Autism gene variants disrupt enteric neuron migration and cause gastrointestinal dysmotility

preprint OA: closed
📄 Open PDF Full text JSON View at publisher

Abstract

ABSTRACT The comorbidity of autism spectrum disorders and severe gastrointestinal symptoms is well-established, yet the molecular underpinnings remain unknown. The identification of high-confidence large-effect autism risk genes offers the opportunity to identify convergent, underlying biology by studying these genes in the context of the gastrointestinal system. Here we show that the expression of these genes is enriched in human prenatal gut neurons as well as their migratory progenitors, suggesting that the development and/or function of these neurons may be disrupted by autism-associated pathogenic variants, leading to gastrointestinal dysfunction. Here we document the prevalence of gastrointestinal issues in patients with large-effect variants in sixteen of these genes, highlighting dysmotility, consistent with potential enteric neuron dysfunction. Using the high-throughput diploid frog Xenopus tropicalis , we individually target five of these genes ( SYNGAP1, CHD8, SCN2A, CHD2 , and DYRK1A ) and observe disrupted enteric neuronal progenitor migration for each. More extensive analysis of DYRK1A reveals that perturbation causes gut dysmotility in vivo , which can be ameliorated by treatment with a selective serotonin reuptake inhibitor (escitalopram) or a serotonin receptor 6 agonist, identified by in vivo drug screening. This work suggests that atypical development of enteric neurons contributes to the gastrointestinal distress commonly seen in individuals with autism and that increasing serotonin signaling may be a productive therapeutic avenue.
Full text 65,936 characters · extracted from preprint-html · click to expand
Autism gene variants disrupt enteric neuron migration and cause gastrointestinal dysmotility | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Autism gene variants disrupt enteric neuron migration and cause gastrointestinal dysmotility View ORCID Profile Kate E. McCluskey , Katherine M. Stovell , View ORCID Profile Karen Law , View ORCID Profile Elina Kostyanovskaya , View ORCID Profile James Schmidt , Cameron R. T. Exner , View ORCID Profile Jeanselle Dea , View ORCID Profile Elise Brimble , View ORCID Profile Matthew W. State , A. Jeremy Willsey , View ORCID Profile Helen Rankin Willsey doi: https://doi.org/10.1101/2024.05.28.593642 Kate E. McCluskey 1 Department of Psychiatry and Behavioral Sciences, UCSF Weill Institute for Neurosciences, University of California San Francisco , San Francisco, CA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Kate E. McCluskey Katherine M. Stovell 1 Department of Psychiatry and Behavioral Sciences, UCSF Weill Institute for Neurosciences, University of California San Francisco , San Francisco, CA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Karen Law 1 Department of Psychiatry and Behavioral Sciences, UCSF Weill Institute for Neurosciences, University of California San Francisco , San Francisco, CA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Karen Law Elina Kostyanovskaya 1 Department of Psychiatry and Behavioral Sciences, UCSF Weill Institute for Neurosciences, University of California San Francisco , San Francisco, CA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Elina Kostyanovskaya James Schmidt 1 Department of Psychiatry and Behavioral Sciences, UCSF Weill Institute for Neurosciences, University of California San Francisco , San Francisco, CA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for James Schmidt Cameron R. T. Exner 1 Department of Psychiatry and Behavioral Sciences, UCSF Weill Institute for Neurosciences, University of California San Francisco , San Francisco, CA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jeanselle Dea 1 Department of Psychiatry and Behavioral Sciences, UCSF Weill Institute for Neurosciences, University of California San Francisco , San Francisco, CA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jeanselle Dea Elise Brimble 2 Ciitizen , San Francisco, CA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Elise Brimble Matthew W. State 1 Department of Psychiatry and Behavioral Sciences, UCSF Weill Institute for Neurosciences, University of California San Francisco , San Francisco, CA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Matthew W. State A. Jeremy Willsey 1 Department of Psychiatry and Behavioral Sciences, UCSF Weill Institute for Neurosciences, University of California San Francisco , San Francisco, CA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Helen Rankin Willsey 1 Department of Psychiatry and Behavioral Sciences, UCSF Weill Institute for Neurosciences, University of California San Francisco , San Francisco, CA 3 Chan Zuckerberg Biohub – San Francisco , San Francisco, CA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Helen Rankin Willsey For correspondence: helen.willsey{at}ucsf.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF ABSTRACT The comorbidity of autism spectrum disorders and severe gastrointestinal symptoms is well-established, yet the molecular underpinnings remain unknown. The identification of high-confidence large-effect autism risk genes offers the opportunity to identify convergent, underlying biology by studying these genes in the context of the gastrointestinal system. Here we show that the expression of these genes is enriched in human prenatal gut neurons as well as their migratory progenitors, suggesting that the development and/or function of these neurons may be disrupted by autism-associated pathogenic variants, leading to gastrointestinal dysfunction. Here we document the prevalence of gastrointestinal issues in patients with large-effect variants in sixteen of these genes, highlighting dysmotility, consistent with potential enteric neuron dysfunction. Using the high-throughput diploid frog Xenopus tropicalis , we individually target five of these genes ( SYNGAP1, CHD8, SCN2A, CHD2 , and DYRK1A ) and observe disrupted enteric neuronal progenitor migration for each. More extensive analysis of DYRK1A reveals that perturbation causes gut dysmotility in vivo , which can be ameliorated by treatment with a selective serotonin reuptake inhibitor (escitalopram) or a serotonin receptor 6 agonist, identified by in vivo drug screening. This work suggests that atypical development of enteric neurons contributes to the gastrointestinal distress commonly seen in individuals with autism and that increasing serotonin signaling may be a productive therapeutic avenue. INTRODUCTION Autism Spectrum Disorders (ASD) are neurodevelopmental disorders defined by atypical social interactions, repetitive behaviors, and restricted interests 1 . One of the most prevalent and impairing comorbidities of ASD is gastrointestinal (GI) distress, commonly presenting as gastric motility symptoms like constipation, diarrhea, or abdominal pain 2 – 4 . Despite this well-established comorbidity, the underlying molecular mechanisms remain unknown. The discovery of high-confidence (hc), large-effect autism genes 5 has opened the door to studying these genes in vivo in order to identify the molecular origins of this co-occurrence. In the central nervous system, hcASD risk genes have been shown to converge in regulating the development of neural progenitor cells 6 – 13 , motivating the hypothesis that these genes may also contribute to the development of the enteric nervous system (ENS), the neurons that control the GI tract. Indeed, the role of one of the first identified large-effect autism genes, CHD8 , has been elaborated in zebrafish, where disruption of chd8 caused reduced colonization of enteric neurons into the gut as well as gut dysmotility 14 . Consistently, it has been shown that autism genes are enriched in expression