A Rat Model of Chronic Heart Failure Combined with Intestinal Dysfunction and Alterations in the Microbiome and Metabolomics

A Rat Model of Chronic Heart Failure Combined with Intestinal Dysfunction and Alterations in the Microbiome and Metabolomics | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article A Rat Model of Chronic Heart Failure Combined with Intestinal Dysfunction and Alterations in the Microbiome and Metabolomics Jiahui Liu, Xiunan Wei, Yonggang Dai, Gongyi Li, Miaomiao Zhang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3266597/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Intestinal dysfunction (ID) is considered a critical comorbidity of chronic heart failure (CHF) and can exacerbate the condition. The pathophysiology underlying chronic heart failure combined with intestinal dysfunction (CHF&ID) remains elusive, and animal models are lacking. In this study, we compared four modeling methods, abdominal aortic constriction (AAC), transverse aortic constriction (TAC), TAC combined with cecum ligation (TAC + CL), and AAC combined with cecum ligation (AAC + CL), to establish a rat CHF&ID model. The results demonstrated that TAC + CL elicited a significant elevation in B-type natriuretic peptide (BNP) and trimethylamine N-oxide (TMAO) levels, accompanied by a notable decrease in heart function as assessed by echocardiography. Moreover, this method induced myocardial fibrosis, and cardiomyocyte hypertrophy in rats. Additionally, it was found to induce mechanical barrier damage to the small intestinal, including disorganization of epithelial structure, and increased diamine oxidase (DAO) and lipopolysaccharide (LPS) in rats. Afterward, analysis of the cecal intestinal microbiota using 16S rRNA sequencing technology revealed significant alterations in CHF&ID rats, characterized by an increased abundance of Bacteroides, Ruminococcaceae_UCG-005, NK4A214_group, Family_XIII_AD3011_group, Lachnospiraceae_UCG-010 , and Bifidobacterium ( p < 0.05), as well as a decreased abundance of Roseburia, Oscillibacter and Tuzzerella ( p < 0.05). Detection of serum metabolites by the LC‒MS coupling technique revealed that LysoPC (0:0/18:2(9Z,12Z)), LysoPC (18:3(9Z,12Z,15Z)/0:0), PC (17:1(9Z)/0:0), glycoursodeoxycholic acid were upregulated. Correlation analysis showed that the intestinal microbiota was significantly associated with several lipid metabolites, cardiac remodeling and leaky gut indicators. These results suggest that intestinal microbiota disorders and serum metabolites crosstalk with each other to induce the development of CHF&ID. Health sciences/Diseases/Cardiovascular diseases Health sciences/Diseases/Gastrointestinal diseases Chronic Heart Failure Intestinal Dysfunction Rat model Intestinal microbiota Serum Metabolites Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction CHF is a prevalent and life-threatening disease affecting over 37.7 million individuals globally 1 , with its incidence steadily increasing year by year 2 . As the leading cause of hospitalization among the Chinese population, CHF imposes a significant burden on healthcare systems 3 . CHF affects multiple organs throughout the body, with the intestinal tract being particularly susceptible to damage. This can result in intestinal biological, physical, immune and chemical barriers, leading to ID and even failure 4 . Consequently, ID results in the translocation of bacteria and their metabolites into the bloodstream, exacerbating heart failure 5 . Additionally, ID-induced symptoms such as nausea, vomiting, anorexia, diarrhea, constipation, abdominal distension and pain can contribute to malnutrition and further burden patients with this condition 5 , 6 . The impact of malnutrition and subsequent cachexia on the clinical course of congestive heart failure and the quality of life of patients has been demonstrated by numerous studies 7 , 8 , 9 . The intestinal mucosal barrier and intestinal microbiota have emerged as novel therapeutic targets for cardiovascular disease 10 . The pathophysiology of CHF & ID remains poorly understood, with limited research conducted on this topic. Recent studies have highlighted the significance of dysbiosis 11 , 12 and metabolic disorders 13 as not only pathological factors in CHF but also crucial contributors to the development of ID 14 . These viewpoints suggest that dysbiosis and metabolic disorders may serve as primary