u003e115\u003c/span\u003e]. Prionoses affect both human and non-human mammalian species [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e]. The list of human prionoses include Creutzfeldt-Jakob disease (CJD), Gerstmann Straussler Scheinker syndrome, fatal familial insomnia, variably protease-sensitive prionopathy and kuru. Sporadic CJD (sCJD) with an annual incidence approximated at one case per million is the most common of the human prionoses [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e, \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e]. Given several shared characteristics between sCJD and other neurodegenerative diseases, which include strong association with aging, misfolded protein centered pathology, and chronic neuroinflammatory activation, several past studies have explored how \u003cem\u003eAPOE\u003c/em\u003e polymorphism might influence the risk of sCJD occurrence. While some initial reports suggested a modest uptick in incidence among \u003cem\u003eε4\u003c/em\u003e carriers [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR118\" class=\"CitationRef\"\u003e118\u003c/span\u003e] this association was refuted by subsequent studies [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e, \u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e95\u003c/span\u003e, \u003cspan citationid=\"CR126\" class=\"CitationRef\"\u003e126\u003c/span\u003e]. Expanding knowledge on the modulatory effects played by \u003cem\u003eAPOE\u003c/em\u003e alleles in various mechanisms of neurodegeneration and separating these mechanisms into those regulating the risk of disease occurrence from those affecting the rate of progression [\u003cspan citationid=\"CR119\" class=\"CitationRef\"\u003e119\u003c/span\u003e] merit a careful examination whether \u003cem\u003eAPOE\u003c/em\u003e polymorphism might influence the course of neurodegeneration in prionoses. However, the limited number of clinical cases and well-recognized complexity of human prion disease, which includes factors like codon 129 polymorphism, PrP\u003csup\u003eSc\u003c/sup\u003e subtypes, and variable presence of Aβ co-pathology [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e], render systematic analysis of the \u003cem\u003eAPOE\u003c/em\u003e polymorphism effect on disease progression in human prion entities arduous to conduct and inherently underpowered [\u003cspan citationid=\"CR126\" class=\"CitationRef\"\u003e126\u003c/span\u003e]. To control for these variables we used \u003cem\u003eAPOE\u003c/em\u003e targeted replacement (\u003cem\u003eAPOE\u003c/em\u003e-TR) mice, where both murine \u003cem\u003eApoe\u003c/em\u003e alleles are replaced by human \u003cem\u003eAPOE\u003c/em\u003e alleles [\u003cspan citationid=\"CR110\" class=\"CitationRef\"\u003e110\u003c/span\u003e], and infected them with 22L mouse adapted scrapie strain, which is an established and reliable laboratory model of prion disease featuring limited variability in disease latency and neuropathological metrics [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e, \u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e]. Using this model, we determined the detrimental effect of the \u003cem\u003eε4\u003c/em\u003e allele and to a lesser extent the \u003cem\u003eε2\u003c/em\u003e allele on progression of neurodegeneration compared to the \u003cem\u003eε3\u003c/em\u003e allele.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eMaterial and reagents\u003c/h2\u003e\u003cp\u003eUnless otherwise specified, all reagents and chemicals were purchased from Sigma-Aldrich (St. Louis, MO). Information on primary and secondary antibodies used for Western immunoblotting and immunohistochemistry is provided in Tables\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, respectively. Sequences of primers used for Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) are listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. All primers were made to order by Sigma-Aldrich.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of antibodies used for Western immunoblotting\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntigen\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHost\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDilution\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSource\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCat. #\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eClone\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eβ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:10,000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSigma- Aldrich, St. Louis, MO\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eA2228\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eAC-74\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCluster of differentiation (CD) 230*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:5,000\u003csup\u003e**\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eBioLegend, San Diego, CA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e808001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e6D11\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGlial fibrillary acidic protein (GFAP)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRabbit\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:15,000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eDako/Agilent Technologies, Santa Clara, CA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eZ0334\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHuman apoE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGoat\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:5,000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eMeridian Life Science Inc., Memphis, TN\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eK74180B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHRP-linked anti-goat IgG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDonkey\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:25,000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSanta Crus Biotechnology Inc., Dallas, Tx\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSc-2020\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHRP-linked anti-rabbit IgG F(ab\u0026rsquo;)2 specific\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDonkey\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:30,000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCytiva, Marlborough, MA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNA9340\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHRP-linked anti-mouse IgG F(ab\u0026rsquo;)2 specific\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSheep\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:30,000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCytiva, Marlborough, MA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNA9310\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"6\"\u003e* CD230 denotes prion protein (PrP)\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd colspan=\"6\"\u003e** for Western immunoblot detection of immunoprecipitated PrP, dilution of 6D11 was increased to 1:2,000\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of antibodies used for immunohistochemistry\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntigen\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHost\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDilution\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSource\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCat. #\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eClone\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCluster of differentiation (CD) 68\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRat\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:250\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAbcam Inc., Cambridge, MA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eAb53444\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eFA-11\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCluster of differentiation (CD) 230*\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMouse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:200\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eBioLegend, San Diego, CA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e808001\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e6D11\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eComplement component 3 (C3)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRat\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eHycult Biotech, Uden, Netherlands\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eHM1045\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e11H9\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGlial fibrillary acidic protein (GFAP)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRabbit\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:2,000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eDako/Agilent Technologies, Santa Clara, CA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eZ0334\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIonized calcium adaptor protein 1 (IBA1)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRabbit\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:1,000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eWako Chemicals Inc., Richmond, VA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e019-19741\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAlexa 594-conjugated anti-mouse IgG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGoat\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:500\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eJackson Immuno Research Labs, West Grove, PA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e115-585-146\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAlexa 488- conjugated anti-rabbit IgG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGoat\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:500\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eJackson Immuno Research Labs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e111-545-144\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAlexa 594- conjugated anti-rabbit IgG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGoat\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:500\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eJackson Immuno Research Labs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e111-585-144\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAlexa 594- conjugated anti-rat IgG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGoat\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1:500\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eJackson Immuno Research Labs\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e112-585-143\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"6\"\u003e* CD230 denotes prion protein (PrP)\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of primer sequences used for RT-qPCR\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene Symbol\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer Sequence (5\u0026rsquo; \u0026minus;\u0026thinsp;3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse Primer Sequence (5\u0026rsquo; \u0026minus;\u0026thinsp;3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGapdh\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGGTCGGTGTGAACGGATTTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGTAGACCATGTAGTTGAGGTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eC3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCAGCTCCCCATTAGCTCTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCACTTGCCTCTTTAGGAAGTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eIl1α\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGCTTGAGTCGGCAAAGAAAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTTCCCGTTGCTTGACGTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eC1qa\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAAGGCAATCCAGGCAATATCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGGTTCTGGTATGGACTCTCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eAif\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCTTCGTTTTACCATCAGCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGACACGGACGCTGGCCTGAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eC3ar1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCGATGCTGACACCAATTCAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCCAATAGACAAGTGAGACCAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCx3cr1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGCATCGACCGGTACCTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCTGCACTGTCCGGTTGTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGfap\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGCGCTCAATGCTGGCTTCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCTGCCTCCAGCCTCAGGTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCcl12\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATTTCCACATTCTATGCCTCCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATCCAGTATGGTCCTGAAGATCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCcl2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCACTCACCTGCTGCTACTCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCTTGGTGACAAAAACTACAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTnfα\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGTGCTCAGAGCTTTCAACAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTTGATGGTGGTGCATGAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eTransgenic animals\u003c/h3\u003e\n\u003cp\u003e All mouse care and experimental procedures were approved by Institutional Animal Care and Use Committees of the New York University Grossman School of Medicine. \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e, \u003cem\u003eε2/ε2\u003c/em\u003e, \u003cem\u003eε3/ε3\u003c/em\u003e, and \u003cem\u003eε4/ε4\u003c/em\u003e strains have been detailed in previous publications [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR127\" class=\"CitationRef\"\u003e127\u003c/span\u003e]. \u003cem\u003eε2/ε2\u003c/em\u003e, \u003cem\u003eε3/ε3\u003c/em\u003e, and \u003cem\u003eε4/ε4\u003c/em\u003e lines are \u003cem\u003eAPOE\u003c/em\u003e targeted replacement mice, where both murine \u003cem\u003eApoe\u003c/em\u003e alleles are replaced by isogenic human \u003cem\u003eAPOE\u003c/em\u003e alleles and those remain expressed under the endogenous \u003cem\u003eApoe\u003c/em\u003e promoter. We maintain a colony of \u003cem\u003eAPP/PS1/Apoe\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e, \u003cem\u003eAPP/PS1/ε2/ε2\u003c/em\u003e, \u003cem\u003eAPP/PS1/ε3/ε3\u003c/em\u003e, and \u003cem\u003eAPP/PS1/ε4/ε4\u003c/em\u003e mice, which are heterozygous for the \u003cem\u003eAPP/PS1\u003c/em\u003e transgene [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. For this project we used non-transgenic offsprings from this colony, which did not carry the \u003cem\u003eAPP/PS1\u003c/em\u003e transgene. All animals were subjected to genomic DNA analysis. They genotyped negatively for the \u003cem\u003eAPP/PS1\u003c/em\u003e transgene, while their \u003cem\u003eAPOE\u003c/em\u003e genotype was confirmed by restricted fragment length polymorphism of the \u003cem\u003eAPOE\u003c/em\u003e amplification product as previously described [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. All mice used in this study were on C57BL/6 background.\u003c/p\u003e\n\u003ch3\u003eExperimental design\u003c/h3\u003e\n\u003cp\u003ePrion disease was induced by intraperitoneal inoculation with 22L mouse adapted scrapie strain following our published protocols [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e, \u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e]. Control animals were intraperitoneally inoculated with the normal brain homogenate (NBH). Mice were inoculated at the age of 10\u0026ndash;12 weeks, maintaining\u0026thinsp;~\u0026thinsp;50%:50% female: male ratio per each experimental group. Mice were euthanized at 23 weeks post inoculation (wpi.), when all 22L-inoculated groups displayed overt neurological signs of prion disease, while NBH inoculated control mice appeared healthy. A subset of 22L-inoculated mice also was euthanized at 15 wpi. when the mice remain presymptomatic, to assess accumulation of PrP\u003csup\u003eSc\u003c/sup\u003e in the lymphoreticular system (LRS) and characterize early stage of neuroinvasion. In the manuscript, 22L-inoculated mice euthanized at 15 and 23 wpi. are alternatively referred to as presymptomatic and symptomatic animals, respectively.\u003c/p\u003e\n\u003ch3\u003ePrion inoculation, animals’ care, and behavioral testing\u003c/h3\u003e\n\u003cp\u003eThe 22L prion inoculum was prepared from the brains of C57BL/6 mice, which were infected with 22L mouse adapted scrapie strain and housed in an Animal Biosafety Level 2 facility until they reached the terminal stage of prion disease. Their brains were harvested and homogenized under sterile conditions in the tissue homogenization buffer (THB) maintaining 1:10 weight to volume ratio. The THB consists of 20 mM Tris-HCL pH 7.4, 250 mM sucrose, 1 mM ethylenediaminetetraacetic acid, 1 mM egtazic acid and 10 \u0026micro;g/mL of Complete Proteinase Inhibitor Cocktail (cOmplete) (Roche Life Science, Indianapolis, IN). After preparation, the inoculum was immediately aliquoted, flash-frozen, and stored at -80\u0026ordm;C until use. NBH was prepared from the brains of healthy C57BL/6 mice following the same protocol. A single prepared batch of 22L inoculum and NBH was used for the entire study. For the inoculation, aliquots of the 22L inoculum or NBH were taken out from the cryostorage and thawed. Each animal received a single intraperitoneal injection containing 100 \u0026micro;L of either 22L inoculum or NBH. Remnants of the aliquots were never reused but neutralized with an excess of sodium hypochlorite and disposed.