in human adult enteric neurons 15 , the neurons controlling gastric motility 16 . Together, these findings raise the possibility that the observed comorbidity may be due to atypical development of the ENS. Here we document the prevalence of GI dysmotility in patients with pathogenic variants in hcASD genes, highlighting dysmotility, consistent with potential ENS dysfunction. These genes represent a wide swath of functional annotations and are highly pleiotropic, complicating efforts to establish direct links between molecular mechanisms and observed phenotypes 17 – 19 . A convergence neuroscience approach, where many genes are studied empirically in parallel and phenotypes and functions in common to multiple genes are considered more likely to be relevant to core biology, is one avenue to combat this challenge 17 – 19 . With this strategy in mind, we chose the model organism Xenopus tropicalis to study five hcASD genes representing disparate functional annotations in vivo to identify convergent phenotypes in the development of the ENS. These frogs have a simple diploid genome very similar to that of humans 20 , 21 , an elaborate, coiled GI system 22 , and the ability to perform unilateral genetic perturbations within an animal 6 , 20 , 23 – 25 . For all five gene perturbations individually ( SYNGAP1, CHD8, SCN2A, CHD2 , or DYRK1A ), we observe defects in embryonic enteric neuron progenitor migration. We further focus on the hcASD gene DYRK1A , which encodes a kinase, and show that it is also required for gut motility in vivo . With a targeted drug screen we identify the selective serotonin reuptake inhibitor escitalopram and a serotonin receptor 6 agonist that can each individually ameliorate this dysmotility. Together, these results suggest that ENS developmental defects may be a convergent, contributing factor to the comorbidity between autism and GI distress and that increasing serotonin signaling may be a productive therapeutic strategy. RESULTS hcASD gene expression is enriched in enteric neurons and their progenitors Previously, hcASD gene expression has been shown to be enriched in adult human enteric neurons 15 . To assess hcASD gene expression in this tissue during development, we analyzed scRNA sequencing data from a range of stages during human prenatal gut development 26 . All 252 hcASD genes with an FDR < 0.1 5 were expressed in the data set. We used Module Score Analysis (AddModuleScore, Seurat R Package) to calculate the average expression of these genes and their relative expression enrichment across cell types, compared to a comparably expressed random control geneset ( Fig. S1A-B ). hcASD gene expression enrichment was significantly higher in enteric neurons and their progenitors, enteric neural crest-derived cells (ENCCs), compared to all other cell types in the developing human prenatal gut ( Fig. 1A-B , padj < 0.0001 and padj < 0.0001, Kruskal-Wallis test followed by Wilcoxon Rank-Sum tests with Bonferroni adjustment for multiple comparisons). These results suggest that hcASD gene expression is enriched in both mature and developing enteric neurons. Download figure Open in new tab Figure 1. hcASD gene expression is enriched in ENS cells and individuals with pathogenic variants in these genes experience GI issues. (A) Enrichment of 252 hcASD genes is higher in Enteric Neuron Progenitors (ENCCs) and Enteric Neurons compared to all other cell types in single-cell RNA-sequencing data from the human prenatal gut 26 . (B) 252 hcASD genes are enriched in ENCCs and Enteric Neurons compared to all other Non-ENS cells in the human prenatal gut. A Kruskal-Wallis test was performed, followed by Wilcoxon rank-sum tests and Bonferroni adjustment for multiple comparisons. ****padj < 0.0001. (C-E) The number of individuals affected and the total number of people surveyed is tallied at the end of each bar. (C) Simons Searchlight data documenting the percentage of affected individuals (teal bars) and their unaffected family members (gray bars) who reported GI issues in caregiver surveys. (D) Ciitizen® medical record data showing the percentage of individuals with a SYNGAP1, SCN2A, CHD2, STXBP1 or SLC6A1 genetic variant with medical record diagnoses related to GI dysmotility. (E) Ciitizen® medical record data by variant for dysmotility phenotypes including constipation, abdominal pain, and diarrhea. Prevalence of GI dysmotility among patients with hcASD gene variants Recently Simons Searchlight has compiled caregiver survey data for patients with large-effect variants in autism-associated genes and loci, as well as often for unaffected family members 27 . Within these data, we identified any patient with a genetic variant in one of the 252 hcASD risk genes. Nineteen genes were represented, with sixteen genes having more than ten affected individuals. Of these sixteen genes, seven are within the ten highest-associated hcASD genes (FDR < 0.01; SYNGAP1, CHD8, ADNP, SCN2A, FOXP1, CHD2, GRIN2B ) 5 . All sixteen patient cohorts had caregiver-reported GI symptoms (average prevalence = 51.7%), while few unaffected family members did (average prevalence = 0.4%). To dive more deeply into the specific nature of these GI symptoms, we identified any patient in the Ciitizen ® medical record database with a genetic variant in a hcASD gene. Medical record data were available for 5 hcASD genes: SYNGAP1 (n = 186 patients), SCN2A (n = 58 patients), CHD2 (n = 41 patients), SLC6A1 (n = 49 patients), and STXBP1 (n = 80 patients). For all of these cohorts, over 80% of individuals had medical record diagnoses related to GI symptoms ( Table S1 ), consistent with caregiver reports for similar cohorts in Simons Searchlight described above. Of these diagnoses, GI dysmotility symptoms, particularly constipation, were reported in medical records for over 60% of individuals among all cohorts ( Fig. 1D-E ). Since GI motility is controlled by the ENS 28 , these observations are consistent with the possibility that variants in these genes disrupt ENS development and/or function, leading to gut dysmotility. hcASD gene variants disrupt ENS migration in vivo Next we next aimed to examine the role of hcASD genes in the development of the ENS in vivo . ENS progenitors (ENCCs) are exclusively derived from the neural crest and migrate into the gut during embryonic development 29 . To study the role of hcASD genes in the development of these cells in vivo , we adapted the vertebrate diploid frog model Xenopus tropicalis , where parallel in vivo analysis of hcASD genes during embryogenesis is possible. Specifically, we visualized the ENCCs by whole-mount RNA in situ hybridization for their marker gene phox2b 16,30 ( Fig. 2A ) during embryogenesis following perturbation of hcASD genes by unilateral CRISPR/Cas9 mutagenesis, comparing the mutated half of the animal to the contralateral control side ( Fig. 2B ). We chose to perturb 5 of the 20 highest-associated hcASD genes 5 with disparate functional annotations (neurotransmission: SYNGAP1 and SCN2A , chromatin regulation: CHD2 and CHD8 , and kinase activity: DYRK1A ) by individually injecting Cas9 protein with a previously validated sgRNA 6 into one cell of two-cell stage embryos. We hypothesized that phenotypes observed in all of these five mutants are more likely to be relevant to the core underlying biology of the ASD/GI comorbidity, and less likely to be a byproduct of pleiotropy. The phenotype we observed for all five gene perturbations was a significant reduction in ENCC migration area, which was not observed in control animals injected with Cas9 protein and a sgRNA targeting a pigmentation gene slc45a2 ( Fig. 2C-D ). This result was comparable for all five hcASD gene perturbations, irrespective of the gene’s annotated cellular function, suggesting functional convergence in the process of ENCC migration. Download figure Open in