etiological factors underlying CHF and ID. Animal models are important tools for studying the developmental regression of the disease and the therapeutic effects of drugs. Animal models of aortic arch constriction (TAC) and abdominal aortic constriction (AAC) are widely used in the study of CHF 15 . Animal models of ID are commonly used in the study of sepsis 16 , acute pancreatitis 17 , and inflammatory bowel disease 18 . However, there is a lack of research on the construction and evaluation of animal models of CHF & ID comorbidities. In this study, we compared and evaluated four modeling methods, namely, AAC, TAC, AAC + CL, and TAC + CL, to find the best rat CHF&ID modeling method, which can provide a tool for the study of pathological mechanisms and drugs for this disease. In addition, this study examined the intestinal microbiota and serum metabolites of rats in the TAC + CL group to investigate the pathogenesis. Results Symptoms and behavior of rats All rats in the model groups survived except for one death each in the AAC and AAC + CL groups during the modeling period. The Sham 1 and Sham 2 groups had poorer mobility, grip strength, and mental status than the CON group in the first week after surgery, lower food and water intake, and less feces than the CON group, with no abnormal secretion. They recovered to baseline levels in the second to eighth weeks. Compared with the sham and CON groups, the rats in each model group had more withered and loose hair, increased eyelid secretion, decreased mobility and grip strength, decreased food and water intake, depressed mental state, slow reaction, and different degrees of asthma and sputum, and individually exhibited pink foamy sputum, foot and paw, head and facial edema, in addition to the above symptoms. The AAC + CL and TAC + CL groups also showed abdominal distension, diarrhea, and hydroperitoneum (Fig. 1 A). The weight change curves of rats in each group from 0 to 8 weeks can be seen (Fig. 1 B). The growth trend of rats in each group from 0 to 4 weeks was the same. The rats in the CON, Sham1, and Sham2 groups continued to increase in body weight after 4 weeks. The growth trend of each model group leveled off after 4 weeks, especially the TAC and AAC + CL groups, which showed a significant decreasing trend after week 7, and the AAC and TAC + CL groups stopped growing after week 4. At the end of the experiment, there was no statistically significant difference in body weight between the Sham 1 and Sham 2 groups compared to the CON group. Compared to the CON group, all model groups showed a significant decrease in body weight ( p < 0.05). Compared to the sham groups, the AAC, AAC + CL, and TAC groups showed a significant decrease in body weight ( p 0.05). We hypothesized that the body weight of rats in the TAC + CL group did not significantly differ from that in the sham2 group, possibly due to the pronounced presence of ascites during later stages. Comparison of small intestinal transit rates We evaluated the small intestinal transit rate by gavage with methylene blue solution (Fig. 1 C). There was no statistically significant difference in the small intestinal transit rate in the sham group compared with the CON group ( p > 0.05), and there was a significant decrease in all model groups ( p < 0.01). Compared with that in the Sham1 group, the small intestinal transit rate decreased in the AAC and AAC + CL groups ( p < 0.05). Compared with the Sham2 group, the small intestinal transit rate decreased in the TAC and TAC + CL groups ( p 0.05). Comparison of cardiac function We evaluated the cardiac function of rats in each group by echocardiography at 8 weeks after modeling (Fig. 1 (D-G)). left ventricular ejection fraction (EF), fractional shortening (FS), and left ventricular internal diameter systolic (LVIDs) in the AAC group were significantly lower ( p < 0.05) than those in the CON and Sham1 groups, while there was no statistically significant difference in left ventricular internal diameter diastolic (LVIDd) compared with the CON group. In the TAC group, LVIDs, LVIDd, EF, and FS were significantly lower ( p < 0.05) than those in the CON and Sham2 groups. LVIDs, EF, and FS in the AAC + CL group were significantly lower ( p < 0.05) than those in the CON group, but there was no significant difference compared to the Sham1 group. LVIDs, LVIDd, EF, and FS in the TAC + CL group were significantly