\u003c/p\u003e\u003cp\u003eFollowing the inoculation mice were kept in a pathogen-free Animal Biosafety Level 2 facility with 12/12-hour light/dark cycle and \u003cem\u003ead libitum\u003c/em\u003e food and water access. Their general health and well-being were assessed twice a week following established standards of good husbandry practice [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. From 10 wpi. onward, mice were evaluated weekly for the first signs of prion disease using a parallel bar crossing test, which was carried out by two independent examiners blinded to \u003cem\u003eAPOE\u003c/em\u003e genotype and inoculum type. This testing evaluates an animal\u0026rsquo;s competency to cross a series of parallel bars that are 3 mm in diameter and set 7 mm apart. An animal displaying difficulties in initiating and/or completing this task in a timely and coordinated manner for three weeks in a row is considered clinically symptomatic and the first week that the positive score is assigned is considered the onset of clinical disease. Severity of neurological symptoms were longitudinally characterized using the Total Scrapie Score (TSS), which is an equally weighted composite of the following scorable metrics: somnolence, hind limb weakness, kyphosis, walk, and body condition. These behavioral metrics are scored based on the following criteria: 0\u0026thinsp;=\u0026thinsp;normal, 1\u0026thinsp;=\u0026thinsp;subtle, 1.5\u0026thinsp;=\u0026thinsp;mild, 2\u0026thinsp;=\u0026thinsp;moderate, 2.5\u0026thinsp;=\u0026thinsp;advanced, and 3\u0026thinsp;=\u0026thinsp;severe [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e, \u003cspan citationid=\"CR104\" class=\"CitationRef\"\u003e104\u003c/span\u003e]. Their sum constitutes the TSS, which ranges from 0 in healthy animals to 15 points in terminally sick ones. TSS was assessed on a weekly basis starting from the 100th day post-inoculation (dpi) by two independent examiners who remained blinded to the animal \u003cem\u003eAPOE\u003c/em\u003e genotype.\u003c/p\u003e\n\u003ch3\u003eAnimal euthanasia and tissue harvesting\u003c/h3\u003e\n\u003cp\u003eAt the conclusion of the experiment animals were euthanized by a single intraperitoneal injection of Euthasol (500 \u0026micro;l /kg) (Virbac AH, Inc.; Westlake, TX). Once they showed absence of pain and corneal responses, they were transcardially perfused with heparinized, ice-cold 10 mM phosphate-buffered saline (PBS) pH 7.4. Their brains were extracted from the skulls and carefully stripped from the dura and vessels under the AmScope stereoscopic microscope (AmScope, Chino, CA). The olfactory bulbs, the brain stem, and the cerebellum were removed, and the corpus callosum was dissected to separate the hemispheres. The cortical mantle including the hippocampus was dissected out from the left hemisphere and either flash-frozen and stored at -80\u0026ordm;C or immediately used for RNA extraction. The total RNA was extracted using RNeasy Mini Kit (Qiagen Sciences Inc., Germantown, MD) following the manufacturer-provided protocol. The resulting extract was treated with 2 U of DNAse I per brain (Qiagen Sciences Inc.), flash frozen and stored at -80\u0026ordm;C for transcriptomic analysis. The right brain hemisphere was cut in the frontal plane at ~\u0026thinsp;1 mm anterior to the bregma. The rostral part was immersion-fixed in 2% phosphate-buffered formalin and embedded in paraffin. The caudal part was immersion fixed in 2% paraformaldehyde in 0.1 M phosphate buffer (PB), pH 7.4 at 4\u0026ordm;C for a week and then dehydrated in a solution of 2% dimethyl sulfoxide and 20% glycerol in 0.1 M PB, pH 7.4 at 4\u0026deg;C until sectioning.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eWestern immunoblot analyses\u003c/h2\u003e\u003cp\u003eBrain homogenate samples were removed from cryostorage, thawed, weighted, and homogenized in the THB maintaining 1:10 tissue weight to the THB volume ratio. A three-step homogenization protocol was followed where the tissue was first manually fragmented by grinding with a pestle, then triturated by repeated passing through a 28-gauge needle and finally sonicated. The remaining cellular fragments were cleared by centrifugation at 10,000 x g and 4\u0026ordm;C for 3 min. The protein concentration in the resulting supernatant was measured by bicinchoninic acid (BCA) method using Pierce\u0026trade; Micro BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer\u0026rsquo;s protocol. Samples containing 5 \u0026micro;g of the total protein were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions using 10% gels. Resolved protein was transferred onto nitrocellulose membranes, which were blocked overnight in 5% non-fat milk at 4\u0026ordm;C and then incubated with primary and then horse radish peroxidase-conjugated secondary antibodies listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The membranes were treated with SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher Scientific) and apposed to HyBlot CL\u0026reg; autoradiography films (Thomas Scientific, LLC, Swedesboro, NJ), which then were developed. For immunoblotting of the apoE protein the Western blot protocol was modified by increasing the amount of the total protein in electrophoresed samples to 20 \u0026micro;g and using 5% soy milk for the overnight block. To confirm equal protein load, the nitrocellulose membranes were stripped with Restore\u0026trade; Western Blot Stripping Buffer (Thermo Fisher Scientific) and immunoblotted against β-actin.\u003c/p\u003e\u003cp\u003eAutoradiography films were digitized at the resolution of 600 dots per inch and saved in TIFF format. Protein band optical densities (OD) were quantified using NIH ImageJ v2.1.0/1.53c (Bethesda, MD) following our previously established protocols [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e, \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]. For PrP protein analysis, OD of its three bands was totaled.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003ePrP detection\u003c/h3\u003e\n\u003cp\u003eAliquots of brain homogenate containing 10 \u0026micro;g of total protein were diluted with 10 mM PBS to the final protein concentration of 1 \u0026micro;g/\u0026micro;L and treated with Proteinase K (PK) (Roche Life Science) at 37\u0026ordm;C for 45 min. maintaining 10:1 protein to enzyme weight ratio. PK activity was quenched by adding 4 \u0026micro;L of 100 mM phenylmethylsulfonyl fluoride (PMSF) per sample and placing the samples in ice bath for 5 min. Samples were centrifuged at 20,000 x g and 4\u0026ordm;C for 45 min. Resulting pellets were resuspended in 20 \u0026micro;L of 10 mM PBS and 20 \u0026micro;l of sample buffer containing β-mercaptoethanol, boiled, and resolved on 12.5% SDS-PAGE. Following Western blot transfer, the PrP protein was immunodetected and densitometrically quantified as described above.\u003c/p\u003e\u003cp\u003eTo detect the presence of PrP\u003csup\u003eSc\u003c/sup\u003e in the LRS we homogenized spleen tissue, which was first cut up into small pieces using a thin surgical blade and then thoroughly sonicated in Dulbecco\u0026rsquo;s phosphate buffered saline (DPBS) without Ca\u003csup\u003e2+\u003c/sup\u003e and Mg\u003csup\u003e2+\u003c/sup\u003e and supplemented with 10 \u0026micro;g/mL cOmplete. Remnants of unhomogenized tissue were cleared by centrifugation at 10,000 x g and 4\u0026ordm;C for 3 min. and the protein concentration in the resulting supernatant was measured by the BCA method. Samples containing 500 \u0026micro;g of total protein were diluted with DPBS to obtain the final volume of 100 \u0026micro;L, mixed with equal volume of 4% Sarkosyl in DPBS, and incubated at 37\u0026ordm;C for 10 min. with constant agitation in a ThermoMixer\u0026reg; C (Eppendorf North America, Enfield, CT). Then, Benzon nuclease and MgCl\u003csub\u003e2\u003c/sub\u003e were added to the final concentrations of 50 U/mL and 1 mmol/L, respectively, and the samples were incubated again at 37\u0026ordm;C for 30 min. To enhance sensitivity of PrP\u003csup\u003eSc\u003c/sup\u003e detection, the total protein in the sample was precipitated with sodium phosphotungustic acid (NaPTA) [\u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e, \u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e94\u003c/span\u003e]. A 4% stock solution of NaPTA was prepared in 170 mmol/L MgCl\u003csub\u003e2\u003c/sub\u003e and added to achieve the final NaPTA concentration of 0.3% in the sample. Samples were incubated at 37\u0026ordm;C for 30 min. in a ThermoMixer\u0026reg; C and then centrifuged at 15,800 x g and 4\u0026ordm;C for 30 min. Resulting pellets were resuspended in 50 \u0026micro;L of 0.1% Sarkosyl in DPBS and sonicated for 30 sec. [\u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e, \u003cspan citationid=\"CR120\" class=\"CitationRef\"\u003e120\u003c/span\u003e]. Ten \u0026micro;L of sarkosyl solubilized pellet was mixed with 38 \u0026micro;L of PBS and digested by adding 2 \u0026micro;L of 1 \u0026micro;g/\u0026micro;L PK solution at 37\u0026ordm;C for 45 min. PK activity was quenched by adding 6 \u0026micro;L of 100 mM PMSF per sample and placing the samples in ice bath for 5 min. PK-digested samples were centrifugated at 20,000 x g and 4\u0026ordm;C for 45 min. Resulting supernatant was discarded while the pellets were resuspended in 20 \u0026micro;L of 10 mM PBS and 20 \u0026micro;L of sample buffer containing β-mercaptoethanol, boiled, and resolved on 12.5% SDS-PAGE. Following Western blot transfer, the PrP protein was immunodetected and densitometrically quantified as described above.\u003c/p\u003e\n\u003ch3\u003ePrP detergent solubility assay\u003c/h3\u003e\n\u003cp\u003eFifty microliters of brain homogenate were mixed with 50 \u0026micro;L THB containing 1% Triton X-100 and 1% sodium deoxycholate and incubated on ice for 60 min. The samples were sonicated for 30 sec., incubated at 37\u0026ordm;C for 60 min., and centrifuged at 10,000 x g at 4\u0026ordm;C for 3 min. Protein concentration in the supernatant was assayed using the BCA method. Aliquots containing 100 \u0026micro;g of protein were diluted with 10 mM PBS to achieve 1\u0026micro;g/\u0026micro;L protein concentration and subjected to ultracentrifugation at 150,000 x g and 4\u0026ordm;C for 60 min. using the TLA120.2 fixed-angle rotor in Optima TL ultracentrifuge (Beckman Coulter, Indianapolis, IN). Ultracentrifugated supernatant containing detergent soluble PrP fraction was transferred into new tubes, while the pellets containing detergent insoluble PrP fraction were solubilized by sonication in 100 \u0026micro;L of THB containing 0.5% Triton X-100 and 0.5% sodium deoxycholate. Ten microliters of the supernatant or 10 \u0026micro;L of the solubilized pellet were mixed with an equal volume of sample buffer containing β-mercaptoethanol, boiled, and resolved on 12.5% SDS-PAGE. Following Western blot transfer, the PrP protein was immunodetected and densitometrically quantified as described above.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eCharacterization of PrP oligomers\u003c/h2\u003e\u003cp\u003eBrain homogenate samples containing 600 \u0026micro;g of total protein were diluted with 10 mM PBS to the final volume of 200 \u0026micro;L, mixed with 20 \u0026micro;L of 10% Sarkosyl and incubated on ice for 30 min. Then they were loaded on the top of the sucrose density gradient, which was formed in polyallomer centrifuge tubes by carefully layering 300 \u0026micro;L of 60%, 50%, 40%, 30%, 20% and 10% sucrose solution prepared in deionized water. Velocity sedimentation was performed using TLS-55 swinging-bucket rotor in an Optima TL ultracentrifuge (Beckman Coulter, Indianapolis, IN) at 200,000 x g and 4\u0026ordm;C for 90 min. Fourteen fractions (145 \u0026micro;L each) were collected from the top to the bottom of each ultracentrifugated sample. Twenty microliters from each fraction were mixed with an equal volume of sample buffer containing β-mercaptoethanol, boiled, and resolved on 12.5% SDS-PAGE. Following Western blot transfer, the PrP protein was immunodetected and densitometrically quantified as described above. OD of the PrP signal in each fraction was converted to percentage value using the sum of OD values in all 14 fractions as denominator. Bovine serum albumin (molecular weight 68 kDa), alcohol dehydrogenase (150 kDa) and apoferritin (443 kDa) were used as molecular weight markers. They were subjected to the same velocity sedimentation, SDS-PAGE, and Western blot protocols as PrP oligomers and detected with InstantBlue Coomassie Protein Stain (ThermoFisher Scientific).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eImmunoprecipitation and characterization of PrP/apoE complexes\u003c/h2\u003e\u003cp\u003eM-280 Sheep anti-mouse IgG magnetic Dyanabeads\u0026trade; (Thermo Fisher Scientific) were coated with anti-human apoE monoclonal antibody (mAb) HJ15.3 [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR103\" class=\"CitationRef\"\u003e103\u003c/span\u003e]. For each immunoprecipitated brain homogenate sample a 50 \u0026micro;L of manufacturer provided bead solution was mixed with 15 \u0026micro;g of the antibody and incubated in room temperature for 3 hrs. HJ15.3 coated beads were added to samples of brain homogenate containing 400 \u0026micro;g of total protein in 400 \u0026micro;L volume and incubated overnight at 4\u0026ordm;C with constant mixing on a Roto-Bot programmable rotator (Benchmark Scientific, Sayreville, NJ). On the following day, the beads were magnetically separated, washed with 10 mM PBS pH 7.4, and incubated in a solution containing 0.05 M Tris-HCL pH 8.0, 0.15 M NaCl and 2% Sarkosyl for 30 min. in room temperature with constant mixing to remove nonspecifically bound brain proteins. This step was followed by additional 30-min. and 5-min. incubations in 0.05 M Tris-HCl solution pH 8.0 containing 0.5 M NaCl and 1% Sarkosyl in room temperature, with constant mixing. Finally, the beads were magnetically separated and resuspended in 20 \u0026micro;L of 10 mM PBS and 20 \u0026micro;L of sample buffer containing β-mercaptoethanol, boiled, and resolved on 12.5% SDS-PAGE. Following Western blot transfer, the PrP protein was immunodetected as described above. To confirm the presence of the apoE protein in immunoprecipitated complexes, the nitrocellulose membranes were stripped with Restore\u0026trade; Western Blot Stripping Buffer (Thermo Fisher Scientific) and immunoblotted with anti-human ApoE goat polyclonal antibody (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eHistology, immunochemistry, and quantitative neuropathology\u003c/h2\u003e\u003cp\u003eParaffin blocks containing the rostral portion of the right hemisphere were cut into 5-\u0026micro;m-thick coronal sections, which were then stained with hematoxylin-eosin. The load of spongiform lesions in the M1 primary motor cortex was quantified at three approximated bregma levels (+\u0026thinsp;1.0 mm, +\u0026thinsp;1.2 mm, and +\u0026thinsp;1.4 mm) following our previously published protocols [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]]. The caudal portion of the right hemisphere was cut serially using a freezing microtome (Leica Microsystems, Weltzer, Germany) into 40-\u0026micro;m-thick coronal sections, which were alternately collected into 10 series and stored in a cryoprotectant solution consisting of 30% ethylene glycol and 30% sucrose in 0.1M PB, pH 7.4. Randomly selected series of sections were immunostained against the following antigens [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] cluster of differentiation (CD) 230 (a.k.a. prion protein [PrP]), [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] ionized calcium adaptor protein 1 (IBA1), [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] cluster of differentiation (CD) 68, [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] glial fibrillary acidic protein (GFAP), and [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] complement component 3 (C3) in combination with GFAP. An antigen retrieval protocol was used for all immunostainings and involved incubating the sections in 10 mM sodium citrate pH 6.0 with 0.05% Tween 20 at 85\u0026ordm;C for 15 min. For anti-CD230 immunostaining, sections were additionally incubated in 98% formic acid at room temperature for 10 min. to disrupt β-sheet-pleated secondary structure of the PrP\u003csup\u003eSc\u003c/sup\u003e conformer. Non-specific staining was reduced using a blocking mixture which contained 10% normal goat serum, 1% bovine serum albumin and 0.3% Triton X-100 in 10 mM PBS pH 7.4 in room temperature for two hours. For mouse-derived primary antibodies, the mouse-on-mouse blocking reagent (Vector Laboratories; Burlingame, CA) was added to the blocking mixture at the amount of 1.5 \u0026micro;L per 1mL. The list of primary antibodies and fluorochrome-conjugated secondary antibodies, along with their working dilutions is provided in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Double anti-GFAP/anti-C3 immunostaining was performed using a mixture of primary antibodies to respective antigens, followed by a mixture of fluorochrome-conjugated secondary antibodies. All immunostainings were carried out on free floating sections. Sections were washed thrice with excess 10 mM PBS pH 7.4 and 0.1% Triton X-100 between each step of the protocol. Immunostained sections were carried onto glass histological slides, briefly air-dried, and coverslipped using Depex mounting medium (Thermo Fisher Scientific, Waltham, MA). They were digitized and subjected to quantitative analysis following our published protocols [\u003cspan additionalcitationids=\"CR76\" citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. Quantitative metrics included [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] integrated density (ID) of anti-CD230 (PrP) immunostaining, the load of [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] IBA1\u003csup\u003e+\u003c/sup\u003e and [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] CD68\u003csup\u003e+\u003c/sup\u003e microglia, [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] the load of GFAP\u003csup\u003e+\u003c/sup\u003e astrocytes, and [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] ratio of C3\u003csup\u003e+\u003c/sup\u003e to GFAP\u003csup\u003e+\u003c/sup\u003e immunostaining in astrocytes. All quantitative analyses were performed in the S1 primary somatosensory cortex at three approximated bregma levels (0.0 mm, -0.4 mm, and \u0026minus;\u0026thinsp;0.8 mm).