new tab Figure 2. hcASD gene depletion in vivo causes ENCC migration defects. (A) Schematic of phox2b staining in NF stage 40 animals to mark enteric neural crest-derived cells (ENCCs, enteric neuron progenitors) in the gut, circled by a red dashed line. (B) Unilateral mutants were made by injecting the Cas9 protein and an sgRNA targeting an hcASD gene into one cell at the two-cell embryonic stage. Three days later, injected embryos were stained and ENCC area and gut area was measured on each side of the animal and compared to quantify relative gut area (CRISPR side / Control side) of migration. (C) Individual CRISPR mutagenesis of hcASD genes syngap1, chd8, scn2a, chd2 , or dyrk1a reduce the area of ENCC migration in the gut compared to control mutagenesis of pigmentation gene slc45a2 . (D) Area of gut migration quantification by target gene. Control in gray, hcASD genes in red. A Kruskal-Wallis test was performed followed by Wilcoxon matched-pairs signed rank test to compare the CRISPR side to the control side within each animal and a Holm-Šídák test to adjust for multiple comparisons. ns (not significant) indicates padj > 0.05, **padj < 0.01, ***padj < 0.001. Depletion of dyrk1a disrupts neural crest development and ENCC migration Next we elaborated this finding for dyrk1a in Xenopus , given our previous experience perturbing this gene within the central nervous system and the abundance of associated molecular tools 6 , 25 , 31 , 32 . We observed that dyrk1a is expressed in ENCCs during migration ( Fig. S2A ) and persists in mature enteric neurons ( Fig. S2B-C ), particularly at the primary cilium, an organelle required for ENCC migration 33 . As additional validation that our CRISPR-mediated disruption of dyrk1a was specific to this gene, we also perturbed dyrk1a in two additional ways. First, we depleted Dyrk1a protein with a validated translation-blocking morpholino 25 , 31 and observed the same phenotype as the CRISPR perturbation ( Fig. 3A-B ). Second, we used a pharmacological approach to inhibit Dyrk1a by targeting its kinase activity, raising embryos in either of two Dyrk1a inhibitors TG003 34 and harmine 35 , which similarly caused a reduction in ENCC migration ( Fig. 3A-B , Fig S3B ). These results show that dyrk1a is required for proper embryonic ENCC migration in Xenopus . Download figure Open in new tab Figure 3. hcASD gene dyrk1a perturbation reduces ENCC migration and decreases gut motility in vivo . (A) dyrk1a perturbation through CRISPR injection, morpholino (MO) injection, or Dyrk1a inhibitor (TG003) treatment all reduce the area of ENCC migration in the gut compared to control CRISPR, control MO, or vehicle control (DMSO). (B) Area of gut migration quantification by condition. For injection comparisons, a Two-Way ANOVA was performed followed by Wilcoxon matched-pairs signed rank test to compare the CRISPR or morpholino side to the control side within each animal and a Holm-Šídák test to adjust for multiple comparisons. p values are from paired t tests, in which ns (not significant) indicates padj > 0.05, dyrk1a CRISPR padj = 0.0094, dyrk1a MO padj < 0.0001. For small molecule treatment, an unpaired student’s one-tailed t-test was performed after testing for normality to compare DMSO to 5 µM TG003-treated embryos. TG003 p = 0.0012. (C) Schematic of the in vivo gut motility assay. At NF stage 47, tadpoles were fed food with fluorescent beads for 2 hours, then placed in a 6-well plate in 3D-printed baskets with 20 animals/well for 3 hours. Tadpoles are then removed by taking out baskets and leaving excrement with fluorescent beads behind, after which the plates were imaged to count the number of beads per well. Created with BioRender.com . (D) Developmental inhibition of Dyrk1a (TG003-treated beginning at NF 20) results in decreased fluorescent bead excretion compared to vehicle control (DMSO). Representative images of fluorescent beads (false-colored black). (E) Number of fluorescent beads per well counted for DMSO and TG003 (Dyrk1a inhibitor) wells. Wilcoxon rank-sum test, p = 0.002. ENCCs develop exclusively from the neural crest 29 , 36 , and our group and others have observed dyrk1a expression in the Xenopus neural crest 25 , 31 , 32 . Therefore, this migration phenotype could be due to earlier neural crest developmental defects. Indeed, by CRISPR or morpholino perturbation, we observed defects in the early neural crest marker sox10 37,38 at NF stage 15 by whole-mount RNA in situ hybridization ( Fig. S3A ). This indicates that Dyrk1a is required earlier in the embryo for neural crest development, a finding that is corroborated by a recent preprint 32 . To separate the roles of Dyrk1a early in neural crest development and later in ENCC migration, we took advantage of the ability to conditionally inhibit Dyrk1a by pharmacological inhibition after neural crest specification is complete, at the onset of vagal neural crest migration 39 ( Fig S3B ). When we inhibited Dyrk1a with either TG003 or harmine 35 at the onset of migration (NF stage 25), ENCC migration was still disrupted and to a similar extent as it was by CRISPR perturbation, or compared to our positive control Ret inhibitor, a model of Hirschsprung’s Disease 40 , 41 ( Fig S3C-D ). This was in contrast to the negative control treatments DMSO or moclobemide, a MAO inhibitor that controls for a potential off-target effect of harmine 42 . Together, these results suggest that dyrk1a , while required for early neural crest development, is also independently required for ENCC migration in Xenopus . Depletion of Dyrk1a decreases gut motility in vivo We next assessed whether inhibition of Dyrk1a during development affects gut motility in vivo . As seen above, gut dysmotility in the form of constipation is common among patient cohorts for several hcASD risk genes. To assess gut transit in Xenopus , we developed an in vivo gut motility assay where mature tadpoles (NF stage 47) were fed food with 6 µm fluorescent beads for 2 hours, rinsed out of the food and placed in baskets in 6-well plates to defecate for 3 hours, and then taken out by removing the baskets while leaving the excrement and fluorescent beads behind ( Fig. 3C ). The plates were then imaged with a fluorescence microscope and the number of fluorescent beads per well was counted in Fiji. Each well contained 20 tadpoles and each condition was completed in triplicate. To test the role of Dyrk1a in gut motility in viv o, we raised animals in the Dyrk1a inhibitor TG003 or in control DMSO solution (starting at NF stage 20) and then performed the in vivo gut motility assay at mature tadpole stage (NF stage 47). There was a significant decrease in the number of fluorescent beads excreted in animals treated with the Dyrk1a inhibitor, compared to the DMSO control-treated tadpoles (p = 0.002, Wilcoxon Rank-Sum test) ( Fig. 3D-E ). This result suggests that developmental Dyrk1a inhibition in vivo causes gut dysmotility in Xenopus tadpoles. Serotonin reuptake inhibitor treatment rescues gut dysmotility following Dyrk1a inhibition Serotonin signaling is known to control enteric neuron activity and gut motility 43 . Therefore, we selected 8 FDA-approved drugs that impact serotonin signaling at various points in the pathway ( Fig. 4A ) and tested whether acute treatment alters gut movement with our in vivo gut motility assay in unmanipulated mature tadpoles. Of these drugs, at the concentration we tested (10 µM), only the selective serotonin reuptake inhibitor (SSRI) escitalopram oxalate was able to promote gut motility greater than 1 standard deviation compared to negative control treatment DMSO ( Fig. 4B ). Escitalopram oxalate (also known as Lexapro) is a common SSRI that interacts with SERT, the serotonin transporter, to inhibit the reuptake of serotonin into the presynaptic cell, thereby prolonging serotonin pathway activation ( Fig. 4A ). This result is consistent with previous studies in which activating or prolonging active serotonin signaling promotes gut motility in mammals 44 – 47 . Download figure Open in new tab Figure 4. Dyrk1a-associated gut dysmotility is ameliorated by acute exposure to an SSRI or 5-HTR6 agonist. (A) Schematic of a serotonergic synapse labeling the presumed location of action for the drugs tested. Created with BioRender.com (B) Acute exposure to escitalopram oxalate (selective serotonin reuptake inhibitor, SSRI) alone increases the average number of fluorescent beads excreted more than one standard deviation compared to the average DMSO treatment, blue. (C) Both acute treatment of an SSRI (10 µM escitalopram oxalate) or a 5HTR6 agonist (10 µM WAY-181187) rescue the decreased fluorescent bead excretion from developmentally inhibited Dyrk1a (5 µM TG003 starting at stage NF 20) animals. (D) Fluorescent beads per well quantified for each treatment condition. A one-way ANOVA was performed followed by unpaired one-tailed t tests with welch’s correction compared to TG003 treatment, DMSO p = 0.002, TG003 + SSRI p = 0.0423, TG003 + WAY-181187 p = 0.0033. (E) Model of how hcASD gene large-effect variants could contribute to GI dysmotility. An hcASD genetic variant leads to perturbed ENCC migration and ultimately GI dysmotility. Created with BioRender.com Next we tested whether this SSRI could acutely rescue the effects of developmental Dyrk1a inhibition on gut motility. In addition to this SSRI, we concurrently tested a more specific activator of serotonin signaling, an agonist for serotonin receptor 6 (5-HTR6) (WAY-181187 48 ). We included this drug because both Dyrk1a and serotonin receptor 6 specifically localize to primary cilia 49 ( Fig. S2C-D ). To test these compounds, we raised tadpoles in DMSO or TG003 (Dyrk1a inhibitor) and performed our in vivo gut motility assay, adding 10 µM escitalopram oxalate or WAY-181187 to a portion of the TG003-treated animals acutely during the 3-hour excretion portion of the assay. Acute exposure to either of these compounds rescued the decreased motility phenotype of the Dyrk1a inhibitor-treated animals, restoring excretion to that comparable to the DMSO control ( Fig. 4C-D ). Therefore, these results suggest that Dyrk1a-associated gut dysfunction can be ameliorated by acute treatment with an SSRI or, more specifically, with a 5-HTR6 agonist. Together, our work suggests a model ( Fig. 4E ) in which ASD genetic variants cause atypical ENCC development, leading to GI dysmotility, and suggests serotonin signaling as a potential therapeutic pathway. DISCUSSION The co-occurrence of autism and GI issues is well-established 2 , yet the molecular mechanisms underlying this comorbidity remain unclear. Here we document the prevalence of GI issues in individuals with variants in hcASD genes, particularly highlighting constipation, a symptom of GI dysmotility. Our group and others have shown that many hcASD genes converge to regulate neuronal development in the central nervous system 6 – 13 , motivating us to consider whether these genes also contribute to the development of the ENS. Consistently, we observe that hcASD gene expression is enriched in both enteric neurons and their migrating progenitor cells during human embryonic development. Therefore, to test this hypothesis, we use a vertebrate in vivo model to individually perturb five hcASD genes with disparate functional annotations (neurotransmission, chromatin regulation, kinase activity). We observe disrupted ENCC migration for each, suggesting that atypical ENCC migration may contribute to GI dysmotility in ASD. We further investigate the role of Dyrk1a in gut motility and observe that Dyrk1a perturbation leads to a decrease in excretion that can be restored by acute exposure to agonists of serotonergic signaling. This work adds to a growing literature suggesting that variants in ASD genes perturb ENS development 3 , 50 , consistent with work done in zebrafish for CHD8 14 and in mice for FOXP1 51 and PTEN 52 . While a fish study of SHANK3 did not observe a significant change in gut neuron number 53 , this group did identify disrupted serotonergic signaling in the gut, consistent with our findings that manipulating serotonin signaling could be a potential therapeutic avenue. Indeed, the role of serotonin signaling in gut motility is well-established 44 – 47 , so this pathway could be productively exploited in the context of ASD more broadly for treating GI issues. Moving forward, other key questions remain including how ASD gene variants affect enteric neuron number, differentiation, organization, morphology, and activity in mature animals. The effect of gene dosage on these parameters will also be an important future direction, as here we characterized strong loss of function for these genes, while individuals with pathogenic variants in these genes are heterozygous. Impaired ENCC migration is a central observation of our study, consistent with previous work in an assembloid model suggesting that neuron migration may be a convergent process disrupted in neurodevelopmental disorders 54 . Interestingly, we observed that ENCC migration is affected by perturbation of genes known for their roles in neurotransmission ( SYNGAP1, SCN2A ). Similar to our previous findings in Xenopus central nervous system development 6 that have been recently validated in human cortical organoids 13 , this work suggests that these genes may have additional roles beyond neurotransmission during ENS development. Recently, several of these neurotransmission proteins have been shown to localize to the cilium 55 , an organelle known to be required specifically for ENCC migration into the gut 33 . Here we show that Dyrk1a localizes to the primary cilium in enteric neurons in Xenopus ( Fig. S2C ). It is also known that serotonin receptor 6 (5-HTR6) specifically localizes to the cilium in neurons 49 . Here we show that acute exposure to a 5-HTR6 agonist is able to increase gut motility and rescue a Dyrk1a model of dysmotility. Given the role of serotonin in gut motility and development 56 , a productive area of future investigation will be to understand how ASD gene variants perturb primary cilia in the development and function of the ENS. In summary, this work documents the prevalence of gut dysmotility, particularly constipation, in many individuals with large-effect variants in hcASD genes. Disruption of five hcASD genes convergently impacts ENCC migration in Xenopus , and, based on the study of Dyrk1a, this disruption may underlie the gut dysmotility seen in affected individuals. It will be important future work to determine the extent to which perturbations of other hcASD genes also result in gut dysmotility, and whether serotonin activation can also ameliorate any observed phenotypes. If this finding holds for many hcASD genes, investigating the therapeutic potential of serotonin activation for restoring gut motility in affected individuals may be a productive endeavor. MATERIALS AND METHODS Simons Searchlight and Ciitizen® Patient Data Analysis Research with Simons Foundation Autism Research Initiative (SFARI) Simons Collection (Searchlight) data and with Ciitizen® medical record data was determined to be non-human subjects research by UCSF IRB office, IRB#23-39-079. Unaffected family and affected individual GI data was accessed through the Simons Searchlight Single Gene Dataset v8.0. All data was used from families with any genetic variant in a hcASD gene, as defined by Fu et al. 2022 5 with an FDR < 0.1. Patient GI data was additionally accessed from Ciitizen®. Patients were included if they possessed a genetic variant that was classified on their genetic report as ‘pathogenic’, ‘likely pathogenic’, or ‘variant of uncertain significance’. Individuals with ‘benign’ variants in a hcASD gene were excluded. Individuals with a ‘variant of uncertain significance’ in a hcASD gene in addition to a ‘pathogenic’ variant in a non-ASD gene were also excluded. Data analysis and visualization were performed in Prism (v.10.1.1) software. Human prenatal intestine scRNA-sequencing analysis and enrichment scoring First, scRNA-seq FASTQ files of human prenatal intestine (ArrayExpress: E-MTAB-9489 26 ) were downloaded from ArrayExpress and processed by Cell Ranger (GRCh38). Following the standard Seurat analysis pipeline, we read the gene-barcode matrix outputs of all samples and filtered out low quality cells that had > 10% mitochondrial counts and unique feature counts over 2,500 or less than 200, leaving 39,095 cells. Normalization was then done with the gene-barcode matrix with method LogNormalize that normalized each cell by total expression and multiplied by the default scale factor (10,000). 