lower ( p < 0.01) than those in the CON and Sham1 groups. Comparison of serum BNP, TMAO, DAO, and LPS concentrations After modeling, serum concentrations of BNP, TMAO, DAO, and LPS were determined for each group to evaluate cardiac function and the intestinal mucosal barrier (Fig. 1 (H-K)). No statistically significant difference was observed in the levels of serum BNP, TMAO, DAO, and LPS between the sham group and the CON group ( p > 0.05). Compared with the CON and sham groups, the levels of BNP and TMAO were differentially elevated in all model groups ( p < 0.05, p < 0.01). The levels of DAO and LPS were significantly higher in the AAC + CL and TAC + CL groups than in the CON group and the sham group ( p < 0.05, p < 0.01), indicating the presence of leaky gut in these two groups. Compared to the CON group, the AAC group exhibited significantly elevated levels of DAO and LPS, while no significant difference was observed compared to the Sham1 group. No significant difference in DAO ( p > 0.05) was found between the TAC group and the CON group, but higher LPS levels were detected in the former ( p 0.05). Histopathological changes in cardiac tissues We performed H&E staining on the myocardial tissues of rats in each group and analyzed the pathological and histological changes after modeling (Fig. 2 (A-G)). The myocardial tissue of both the CON and sham groups exhibited a compact structure without inflammatory cell infiltration, with well-organized and uniform cardiomyocytes, as well as nuclei sizes that were consistent throughout. In all model groups, myocardial tissue showed a loosely arranged structure with increased interstitial space between cells. In addition, inflammatory cell infiltration was observed. Cardiomyocytes were disorganized and hypertrophic, with some nuclei missing. Compared to the CON group, a significant increase in cardiomyocyte area was observed in the AAC, TAC, AAC + CL, and TAC + CL groups ( p < 0.01). Furthermore, there was a significant increase in cardiomyocyte area in the AAC and AAC + CL groups compared to the Sham1 group ( p < 0.05). In addition, both the TAC and TAC + CL groups showed a significant increase in cardiomyocyte area compared to the Sham2 group ( p < 0.01) (Fig. 2 H). Masson's staining results of rat myocardial tissues in each group (Fig. 2 (I-O)) showed a significant increase in the area of collagen fibers within the interstitial matrix of rat myocardial cells and an increase in the area of collagen fibrils in each model group compared with both the CON and sham groups. According to the results obtained from ImageJ software measurements (Fig. 2 P), the percentage of myocardial fibrosis area was significantly increased in each model group compared to the CON group ( p < 0.01). Furthermore, all model groups exhibited a significant increase in the percentage of myocardial fibrosis area compared to the Sham groups ( p < 0.01). Histopathological changes in jejunum and ileum tissues As shown by the results of H&E staining (Fig. 3 (A-G)) and the jejunal villus length/crypt depth ratio (Fig. 3 H) of the rat jejunum in each group, the jejunal villi in the CON and Sham groups were compact and neatly arranged, with slender and elongated morphology, abundant crypts, and a normal number of cup cells. The jejunal villi of the model groups were sparse and disorganized in their arrangement, with a wide, shortened and truncated morphology, and some of them were broken. The number of jejunal villi was reduced, and the number of cup cells was increased in the model groups. Furthermore, the jejunal villus length/crypt depth ratio in each model group was significantly decreased compared with that in the CON and sham groups (p < 0.05). The results of H&E staining of the ileum in each group (Fig. 3 (I-O)) showed that the ileal villi and epithelial cells in the CON and sham groups had an intact structural organization without any infiltration of inflammatory cells. In contrast, the model group showed sparse, broken, and detached ileal villi, atrophied glands, and inflammatory cell infiltration. Additionally, a significant decrease in the number of ileal villi was observed in each model group compared to the CON and sham groups ( p < 0.05) (Fig. 3 P). The microvilli on the surface of ileal epithelial cells in the CON and Sham groups exhibited dense and orderly arrangements, normal lengths, absence of shedding, tight and clear