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eNanoStringTM nCounter\u0026reg; analysis of glial transcript\u003c/h2\u003e\u003cp\u003eAliquots of previously isolated total RNA were removed from \u0026minus;\u0026thinsp;80\u0026ordm;C cryostorage and assayed for purity and integrity using a 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA). Only samples with the RNA Integrity Number\u0026thinsp;\u0026ge;\u0026thinsp;7 were used for gene expression analysis. RNA concentration in the samples was determined by NanoDrop\u0026trade; 2000 spectrophotometer (Thermo Fisher Scientific). The nCounter Mouse Glial Profiling Panel (NanoString Technologies, Inc., Seattle, WA) was used to assess the expression of 770 glia specific genes in samples containing 100 ng of total RNA. This analysis was carried out by the Genome Technology Center at NYU Grossman School of Medicine using nCounter MAX Analysis System. Gene expression data were analyzed using nSolver Analysis Software v4.0 (NanoString Technologies Inc.) and included only genes consistently producing a read of \u0026ge;\u0026thinsp;25 counts per brain. Raw counts were normalized using 13 internal reference genes as described before [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. Gene expression heatmaps were created using the nSolver Analysis Software v4.0, which also was used for cluster analysis of individual animals. In addition, we computed a fold change for each analyzed gene in 22L-infected animals relative to their \u003cem\u003eAPOE\u003c/em\u003e-matched NBH inoculated controls.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eReverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) analysis\u003c/h2\u003e\u003cp\u003eTwo micrograms of total RNA per brain were reverse transcribed into cDNA using an iScript\u0026trade; Advanced cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA). Sequences of primers used to determine the expression of target and housekeeping genes are listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Their amplification efficiency was vetted and optimized to remain within the 90% to 110% range. The qPCR was performed using SsoAdvanced Universal SYBR Green Supermix on the CFX96 Real-Time System (Bio-Rad Laboratories). Differences in gene expression were analyzed using ΔΔCt method [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eDisease latency time was analyzed using Kaplan-Meier estimator and the differences across \u003cem\u003eAPOE\u003c/em\u003e genotypes were compared using Log-Rank test. Differences in the total scrapie score and its components were tracked longitudinally and analyzed by repeated measures analysis of variance (ANOVA). Data distribution of individual, quantitative metrics was vetted using Kolmogorov-Smirnov and Shapiro-Wilk tests to assess conformity with the normal distribution pattern. Differences across multiple data sets were first analyzed with one-way ANOVA, which was followed by Holm-Sidak\u0026rsquo;s post hoc test, comparing pairs of individual experimental groups. Sex differences within individual experimental groups were tested with the help of unpaired t-test with Welch\u0026rsquo;s correction. Differences in the PrP signal distribution across 14 fractions resulting from sucrose density gradient centrifugation of brain homogenate were determined using the Kolmogorov-Smirnov test between each pair of experimental groups. GraphPad Prism (v10.4.1 for Windows, GraphPad Software, Boston, MA) was used for all statistical analyses and graph making.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eAPOE\u003c/b\u003e \u003cb\u003egenotype modulates latency, symptom progression, and pathology burden in a mouse model of prion disease\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe latency period of prion disease was determined through serial locomotor testing, and the differences across animals of different \u003cem\u003eAPOE\u003c/em\u003e genotypes were compared using the Kaplan-Meier estimator. The \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice were the first to show neurological signs of the prion disease with a median latency of 115.0 days in females and 113.5 days in males. The \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice were second to be affected with a median latency of 135.0 days in females and 131.5 days in males, followed by \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice, where the median latency was 136.0 days for both sexes. Differences across \u003cem\u003eAPOE\u003c/em\u003e genotypes both for female and male animals were statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea), while female and male mice of the same \u003cem\u003eAPOE\u003c/em\u003e genotype showed no significant differences (Supplementary File 1; Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). To quantify progression and severity of neurological symptoms we conducted serial assessments using the Total Scrapie Score (TSS) in a subset of 22L-infected mice. The TSS is a 15-point cumulative scale, accounting for five scorable behavioral metrics: animal alertness (somnolence), hind limb weakness, posture (kyphosis), walking competency, and body condition. Both \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e females and males showed the most aggressive tempo of disease progression compared to mice of other \u003cem\u003eAPOE\u003c/em\u003e genotypes. At 23 weeks post inoculation (wpi.), which was the final time point of the experiment, \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e females scored on average 13.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 pts. on the TSS scale (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 vs. \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e), while \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e males scored 13.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 pts. (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 vs. \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice scored worse than \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice, with females and males scoring an average of 9.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 pts. (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 vs. \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e) and 9.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 pts. (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e), respectively. At 23 wpi. TSS scores in \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e females and males were 7.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 pts. and 8.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1 pts., respectively. The \u003cem\u003eε4\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u0026gt;\u0026thinsp;\u003cem\u003eε2\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cem\u003eε3 APOE\u003c/em\u003e allele gradient effect was consistent across all five individual components of the TSS, with the most prominent differences in respect to alertness, walk, and body condition (Supplementary File 1: Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e a, b). Differences in the TSS and its individual components between \u003cem\u003eAPOE\u003c/em\u003e genotype matched female and male mice were not statistically significant.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo ensure that differences in disease latency and the tempo of symptoms progression across mice of different \u003cem\u003eAPOE\u003c/em\u003e genotypes are not caused by variable accumulation of PrP\u003csup\u003eSc\u003c/sup\u003e in the LRS, we assayed the level of PK-resistant PrP\u003csup\u003eSc\u003c/sup\u003e in the spleen homogenate. In presymptomatic 22L-infected mice, which were killed at 15 wpi., PrP\u003csup\u003eSc\u003c/sup\u003e was readily detectable in the spleen, but its level did not significantly differ across \u003cem\u003eAPOE\u003c/em\u003e genotypes (Supplementary File 1: Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e a, b). In NBH-inoculated control animals no PK-resistant PrP\u003csup\u003eSc\u003c/sup\u003e signal was detectable.\u003c/p\u003e\u003cp\u003eTo determine the effect of the \u003cem\u003eAPOE\u003c/em\u003e genotype on the burden of prion pathology in the brain we quantified the load of spongiform lesions in the M1 motor cortex. Presymptomatic 22L-infected mice showed only a limited number of spongiform lesions. In contrast, symptomatic mice, euthanized at 23 wpi. featured numerous spongiform lesions, which load was significantly affected by the \u003cem\u003eAPOE\u003c/em\u003e genotype. In \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice the spongiform lesion load was 1.24- and 1.44-fold higher than that in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), respectively; with the difference between the two latter groups being significant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, d). We also analyzed, the integrated density (ID) of anti-PrP immunostaining in the S1 somatosensory cortex. Not presymptomatic, but symptomatic 22L-infected mice showed a significant increase in the anti-PrP ID values relative to NBH controls, and this effect was \u003cem\u003eAPOE\u003c/em\u003e genotype dependent (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee, f). \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice had 2.0 and 2.6- fold higher values of anti-PrP ID compared to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), respectively; with the difference between the latter two groups not reaching statistical significance. Differences in the spongiform lesion load and the anti-PrP ID values between female and male animals for matching \u003cem\u003eAPOE\u003c/em\u003e genotypes, inoculum type, and the survival time were not statistically significant (Supplementary File 1: Fig. S4 a, b).\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe\u003c/b\u003e \u003cb\u003eAPOE ε4\u003c/b\u003e \u003cb\u003eallele is associated with greater PrP accumulation, PrP\u003c/b\u003e\u003csup\u003e\u003cb\u003eSc\u003c/b\u003e\u003c/sup\u003e \u003cb\u003econversion, and aggregation\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePrion pathology is invariably associated with an increase in the brain total PrP protein level and the appearance of its PK-resistant conformer PrP\u003csup\u003eSc\u003c/sup\u003e. The total PrP level showed no differences across NBH-inoculated control mice of various \u003cem\u003eAPOE\u003c/em\u003e genotypes and no significant increase in presymptomatic 22L-infected mice, at 15 wpi. In contrast, symptomatic 22L-infected mice, euthanized at 23 wpi., featured a marked increase in the total brain PrP level by ~\u0026thinsp;4- to ~\u0026thinsp;5- folds compared to \u003cem\u003eAPOE\u003c/em\u003e matched NBH controls (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, b). The highest total PrP level was found in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice, and it was 1.2- and 1.3-fold higher than those in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) animals, respectively; with the difference between the two latter groups not reaching statistical significance. The PrP\u003csup\u003eSc\u003c/sup\u003e conformer was undetectable by the PK-digestion assay in the brains of NBH-controls and presymptomatic 22L-infected mice. In contrast, in symptomatic 22L-infected mice PrP\u003csup\u003eSc\u003c/sup\u003e was abundantly detected, and its level was significantly potentiated by the presence of the \u003cem\u003eε4\u003c/em\u003e allele (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, d). \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice featured 1.24- and 1.37-fold higher PrP\u003csup\u003eSc\u003c/sup\u003e level compared to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), respectively; with the difference between the two latter groups not reaching statistical significance.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eUsing the detergent solubility assay, we characterized solubility changes the PrP protein undergoes during the PrP\u003csup\u003eC\u003c/sup\u003e to PrP\u003csup\u003eSc\u003c/sup\u003e transformation. Brains from NBH and presymptomatic 22L-infected mice showed no evidence of detergent insoluble PrP protein. In symptomatic, 22L-infected mice detergent insoluble PrP, was not only abundantly present, but its amount well exceeded that detected in the detergent soluble fraction. The highest ratio of detergent insoluble to detergent soluble PrP was in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (9.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.8) and it was significantly higher than those in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (6.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4) (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and in \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (5.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7) (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee, f). The difference between \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice was not statistically significant. Differences in the total PrP level, PrP\u003csup\u003eSc\u003c/sup\u003e level, and the insoluble to soluble PrP ratio between female and male mice for matching \u003cem\u003eAPOE\u003c/em\u003e genotype, inoculum, and survival time were not statistically significant (Supplementary File 1: Fig. S5 a-c).\u003c/p\u003e\u003cp\u003eWe also investigated the effect of \u003cem\u003eAPOE\u003c/em\u003e genotype on PrP oligomerization by subjecting brain cortex homogenate to sucrose gradient centrifugation. The resulting 14 fractions were individually collected and resolved using SDS-PAGE under reducing conditions and immunoblotted for PrP (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b). Brains from NBH-inoculated and symptomatic, 22L-infected \u003cem\u003eε2/ε2\u003c/em\u003e, \u003cem\u003eε3/ε3\u003c/em\u003e, and \u003cem\u003eε4/ε4\u003c/em\u003e mice were examined along with those from \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice. In NBH controls, the PrP signal was detectable only in fractions 1\u0026ndash;4 and its distribution showed no statistically significant differences across \u003cem\u003eAPOE\u003c/em\u003e genotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec; Supplementary File 2: Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). In contrast, in 22L-infected mice, the PrP signal was detected across all 14 fractions, and its distribution bore a significant \u003cem\u003eε4\u003c/em\u003e effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed). The \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice featured the most pronounced, right-sided shift in the PrP signal distribution across the 14 fractions compared to any other 22L-infected \u003cem\u003eAPOE\u003c/em\u003e genotype or \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e animals (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Differences in the PrP signal distribution pattern between \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e or \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice were insignificant. A statistically significant difference was noted only between \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) owing to the most left-sided shift in the signal distribution in the latter group. To better visualize the \u003cem\u003eε4\u003c/em\u003e effect in 22L-infected mice we grouped the fractions into four clusters 1\u0026ndash;4, 5\u0026ndash;7, 8\u0026ndash;10, and 11\u0026ndash;14, and showed the proportional contribution of each cluster to the total PrP signal in all 14 fractions using pie charts (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee). In \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice, the cluster 11\u0026ndash;14 contributed 25.7% of the total PrP signal, while for comparison in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, and \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003csub\u003e22L\u003c/sub\u003e groups its contribution ranged from 12.4% to 13.8%. Conversely, the cluster 1\u0026ndash;4 in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice constituted 32.3% of the total PrP signal, while in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, and \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003csub\u003e22L\u003c/sub\u003e groups its contribution ranged from 41.7% to 49.8%. This experiment demonstrates that while PrP oligomerization is an inherent feature of the prion proteinopathy, it is promoted only in the presence of the \u003cem\u003eε4\u003c/em\u003e allele, as there are no significant differences between \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e or \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eIncrease in the apoE protein level and formation of the PrP/apoE complexes during prion infection is\u003c/b\u003e \u003cb\u003eAPOE\u003c/b\u003e \u003cb\u003egenotype dependent\u003c/b\u003e\u003c/p\u003e\u003cp\u003eConsistently with previously published data, we found a significant effect of the \u003cem\u003eAPOE\u003c/em\u003e genotype on the brain apoE protein level in NBH control mice. \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003eNBH\u003c/sub\u003e animals featured 1.2- and 1.5- fold higher apoE level compared to \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003eNBH\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003eNBH\u003c/sub\u003e mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea; Supplementary File 1: Fig. S6), respectively; with the difference between \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003eNBH\u003c/sub\u003e and \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003eNBH\u003c/sub\u003e mice being statistically significant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Prion infection gave rise to a significant increase in the brain apoE level in symptomatic (23 wpi.) but not in presymptomatic (15 wpi.) animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, b). The magnitude of this increase varied across \u003cem\u003eAPOE\u003c/em\u003e genotypes, and it was the highest in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice, where the level of apoE protein rose 1.6-fold relative to \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003eNBH\u003c/sub\u003e controls (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Both in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice the increase in apoE level was 1.3-fold relative to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003eNBH\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003eNBH\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) controls, respectively. Animal sex had no significant effect on the brain apoE level, neither in NBH-controls nor in 22L-infected mice (Supplementary File 1: Fig. S7).