2,000 highly variable genes of each sample were identified with function FindVariableFeatures then all samples were integrated with method IntegrateData to form a combined Seurat object for downstream analysis. Integrated object was then scaled and Principal Component Analysis was performed for dimensional reduction. FindNeighbors and FindClusters were used to compute cell clusters of the object. Next, identification of cell clusters was performed using gene markers from Elmentaite et al. 2020 57 in addition to ENCC markers ( SOX10, FOXD3, PHOX2B ) and enteric neuron markers ( TUBB3, ELAVL4, RET ) to finalize cell annotations. To assess enrichment of hcASD genes, AddModuleScore function was performed for the 252 hcASD genes from Fu et al. 2022 and compared against a control geneset with equivalent average expression across all cells. Each cell received a module score and was then grouped based on cell annotation as described above. A cell expressing hcASD genes higher than the control geneset received a score > 0, while a cell expressing the control geneset higher than the hcASD genes had a score of < 0. Cells were then grouped into Non-ENS cells, ENCCs, and enteric neurons based on the above clustering. Next we tested whether ENCCs and enteric neurons had significantly higher hcASD gene expression enrichment scores, compared to all other cells by a Kruskal-Wallis test, followed by Wilcoxon rank-sum tests and Benjamini-Hochberg adjustment for multiple comparisons. The enrichment of these genes in each cluster or group was plotted using VlnPlot. Xenopus husbandry Xenopus laevis or tropicalis adults originated from the National Xenopus Resource Center and the Khokha Lab. Animals used were of wildtype lines of both sexes. Animals were housed in a recirculating system and were maintained in accordance with approved UCSF IACUC protocol AN199587-00A. Ovulation was induced with human chorionic gonadotropin (Sigma CG10), and embryos were collected and manipulated according to standard procedure 58 . Gut motility experiments were done in Xenopus laevis , while migration experiments were done in Xenopus tropicalis . Xenopus tropicalis microinjections and loss of function A Narishige micromanipulator, Parker or Narishige Picospritzers, and Zeiss Stemi508 microscopes were used to microinject reagents into 1 cell of 2-cell stage embryos. For morpholino injections, 2 nl injection volume of each condition was measured using an eyepiece micrometer, delivering 5 ng of the morpholino per blastomere. Embryos were injected and grown at 20-25°C in 1/9 Modified Ringer’s (MR) solution. Published and validated translation-blocking dyrk1a morpholino (5′ TGCATCGTCCTCTTTCAAGTCTCAT 3′) 25 , 31 was compared against a standard control morpholino (5’ CCTCTTACCTCAGTTACAATTTATA 3’, GeneTools). For CRISPR, we synthesized (EnGen, NEB E3322S) and purified (Zymo R1018) validated sgRNAs 6 and injected 400 pg of sgRNA and 2.24 ng of Cas9-NLS protein (UC Berkeley MacroLabs 59 ) into 1 cell of 2-cell stage X. tropicalis embryos. The exceptions to this are syngap1 and corresponding slc45a2 control where embryos were injected with 800 pg of sgRNA and 4.48 ng of Cas9-NLS protein, since the syngap1 sgRNA is of lower mutational efficiency. Injection volume was measured using an eyepiece micrometer and embryos were incubated at 27°C for 1 hour immediately after injection and then grown at 20-25°C in 1/9 MR solution. Xenopus whole-mount RNA in situ hybridization All embryos were fixed in MEMFA for 1 hour and stained according to Willsey et al 2021 60 using anti-DIG (1:3000, Sigma 11093274910) and BM Purple (Sigma 11442074001). phox2b probe plasmid was a kind gift from the Harland lab (IMAGE clone #8956276, probe synthesis with T7 enzyme and EcoR1 restriction enzyme), and sox10 probe was previously described 6 . The stainings were performed in a high-throughput basket format with 200 µm mesh in 3D-printed racks 60 , 61 . All embryos were imaged on a Zeiss AxioZoom.V16 with a 1x objective and extended depth of focus processing in Zeiss Zen software. For hybridization chain reaction (HCR) 62 , embryos were stained according to Willsey et al 2021 60 , with an additional step of heating probes to 95°C for 90 seconds and cooling to room temperature before use. dyrk1a and phox2b probes were custom ordered through Molecular Instruments and designed to target the X. tropicalis genes. Embryos were imaged on a Zeiss 980 LSM with a 63x oil objective, Airyscan processed and Maximum Intensity Projection performed in Zen or on a Zeiss AxioZoom.V16 with a 1x objective and extended depth of focus for full-embryo imaging. Drug treatment Dyrk1a inhibitor (TG003, Sigma T5575) and MAO inhibitor control (Moclobemide, Sigma M3071) were resuspended in DMSO at 10 mM. Dyrk1a inhibitor (harmine, Sigma 286044) and Ret inhibitor (PP1, Sigma P0040) were resuspended in DMSO at 1 mM. Embryos were treated with drug or an equal volume of DMSO, diluted in 1/9 MR, at NF stage 25 and fixed at NF stage 40 for RNA in situ hybridization staining. Media was not refreshed while embryos were growing. For the serotonin gut motility screen (see below), selected drugs from an FDA-approved drug library (Enzo Life Sciences BML-2843-0100) were tested at 10 µM alongside an equal volume of DMSO diluted in 1/3 MR. Gut motility assay All gut motility assays were performed in Xenopus laevis , since pilot studies showed they excrete more than X. tropicalis (they are larger animals), which was enough to be able to reliably quantify bead number per well from 20 animals. Since these experiments are all drug treatments and not genetic perturbations, the advantages of the X. tropicalis diploid genome are less critical. Xenopus laevis embryos were collected and raised for 9 days at room temperature until NF stage 47. At the beginning of the gut motility assay, tadpoles were moved into 15 cm dishes containing 20 mL of 1/3 MR. Food was prepared by resuspending 1 g of sera micron (Sera 00720) in 45 mL of 1/3 MR with 30 µL of 6 µm fluorescent bead solution (Polysciences 18862-1) added, similarly to what has previously been used to assay gut motility in zebrafish 53 . 2.5 mL of the food suspension was added to each 15 cm dish for each condition. Tadpoles were left to feed for 2 hours and then rinsed in a homemade mesh (Spectra Mesh 100 µm and 200 µm, 146488 and 146487) trough in a glass dish (Grainger 900203). Using a vacuum, media was removed while fresh 1/3 MR was added until the media was clear of food and beads. Tadpoles were moved from the mesh trough using a plastic pipette into a fresh 15 cm dish. They were then transferred to a 6-well plate with homemade 3D-printed baskets with lattice bottoms inserted into each well. 20 tadpoles were allotted into each basket. After defecating for 3 hours, baskets with tadpoles were removed from each well, leaving excretion with fluorescent beads in the well. All plates were left in the dark at 4°C overnight to let all matter sink to the bottom of the plate. Then, plates were tile-imaged in the same position on a Zeiss AxioZoom.V16 with a 1x objective and analyzed in Fiji. When raising animals in Dyrk1a inhibitor, TG003 or equivalent volume of DMSO was added to 1/3 MR to make it a 5 µM TG003 solution. 