TJs, and normal mitochondrial morphology. In contrast, the model groups displayed loose and disorganized microvilli with shortened or broken lengths, widened or fuzzy cell gaps, and swollen mitochondria. Notably, significant alterations were observed in the AAC + CL and TAC + CL groups (Fig. 3 (Q-W)). TAC + CL modeling induces myocardial tissue remodeling and intestinal barrier damage in rats All of the above results suggest that the TAC + CL modeling method has a better CHF&ID characterization and a lower mortality rate compared with the other three methods. Next, we determined the expression levels of BNP, ANP and Col1a1 mRNA in myocardial tissue and ZO-1 mRNA in ileal tissue of rats in the TAC + CL group (Fig. 3 X). Compared with the Sham2 group, BNP, ANP and Col1a1 mRNA expression levels in myocardial tissues were upregulated (p < 0.05), and ZO-1 mRNA expression levels in ileal tissues were decreased ( p < 0.05). These results confirm the development of cardiomyocyte hypertrophy and fibrosis and the impairment of intestinal barrier function in the TAC + CL rat model, further suggesting its stability. TAC + CL alters intestinal microbiota and serum metabolites Previous studies have demonstrated alterations in the intestinal microbiota in patients with CHF, but changes in the intestinal microbiota specific to CHF&ID remain unknown. In this study, we analyzed the cecal contents of the CHF&ID model to investigate shifts in intestinal microbial composition. The Kruskal‒Wallis test revealed that at the genus level, there was an enrichment in the abundance of Bacteroides, Ruminococcaceae_UCG-005, NK4A214_group, Family_XIII_AD3011_group, Allobaculum, Fournierella, Lachnospiraceae_UCG-010, Holdemania and Bifidobacterium in the TAC + CL group, while Roseburia, Oscillibacter and Tuzzerella showed a decrease ( p < 0.05) (Fig. 4 A). To display indicator species visually, we performed a linear discriminant analysis (LDA) effect size analysis (LEfSe) with LDA score＞3 and p < 0.05 (Fig. 4 B). Compared with the Sham2 group, 10 genus-level differential taxa, including g__Bacteroides, g__UCG_005, g__Christensenellaceae_R_7_group, g__NK4A214_group, g__Family_XIII_AD3011_group, g__Candidatus_Soleaferrea, g__Allobaculum, g__Bifidobacterium, g__Fournierella, and g__Blautia Alterations, were found to be enriched in the rat intestinal microbiota after modeling. Kyoto Encyclopedia of Genes and Genomes (KEGG) was used to annotate the function of the microbiota. Twenty-three KEGG pathways were significantly altered in the TAC + CL group (Fig. 4 C), including biosynthesis of unsaturated fatty acids, fatty acid degradation, choline metabolism in cancer, alanine, aspartate and glutamate metabolism, arginine and proline metabolism, arginine biosynthesis, necroptosis, and cardiac muscle contraction. Hierarchical clustering was performed on the expression of the top 50 significant metabolites ranked by variable importance of projection (VIP), and among those significantly upregulated were LysoPC(0:0/18:2(9Z,12Z)), LysoPC(18:3(9Z,12Z,15Z)/0:0), PC(17:1(9Z)/0:0), ethenyl acetate, glycoursodeoxycholic acid, 11-hydroxyhexadecanoylcarnitine, alanine lactate, etc. ( p < 0.01) (Fig. 4 D). The downregulated metabolites included PA(a-21:0/PGF2alpha), beta-D-fructose 2,6-bisphosphate, and N-undecylbenzenesulfonic acid ( p < 0.01). The majority of the aforementioned metabolites were classified within the Super Class of Lipids and Lipid-like molecules, indicating that lipid metabolism may play a crucial role in the pathogenesis of CHF&ID. Correlation analysis between intestinal microbiota and serum metabolites To investigate the underlying mechanism contributing to the observed outcomes in the CHF&ID animal model, we conducted correlation analyses between intestinal microbiota and serum metabolites. We selected the top 20 entries with the most significant microbial differences and metabolite differences separately and calculated their correlations (Fig. 4 E). The intestinal microbiota exhibited a significant correlation with serum metabolites, wherein Bifidobacterium showed a strong association with metabolites such as 3-sulfodeoxycholic acid and lysoPC(20:3(8Z,11Z,14Z)/0:0) (|r| > 0.8, p 0.8, p 0.8, p < 0.01). The findings of this study suggest a significant correlation between alterations in the microbiome of CHF&ID rats and changes in serum metabolites, particularly with respect to