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo determine whether apoE directly interacts with PrP, we immunoprecipitated the apoE/PrP complexes from the brain cortex homogenate using magnetic beads coated with HJ15.3 mAb, which reacts with the human apoE sequence. Captured complexes were resolved on SDS-PAGE under reducing conditions and the resulting monomeric PrP was detected using anti-CD230 clone 6D11 mAb (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). The PrP signal was detected in symptomatic \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, and \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice, but not in NBH-inoculated controls. Optical density (OD) of the PrP protein band released from the complexes in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice was ~\u0026thinsp;1.6-fold higher compared to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e or \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed), while the difference between the latter two groups was not statistically significant. We also quantified the PrP/apoE OD ratio by dividing the PrP protein band OD by that of apoE, which was detected on the same membrane as PrP, following membrane stripping and re-probing with goat polyclonal anti-human apoE antibody. The PrP/apoE OD ratio in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice was 2.8- and 1.7- fold higher than those in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee), respectively, while the difference between the latter two groups was not statistically significant. As additional negative experimental controls, we used brain cortex homogenate from \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003csub\u003eNBH\u003c/sub\u003e and \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003csub\u003e22L\u003c/sub\u003e animals, in which no apoE/PrP complexes were detected. Our findings indicate that the apoE protein directly interacts with PrP but only in prion disease and not under physiological conditions.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMicroglia activation is differentially regulated by the\u003c/b\u003e \u003cb\u003eAPOE\u003c/b\u003e \u003cb\u003egenotype\u003c/b\u003e\u003c/p\u003e\u003cp\u003eMicroglia activation was characterized by unbiased quantification of IBA1- and CD68-positive microglia load in the S1 somatosensory cortex alongside transcriptomic analysis of microglia specific genes. Presymptomatic, 22L-infected mice (15 wpi.) already showed a modest, but statistically insignificant increase in the IBA1 and CD68 load relative to NBH-inoculated controls. A robust and significant increase in the IBA1 and CD68 load was observed in symptomatic 22L-infected mice (23 wpi.), and this effect was \u003cem\u003eAPOE\u003c/em\u003e genotype dependent (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea-d). The strongest activation of microglia was noted in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice, which had a 1.32- and 1.64-fold greater IBA1 load relative to the \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) mice, respectively. Likewise, \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice showed 1.04-fold and 1.17-fold greater CD68 load relative to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (non-significant) and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) mice, respectively. The value of IBA1 load in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice was significantly higher than that in \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), while the difference in the CD68 load insignificantly favored \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals. It is noteworthy that the increase in the IBA1 load in symptomatic 22L-infected mice relative to their \u003cem\u003eAPOE\u003c/em\u003e-matched NBH controls ranged between 1.7-fold and 2.8-fold, while the increase in the CD68 load ranged between 16.4-fold and 22.7-fold. Differences in the IBA1 and CD68 load values between female and male animals for matching \u003cem\u003eAPOE\u003c/em\u003e genotypes, inoculum type, and the survival time were not statistically significant (Supplementary File 1: Fig. S8 a, b).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTranscriptomic analysis included microglial genes, which were significantly upregulated in at least one \u003cem\u003eAPOE\u003c/em\u003e genotype within the symptomatic 22L-infected group compared to \u003cem\u003eAPOE\u003c/em\u003e-matched NBH controls (Supplementary File 2: Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Significantly upregulated genes were grouped into three functional categories 1) activated microglia markers (\u003cem\u003eAif1, Csf1r, Cst7, P2ry12, Siglech\u003c/em\u003e, and \u003cem\u003eTmem119\u003c/em\u003e), 2) genes involved in immune response (\u003cem\u003eC1qa, C1qb, C1qc, C4a/b, C3ar1, Csf3r, Csf1\u003c/em\u003e, and \u003cem\u003eCcl3\u003c/em\u003e), 3) and those encoding various microglia recognition receptors (\u003cem\u003eAxl, Cx3cr1, Fcrls, Clec7a, Mertk, P2ry6, Stab1\u003c/em\u003e, \u003cem\u003eTrem2\u003c/em\u003e, and \u003cem\u003eTyrobp\u003c/em\u003e). Hierarchical cluster analysis of all genes showed no systematic clustering across individual NBH animals. In contrast, 22L-infected animals featured a strong hierarchical signal (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). First, the animals clustered within their \u003cem\u003eAPOE\u003c/em\u003e genotypes, and then \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals clustered together separate from \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals. We also compared differences in the fold increase of individual gene expression across \u003cem\u003eAPOE\u003c/em\u003e genotypes. \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice showed significantly higher upregulations of all genes compared to \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice and \u003cem\u003eAif1, C1qa, C1qb, C1qc, C4a/b, C3ar1, Csf1, Fcrls, Mertk, P2ry6, Stab1\u003c/em\u003e genes compared to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb-d). \u003cem\u003eAif1, Cst7, P2ry12, Tmem119, C1qb, C1qc, Ccl3, Cx3cr1, Fcrls, Clec7a, Trem2\u003c/em\u003e, and \u003cem\u003eTyrobp\u003c/em\u003e genes were expressed at significantly higher level in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice compared to \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice. \u003cem\u003eCst7, C4a/b, Ccl3\u003c/em\u003e, and \u003cem\u003eClec7a\u003c/em\u003e were found to be upregulated at particularly high level (\u0026ge;\u0026thinsp;10-fold relative to NBH controls) in at least one of the \u003cem\u003eAPOE\u003c/em\u003e genotypes (Supplementary File 2: Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAPOE\u003c/b\u003e \u003cb\u003egenotype differentially modulates activation of astrocytes during prion infection\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAstrocytic activation was characterized by determining changes in the GFAP protein level by quantitative immunoblotting, unbiased quantification of GFAP and C3-positive astrocyte load in the S1 somatosensory cortex and transcriptomic analysis of astrocyte specific genes. GFAP protein level showed no differences across \u003cem\u003eAPOE\u003c/em\u003e genotypes in NBH-inoculated controls. In presymptomatic 22L-infected mice (15 wpi.), it was modestly, albeit insignificantly increased (1.1-1.2-fold), while in symptomatic 22L-infected mice (23 wpi.) its level ranged between 2.2-fold and 3.1-fold relative to \u003cem\u003eAPOE\u003c/em\u003e-matched NBH controls (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea, b). Differences across \u003cem\u003eAPOE\u003c/em\u003e genotypes in symptomatic 22L-infected mice were statistically significant with \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice featuring 1.3- and 1.4-fold higher GFAP protein level compared to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), respectively; while the difference between the latter two groups was not significant.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe load of GFAP positive astrocytes in the S1 somatosensory cortex was already significantly increased in presymptomatic 22L-infected mice (15 wpi.) (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ec, d), but without any significant \u003cem\u003eAPOE\u003c/em\u003e genotype effect. Symptomatic 22L-infected mice (23 wpi.) featured further increase in the GFAP load, which ranged between 20.1- and 32.1-fold relative to NBH controls (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice had a 1.3- and 1.4-fold higher GFAP load compared to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), respectively, and the difference between the latter two groups was statistically significant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). We also quantified the load of C3-positive astrocytes and analyzed it in relation to the GFAP load (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ee, f). In NBH-inoculated control mice, C3-positive astrocytes were absent. For the first time, expression of C3 in astrocytes was noted in presymptomatic 22L-infected mice, where the C3/GFAP ratio ranged between 0.08 and 0.11 across \u003cem\u003eAPOE\u003c/em\u003e genotypes (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 to \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 vs. NBH). In symptomatic 22L-infected mice, the C3 expression increased further with C3/GFAP ratio reaching values of 0.49 to 0.71 across \u003cem\u003eAPOE\u003c/em\u003e genotypes (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 vs. NBH or 22L at 15 wpi). Differences in the C3/GFAP ratio showed a significant \u003cem\u003eAPOE\u003c/em\u003e-genotype effect in symptomatic but not in presymptomatic animals. Symptomatic \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice featured 1.2- and 1.4-fold higher values of the C3/GFAP ratio compared to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), respectively; with the difference between the latter two groups also being statistically significant (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). There were no statistically significant differences in respect to the GFAP protein level, the GFAP-positive astrocyte load, and the C3/GFAP ratio between female and male animals for matching \u003cem\u003eAPOE\u003c/em\u003e genotype, inoculum type, and survival time (Supplementary File 1: Fig. S9 a-c).\u003c/p\u003e\u003cp\u003eTranscriptomic analysis included those astrocytic genes, which were significantly upregulated in at least one \u003cem\u003eAPOE\u003c/em\u003e genotype in symptomatic 22L-infected mice relative to their \u003cem\u003eAPOE\u003c/em\u003e-matched NBH controls (Supplementary File 2; Tab S3). Analyzed genes were grouped into four functional categories: 1) markers of reactive astrocytes (\u003cem\u003eAldh1l1, Aqp4, Gfap, Serpina3n, Slc1a3, Sox9, Vim\u003c/em\u003e), 2) genes involved in antigen presenting and processing (\u003cem\u003eH2-D1, H2-T23, Tap1\u003c/em\u003e), 3) genes involved in immune response (\u003cem\u003eCcl12, Cd14\u003c/em\u003e), and 4) those encoding astrocytic markers, whose expression is induced by interferons (\u003cem\u003eStat1, Stat2, Stat3, Gbp2, Psmb8\u003c/em\u003e). Hierarchical cluster analysis of all genes showed no systematic clustering across individual NBH-inoculated animals. \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice clustered separately from \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice, which clustered together. All NBH animals clustered separately from 22L-infected animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea). We also compared differences in the fold increase of individual genes across \u003cem\u003eAPOE\u003c/em\u003e genotypes. \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice showed significantly greater expression of all genes compared to \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice except for \u003cem\u003eTap1\u003c/em\u003e and \u003cem\u003eGbp2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb-e). \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice also showed significantly greater expression of \u003cem\u003eAldh1l1, Gfap, Serpina3n, Vim, H2-D1, H2-T23, Ccl12, Stat2\u003c/em\u003e, and \u003cem\u003eStat3\u003c/em\u003e compared to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e\u003cem\u003e22L\u003c/em\u003e\u003c/sub\u003e mice. \u003cem\u003eAldh1l1, Aqp4, Tap1, Ccl12, Cd14\u003c/em\u003e, and \u003cem\u003ePsmb8\u003c/em\u003e genes were upregulated at significantly higher level in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice compared to \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice. \u003cem\u003eGfap, Serpina3n, Vim\u003c/em\u003e, and \u003cem\u003eCcl12\u003c/em\u003e were upregulated at particularly high level (\u0026ge;\u0026thinsp;10-fold relative to NBH controls) in at least one of the \u003cem\u003eAPOE\u003c/em\u003e genotypes (Supplementary File 2: Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAPOE\u003c/b\u003e \u003cb\u003egenotype differentially regulates reciprocal proinflammatory crosstalk between microglia and astrocytes\u003c/b\u003e\u003c/p\u003e\u003cp\u003eChronically reactive microglia secrete a triad of cytokines IL1-α, TNFα, and C1QA, which stimulate reactive astrocytes. These in turn secrete C3, which reciprocally stimulates neurodegenerative microglia. We explored the effect of \u003cem\u003eAPOE\u003c/em\u003e genotype on this pathway in prion infected mice using qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ea-c). We compared the expression of \u003cem\u003eIl1α\u003c/em\u003e, \u003cem\u003eTnfα\u003c/em\u003e, \u003cem\u003eC1qa\u003c/em\u003e, and \u003cem\u003eC3\u003c/em\u003e genes alongside expression of genes which are considered transcriptomic markers of neurodegenerative microglia phenotype (\u003cem\u003eAif1\u003c/em\u003e, \u003cem\u003eC3ar1\u003c/em\u003e, and \u003cem\u003eCx3cr1\u003c/em\u003e) and those specifically associated with chronically reactive astrocytes (\u003cem\u003eGfap\u003c/em\u003e, \u003cem\u003eCcl12\u003c/em\u003e, and \u003cem\u003eCcl2\u003c/em\u003e). No changes in expression level of any of these genes were found in presymptomatic 22L-inoculated mice (15 wpi.) compared to NBH-inoculated controls for matching \u003cem\u003eAPOE\u003c/em\u003e genotypes. In contrast, symptomatic 22L-inoculated mice (23 wpi.) showed significant upregulation of all interrogated genes with significant differences across the \u003cem\u003eAPOE\u003c/em\u003e genotypes. The highest expression of all the genes was found in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice with differences between \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice and \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice being statistically significant for all genes (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 to \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) except for \u003cem\u003eCx3cr1\u003c/em\u003e (\u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e vs. \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e). Expression of \u003cem\u003eIl1α\u003c/em\u003e, \u003cem\u003eC1qa\u003c/em\u003e, \u003cem\u003eC3, Aif1\u003c/em\u003e, \u003cem\u003eCx3cr1 and Ccl12\u003c/em\u003e genes was significantly higher in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e\u003cem\u003e22L\u003c/em\u003e\u003c/sub\u003e mice compared to \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 to \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eBy infecting \u003cem\u003eAPOE\u003c/em\u003e-TR mice with 22L mouse adapted scrapie strain, we identified a differential effect of human \u003cem\u003eAPOE\u003c/em\u003e alleles on prion induced neurodegeneration. \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice featured the shortest disease latency, the fastest progression of neurological symptoms, the worst neurological score at the end of the study, and the highest load of spongiform lesions, PrP\u003csup\u003eSc\u003c/sup\u003e level, and neuroinflammatory response. In addition, we found that \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice performed worse in respect to behavioral, neuropathological, and neuroinflammatory metrics compared to \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals, which suggests the \u003cem\u003eε2\u003c/em\u003e allele might be a disadvantageous rather than protective determinant in prion pathology. Examination of spleens and brains of presymptomatic mice euthanized at 15 wpi., showed no evidence of differential effect of \u003cem\u003eAPOE\u003c/em\u003e alleles on PrP\u003csup\u003eSc\u003c/sup\u003e accumulation in the LRS or early brain pathology. This indicates prion neuroinvasion is independent of the \u003cem\u003eAPOE\u003c/em\u003e polymorphism and the variance we observed in disease outcomes results from differential effect of the \u003cem\u003eAPOE\u003c/em\u003e polymorphism on ensuing brain pathology. This is an important observation since apoE is expressed by the spleen’s dendritic cells [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]], which are known to replicate PrP\u003csup\u003eSc\u003c/sup\u003e and constitute its reservoirs outside the central nervous system [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eConformational transformation of PrP\u003csup\u003eC\u003c/sup\u003e into PrP\u003csup\u003eSc\u003c/sup\u003e is central to prion pathogenesis and involves several physicochemical changes within the PrP protein, which include reduced detergent solubility, oligomerization, acquisition of proteolytic resistance, and accumulation [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e, \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e, \u003cspan citationid=\"CR115\" class=\"CitationRef\"\u003e115\u003c/span\u003e]. \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice featured significantly higher level of the total brain PrP, confirmed both by quantitative immunohistochemistry and Western immunoblotting, PK-resistant PrP\u003csup\u003eSc\u003c/sup\u003e, and insoluble PrP fraction compared to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals, in which values of these metrics were similar. Characterization of PrP oligomeric assemblies performed using sucrose density gradient centrifugation of brain homogenate detected PrP signal only in fractions 1–4 in NBH inoculated controls while in 22L infected mice the PrP signal was predominantly present in fractions 8–14. \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e−/−\u003c/sup\u003e\u003csub\u003e22L\u003c/sub\u003e, \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice showed similar pattern of PrP signal distribution across all 14 fractions, what suggests apoE is not a prerequisite for PrP oligomer formation since these are detectable in \u003cem\u003eApoe\u003c/em\u003e\u003csup\u003e−/−\u003c/sup\u003e\u003csub\u003e22L\u003c/sub\u003e mice. However, \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals featured a distinctly different PrP distribution pattern characterized by significantly increased signal in fractions 11–14, which represent higher order oligomers (+ 10-mers). This finding indicates that apoE4 isoform effectively promotes PrP oligomerization.