75 NF stage 20 X. laevis embryos were treated for each condition. For the serotonin screen, tadpoles were raised only in 1/3 MR until the 3-hour defecation period, at which point they were acutely exposed to 10 µM of each compound individually. For the rescues, animals were grown in DMSO or 5 uM TG003 starting at stage 20. At stage 47, animals were removed from drug solution and fed beads in 1/3 MR as above. Following feeding, animals were left to defecate either in 1/3 MR or in 10 µM SSRI or 5-HTR6 drug solution in 1/3MR. Image Processing and Statistical Analyses All images were processed in FIJI (NIH) and arranged in Illustrator (Adobe). For ENCC quantification, the area of ENCCs and total gut area were both measured by drawing with the free-hand selection tool and quantified with the measure function. The ENCC area was normalized to the total gut area. Tests for normality were performed in Prism (GraphPad) followed by an ANOVA or Kruskal-Wallis test as appropriate. For unilateral mutagenesis, multiple paired t tests were performed to compare the uninjected and injected sides of each embryo per condition and then adjusted for multiple comparisons with the Holm-Šídák method. For small molecule experiments, a one-way ANOVA or Kruskal-Wallis test was used as appropriate based on normality tests, followed by an unpaired t test or a Wilcoxon rank-sum test. For gut motility image analysis, tiled images were analyzed in FIJI with a macro to Find Maxima (Prominence > 60, Output type: Count) in each well of a 6-well plate. Counts were imported into Prism and standard deviation was calculated for control treatments. For comparing between DMSO, TG003 and rescue treatments, all conditions passed normality and a one-way ANOVA was performed followed by unpaired one-tailed t tests with Welch’s correction. Cell culture and transfection HEK293T cells were cultured in 96-well plate format in DMEM (Cat # 11995040) + 10% Fetal Bovine Serum, incubated at 37°C, 5% CO2 on poly-D-lysine coated plates (0.1 mg/mL solution, 50 µL per well). 25,000 HEK293T cells were seeded per well 24 hours prior to transfection. HEK293T cells were fed with fresh media 1 hour before transfection and transfected with 200 ng of GFP-tagged human DYRK1A cDNA in a pcDNA3.1+GFP plasmid backbone (GenScript, cloned from DYRK1A accession # NM_001396 ). 200 ng of plasmid DNA was diluted in 10 µL of DMEM and combined with 0.6 µL of PolyJet transfection reagent diluted in 10 µL. The DNA and transfection reagent were incubated for 10 minutes at room temperature and added dropwise to cells. After 48 hours, cells were fixed with 4% PFA for 10 minutes, washed with three times PBS, and stored at 4°C for further processing. Immunofluorescence staining For NF stage 45 samples, Immunostaining was performed according to Willsey et al 2021 60 with the omission of the bleaching step as it was found to add bubbles that affected GI morphology. Phalloidin (1:400, Life Tech A34055) and DAPI (1:400) were added during the secondary antibody step. Primary antibodies used were against Dyrk1a (1:100, ThermoFisher A303-802A) or Acetylated a-Tubulin (1:200, Abcam ab179484). Secondary antibodies (Abcam ab150177, Thermofisher A32733) were diluted at 1:250. Embryos were imaged on a Zeiss 980 LSM with a 63x oil objective, Airyscan processing and Maximum Intensity Projection were performed in Zen. HEK293T cells (cultured on coverslips and fixed as described above) were permeabilized with PBST (1X PBS at pH 7.4 containing 0.2% Triton X-100) three times for 5 minutes. Cells were blocked with 2% BSA (US biological BSA in PBST) for 1 hour at room temperature. Primary antibodies were diluted into 2% BSA and cells were incubated at 4°C overnight. Antibodies used were ARL13B (1:2000, ProteinTech 17711-1-AP) and β-Tubulin (1:500, Invitrogen 32-2600). Following primary antibody incubation, cells were washed three times for 5 minutes in PBST, protected from light. Secondary antibodies (Thermo A32732 or Thermo A32728) were diluted at 1:250 in 2% BSA, and DAPI was included in this secondary incubation at 1:1000. Cells were incubated for 1 hour at room temperature, protected from light. Stained cells were washed with PBST three times for 3 minutes and with 1X PBS two times; cells were stored at 4°C. Cells were imaged on a Zeiss 980 LSM with a 63x oil objective, Airyscan processing was performed in Zen. Maximum intensity projection was performed in FIJI. FUNDING This work was supported by a grant from the National Institutes of Mental Health (U01MH115747 to A.J.W and M.W.S) and an investigator award from the Chan Zuckerberg Biohub - San Francisco (to H.R.W.). AUTHOR CONTRIBUTIONS Conceptualization: KEM, HRW, AJW, MWS Methodology: KEM, HRW, AJW, KMS, KL, CRTE Validation: KEM Formal Analysis: KEM, KL, EB Investigation: KEM, EK, JS, CRTE, JD Resources: HRW, AJW, MWS, EB Writing – Original Draft: KEM Writing – Review & Editing: HRW, KEM, AJW, MWS Visualization: KEM, HRW, EK Supervision: HRW, MWS, AJW Project Administration: HRW Funding Acquisition: AJW, HRW, MWS COMPETING INTERESTS The authors do not have any competing interests. DATA AND MATERIALS AVAILABILITY The hcASD gene list is publically available 5 . Ciitizen® medical record data is available with proper IRB approval from Ciitizen® ( www.ciitizen.com ). Approved researchers can obtain the Simons Searchlight population dataset described in this study by applying at https://base.sfari.org SUPPLEMENTAL FIGURES Download figure Open in new tab Figure S1. hcASD gene expression enrichment in human prenatal gut transcriptomic dataset. Related to Figure 1 . (A) UMAP of human prenatal gut scRNA-sequencing data 26 . Cells colored according to enrichment of hcASD gene module scores. Enteric neurons and ENCCs are outlined in a red rectangle and enlarged to the right. (B) The expression patterns of two marker genes SOX10 (neural crest) and PHOX2B (vagal neural crest, ENCCs, and enteric neurons) to show cell-type identities for these populations. Download figure Open in new tab Figure S2. dyrk1a is expressed in ENCCs and Dyrk1a localizes to microtubule-based structures. Related to Figure 2 . (A) RNA in situ hybridization chain reaction staining shows dyrk1a (green) expression in phox2b -positive (magenta) ENCCs in X. tropicalis , stage 40. Bottom panel shows a high magnification image of dyrk1a mRNA transcripts within a single phox2b -positive cell. (B) Immunofluorescence staining shows Dyrk1a (green) localizing to enteric neuron projections in X. tropicalis as marked by Acetylated a-Tubulin (white). (C) Immunofluorescence staining shows Dyrk1a (green) localizing to the primary cilium of an enteric neuron in X. tropicalis as marked by Acetylated a-Tubulin (yellow). (D) Overexpression of human DYRK1A-GFP plasmid shows localization of human Dyrk1a (green) to the primary cilium of HEK293T cells as marked by Arl13b (white). Download figure Open in new tab Figure S3. dyrk1a is independently required for early neural crest development and for later ENCC migration. Related to Figure 3 . (A) Perturbation of dyrk1a with either CRISPR or morpholino (MO) injection results in an increased proportion of moderate and severe early (stage 15) neural crest phenotypes compared to controls. Migratory neural crest was visualized with RNA in situ hybridization staining for sox10 at NF stage 15. There are significantly more moderate and severe phenotypes in dyrk1a CRISPR and MO embryos than controls (Fisher’s exact test, CRISPR p = 0.02, MO p < 0.0001). (B) Schematic of assay to uncouple early neural crest development disruption from later ENCC