bile acid metabolism within lipid metabolism. Intestinal microbiota is associated with alterations in serum indicators of CHF and ID Correlation analysis was performed to investigate the relationship between the intestinal microbiota and serum indicators of CHF, including BNP and TMAO, as well as serum indicators of ID, such as LPS and DAO. A total of 24 genera exhibited correlation coefficients |6|>0.6 with these four indicators, and the significant associations were visualized using network diagrams (Fig. 4 F). Notably, BNP showed a significantly positive correlation with Tuzzerella (p < 0.01). The levels of TMAO were found to be positively correlated with Oscillibacter and Tuzzerella (p < 0.01). LPS was significantly and positively associated with Tuzzerella , Ruminiclostridium , and Peptococcus (p < 0.01). DAO showed a significant negative correlation with NK4A214_group (p < 0.01), while it exhibited a significant positive correlation with Roseburia, Tuzzerella, Pygmaiobacter, Acetatifactor , and Peptococcus (p < 0.01). Furthermore, the presence of Tuzzerella was significantly linked to all four serologic indicators and may serve as the key causative agent for CHF&ID. Discussion The intestinal tract serves not only as a site for nutrient absorption but also as a critical defense mechanism against the entry of harmful substances into the body. Impairment of the intestinal mucosal barrier leads to ID 19 , which has been observed in several systemic diseases 18 , 20 , 21 , 21 . The intestinal tract has an abundant vascular and blood supply that is highly susceptible to ischemia, congestion and anoxia 22 . CHF represents the advanced stage of several chronic cardiovascular diseases and often results in circulatory disturbances. Therefore, ID is implicated as both an early contributor to the pathogenesis of CHF and a late factor in recovery, while also triggering or exacerbating systemic inflammatory response syndrome and multiorgan failure 20 . However, despite its significance in CHF development, the underlying mechanisms of CHF & ID remain unclear, and there is a dearth of reports on animal models for this condition. Thus, it is crucial to establish stable and reliable animal models for studying disease mechanisms and evaluating drug efficacy. TAC and AAC are the most commonly utilized modeling methods for CHF. In this study, we applied these two modeling methods and observed nonsignificant changes in LPS and DAO levels compared with the sham groups. We postulate that ID is a comorbidity that arises in the mid-to-late stage of CHF and gradually develops from the disease process, whereas TAC and AAC have an 8-week modeling cycle that may not fully capture ID. To overcome this limitation, we utilized absorbable surgical sutures for the ligation of the distal third of the cecum to establish an experimental model of ID. Studies have demonstrated that the rat cecum, which is a crucial organ for fermenting plant-based foods 23 and absorbing nutrients such as vitamins and calcium 24 , possesses abundant blood vessels and is larger than its human counterpart. Ligation of the cecum in rats results in both ischemia and reperfusion of the terminal ileum, leading to pseudo-obstruction that hinders digestion and absorption processes, ultimately causing ID. In conjunction with aortic narrowing, this results in a comprehensive model encompassing both diseases. The success and fidelity of the modeling were confirmed through histopathological examination of the heart and small intestine, cardiac ultrasound imaging, and measurements of BNP, LPS, TMAO, and DAO. The findings demonstrated that all four modeling approaches induced myocardial hypertrophy, myocardial fibrosis, and impaired cardiac function, along with elevated levels of TMAO and BNP in rats. However, in terms of the overall condition of rats, as well as jejunal villus/crypt ratio, ileal villus number, and intestinal barrier function serum indicators such as DAO and LPS, the characterization obtained by AAC + CL and TAC + CL exhibited greater similarity to ID. Combined with the observed mortality rate, our findings suggest that the TAC CL molding method exhibits stability, low mortality rates and high repeatability. The TAC + CL group exhibited a significant upregulation in the PCR results of myocardial tissue BNP, ANP, and Col1a1, and this was further supported by increased ileal tissue ZO-1 expression. Both Huo et al . 