\u003c/p\u003e\u003cp\u003eConsistent with several published studies, we found the brain level of apoE protein is \u003cem\u003eAPOE\u003c/em\u003e genotype dependent, with \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003eNBH\u003c/sub\u003e and \u003cem\u003eε4/ε4\u003c/em\u003e \u003csub\u003eNBH\u003c/sub\u003e animals representing opposite ends of the spectrum [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR109\" class=\"CitationRef\"\u003e109\u003c/span\u003e, \u003cspan citationid=\"CR116\" class=\"CitationRef\"\u003e116\u003c/span\u003e]. The mechanism(s) underlying this phenomenon have not been fully elucidated, though differential receptor mediated clearance of various apoE isoforms has been postulated to play a central role. We previously showed that prion pathology is associated both with an increase in the brain apoE level and cell-type shift in apoE expression [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. While under physiological conditions the bulk of brain apoE is produced by resting or A0 astrocytes, their activation is associated with reduced apoE expression [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. Conversely, while resting (M0) microglia do not produce apoE, de-repression of apoE translation is an unique characteristic of their reactive states commonly referred to as disease-associated microglia (DAM) or microglia neurodegenerative phenotype (MGnD) [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. In all three \u003cem\u003eAPOE\u003c/em\u003e-TR lines, prion pathology was associated with increase in the total brain apoE level, but the magnitude of this effect was \u003cem\u003eAPOE\u003c/em\u003e-genotype dependent. While \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice featured a similar fold change relative to their \u003cem\u003eAPOE\u003c/em\u003e genotype matched NBH controls, the relative increase in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice was significantly higher. Notably \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals featured the highest degree of microglia and astrocyte activation compared to \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice, what reasonably can explain the highest relative increase in apoE level in this line.\u003c/p\u003e\u003cp\u003eUsing immunoprecipitation assay, we found apoE protein and disease-altered PrP form complexes, which become dissociated under reducing conditions. ApoE/PrP complexes were immunoprecipitated using HJ15.3 anti-apoE clone [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR103\" class=\"CitationRef\"\u003e103\u003c/span\u003e] and detected using 6D11 anti-PrP clone [\u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e, \u003cspan citationid=\"CR102\" class=\"CitationRef\"\u003e102\u003c/span\u003e]. Interestingly, the immunoprecipitation experiment did not work in reverse where 6D11 and HJ15.3 clones were used as the capture and the detection antibodies, respectively. This suggests, binding of apoE to PrP might hinder the 6D11 epitope comprised of residues 97–100 (QWNK) of murine PrP [\u003cspan citationid=\"CR102\" class=\"CitationRef\"\u003e102\u003c/span\u003e]. This epitope is known to be conserved between mouse and human sequences and corresponds to residues 98–101 of the latter [\u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e93\u003c/span\u003e], which implies similar interaction between apoE and PrP might take place in human prionoses. It is noteworthy that the 6D11 PrP epitope also was proposed to interact with Aβ oligomers, while its hindrance was shown to prevent binding of Aβ oligomers to excitatory synapses and reduce intraneuronal tau phosphorylation and aggregation [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR117\" class=\"CitationRef\"\u003e117\u003c/span\u003e]. The amount of PrP, which was released from immunoprecipitated complexes under reducing conditions was similar between \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice but significantly higher in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals. This increased ratio between apoE and PrP in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice suggests stronger interaction between PrP and apoE4 than between PrP and other apoE isoforms and might explain the propensity for increased formation of large order oligomers observed in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals. Since no apoE/PrP complexes were detected in NBH-inoculated control, it is likely that disease specific changes in the PrP protein conformation and/or changes in its physicochemical properties constitute prerequisites for the interaction with apoE. Taking it together, we found numerous aspects of PrP proteinopathy that were significantly enhanced in the presence of the \u003cem\u003eε4\u003c/em\u003e allele including elevated levels of the total PrP, PrP\u003csup\u003eSc\u003c/sup\u003e, detergent insoluble PrP, enhanced PrP oligomerization and evidence of increased complexing of pathologically altered PrP with apoE, which constitute one important mechanism, through which the \u003cem\u003eε4\u003c/em\u003e allele negatively affects the outcome of prion disease. The isoform-specific interaction between apoE and various disease-specific misfolded proteins is a recognized mechanism through which apoE propagates aggregation and deposition of these proteins. Besides a well-established effect of apoE directly interacting with Aβ and particularly apoE4 promoting Aβ oligomerization and fibrillization [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e, \u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e, \u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e96\u003c/span\u003e, \u003cspan citationid=\"CR106\" class=\"CitationRef\"\u003e106\u003c/span\u003e, \u003cspan citationid=\"CR108\" class=\"CitationRef\"\u003e108\u003c/span\u003e], there is evidence derived both from transgenic animal and \u003cem\u003ein vitro\u003c/em\u003e studies apoE4 may directly promote α-synuclein aggregation [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In contrast, \u003cem\u003ein vitro\u003c/em\u003e studies have identified that recombinant as well as lipidated, apoE2 and to a lesser extent apoE3, but not apoE4 form complexes with recombinant human tau [\u003cspan citationid=\"CR105\" class=\"CitationRef\"\u003e105\u003c/span\u003e, \u003cspan citationid=\"CR107\" class=\"CitationRef\"\u003e107\u003c/span\u003e, \u003cspan citationid=\"CR128\" class=\"CitationRef\"\u003e128\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePrion pathology is inherently associated with early and robust inflammatory activation of astrocytes and microglia [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. In fact, GFAP-reactive astrogliosis was the first neuropathological metric clearly showing a significant increase in presymptomatic \u003cem\u003eAPOE\u003c/em\u003e-TR mice at 15 wpi. We found a strong \u003cem\u003eAPOE\u003c/em\u003e genotype effect on the magnitude of microglia and astrocyte activation both reflected by differences in the load of activated microglia and astrocytes and differences in microglia and astrocyte specific transcript. Characterization of the transcript using a nanoStringTM nCounter® analysis showed significant upregulation in a number of microglia specific genes, canonically categorized as markers of microglia activation (\u003cem\u003eAif1, Csf1r, Cst7, and Siglech\u003c/em\u003e), genes involved in immune response (\u003cem\u003eC1qa, C1qb, C1qc, C4a/b, C3ar1, Csf3r, Csf1\u003c/em\u003e, and \u003cem\u003eCcl3\u003c/em\u003e), and those encoding various microglia recognition receptors (\u003cem\u003eAxl, Cx3cr1, Fcrls, Clec7a, Mertk, P2ry6, Stab1\u003c/em\u003e, \u003cem\u003eTrem2\u003c/em\u003e, and \u003cem\u003eTyrobp\u003c/em\u003e). Similarly, several categories of astrocyte specific genes were upregulated including reactive astrocyte markers (\u003cem\u003eAldh1l1, Aqp4, Gfap, Serpina3n, Slc1a3, Sox9, Vim\u003c/em\u003e), genes involved in antigen presenting and processing (\u003cem\u003eH2-D1, H2-T23, Tap1\u003c/em\u003e), genes involved in immune response (\u003cem\u003eCcl12, Cd14\u003c/em\u003e), and those encoding astrocytic markers, which expression is induced by interferons (\u003cem\u003eStat1, Stat2, Stat3, Gbp2, Psmb8\u003c/em\u003e). Nearly all these genes were expressed in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice at a significantly higher level than in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice, while majority of them also showed significantly higher expression in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice compared with \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals. This \u003cem\u003eε4 \u0026gt; ε2 \u0026gt; ε3\u003c/em\u003e allele gradient effect could be demonstrated both through cluster analysis of microglia and astrocyte specific gene sets and comparison of individual gene expression through one-way ANOVA. Among significantly upregulated microglia genes we found \u003cem\u003eP2ry12\u003c/em\u003e, and \u003cem\u003eTmem119\u003c/em\u003e, which together with \u003cem\u003eCx3cr1\u003c/em\u003e encoding fractalkine receptor are canonically categorized as microglia homeostatic (M0) genes. Their expression is controlled by TGFβ signaling [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]] and they become commonly downregulated in microglia adopting DAM or MGnD states [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e]. However, there also is prior evidence for modest increase in \u003cem\u003eP2ry12, Tmem119\u003c/em\u003e and \u003cem\u003eCx3cr1\u003c/em\u003e transcript in mouse prion models, especially in bulk RNA transcript analysis, what suggests a disease-specific effect on their expression [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSeveral genes were found to be expressed more than 10-folds higher in prion infected mice compared to NBH controls in at least one \u003cem\u003eAPOE\u003c/em\u003e genotype. This list both includes genes specific for microglia \u003cem\u003eCst7, C4a/b, Ccl3\u003c/em\u003e, and \u003cem\u003eClec7a\u003c/em\u003e and for astrocytes \u003cem\u003eGfap, Serpina3n, Vim\u003c/em\u003e, and \u003cem\u003eCcl12. Cst7\u003c/em\u003e encodes cystatin F, which is an endosomal cysteine protease inhibitor, and its upregulation has been confirmed across several prion and AD studies most likely as a function of ongoing lysosomal pathology [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. \u003cem\u003eC4a/b\u003c/em\u003e encodes isotypes of the complement component C4 and \u003cem\u003eCcl3\u003c/em\u003e encodes macrophage inflammatory protein 1α, which both are critically involved in mounting the inflammatory cascade initiated by MGnD [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]. Upregulation of \u003cem\u003eClec7a\u003c/em\u003e is a hallmark of adopting by microglia DAM or MGnD reactive state [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e] and the gene encodes Dectin-1 representing the C-type lectin receptor involved in the immune system's recognition and acting as the phagocytosis regulator. Its inhibition was found to attenuate neurodegeneration and excessive synapse elimination by MGnD in P301S tau mutant mice [\u003cspan citationid=\"CR123\" class=\"CitationRef\"\u003e123\u003c/span\u003e]. \u003cem\u003eGfap\u003c/em\u003e and \u003cem\u003eVim\u003c/em\u003e encode intermediate filament proteins of the astrocyte cytoskeleton, and their upregulation is recognized as universal marker of astrocytic activation [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. \u003cem\u003eSerpina3n\u003c/em\u003e encodes Serpin 3 protein (a.k.a. α1-antichymotrypsin), which functions as serine peptidase inhibitor during complement cascade activation, apoptosis and inflammation and its expression is particularly increased in response to IL-1, TNF, and IL-6. Upregulation of \u003cem\u003eSerpina3n\u003c/em\u003e has been documented both in transmissible prion mouse models and AD transgenic mice and it is closely linked to chronic inflammatory response featured by these models [\u003cspan citationid=\"CR125\" class=\"CitationRef\"\u003e125\u003c/span\u003e]. \u003cem\u003eCcl12\u003c/em\u003e encodes CC motif chemokine ligand 12, also known as monocyte chemotactic protein 5 (MCP-5), a small protein, which plays a role in recruiting peripheral immune cells to the site of damage and inflammation and its upregulation previously has been shown in prion disease [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eStimulation between chronically reactive microglia and astrocytes in neurodegeneration is bidirectional [\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e]. To ascertain the effect of \u003cem\u003eAPOE\u003c/em\u003e genotype on this process we used RT-qPCR to quantify expression of \u003cem\u003eIl1α\u003c/em\u003e, \u003cem\u003eTnfα\u003c/em\u003e, \u003cem\u003eC1qa\u003c/em\u003e encoding respective cytokines IL1α, TNFα and C1QA, which are secreted by MGnD microglia and stimulate acquisition of the chronic reactive state by astrocytes and the \u003cem\u003eC3\u003c/em\u003e gene encoding complement component 3 protein (C3), which is expressed by reactive astrocytes and reciprocally advances MGnD phenotype [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. We also used RT-qPCR to quantify expression of specific MGnD markers \u003cem\u003eAif1\u003c/em\u003e encoding IBA1, \u003cem\u003eC3ar1\u003c/em\u003e encoding C3 specific receptor, and \u003cem\u003eCx3cr1\u003c/em\u003e. Reactive astrocyte markers included \u003cem\u003eGfap\u003c/em\u003e, \u003cem\u003eCcl12\u003c/em\u003e, and \u003cem\u003eCcl2\u003c/em\u003e, which encodes CC motif chemokine ligand 2. Both CC motif chemokine ligands 12 and 2 are astrocytic secretans that can attract immune cells like microglia to the site of chronic inflammation [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Propensity of astrocytes to secrete chemotactic molecules like CC2 and CC12 and proinflammatory factors like C3 suggest they may not only passively contribute to neuroinflammation but rather function as effector cells performing classical innate immune functions and driving the neuroinflammatory cascade [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e]. These proinflammatory functions of astrocytes appear to play a particularly important role in prionoses, where paradoxical exacerbation of pathology was observed in microglia deficient mice as it was driven by uninhibited proinflammatory response of astrocytes [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In line with the concept of astrocyte-driving neurodegeneration selective removal of astrocytic apoE4 was found to protect against tau mediated neurodegeneration in P301S tau mutant mice [\u003cspan citationid=\"CR121\" class=\"CitationRef\"\u003e121\u003c/span\u003e]. All genes interrogated using RT-qPCR were significantly upregulated in 22L inoculated mice at 23 wpi. but not at 15 wpi. Their transcript level was the highest in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice followed by \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e\u003cem\u003e22L\u003c/em\u003e\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals. Thus, using various transcriptomic approaches we found the strongest proinflammatory effect and evidence for microglia-astrocyte co-stimulatory activation in the setting of the \u003cem\u003eε4\u003c/em\u003e allele and to a lesser extent in the setting of the \u003cem\u003eε2\u003c/em\u003e allele compared to the \u003cem\u003eε3\u003c/em\u003e allele, where the inflammatory response was the least pronounced. This increased neuroinflammatory response associated with the \u003cem\u003eε2\u003c/em\u003e allele is most likely responsible for reduced disease latency, accelerated tempo of symptoms progression and increased burden of pathology observed in \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice compared to \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals.\u003c/p\u003e\u003cp\u003eThe \u003cem\u003eAPOE\u003c/em\u003e polymorphism influences immune response both systemically and within the CNS owing it to the expression of apoE in multiple myeloid-lineage cells, including macrophages, dendritic cells, and microglia [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e]. Consistently with the main finding of this study, the \u003cem\u003eε4\u003c/em\u003e allele has been generally acknowledged as associated with the strongest inflammatory response, while the immunoregulatory properties of the \u003cem\u003eε2\u003c/em\u003e allele have been reported with variable results depending on cell type and inflammatory stimulus. In respect to the systemic response, both \u003cem\u003eε2\u003c/em\u003e and \u003cem\u003eε4\u003c/em\u003e alleles were found to produce stronger inflammatory effect compared to the \u003cem\u003eε3\u003c/em\u003e allele [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR114\" class=\"CitationRef\"\u003e114\u003c/span\u003e]. In respect to CNS-specific studies, intraventricular injection of lipopolysaccharide (LPS) into \u003cem\u003eAPOE\u003c/em\u003e-TR mice [\u003cspan citationid=\"CR129\" class=\"CitationRef\"\u003e129\u003c/span\u003e], or \u003cem\u003ein vitro\u003c/em\u003e stimulation of microglia isolated from these animals using LPS [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e] yielded aggravated and attenuated response in the context to \u003cem\u003eε4\u003c/em\u003e and \u003cem\u003eε2\u003c/em\u003e alleles compared to the \u003cem\u003eε3\u003c/em\u003e allele, respectively. In stark contrast, \u003cem\u003ein vitro\u003c/em\u003e LPS challenge of astrocytes isolates from \u003cem\u003eAPOE\u003c/em\u003e-TR mice produced the highest release of pro-inflammatory cytokines and upregulation of nuclear factor-kappa B subunit expression in the context of the \u003cem\u003eε2\u003c/em\u003e allele [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. Interestingly a recent study examining how \u003cem\u003eAPOE\u003c/em\u003e genotype modulates cell-type-specific transcriptomic changes in AD brains revealed that \u003cem\u003eε4\u003c/em\u003e carriers feature the strongest upregulation of microglia specific genes and most of pro-inflammatory pathways, it also found \u003cem\u003eε2\u003c/em\u003e carriers exhibit strong inflammatory response especially involving IL-6 and IL-1β pathways, which suggests a role of both alleles in promoting inflammatory response in the context of AD pathology [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSeveral bi-transgenic mouse models were generated based on \u003cem\u003eAPOE-\u003c/em\u003eTR mice to directly study the effect of the \u003cem\u003eAPOE\u003c/em\u003e polymorphism on CNS pathology induced by accumulation of disease specific misfolded proteins. In models of Aβ deposition, Aβ plaque load clearly was modified in the rank order of \u003cem\u003eε4\u003c/em\u003e \u0026gt; \u0026gt; \u003cem\u003eε3\u003c/em\u003e \u0026gt; \u003cem\u003eε2\u003c/em\u003e [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e, \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e], with \u003cem\u003eε4\u003c/em\u003e mice featuring the strongest peri-plaque proinflammatory microglia activation [\u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e]. Interestingly modeling of tau pathology has been reported with variable results depending on the model used. Crossing of P301S tau mutant mice [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] with \u003cem\u003eAPOE-TR\u003c/em\u003e mice exacerbated tau accumulation and produced the strongest tau-associated inflammatory response in \u003cem\u003eε4\u003c/em\u003e mice, while both the tau pathology load and innate immune response in \u003cem\u003eε2\u003c/em\u003e and \u003cem\u003eε3\u003c/em\u003e mice were comparable [\u003cspan citationid=\"CR99\" class=\"CitationRef\"\u003e99\u003c/span\u003e]. In contrast, following adeno-associated virus delivery of the P301L tau mutant into the lateral ventricle of \u003cem\u003eAPOE-\u003c/em\u003eTR mice the greatest accumulation of pathology was found in \u003cem\u003eε2\u003c/em\u003e mice, while \u003cem\u003eε4\u003c/em\u003e allele showed a protective effect compared to \u003cem\u003eε3\u003c/em\u003e mice [\u003cspan citationid=\"CR128\" class=\"CitationRef\"\u003e128\u003c/span\u003e]. These variable outcomes could be explained by differences in neuroinflammatory response, which in the P301S model is inherently upregulated, and it was further exacerbated by the presence of the \u003cem\u003eε4\u003c/em\u003e allele [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], differences in the size of expressed human tau protein, and specific mutations used in different models, and possibly by existence of direct interaction between tau and apoE isoforms postulated in the P301L tau model [\u003cspan citationid=\"CR128\" class=\"CitationRef\"\u003e128\u003c/span\u003e]. Crossing of A53T α-synucleinopathy model mice onto the \u003cem\u003eAPOE\u003c/em\u003e-TR lines, exacerbated behavioral and pathological metrics in animals expressing the \u003cem\u003eε4\u003c/em\u003e allele, while the \u003cem\u003eε2\u003c/em\u003e allele attenuated α-synuclein pathology [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. It is noteworthy, that in this model transcriptomic markers of microglia and astrocyte activation showed no differences across animals expressing various \u003cem\u003eAPOE\u003c/em\u003e alleles. Study using a \u003cem\u003eCx3cr1\u003c/em\u003e\u003csup\u003e\u003cem\u003eGFP/GFP\u003c/em\u003e\u003c/sup\u003e mouse model of macular degeneration showed exacerbation of the pathology readouts including subretinal inflammatory response in the setting of the \u003cem\u003eε2\u003c/em\u003e allele and a protective effect of the \u003cem\u003eε4\u003c/em\u003e allele compared to the \u003cem\u003eε3\u003c/em\u003e allele [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. In summary, \u003cem\u003eAPOE\u003c/em\u003e-TR mouse studies have demonstrated both \u003cem\u003eε2\u003c/em\u003e and \u003cem\u003eε4\u003c/em\u003e allele can exacerbate neurodegeneration in a pathology specific context.\u003c/p\u003e\u003cp\u003eThe effect of \u003cem\u003eAPOE\u003c/em\u003e polymorphism on various neurodegenerative diseases also was investigated through a number epidemiological and neuropathological studies carried out in affected patients. Presence of the \u003cem\u003eε4\u003c/em\u003e allele has been invariably found to elevate occurrence of LOAD, which risk is 3-4-fold and 12-15-fold increased among carries of a single and two \u003cem\u003eε4\u003c/em\u003e copies, compared to \u003cem\u003eε3\u003c/em\u003e homozygotes, respectively [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In contrast, the \u003cem\u003eε2\u003c/em\u003e allele strongly protects against LOAD [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] and the likelihood of LOAD among \u003cem\u003eε2\u003c/em\u003e homozygotes was found to be exceptionally low [\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e]. Irrespective of its effect on increasing the risk of LOAD occurrence, the \u003cem\u003eε4\u003c/em\u003e allele in allele dose-dependent manner accelerates the tempo of cognitive decline, brain atrophy, and accumulation of neurofibrillary tangle (NFT) pathology in patients with established disease [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR99\" class=\"CitationRef\"\u003e99\u003c/span\u003e, \u003cspan citationid=\"CR112\" class=\"CitationRef\"\u003e112\u003c/span\u003e, \u003cspan citationid=\"CR113\" class=\"CitationRef\"\u003e113\u003c/span\u003e]. Information on how the \u003cem\u003eε2\u003c/em\u003e allele may affect progression of established LOAD is limited due to low number of affected \u003cem\u003eε2\u003c/em\u003e carriers who also do not carry the \u003cem\u003eε4\u003c/em\u003e allele; however, available data suggest NFT pathology load in \u003cem\u003eε2/ε3\u003c/em\u003e patients is reduced compared to \u003cem\u003eε3/ε3\u003c/em\u003e and \u003cem\u003eε3/ε4\u003c/em\u003e individuals [\u003cspan citationid=\"CR124\" class=\"CitationRef\"\u003e124\u003c/span\u003e]. The \u003cem\u003eε4\u003c/em\u003e allele also has been associated with a greater severity of Lewy body pathology when controlling for co-associated AD pathology [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In contrast, several studies have found \u003cem\u003eε2\u003c/em\u003e carriers and in particular \u003cem\u003eε2/ε2\u003c/em\u003e homozygotes to present with increased risk and elevated pathology load in primary tauopathies, including progressive-supranuclear palsy [\u003cspan citationid=\"CR122\" class=\"CitationRef\"\u003e122\u003c/span\u003e, \u003cspan citationid=\"CR128\" class=\"CitationRef\"\u003e128\u003c/span\u003e], corticobasal degeneration [\u003cspan citationid=\"CR128\" class=\"CitationRef\"\u003e128\u003c/span\u003e] and very late onset NFT-predominant dementia [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Likewise, the \u003cem\u003eε2\u003c/em\u003e allele was implicated as a potential risk factor in aged-related macular degeneration [\u003cspan citationid=\"CR111\" class=\"CitationRef\"\u003e111\u003c/span\u003e]. While in prion diseases epidemiological studies showed no clear effect of \u003cem\u003eAPOE\u003c/em\u003e polymorphism on the risk of disease occurrence [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e, \u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e95\u003c/span\u003e, \u003cspan citationid=\"CR126\" class=\"CitationRef\"\u003e126\u003c/span\u003e], clinical and neuropathological studies evaluating possible effects of \u003cem\u003eAPOE\u003c/em\u003e polymorphism on the rate of prion disease progression and pathology burden have not been done due to limited number of available cases, disease diversity, and restrictions related to infection precaution concerning work with human prion material [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e, \u003cspan citationid=\"CR126\" class=\"CitationRef\"\u003e126\u003c/span\u003e]. Therefore, we examined the effect of \u003cem\u003eAPOE\u003c/em\u003e polymorphism on prion pathology using \u003cem\u003eAPOE\u003c/em\u003e-TR mice we infected with 22L mouse adapted scrapie strain and while we found no effect of the \u003cem\u003eAPOE\u003c/em\u003e genotype on extra-CNS PrP\u003csup\u003eSc\u003c/sup\u003e accumulation and neuroinvasion, the ensuing brain pathology was significantly intensified in the presence of the \u003cem\u003eε4\u003c/em\u003e allele and to lesser extent in the presence of the \u003cem\u003eε2\u003c/em\u003e allele.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eFindings of our study indicate that \u003cem\u003eAPOE\u003c/em\u003e polymorphism differentially regulates the progression of prion pathology. We identified two mechanisms attributable to detrimental effect endowed by the \u003cem\u003eε4\u003c/em\u003e allele, which are increased conversion and accumulation of the PrP\u003csup\u003eSc\u003c/sup\u003e conformer and worsening of prion-associated neuroinflammation, while the \u003cem\u003eε2\u003c/em\u003e allele was found to be associated with increased inflammatory response. Our findings suggest both \u003cem\u003eε4\u003c/em\u003e and \u003cem\u003eε2\u003c/em\u003e alleles are disadvantageous determinants in prion pathology (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAb:\u0026nbsp;b-amyloid;\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eANOVA: analysis of variance; apoE: apolipoprotein E protein; \u003cem\u003eApoe:\u003c/em\u003e apoE gene (murine); \u003cem\u003eAPOE\u003c/em\u003e: apoE gene (human); BCA: bicinchoninic acid; C3: complement component 3; CD68: cluster of differentiation 68; CD230: cluster of differentiation 230 (a.k.a PrP); CJD: Creutzfeldt-Jakob disease; CNS: central nervous system; DAM: disease associated microglia; DPBS: Dulbecco\u0026rsquo;s phosphate buffered saline; dpi: days post inoculation; GFAP: glial fibrillary acidic protein; Iba1: Ionized calcium binding adaptor molecule; ID: integrated density; \u0026nbsp;IFN: interferon; LOAD: late onset Alzheimer\u0026rsquo;s disease; LPS: lipopolysaccharide; LRS: lymphoreticular system; M1: primary motor cortex; MGnD: microglial neurodegenerative phenotype; NaPTA: sodium phosphotungustic acid; NBH: normal brain homogenate; NFT: neurofibrillary tangle;\u0026nbsp;OD: optical density; PK: proteinase K;\u0026nbsp;LRS: lymphoreticular system; PrP: prion protein, PrP\u003csup\u003eSc\u003c/sup\u003e: scrapieform conformer of prion protein; RT-qPCR: Reverse Transcription Quantitative Polymerase Chain Reaction; S1: primary somatosensory cortex; SEM: standard error; SDS-PAGE: sodium dodecyl sulfate-polyacrylamide gel electrophoresis; THB: tissue homogenization buffer; TR: target replacement; TSS: Total Scrapie Score; wpi: weeks post inoculation;\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics Approval and Consent to participate\u003c/strong\u003e\u003cp\u003eAll mouse care and experimental procedures were approved by Institutional Animal Care and Use Committees of the New York University Grossman School of Medicine.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003cp\u003eN/A\u003c/p\u003e\u003ch2\u003eCompeting interest\u003c/h2\u003e\u003cp\u003eThe authors declare no competing financial and/or non-financial interests in relation to the work described.\u003c/p\u003e\u003ch2\u003eAuthors\u0026rsquo; information\u003c/h2\u003e\u003cp\u003eN/A\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis work was supported by grants from the National Institute on Aging R01 AG067478, R01 AG0758401, and RF1 AG088226 and by the funding from The Fisher Center for Alzheimer\u0026rsquo;s Research Foundation\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eM.J.S., A.M.L and J.E.P. conceived of the project and designed the experiments. A.M.L, J.E.P., W.L.C. and L.A.F. conducted the research. P.MS. provided unique material, A.M.L., J.E.P., and M.J.S. analyzed the data, designed figures and wrote the manuscript. All authors have read and approved the final version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors would like to thank Dr. D. M. Holtzman from Washington University School of Medicine (St. Louis, MO) for sharing HJ15.3 monoclonal antibody against human apoE. We also would like to acknowledge the staff of NYU Langone's Genome Technology Center (RRID: SCR_017929) for their assistance with processing of NanoString nCounter\u0026reg; chips.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eRaw images and datasets generated and analyzed during the current study are available from the corresponding author upon a reasonable request. In addition, NanoString nCounter\u0026reg; datasets of microglia and astrocyte transcript can be accessed through the Gene Expression Omnibus Repository, [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE307182](https:/www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE307182) .\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAgosta F, Vossel KA, Miller BL, Migliaccio R, Bonasera SJ, Filippi M et al (2009) Apolipoprotein E epsilon4 is associated with disease-specific effects on brain atrophy in Alzheimer's disease and frontotemporal dementia. Proc Natl Acad Sci U S A 106(6):2018\u0026ndash;2022\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAguilar-Calvo P, Garcia C, Espinosa JC, Andreoletti O, Torres JM (2015) Prion and prion-like diseases in animals. Virus Res 207:82\u0026ndash;93\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAguzzi A, Liu Y (2017) A role for astroglia in prion diseases. J Exp Med 214(12):3477\u0026ndash;3479\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAguzzi A, Zhu C (2017) Microglia in prion diseases. J Clin Invest 127(9):3230\u0026ndash;3239\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlagarsamy J, Jaeschke A, Hui DY (2022) Apolipoprotein E in Cardiometabolic and Neurological Health and Diseases. Int J Mol Sci 23(17)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAmouyel P, Vidal O, Launay JM, Laplanche JL (1994) The apolipoprotein E alleles as major susceptibility factors for Creutzfeldt-Jakob disease. Lancet 344(8933):1315\u0026ndash;1318\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAsuni AA, Guridi M, Pankiewicz JE, Sanchez S, Sadowski MJ (2014) Modulation of amyloid precursor protein expression reduces beta-amyloid deposition in a mouse model. Ann Neurol 75(5):684\u0026ndash;699\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAsuni AA, Guridi M, Sanchez S, Sadowski MJ (2015) Antioxidant peroxiredoxin 6 protein rescues toxicity due to oxidative stress and cellular hypoxia in vitro, and attenuates prion-related pathology in vivo. Neurochem Int 90:152\u0026ndash;165\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAsuni AA, Pankiewicz JE, Sadowski MJ (2013) Differential molecular chaperone response associated with various mouse adapted scrapie strains. Neurosci Lett 538:26\u0026ndash;31\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAucouturier P, Geissmann F, Damotte D, Saborio GP, Meeker HC, Kascsak R et al (2001) Infected dendritic cells are sufficient for prion transmission to the CNS in mouse scrapie. J Clin Invest 108:703\u0026ndash;708\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBradford BM, McGuire LI, Hume DA, Pridans C, Mabbott NA (2022) Microglia deficiency accelerates prion disease but does not enhance prion accumulation in the brain. Glia 70(11):2169\u0026ndash;2187\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBurkholder T, Foltz C, Karlsson E, Linton CG, Smith JM (2012) Health Evaluation of Experimental Laboratory Mice. Curr Protoc Mouse Biol 2:145\u0026ndash;165\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eButovsky O, Jedrychowski MP, Moore CS, Cialic R, Lanser AJ, Gabriely G et al (2014) Identification of a unique TGF-beta-dependent molecular and functional signature in microglia. Nat Neurosci 17(1):131\u0026ndash;143\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eButovsky O, Weiner HL (2018) Microglial signatures and their role in health and disease. Nat Rev Neurosci 19(10):622\u0026ndash;635\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCarroll JA, Chesebro B (2019) Neuroinflammation, Microglia, and Cell-Association during Prion Disease. Viruses. 