migration. Tadpoles are raised unperturbed until NF stage 25 when the vagal neural crest begins migration. They are then treated with a Dyrk1a inhibitor or control small molecule and fixed and stained at NF stage 40 to assay ENCC migration. Created with BioRender.com (C) Treatment with Dyrk1a inhibitors harmine or TG003 as well as positive control Ret inhibitor PP1 lead to reduced ENCC migration separately from neural crest specification, compared to DMSO and moclobemide controls. Moclobemide is a monoamine oxidase inhibitor that controls for potential off-target inhibition of monoamine oxidase by harmine. Xenopus illustrations © Natalya Zahn (2022) 63 (D) Area of gut migration quantification by condition. Controls in gray, Dyrk1a inhibitors in red. A One-Way ANOVA was performed followed by a Holm-Šídák test to adjust for multiple comparisons. p values are from paired t tests, in which ns (not significant) indicates padj > 0.05. Compared to DMSO, PP1 padj < 0.0001, harmine padj < 0.0001, TG003 padj = 0.0046, and compared to moclobemide, harmine padj < 0.0001. Table S1. Summary tables of patient GI symptoms from Ciitizen® records for individuals with variants in SYNGAP1, SCN2A, CHD2, STXBP1 , or SLC6A1 . ACKNOWLEDGEMENTS We are grateful to all the families at the participating Simons Searchlight sites as well as the Simons Searchlight Consortium, formerly the Simons VIP Consortium. We appreciate obtaining access to Simons Searchlight phenotyping data on SFARI Base. We thank Nolan Wong, Louie Ramos, and UCSF LARC for animal care; Juan Arbelaez and Ethel Bader for lab maintenance and support; Hasan Alkhairo for coding discussions; Edivinia Pangilinan for expert technical help; and Ashley Clement, Gigi Lopez, Sonia Lopez and Linda Chow for administrative support. This work would not be possible without daily reference to the Xenopus community resource Xenbase (RRID:SCR_003280) and expertise and frog resources from the National Xenopus Resource (RRID:SCR_013731). REFERENCES 1. ↵ Hughes , M. M. et al. The Prevalence and Characteristics of Children With Profound Autism, 15 Sites, United States, 2000-2016 . Public Health Rep . 138 , 971 – 980 ( 2023 ). OpenUrl 2. ↵ McElhanon , B. O. , McCracken , C. , Karpen , S. & Sharp , W. G. Gastrointestinal symptoms in autism spectrum disorder: a meta-analysis . Pediatrics 133 , 872 – 883 ( 2014 ). OpenUrl CrossRef PubMed 3. ↵ Wang , X. et al. The enteric nervous system deficits in autism spectrum disorder . Front. Neurosci . 17 , 1101071 ( 2023 ). OpenUrl 4. ↵ Wasilewska , J. & Klukowski , M. Gastrointestinal symptoms and autism spectrum disorder: links and risks – a possible new overlap syndrome . Pediatric Health, Medicine and Therapeutics 6 , 153 – 166 ( 2015 ). OpenUrl 5. ↵ Fu , J. M. et al. Rare coding variation provides insight into the genetic architecture and phenotypic context of autism . Nat. Genet . 54 , 1320 – 1331 ( 2022 ). OpenUrl PubMed 6. ↵ Willsey , H. R. et al. Parallel in vivo analysis of large-effect autism genes implicates cortical neurogenesis and estrogen in risk and resilience . Neuron 109 , 788 – 804 .e8 ( 2021 ). OpenUrl CrossRef 7. Satterstrom , F. K. et al. Large-Scale Exome Sequencing Study Implicates Both Developmental and Functional Changes in the Neurobiology of Autism . Cell 180 , 568 – 584 .e23 ( 2020 ). OpenUrl CrossRef PubMed 8. Li , M. et al. Integrative functional genomic analysis of human brain development and neuropsychiatric risks . Science 362 , ( 2018 ). 9. Polioudakis , D. et al. A Single-Cell Transcriptomic Atlas of Human Neocortical Development during Mid-gestation . Neuron 103 , 785 – 801 .e8 ( 2019 ). OpenUrl 10. Fan , X. et al. Spatial transcriptomic survey of human embryonic cerebral cortex by single-cell RNA-seq analysis . Cell Res . 28 , 730 – 745 ( 2018 ). OpenUrl CrossRef 11. Willsey , A. J. et al. Coexpression networks implicate human midfetal deep cortical projection neurons in the pathogenesis of autism . Cell 155 , 997 – 1007 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 12. Weinschutz Mendes , H. et al. High-throughput functional analysis of autism genes in zebrafish identifies convergence in dopaminergic and neuroimmune pathways . Cell Rep . 42 , 112243 ( 2023 ). OpenUrl 13. ↵ Birtele , M. et al. Non-synaptic function of the autism spectrum disorder-associated gene SYNGAP1 in cortical neurogenesis . Nat. Neurosci . 26 , 2090 – 2103 ( 2023 ). OpenUrl CrossRef 14. ↵ Bernier , R. et al. Disruptive CHD8 mutations define a subtype of autism early in development . Cell 158 , 263 – 276 ( 2014 ). OpenUrl CrossRef PubMed Web of Science 15. ↵ Drokhlyansky , E. et al. The Human and Mouse Enteric Nervous System at Single-Cell Resolution . Cell 182 , 1606 – 1622 .e23 ( 2020 ). OpenUrl CrossRef 16. ↵ Nagy , N. & Goldstein , A. M. Enteric nervous system development: A crest cell’s journey from neural tube to colon . Semin. Cell Dev. Biol . 66 , 94 – 106 ( 2017 ). OpenUrl CrossRef 17. ↵ Sestan , N. & State , M. W. Lost in Translation: Traversing the Complex Path from Genomics to Therapeutics in Autism Spectrum Disorder . Neuron 100 , 406 – 423 ( 2018 ). OpenUrl CrossRef 18. Willsey , A. J. et al. The Psychiatric Cell Map Initiative: A Convergent Systems Biological Approach to Illuminating Key Molecular Pathways in Neuropsychiatric Disorders . Cell 174 , 505 – 520 ( 2018 ). OpenUrl CrossRef PubMed 19. ↵ Willsey , H. R. , Willsey , A. J. , Wang , B. & State , M. W. Genomics, convergent neuroscience and progress in understanding autism spectrum disorder . Nat. Rev. Neurosci . 23 , 323 – 341 ( 2022 ). OpenUrl CrossRef 20. ↵ Exner , C. R. T. & Willsey , H. R. Xenopus leads the way: Frogs as a pioneering model to understand the human brain . Genesis 59 , e23405 ( 2021 ). OpenUrl 21. ↵ Nakayama , T. et al. Cas9-based genome editing in Xenopus tropicalis . Methods Enzymol . 546 , 355 – 375 ( 2014 ). OpenUrl CrossRef PubMed 22. ↵ Chalmers , A. D. & Slack , J. M. Development of the gut in Xenopus laevis . Dev. Dyn . 212 , 509 – 521 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 23. ↵ Willsey , H. R. et al. Katanin-like protein Katnal2 is required for ciliogenesis and brain development in Xenopus embryos . Dev. Biol . 442 , 276 – 287 ( 2018 ). OpenUrl CrossRef 24. DeLay , B. D. et al. Tissue-Specific Gene Inactivation in Xenopus laevis: Knockout of lhx1 in the Kidney with CRISPR/Cas9 . Genetics 208 , 673 – 686 ( 2018 ). OpenUrl Abstract / FREE Full Text 25. ↵ Willsey , H. R. et al. The neurodevelopmental disorder risk gene DYRK1A is required for ciliogenesis and control of brain size in Xenopus embryos . Development 147 , ( 2020 ). 26. ↵ Holloway , E. M. et al. Mapping Development of the Human Intestinal Niche at Single-Cell Resolution . Cell Stem Cell 28 , 568 – 580 .e4 ( 2021 ). OpenUrl 27. ↵ Simons Vip Consortium . Simons Variation in Individuals Project (Simons VIP): a genetics-first approach to studying autism spectrum and related neurodevelopmental disorders . Neuron 73 , 1063 – 1067 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 28. ↵ Furness , J. B. The enteric nervous system and neurogastroenterology . Nat. Rev. Gastroenterol. Hepatol . 9 , 286 – 294 ( 2012 ). OpenUrl CrossRef PubMed 29. ↵ Lake , J. I. & Heuckeroth , R. O. Enteric nervous system development: migration, differentiation, and disease . Am. J. Physiol. Gastrointest. Liver Physiol . 305 , G1 – 24 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 30. Elworthy , S. , Pinto , J. P. , Pettifer , A. , Cancela , M. L. & Kelsh , R. N. Phox2b function in the enteric nervous system is conserved in zebrafish and is sox10-dependent . Mech. Dev . 122 , 659 – 669 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 31. ↵ Blackburn , A. T. M. et al. DYRK1A-related intellectual disability: a syndrome associated with congenital anomalies of the kidney and urinary tract . Genet. Med . 