25 and Nicola et al . 26 reported an increase in intestinal permeability, as well as significantly elevated mRNA expression of intestinal ZO-1 and LPS levels in the HF model, which is similar to our findings. However, in contrast to other studies that consider ID as a pathological manifestation of the disease, we have classified it as a distinct disease entity. Therefore, in this study, we not only observed the absence of small intestinal villi, disorganization of epithelial structure, and inflammatory response in rats but also identified gastrointestinal symptoms such as reduced food intake, abdominal distention, and altered bowel movements that are consistent with clinical manifestations in patients with CHF&ID 5 . This comprehensive evaluation better captures the intricate clinical features and pathological mechanisms. In recent years, numerous studies have demonstrated the crucial role of intestinal microbiota in the development of CHF through metabolic, immune and renal vascular pathways 11 , 17 , 27 . However, investigations into changes in intestinal microbiota among CHF patients with intestinal comorbidities remain limited. To address this gap, we employed a combination of microbiome and metabolome approaches to analyze the characterization and relationship between intestinal microbiota and serum metabolome in a TAC + CL-induced CHF&ID model. Our findings not only shed light on the pathogenesis of this disease but also identify novel biomarkers. We observed alterations in the intestinal microbiota of CHF&ID model rats compared to the Sham2 group, including an enrichment of Bacteroides and Lachnospiraceae . Zhou et al . 28 reported that in patients with ST-segment elevation myocardial infarction, intestinal Lactobacillus, Bacteroides , and Streptococcus were predominant in their blood samples. Liu et al . 29 reported that Bacteroides plebeius and Fusobacterium were enriched in patients with valvular calcification. Additionally, Bacteroides sp., Bacteroides plebeius , and Lactobacillus were associated with hyperlipidemia. Finally, an increased abundance of Bacteroides spp. and a decreased abundance of Roseburia were found in high-fat Apoe-/- mice fed L-alpha-glycerylphosphorylcholine. Our findings on bacterial colonization align with previous studies, indicating that Oscillibacter and Tuzzerella may play a role in reducing the risk of cardiovascular diseases such as atherosclerosis 30 and dyslipidemia 31 , 32 , as well as other chronic conditions such as obesity 33 and chronic kidney disease 34 . These bacteria are considered potential pathogens for these diseases. Interestingly, we observed a significant correlation between Tuzzerella and BNP and TMAO, which are serum indicators of CHF, and LPS and DAO, which are serum indicators of ID. Previous studies have reported a strong association between LPS and Tuzzerella in obese patients 35 and in models of cyclophosphamide-induced intestinal mucosal barrier injury 36 . These findings suggest that Tuzzerella may play a role in mediating myocardial remodeling, leaky gut syndrome, and metabolic endotoxemia. Our metabolomic analysis revealed elevated levels of LysoPC (0:0/18:2(9Z,12Z)), LysoPC (18:3(9Z,12Z,15Z)/0:0), and PC (17:1(9Z)/0:0). Previous studies have demonstrated that lysophosphatidylcholines (lysoPCs) can induce inflammation by activating macrophages and T lymphocytes 37 , 38 . Furthermore, lysoPCs and phosphatidylcholines (PCs) are established markers for atherosclerosis and cardiac damage 39 . Tappia et al . 40 discovered that phosphatidic acid can enhance cardiac contractile performance by increasing Ca2 + levels through the activation of phospholipase C, while defects in phosphatidic acid-mediated signaling pathways were observed in failing hearts. Our study also revealed a decrease in the levels of phosphatidic acid. Interestingly, KEGG pathway analysis of intestinal microbiota showed significant enrichment of lipid pathways such as unsaturated fatty acid biosynthesis, fatty acid degradation, and choline metabolism in cancer. Choline, phosphatidylcholines 41 , and carnitine 42 serve as precursors for TMAO production, which increases the risk of cardiovascular events. Specific intestinal microbiota, such as Prevotella spp. and Bacteroides spp. , catabolize these substances to trimethylamine (TMA), which is further metabolized by the liver into TMAO 43 , highlighting the crucial role of lipid metabolism in this disease. Additionally, our study revealed a significant elevation in alanine lactate levels. Both alanine and lactate are glycolysis products that increase in pathological conditions. The study conducted by Raimo et al . 