11(1)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCarroll JA, Race B, Phillips K, Striebel JF, Chesebro B (2017) Statins are ineffective at reducing neuroinflammation or prolonging survival in scrapie-infected mice. J Gen Virol 98(8):2190\u0026ndash;2199\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCarroll JA, Race B, Williams K, Striebel J, Chesebro B (2018) Microglia Are Critical in Host Defense against Prion Disease. J Virol. 92(15)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCarroll JA, Race B, Williams K, Striebel J, Chesebro B (2020) RNA-seq and network analysis reveal unique glial gene expression signatures during prion infection. Mol Brain 13(1):71\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCarroll JA, Striebel JF, Rangel A, Woods T, Phillips K, Peterson KE et al (2016) Prion Strain Differences in Accumulation of PrPSc on Neurons and Glia Are Associated with Similar Expression Profiles of Neuroinflammatory Genes: Comparison of Three Prion Strains. PLoS Pathog 12(4):e1005551\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCastellano JM, Kim J, Stewart FR, Jiang H, DeMattos RB, Patterson BW et al (2011) Human apoE Isoforms Differentially Regulate Brain Amyloid-β Peptide Clearance. SciTranslMed 3(89):89ra57\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen XR, Shao Y, Sadowski MJ, Alzheimer's Disease Neuroimaging I (2021) Segmented Linear Mixed Model Analysis Reveals Association of the APOEvarepsilon4 Allele with Faster Rate of Alzheimer's Disease Dementia Progression. J Alzheimers Dis 82(3):921\u0026ndash;937\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen Y, Strickland MR, Soranno A, Holtzman DM (2021) Apolipoprotein E: Structural Insights and Links to Alzheimer Disease Pathogenesis. Neuron 109(2):205\u0026ndash;221\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eColombo E, Farina C (2016) Astrocytes: Key Regulators of Neuroinflammation. Trends Immunol 37(9):608\u0026ndash;620\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCorder EH, Saunders AM, Risch NJ, Strittmatter WJ, Schmechel DE, Gaskell PC Jr. et al (1994) Protective effect of apolipoprotein E type 2 allele for late onset Alzheimer disease. Nat Gen 7(2):180\u0026ndash;184\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCorder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC Jr., Rimmler JB et al (1995) Apolipoprotein E, survival in Alzheimer's disease patients, and the competing risks of death and Alzheimer's disease. Neurol 45(7):1323\u0026ndash;1328\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCorder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, Small GW et al (1993) Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families. Science 261(5123):921\u0026ndash;923\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCosentino S, Scarmeas N, Helzner E, Glymour MM, Brandt J, Albert M et al (2008) APOE epsilon 4 allele predicts faster cognitive decline in mild Alzheimer disease. Neurology 70(19 Pt 2):1842\u0026ndash;1849\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCruchaga C, Kauwe JS, Nowotny P, Bales K, Pickering EH, Mayo K et al (2012) Cerebrospinal fluid APOE levels: an endophenotype for genetic studies for Alzheimer's disease. Hum Mol Genet 21(20):4558\u0026ndash;4571\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDaniels MJD, Lefevre L, Szymkowiak S, Drake A, McCulloch L, Tzioras M et al (2023) Cystatin F (Cst7) drives sex-dependent changes in microglia in an amyloid-driven model of Alzheimer's disease. Elife. 12\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDaude N, Lehmann S, Harris DA (1997) Identification of intermediate steps in the conversion of a mutant prion protein to a scrapie-like form in cultured cells. J Biol Chem 272(17):11604\u0026ndash;11612\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDavis AA, Inman CE, Wargel ZM, Dube U, Freeberg BM, Galluppi A et al (2020) APOE genotype regulates pathology and disease progression in synucleinopathy. Sci Transl Med 12(529)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ede Andrade M, Thandi I, Brown S, Gotto A Jr., Patsch W, Boerwinkle E (1995) Relationship of the apolipoprotein E polymorphism with carotid artery atherosclerosis. Am J Hum Genet 56(6):1379\u0026ndash;1390\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeArmond SJ, Kretzschmar H, Prusiner SB (2002) Prion diseases. In: Graham DI, Lantos P (eds) Greenfield's Neuropathology. seventh ed. Arnold, London, pp 273\u0026ndash;324\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDickson DW, Heckman MG, Murray ME, Soto AI, Walton RL, Diehl NN et al (2018) APOE epsilon4 is associated with severity of Lewy body pathology independent of Alzheimer pathology. Neurology 91(12):e1182\u0026ndash;e95\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEisenberg DT, Kuzawa CW, Hayes MG (2010) Worldwide allele frequencies of the human apolipoprotein E gene: climate, local adaptations, and evolutionary history. Am J Phys Anthropol 143(1):100\u0026ndash;111\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEmamzadeh FN, Aojula H, McHugh PC, Allsop D (2016) Effects of different isoforms of apoE on aggregation of the alpha-synuclein protein implicated in Parkinson's disease. Neurosci Lett 618:146\u0026ndash;151\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGarai K, Verghese PB, Baban B, Holtzman DM, Frieden C (2014) The Binding of Apolipoprotein E to Oligomers and Fibrils of Amyloid-beta Alters the Kinetics of Amyloid Aggregation. Biochemistry\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGeschwind MD (2015) Prion Diseases. Continuum (MinneapMinn). 21(6 Neuroinfectious Disease):1612-38\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHammond TR, Marsh SE, Stevens B (2019) Immune Signaling in Neurodegeneration. Immunity 50(4):955\u0026ndash;974\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHarris DA (1999) Cell biological studies of the prion protein. Curr Issues Mol Biol 1(1\u0026ndash;2):65\u0026ndash;75\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHarris DA (1999) Cellular biology of prion diseases. Clin Microbiol Rev 12(3):429\u0026ndash;444\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHartmann K, Sepulveda-Falla D, Rose IVL, Madore C, Muth C, Matschke J et al (2019) Complement 3(+)-astrocytes are highly abundant in prion diseases, but their abolishment led to an accelerated disease course and early dysregulation of microglia. Acta Neuropathol Commun 7(1):83\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHemonnot-Girard AL, Meersseman C, Pastore M, Garcia V, Linck N, Rey C et al (2022) Comparative analysis of transcriptome remodeling in plaque-associated and plaque-distant microglia during amyloid-beta pathology progression in mice. J Neuroinflammation 19(1):234\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuynh TV, Wang C, Tran AC, Tabor GT, Mahan TE, Francis CM et al (2019) Lack of hepatic apoE does not influence early Abeta deposition: observations from a new APOE knock-in model. Mol Neurodegener 14(1):37\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIgel E, Haller A, Wolfkiel PR, Orr-Asman M, Jaeschke A, Hui DY (2021) Distinct pro-inflammatory properties of myeloid cell-derived apolipoprotein E2 and E4 in atherosclerosis promotion. J Biol Chem 297(3):101106\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIkeda K, Akiyama H, Arai T, Sahara N, Mori H, Usami M et al (1997) A subset of senile dementia with high incidence of the apolipoprotein E epsilon2 allele. Ann Neurol 41(5):693\u0026ndash;695\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIshihara T, Hong M, Zhang B, Nakagawa Y, Lee MK, Trojanowski JQ, Lee VM (1999) Age-dependent emergence and progression of a tauopathy in transgenic mice overexpressing the shortest human tau isoform. Neuron 24(3):751\u0026ndash;762\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJeffrey M, McGovern G, Siso S, Gonzalez L (2011) Cellular and sub-cellular pathology of animal prion diseases: relationship between morphological changes, accumulation of abnormal prion protein and clinical disease. Acta Neuropathol 121(1):113\u0026ndash;134\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKeren-Shaul H, Spinrad A, Weiner A, Matcovitch-Natan O, Dvir-Szternfeld R, Ulland TK et al (2017) A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease. Cell 169(7):1276\u0026ndash;90e17\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim RY, Hoffman AS, Itoh N, Ao Y, Spence R, Sofroniew MV, Voskuhl RR (2014) Astrocyte CCL2 sustains immune cell infiltration in chronic experimental autoimmune encephalomyelitis. J Neuroimmunol 274(1\u0026ndash;2):53\u0026ndash;61\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKnouff C, Hinsdale ME, Mezdour H, Altenburg MK, Watanabe M, Quarfordt SH et al (1999) Apo E structure determines VLDL clearance and atherosclerosis risk in mice. J Clin Invest 103(11):1579\u0026ndash;1586\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKraft AW, Hu X, Yoon H, Yan P, Xiao Q, Wang Y et al (2013) Attenuating astrocyte activation accelerates plaque pathogenesis in APP/PS1 mice. FASEB J 27(1):187\u0026ndash;198\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKrasemann S, Madore C, Cialic R, Baufeld C, Calcagno N, El Fatimy R et al (2017) The TREM2-APOE Pathway Drives the Transcriptional Phenotype of Dysfunctional Microglia in Neurodegenerative Diseases. Immunity 47(3):566\u0026ndash;581 e9\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKuhel DG, Konaniah ES, Basford JE, McVey C, Goodin CT, Chatterjee TK et al (2013) Apolipoprotein E2 accentuates postprandial inflammation and diet-induced obesity to promote hyperinsulinemia in mice. Diabetes 62(2):382\u0026ndash;391\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKushwaha R, Sinha A, Makarava N, Molesworth K, Baskakov IV (2021) Non-cell autonomous astrocyte-mediated neuronal toxicity in prion diseases. Acta Neuropathol Commun 9(1):22\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKuszczyk MA, Sanchez S, Pankiewicz J, Kim J, Duszczyk M, Guridi M et al (2013) Blocking the Interaction between Apolipoprotein E and Abeta Reduces Intraneuronal Accumulation of Abeta and Inhibits Synaptic Degeneration. AmJ Pathol 182(5):1750\u0026ndash;1768\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLauren J, Gimbel DA, Nygaard HB, Gilbert JW, Strittmatter SM (2009) Cellular prion protein mediates impairment of synaptic plasticity by amyloid-beta oligomers. Nature 457(7233):1128\u0026ndash;1132\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLevy O, Lavalette S, Hu SJ, Housset M, Raoul W, Eandi C et al (2015) APOE Isoforms Control Pathogenic Subretinal Inflammation in Age-Related Macular Degeneration. J Neurosci 35(40):13568\u0026ndash;13576\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Z, Martens YA, Ren Y, Jin Y, Sekiya H, Doss SV et al (2025) APOE genotype determines cell-type-specific pathological landscape of Alzheimer's disease. Neuron 113(9):1380\u0026ndash;1397 e7\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiao F, Zhang TJ, Jiang H, Lefton KB, Robinson GO, Vassar R et al (2015) Murine versus human apolipoprotein E4: differential facilitation of and co-localization in cerebral amyloid angiopathy and amyloid plaques in APP transgenic mouse models. Acta Neuropathol Commun 3:70\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiddelow SA, Barres BA (2017) Reactive Astrocytes: Production, Function, and Therapeutic Potential. Immunity 46(6):957\u0026ndash;967\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiddelow SA, Guttenplan KA, Clarke LE, Bennett FC, Bohlen CJ, Schirmer L et al (2017) Neurotoxic reactive astrocytes are induced by activated microglia. Nature 541(7638):481\u0026ndash;487\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiemisa B, Newbury SF, Novy MJ, Pasato JA, Morales-Corraliza J, Peng KY, Mathews PM (2023) Brain apolipoprotein E levels in mice challenged by a Western diet increase in an allele-dependent manner. Aging Brain 4:100102\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin PB, Holtzman DM (2024) Current insights into apolipoprotein E and the immune response in Alzheimer's disease. Immunol Rev 327(1):43\u0026ndash;52\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402\u0026ndash;408\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa J, Yee A, Brewer HB Jr., Das S, Potter H (1994) Amyloid-associated proteins alpha 1-antichymotrypsin and apolipoprotein E promote assembly of Alzheimer beta-protein into filaments. Nature 372(6501):92\u0026ndash;94\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMackenzie G, Will R (2017) Creutzfeldt-Jakob disease: recent developments. F1000Research. 6:2053\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaezawa I, Maeda N, Montine TJ, Montine KS (2006) Apolipoprotein E-specific innate immune response in astrocytes from targeted replacement mice. J Neuroinflammation 3:10\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaezawa I, Nivison M, Montine KS, Maeda N, Montine TJ (2006) Neurotoxicity from innate immune response is greatest with targeted replacement of E4 allele of apolipoprotein E gene and is mediated by microglial p38MAPK. FASEB J 20(6):797\u0026ndash;799\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMahley RW, Weisgraber KH, Huang Y (2009) Apolipoprotein E: structure determines function, from atherosclerosis to Alzheimer's disease to AIDS. J Lipid Res 50:S183\u0026ndash;S8\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMercer RCC, Harris DA (2023) Mechanisms of prion-induced toxicity. Cell Tissue Res 392(1):81\u0026ndash;96\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNakagawa Y, Kitamoto T, Furukawa H, Ogomori K, Tateishi J (1995) Apolipoprotein E in Creutzfeldt-Jakob disease. Lancet 345(8941):68\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNimmo J, Byrne RAJ, Daskoulidou N, Watkins LM, Carpanini SM, Zelek WM, Morgan BP (2024) The complement system in neurodegenerative diseases. Clin Sci (Lond) 138(6):387\u0026ndash;412\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNuvolone M, Schmid N, Miele G, Sorce S, Moos R, Schori C et al (2017) Cystatin F is a biomarker of prion pathogenesis in mice. PLoS ONE 12(2):e0171923\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePankiewicz JE, Baquero-Buitrago J, Sanchez S, Lopez-Contreras J, Kim J, Sullivan PM et al (2017) APOE Genotype Differentially Modulates Effects of Anti-A beta, Passive Immunization in APP Transgenic Mice. Mol Neurodegener 12(1):12\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePankiewicz JE, Diaz JR, Marta-Ariza M, Lizinczyk AM, Franco LA, Sadowski MJ (2020) Peroxiredoxin 6 mediates protective function of astrocytes in Abeta proteostasis. Mol Neurodegener 15(1):50\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePankiewicz JE, Lizinczyk AM, Franco LA, Diaz JR, Marta-Ariza M, Sadowski MJ (2021) Absence of Apolipoprotein E is associated with exacerbation of prion pathology and promotes microglial neurodegenerative phenotype. Acta Neuropathol Commun 9(1):157\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePankiewicz JE, Sanchez S, Kirshenbaum K, Kascsak RB, Kascsak RJ, Sadowski MJ (2019) Anti-prion Protein Antibody 6D11 Restores Cellular Proteostasis of Prion Protein Through Disrupting Recycling Propagation of PrP(Sc) and Targeting PrP(Sc) for Lysosomal Degradation. Mol Neurobiol 56(3):2073\u0026ndash;2091\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eParchi P, Giese A, Capellari S, Brown P, Schulz-Schaeffer W, Windl O et al (1999) Classification of sporadic Creutzfeldt-Jakob disease based on molecular and phenotypic analysis of 300 subjects. Ann Neurol 46(2):224\u0026ndash;233\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eParhizkar S, Holtzman DM (2022) APOE mediated neuroinflammation and neurodegeneration in Alzheimer's disease. Semin Immunol 59:101594\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePastrana MA, Sajnani G, Onisko B, Castilla J, Morales R, Soto C, Requena JR (2006) Isolation and characterization of a proteinase K-sensitive PrPSc fraction. Biochemistry 45(51):15710\u0026ndash;15717\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePatani R, Hardingham GE, Liddelow SA (2023) Functional roles of reactive astrocytes in neuroinflammation and neurodegeneration. Nat Rev Neurol 19(7):395\u0026ndash;409\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePrinz M, Heikenwalder M, Junt T, Schwarz P, Glatzel M, Heppner FL et al (2003) Positioning of follicular dendritic cells within the spleen controls prion neuroinvasion. Nature 425(6961):957\u0026ndash;962\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePrinz M, Jung S, Priller J (2019) Microglia Biology: One Century of Evolving Concepts. Cell 179(2):292\u0026ndash;311\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePrusiner SB (2001) Neurodegenerative diseases and prions. N Engl J Med 344(20):1516\u0026ndash;1526\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQian J, Zhang Y, Betensky RA, Hyman BT, Serrano-Pozo A (2023) Neuropathology-Independent Association Between APOE Genotype and Cognitive Decline Rate in the Normal Aging-Early Alzheimer Continuum. Neurol Genet 9(1):e200055\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRall SC Jr., Weisgraber KH, Mahley RW (1986) Isolation and characterization of apolipoprotein E. Methods Enzymol 128:273\u0026ndash;287\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eReiman EM, Arboleda-Velasquez JF, Quiroz YT, Huentelman MJ, Beach TG, Caselli RJ et al (2020) Exceptionally low likelihood of Alzheimer's dementia in APOE2 homozygotes from a 5,000-person neuropathological study. Nat Commun 11(1):667\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRodgers KR, Lin Y, Langan TJ, Iwakura Y, Chou RC (2020) Innate Immune Functions of Astrocytes are Dependent Upon Tumor Necrosis Factor-Alpha. Sci Rep 10(1):7047\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRodriguez GA, Tai LM, LaDu MJ, Rebeck GW (2014) Human APOE4 increases microglia reactivity at Abeta plaques in a mouse model of Abeta deposition. J Neuroinflammation 11:111\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSadowski M, Kumar A, Wisniewski T (2008) Prion diseases. In: Bradley WG, editor. Neurology in Clinical Practice,. 