21 , 2755 – 2764 ( 2019 ). OpenUrl CrossRef 32. ↵ Johnson , H. K. , Wahl , S. E. , Sesay , F. , Litovchick , L. & Dickinson , A. J. Dyrk1a is required for craniofacial development in Xenopus laevis . bioRxiv ( 2024 ) doi: 10.1101/2024.01.13.575394 . OpenUrl Abstract / FREE Full Text 33. ↵ Tobin , J. L. et al. Inhibition of neural crest migration underlies craniofacial dysmorphology and Hirschsprung’s disease in Bardet-Biedl syndrome . Proc. Natl. Acad. Sci. U. S. A . 105 , 6714 – 6719 ( 2008 ). OpenUrl Abstract / FREE Full Text 34. ↵ Ţînţaş , M.-L. et al. Straightforward Access to a New Class of Dual DYRK1A/CLK1 Inhibitors Possessing a Simple Dihydroquinoline Core . Molecules 28 , ( 2022 ). 35. ↵ Göckler , N. et al. Harmine specifically inhibits protein kinase DYRK1A and interferes with neurite formation . FEBS J . 276 , 6324 – 6337 ( 2009 ). OpenUrl CrossRef PubMed 36. ↵ Avetisyan , M. , Schill , E. M. & Heuckeroth , R. O. Building a second brain in the bowel . J. Clin. Invest . 125 , 899 – 907 ( 2015 ). OpenUrl CrossRef PubMed 37. Honoré , S. M. , Aybar , M. J. & Mayor , R. Sox10 is required for the early development of the prospective neural crest in Xenopus embryos . Dev. Biol . 260 , 79 – 96 ( 2003 ). OpenUrl CrossRef PubMed Web of Science 38. Alkobtawi , M. et al. Characterization of Pax3 and Sox10 transgenic Xenopus laevis embryos as tools to study neural crest development . Dev. Biol . 444 Suppl 1 , S202 – S208 ( 2018 ). OpenUrl 39. ↵ Hutchins , E. J. et al. Migration and diversification of the vagal neural crest . Dev. Biol . 444 Suppl 1 , S98 – S109 ( 2018 ). OpenUrl CrossRef PubMed 40. ↵ Edery , P. et al. Mutations of the RET protooncogene in Hirschsprung’s disease . Nature 367 , 378 – 380 ( 1994 ). OpenUrl CrossRef PubMed Web of Science 41. ↵ Tomuschat , C. & Puri , P. RET gene is a major risk factor for Hirschsprung’s disease: a meta-analysis . Pediatr. Surg. Int . 31 , 701 – 710 ( 2015 ). OpenUrl CrossRef PubMed 42. ↵ Lieberman . Monoamine Oxidase Inhibitors in Neurological Diseases . ( CRC Press , 1994 ). 43. ↵ Sikander , A. , Rana , S. V. & Prasad , K. K. Role of serotonin in gastrointestinal motility and irritable bowel syndrome . Clin. Chim. Acta 403 , 47 – 55 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 44. ↵ Jin , J. G. , Foxx-Orenstein , A. E. & Grider , J. R. Propulsion in guinea pig colon induced by 5-hydroxytryptamine (HT) via 5-HT4 and 5-HT3 receptors . J. Pharmacol. Exp. Ther . 288 , 93 – 97 ( 1999 ). OpenUrl Abstract / FREE Full Text 45. Haga , K. , Asano , K. , Fukuda , T. & Kobayakawa , T. The function of 5-HT3 receptors on colonic transit in rats . Obes. Res . 3 Suppl 5 , 801S – 810S ( 1995 ). OpenUrl PubMed 46. Chen , J. J. et al. Maintenance of serotonin in the intestinal mucosa and ganglia of mice that lack the high-affinity serotonin transporter: Abnormal intestinal motility and the expression of cation transporters . J. Neurosci . 21 , 6348 – 6361 ( 2001 ). OpenUrl Abstract / FREE Full Text 47. ↵ Grider , J. R. , Kuemmerle , J. F. & Jin , J. G. 5-HT released by mucosal stimuli initiates peristalsis by activating 5-HT4/5-HT1p receptors on sensory CGRP neurons . Am. J. Physiol . 270 , G778 – 82 ( 1996 ). OpenUrl PubMed Web of Science 48. ↵ Schechter , L. E. et al. Neuropharmacological profile of novel and selective 5-HT6 receptor agonists: WAY-181187 and WAY-208466 . Neuropsychopharmacology 33 , 1323 – 1335 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 49. ↵ Localization of 5-HT6 receptors at the plasma membrane of neuronal cilia in the rat brain . Brain Res . 872 , 271 – 275 ( 2000 ). OpenUrl CrossRef PubMed Web of Science 50. ↵ Rao , M. & Gershon , M. D. The bowel and beyond: the enteric nervous system in neurological disorders . Nat. Rev. Gastroenterol. Hepatol . ( 2016 ). 51. Fröhlich , H. et al. Gastrointestinal dysfunction in autism displayed by altered motility and achalasia in Foxp1+/-mice . Proc. Natl. Acad. Sci. U. S. A . 116 , 22237 – 22245 ( 2019 ). OpenUrl Abstract / FREE Full Text 52. Puig , I. et al. Deletion of Pten in the mouse enteric nervous system induces ganglioneuromatosis and mimics intestinal pseudoobstruction . J. Clin. Invest . 119 , 3586 – 3596 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 53. ↵ James , D. M. et al. Intestinal dysmotility in a zebrafish (Danio rerio) shank3a;shank3b mutant model of autism . Mol. Autism 10 , 3 ( 2019 ). OpenUrl CrossRef 54. ↵ Meng , X. et al. Assembloid CRISPR screens reveal impact of disease genes in human neurodevelopment . Nature 622 , 359 – 366 ( 2023 ). OpenUrl CrossRef 55. ↵ Loukil , A. et al. Identification of new ciliary signaling pathways in the brain and insights into neurological disorders . bioRxiv ( 2023 ) doi: 10.1101/2023.12.20.572700 . OpenUrl Abstract / FREE Full Text 56. ↵ Li , Z. et al. Essential roles of enteric neuronal serotonin in gastrointestinal motility and the development/survival of enteric dopaminergic neurons . J. Neurosci . 31 , 8998 – 9009 ( 2011 ). OpenUrl Abstract / FREE Full Text 57. ↵ Elmentaite , R. et al. Single-Cell Sequencing of Developing Human Gut Reveals Transcriptional Links to Childhood Crohn’s Disease . Dev. Cell 55 , 771 – 783 .e5 ( 2020 ). OpenUrl CrossRef PubMed 58. ↵ Sive , H. L. , Grainger , R. M. & Harland , R. M. Early Development of Xenopus Laevis: A Laboratory Manual . ( CSHL Press , 2000 ). 59. ↵ Lingeman , E. , Jeans , C. & Corn , J. E. Production of Purified CasRNPs for Efficacious Genome Editing . Curr. Protoc. Mol. Biol . 120 , 31.10.1–31.10.19 ( 2017 ). 60. ↵ Willsey , H. R. Whole-Mount RNA In Situ Hybridization and Immunofluorescence of Xenopus Embryos and Tadpoles . Cold Spring Harb. Protoc . 2021 , db.prot105635 ( 2021 ). 61. ↵ Sive , H. L. , Grainger , R. M. & Harland , R. M. Baskets for in situ hybridization and immunohistochemistry . CSH Protoc . 2007 , db.prot4777 ( 2007 ). 62. ↵ Choi , H. M. T. et al. Third-generation in situ hybridization chain reaction: multiplexed, quantitative, sensitive, versatile, robust . Development 145 , ( 2018 ). 63. ↵ Zahn , N. et al. Normal Table of Xenopus development: a new graphical resource . Development 149 , ( 2022 ). View the discussion thread. Back to top Previous Next Posted May 29, 2024. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Autism gene variants disrupt enteric neuron migration and cause gastrointestinal dysmotility Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Autism gene variants disrupt enteric neuron migration and cause gastrointestinal dysmotility Kate E. McCluskey , Katherine M. Stovell , Karen Law , Elina Kostyanovskaya , James Schmidt , Cameron R. T. Exner , Jeanselle Dea , Elise Brimble , Matthew W. State , A. Jeremy Willsey , Helen Rankin Willsey bioRxiv 2024.05.28.593642; doi: https://doi.org/10.1101/2024.05.28.593642 Share This Article: Copy Citation Tools Autism gene variants disrupt enteric neuron migration and cause gastrointestinal dysmotility Kate E. McCluskey , Katherine M. Stovell , Karen Law , Elina Kostyanovskaya , James Schmidt , Cameron R. T. Exner , Jeanselle Dea , Elise Brimble , Matthew W. State , A. Jeremy Willsey , Helen Rankin Willsey bioRxiv 2024.05.28.593642; doi: https://doi.org/10.1101/2024.05.28.593642 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7652) Biochemistry (17753) Bioengineering (13939) Bioinformatics (42088) Biophysics (21503) Cancer Biology (18661) Cell Biology (25588) Clinical Trials (138) Developmental Biology (13410) Ecology (19951) Epidemiology (2067) Evolutionary Biology (24383) Genetics (15641) Genomics (22569) Immunology (17782) Microbiology (40506) Molecular Biology (17219) Neuroscience (88832) Paleontology (667) Pathology (2846) Pharmacology and Toxicology (4840) Physiology (7668) Plant Biology (15182) Scientific Communication and Education (2048) Synthetic Biology (4307) Systems Biology (9841) Zoology (2274)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00