35 revealed a significant correlation between alanine and CAD events. Studies 44 , 45 , 46 proposed that lactate promotes the excessive production of reactive oxygen species, which in turn mediates oxidative stress and mitochondrial damage, ultimately leading to the development of myocardial infarction and heart failure. Furthermore, D-lactate and L-lactate, two conformers of lactate, are widely employed as markers for detecting intestinal mucosal damage and assessing the integrity of the intestinal mucosal barrier. These findings suggest that these metabolites may serve as common pathological products in both CHF and ID diseases. The intestinal microbiota in the small intestine plays an important role in regulating host metabolism. Our analysis of intestinal microbiota-metabolite correlations in the CHF&ID model revealed significant alterations in Bifidobacterium , Family_XIII_AD3011_group , Lachnospiraceae_UCG-010 , Ruminococcaceae_UCG-005 and other intestinal microorganisms that are closely related to the metabolism of bile acids such as chenodeoxycholic acid, tetracosahexaenoic acid, and 3-sulfodeoxycholic acid 47 . Bile acids (BAs) play a crucial role in coronary artery disease and intestinal mucosal barrier function. The interaction between the gut microbiota and host intestinal barrier is mediated by BAs and short-chain fatty acid metabolism. Sinha et al . 48 reported that BAs possess anti-inflammatory properties and exert a protective effect on the intestinal mucosa by reducing stress on epithelial cells and modulating intestinal immunity via G protein-coupled receptor 5 expressed in immune cells. Following colectomy, patients with ulcerative colitis exhibit decreased levels of secondary bile acids and increased levels of primary bile acids. Desai et al . 49 demonstrated that excess bile acids impede fatty acid oxidation in cardiomyocytes, leading to pathological manifestations such as cardiac hypertrophy and bradycardia in a model of bile acid overload induced by double knockout of Cholecardia, Fxr, and Shp. These findings suggest that bile acids may serve as important mediators of intestinal microbiota dysbiosis, resulting in damage to the intestinal mucosal barrier and remodeling of cardiomyocytes and leading to CHF and ID. Overall, we have developed a more robust animal modeling approach for CHF&ID and identified significant changes in intestinal microbiota and serum metabolites in this model(Fig. 5 ). Our findings provide a clearer understanding of the role of microbiota and metabolism in CHF&ID, which lays a scientific foundation for developing treatments based on the cardio-intestinal axis. In future studies, we plan to explore the relationship between intestinal microbiota, metabolites, and CHF & ID using fecal bacteria transplantation and other advanced techniques. Materials and methods Laboratory animals Forty-two healthy male Wistar rats of SPF grade, weighing 6–7 weeks of age and weighing 180 ± 20 g, were obtained from Beijing Charles River Laboratory Animal Technology Co., Ltd. (SCXK(JING)2021-0006). The experimental procedures and animal care were conducted at the Experimental Animal Center of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine SYXK(LU)2018 0015, in compliance with national regulations on experimental animal management. This study was approved by the Animal Ethics Committee of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine (AWE-2022-009). All experimental animals adhered to ARRIVE guidelines and received humane treatment according to the National Research Council's Guidelines for the Care and Use of Laboratory Animals, following the principles of "Reduce, Replace, and Optimize" (3R). Animal model preparation Forty-two male Wistar rats were acclimatized for 7 days at a temperature of 24 ± 2 ° C, relative humidity of 60 ± 5%, and a light-dark cycle of 12:12 h. The rats were then randomly assigned to the CON group, Sham 1 group, Sham 2 group, AAC group, TAC group, AAC + CL group, and TAC + CL group (n = 6 each). Except for those in the CON group, all rats underwent routine anesthesia and preoperative skin preparation before being