5th Edition ed: Butterworth-Heinemann; pp. 1567-81\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSadowski M, Pankiewicz J, Scholtzova H, Ripellino JA, Li YS, Schmidt SD et al (2004) A synthetic peptide blocking the apolipoprotein E/beta-amyloid binding mitigates beta-amyloid toxicity and fibril formation in vitro and reduces beta-amyloid plaques in transgenic mice. Am J Pathol 165(3):937\u0026ndash;948\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSadowski MJ, Pankiewicz J, Prelli F, Scholtzova H, Spinner DS, Kascsak RB et al (2009) Anti-PrP Mab 6D11 Suppresses PrP\u003csup\u003eSc\u003c/sup\u003e Replication in Prion Infected Myeloid Precursor Line FDC-P1/22L and in the Lymphoreticular System \u003cem\u003eIn Vivo\u003c/em\u003e. Neurobiol Dis 34(2):267\u0026ndash;278\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSafar J, Wille H, Itri V, Groth D, Serban A, Torchia M et al (1998) Eight prion strains have PrPSc molecules with different conformations. Nat Med 4(10):1157\u0026ndash;1165\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSalvatore M, Seeber AC, Nacmias B, Petraroli R, D'Alessandro M, Sorbi S, Pocchiari M (1995) Apolipoprotein E in sporadic and familial Creutzfeldt-Jakob disease. Neurosci Lett 199(2):95\u0026ndash;98\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSanan DA, Weisgraber KH, Russell SJ, Mahley RW, Huang D, Saunders A et al (1994) Apolipoprotein E associates with beta amyloid peptide of Alzheimer's disease to form novel monofibrils. Isoform apoE4 associates more efficiently than apoE3. J Clin Invest 94(2):860\u0026ndash;869\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchmechel DE, Saunders AM, Strittmatter WJ, Crain BJ, Hulette CM, Joo SH et al (1993) Increased amyloid beta-peptide deposition in cerebral cortex as a consequence of apolipoprotein E genotype in late-onset Alzheimer disease. Proc Natl Acad Sci (USA) 90(20):9649\u0026ndash;9653\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShi Y, Manis M, Long J, Wang K, Sullivan PM, Remolina Serrano J et al (2019) Microglia drive APOE-dependent neurodegeneration in a tauopathy mouse model. J Exp Med 216(11):2546\u0026ndash;2561\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShi Y, Yamada K, Liddelow SA, Smith ST, Zhao L, Luo W et al (2017) ApoE4 markedly exacerbates tau-mediated neurodegeneration in a mouse model of tauopathy. Nature 549(7673):523\u0026ndash;527\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSimonovitch S, Schmukler E, Bespalko A, Iram T, Frenkel D, Holtzman DM et al (2016) Impaired Autophagy in APOE4 Astrocytes. J Alzheimers Dis 51(3):915\u0026ndash;927\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSong Y, Stampfer MJ, Liu S (2004) Meta-analysis: apolipoprotein E genotypes and risk for coronary heart disease. Ann Intern Med 141(2):137\u0026ndash;147\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSpinner DR, Kascsak RB, LaFauci G, Meeker HC, Ye X, Flory MJ et al (2007) CpG oligodeoxynucleotide-enhanced humoral immune response and production of antibodies to prion protein PrPSc in mice immunized with 139A scrapie-associated fibrils. J Leukoc Biol 81(6):1374\u0026ndash;1385\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStrickland MR, Rau MJ, Summers B, Basore K, Wulf J 2nd, Jiang H et al (2024) Apolipoprotein E secreted by astrocytes forms antiparallel dimers in discoidal lipoproteins. Neuron 112(7):1100\u0026ndash;9e5\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStriebel JF, Race B, Carroll JA, Phillips K, Chesebro B (2016) Knockout of fractalkine receptor Cx3cr1 does not alter disease or microglial activation in prion-infected mice. J Gen Virol 97(6):1481\u0026ndash;1487\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStrittmatter WJ, Saunders AM, Goedert M, Weisgraber KH, Dong LM, Jakes R et al (1994) Isoform-specific interactions of apolipoprotein E with microtubule-associated protein tau: implications for Alzheimer disease. Proc Natl Acad Sci (USA) 91(23):11183\u0026ndash;11186\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStrittmatter WJ, Saunders AM, Schmechel D, Pericak-Vance M, Enghild J, Salvesen GS, Roses AD (1993) Apolipoprotein E: high-avidity binding to beta-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proc Natl Acad Sci (USA) 90(5):1977\u0026ndash;1981\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStrittmatter WJ, Weisgraber KH, Goedert M, Saunders AM, Huang D, Corder EH et al (1994) Hypothesis: microtubule instability and paired helical filament formation in the Alzheimer disease brain are related to apolipoprotein E genotype. Exp Neurol 125(2):163\u0026ndash;171\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStrittmatter WJ, Weisgraber KH, Huang DY, Dong LM, Salvesen GS, Pericak-Vance M et al (1993) Binding of human apolipoprotein E to synthetic amyloid beta peptide: isoform-specific effects and implications for late-onset Alzheimer disease. Proc Natl Acad Sci (USA) 90(17):8098\u0026ndash;8102\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSullivan PM, Han B, Liu F, Mace BE, Ervin JF, Wu S et al (2011) Reduced levels of human apoE4 protein in an animal model of cognitive impairment. Neurobiol Aging 32(5):791\u0026ndash;801\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSullivan PM, Mezdour H, Aratani Y, Knouff C, Najib J, Reddick RL et al (1997) Targeted replacement of the mouse apolipoprotein E gene with the common human APOE3 allele enhances diet-induced hypercholesterolemia and atherosclerosis. J Biol Chem 272(29):17972\u0026ndash;17980\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThakkinstian A, Han P, McEvoy M, Smith W, Hoh J, Magnusson K et al (2006) Systematic review and meta-analysis of the association between complement factor H Y402H polymorphisms and age-related macular degeneration. Hum Mol Genet 15(18):2784\u0026ndash;2790\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTherriault J, Benedet AL, Pascoal TA, Mathotaarachchi S, Chamoun M, Savard M et al (2019) Association of Apolipoprotein E epsilon4 With Medial Temporal Tau Independent of Amyloid-beta. JAMA Neurol\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTherriault J, Benedet AL, Pascoal TA, Mathotaarachchi S, Savard M, Chamoun M et al (2021) APOEepsilon4 potentiates the relationship between amyloid-beta and tau pathologies. Mol Psychiatry 26(10):5977\u0026ndash;5988\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTsoi LM, Wong KY, Liu YM, Ho YY (2007) Apoprotein E isoform-dependent expression and secretion of pro-inflammatory cytokines TNF-alpha and IL-6 in macrophages. Arch Biochem Biophys 460(1):33\u0026ndash;40\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTzaban S, Friedlander G, Schonberger O, Horonchik L, Yedidia Y, Shaked G et al (2002) Protease-sensitive scrapie prion protein in aggregates of heterogeneous sizes. Biochemistry 41(42):12868\u0026ndash;12875\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eUlrich JD, Burchett JM, Restivo JL, Schuler DR, Verghese PB, Mahan TE et al (2013) In vivo measurement of apolipoprotein E from the brain interstitial fluid using microdialysis. Mol Neurodegener 8:13\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eUm JW, Nygaard HB, Heiss JK, Kostylev MA, Stagi M, Vortmeyer A et al (2012) Alzheimer amyloid-beta oligomer bound to postsynaptic prion protein activates Fyn to impair neurons. Nat Neurosci 15(9):1227\u0026ndash;1235\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVan Everbroeck B, Croes EA, Pals P, Dermaut B, Jansen G, van Duijn CM et al (2001) Influence of the prion protein and the apolipoprotein E genotype on the Creutzfeldt-Jakob Disease phenotype. Neurosci Lett 313(1\u0026ndash;2):69\u0026ndash;72\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVerghese PB, Castellano JM, Holtzman DM (2011) Apolipoprotein E in Alzheimer's disease and other neurological disorders. Lancet Neurol 10(3):241\u0026ndash;252\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWadsworth JDF, Joiner S, Hill AF, Campbell TA, Desbruslais M, Luthert PJ, Collinge J (2001) Tissue distribution of protease resistant prion protein in variant Creutzfeldt-Jakob disease using a highly sensitive immunoblotting assay. Lancet 358(9277):171\u0026ndash;180\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang C, Xiong M, Gratuze M, Bao X, Shi Y, Andhey PS et al (2021) Selective removal of astrocytic APOE4 strongly protects against tau-mediated neurodegeneration and decreases synaptic phagocytosis by microglia. Neuron 109(10):1657\u0026ndash;1674 e7\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang H, Chang TS, Dombroski BA, Cheng PL, Patil V, Valiente-Banuet L et al (2024) Whole-genome sequencing analysis reveals new susceptibility loci and structural variants associated with progressive supranuclear palsy. Mol Neurodegener 19(1):61\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang S, Wang J, Cao Y, Zhang Y, Sun Z, Wan P et al (2025) Clec7a Signaling in Microglia Promotes Synapse Loss Associated with Tauopathy. Int J Mol Sci. 26(7)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYoung CB, Johns E, Kennedy G, Belloy ME, Insel PS, Greicius MD et al (2023) APOE effects on regional tau in preclinical Alzheimer's disease. Mol Neurodegener 18(1):1\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZattoni M, Mearelli M, Vanni S, Colini Baldeschi A, Tran TH, Ferracin C et al (2022) Serpin Signatures in Prion and Alzheimer's Diseases. Mol Neurobiol 59(6):3778\u0026ndash;3799\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZerr I, Helmhold M, Poser S, Armstrong VW, Weber T (1996) Apolipoprotein E phenotype frequency and cerebrospinal fluid concentration are not associated with Creutzfeldt-Jakob disease. ArchNeurol 53(12):1233\u0026ndash;1238\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang H, Reddick RL, Piedrahita JA, Maeda N (1992) Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science 258:468\u0026ndash;471\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao N, Liu CC, Van Ingelgom AJ, Linares C, Kurti A, Knight JA et al (2018) APOE epsilon2 is associated with increased tau pathology in primary tauopathy. Nat Commun 9(1):4388\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu Y, Nwabuisi-Heath E, Dumanis SB, Tai LM, Yu C, Rebeck GW, LaDu MJ (2012) APOE genotype alters glial activation and loss of synaptic markers in mice. Glia 60(4):559\u0026ndash;569\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"acta-neuropathologica-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"anec","sideBox":"Learn more about [Acta Neuropathologica Communications](https://actaneurocomms.biomedcentral.com/)","snPcode":"40478","submissionUrl":"https://submission.springernature.com/new-submission/40478/3","title":"Acta Neuropathologica Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Alzheimer’s disease, apolipoprotein E, astrocytes, microglia, neurodegeneration, neuroinflammation, prion diseases, prion protein","lastPublishedDoi":"10.21203/rs.3.rs-7820890/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7820890/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eAPOE\u003c/em\u003e polymorphism affects the risk of occurrence and the rate of progression in several neurodegenerative diseases including Alzheimer\u0026rsquo;s disease, primary tauopathies, α-synucleinopathy, and age-related macular degeneration, but its role in prionoses remains unestablished. Using \u003cem\u003eAPOE\u003c/em\u003e targeted replacement (TR) mice, we investigated how \u003cem\u003eAPOE\u003c/em\u003e genotype affects key neurodegenerative mechanisms involved in prion pathology. Male and female \u003cem\u003eε2/ε2\u003c/em\u003e, \u003cem\u003eε3/ε3\u003c/em\u003e, and \u003cem\u003eε4/ε4 APOE\u003c/em\u003e-TR mice were inoculated with 22L mouse-adapted scrapie strain or normal brain homogenate and monitored with behavioral testing from 10-week post inoculation (wpi.) onward. Mice were euthanized at 23 wpi. when all prion-infected animals were symptomatic, and their brains were analyzed for multiple neuropathological, biochemical, and transcriptomic metrics. \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice featured the shortest disease latency time, the worst neurological score, and the highest load of spongiform lesions. \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice performed significantly better than \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice but significantly worse than \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e animals. Numerous aspects of PrP proteinopathy were exacerbated in the presence of the \u003cem\u003eε4\u003c/em\u003e allele including increased PrP\u003csup\u003eSc\u003c/sup\u003e accumulation, reduced PrP solubility, and increased PrP oligomerization. These metrics were comparable between \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e and \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice. Prion pathology significantly increased brain apolipoprotein (apo) E levels, with the greatest increase in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice. All apoE isoforms formed complexes with conformationally altered PrP, but this interaction was the strongest in \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice. \u003cem\u003eε4/ε4\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e mice had the highest load of reactive microglia and astrocytes and upregulation of transcriptomic markers typical of neurodegenerative microglia and astrocytes, followed by \u003cem\u003eε2/ε2\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e, with \u003cem\u003eε3/ε3\u003c/em\u003e\u003csub\u003e22L\u003c/sub\u003e having the lowest. Thus, \u003cem\u003eAPOE\u003c/em\u003e polymorphism differentially regulates the progression of prion pathology attributable to two \u003cem\u003eε4\u003c/em\u003e-affected mechanisms: increased conversion and accumulation of PrP\u003csup\u003eSc\u003c/sup\u003e and worsened prion-associated neuroinflammation. Though less severely than \u003cem\u003eε4\u003c/em\u003e, the \u003cem\u003eε2\u003c/em\u003e allele also increased the inflammatory response, rendering disease outcome worse relative to the \u003cem\u003eε3\u003c/em\u003e allele. Our findings suggest both \u003cem\u003eε4\u003c/em\u003e and \u003cem\u003eε2\u003c/em\u003e alleles are disadvantageous determinants in prion pathology.\u003c/p\u003e","manuscriptTitle":"APOE Genotype Differentially Modulates Prion Pathology in a Mouse Model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-30 19:39:13","doi":"10.21203/rs.3.rs-7820890/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-16T20:04:11+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-06T00:30:22+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-04T22:07:50+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-03T21:55:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"12252826736067854238341718339075695131","date":"2025-10-23T17:44:05+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"280324037479711611844776769228419543756","date":"2025-10-23T17:11:25+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"308679238955519002978274840938467812382","date":"2025-10-21T11:29:23+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-20T13:00:43+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-18T12:21:38+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-15T05:45:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"Acta Neuropathologica Communications","date":"2025-10-09T20:55:25+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"acta-neuropathologica-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"anec","sideBox":"Learn more about [Acta Neuropathologica Communications](https://actaneurocomms.biomedcentral.com/)","snPcode":"40478","submissionUrl":"https://submission.springernature.com/new-submission/40478/3","title":"Acta Neuropathologica Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"533ca2cf-87aa-4b0d-aa35-1423d1ab3777","owner":[],"postedDate":"October 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-01-26T16:11:12+00:00","versionOfRecord":{"articleIdentity":"rs-7820890","link":"https://doi.org/10.1186/s40478-025-02207-5","journal":{"identity":"acta-neuropathologica-communications","isVorOnly":false,"title":"Acta Neuropathologica Communications"},"publishedOn":"2026-01-21 15:59:11","publishedOnDateReadable":"January 21st, 2026"},"versionCreatedAt":"2025-10-30 19:39:13","video":"","vorDoi":"10.1186/s40478-025-02207-5","vorDoiUrl":"https://doi.org/10.1186/s40478-025-02207-5","workflowStages":[]},"version":"v1","identity":"rs-7820890","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7820890","identity":"rs-7820890","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}