restrained on an operating table with their limbs and head immobilized. The surgical area was disinfected with iodophor. In the AAC group, a 3 cm midline incision was made along the subxiphoid process to expose the abdominal cavity layer by layer. The bowel was placed externally on saline-moistened gauze to keep the organs moist. The abdominal aorta, located 1.5-2 cm above the renal vein arteries, was identified and bluntly dissected. Subsequently, a 22 G disposable dental irrigation needle was positioned parallel to and near the abdominal aorta, followed by ligation using a 4 − 0 nonabsorbable suture. Thereafter, the dental irrigation needle was slowly withdrawn prior to closure of the incision layers and sterilization (Fig. 6 A). In the TAC group, a VentElite small animal ventilator (Harvard Apparatus Co., Ltd.) was externally connected to the cervical part of the trachea. The skin of the surgical area was incised, and the pectoral muscles were separated layer by layer. The second and third rib arches on the left side of the rats were cut, and an incision was opened with a spreader to fully expose the left side of the thoracic cavity. The thymus and aortic arch were bluntly separated, and a 22G disposable dental irrigation needle was placed immediately adjacent to the aortic arch. A 4 − 0 nonabsorbable suture was used to ligate both the aortic arch and the dental irrigation needle. After ligation, the dental irrigation needle was slowly withdrawn while closing each layer of the thoracic cavity prior to sterilization (Fig. 6 B). In the AAC + CL group, based on abdominal aortic reduction, the cecum was found and ligated in the middle and lower 1/3 of the cecum. The cecum was reintegrated into the abdominal cavity, and the abdomen was sutured layer by layer (Fig. 6 C). In the TAC + CL group, based on aortic arch narrowing, the abdominal cavity was opened by a 2-cm incision along the abdominal white line, the cecum was found and ligated in the middle and lower 1/3 of the cecum, the cecum was incorporated back into the abdominal cavity, and the abdomen was closed by layer-by-layer suturing (Fig. 6 (D-E)). In the Sham1 group, the abdominal aorta was opened and isolated without ligation. In the Sham2 group, the thymus and aortic arch were bluntly separated without ligation. After surgery, each surgical rat was housed in a single cage to avoid wound rupture and then housed in a combined cage after the surgical incision had healed. Recording symptoms and behaviors of rats During the modeling period, the rats in each group were observed daily for hair, secretions, food and water consumption, feces, mobility, grip strength and mental status to evaluate their general condition. The changes in body weight were measured weekly. Evaluation of small intestinal transit rate At week 8 after modeling, sampling was performed, and rats were given 2 ml of 2% methylene blue solution by gavage 30 minutes before sampling. The rats were sacrificed, their stomachs were ligated at both the pylorus and the end of the ileum, and the stomach and small intestine were removed. The displacement of the markers in the small intestine was measured, and the length of the whole small intestine was measured. The transit rate of the small intestine was measured for each group according to the following formula: Small intestine transit rate = the distance traveled by the methylene blue solution/the length of the small intestine × 100 Echocardiography to determine cardiac function Eight weeks after surgery, echocardiography was performed on rats in each group. Rats were anesthetized with 1.5-2% inhaled isoflurane, placed on a heating pad and imaged using a Mindray UMT-200 ultrasound diagnostic device (Shenzhen Myriad Biomedical Electronics Co., Ltd.). Data on EF, FS, LVIDs, and LVIDd were collected, and the average of 3 consecutive cardiac cycles was taken for each index. Measurement of serum LPS, DAO, BNP, and TMAO concentrations Following anesthesia, venous blood was obtained from the abdominal aorta, and cervical vertebrae were excised for euthanasia purposes. The collected blood was allowed to stand at room temperature for 1 hour before being centrifuged at 3000 rpm/min for 10 minutes. Subsequently, the serum was harvested and dispensed into 1 ml centrifuge tubes. The serum was centrifuged into 1 ml centrifuge tubes and operated according to the instructions of the ELISA kit (Shanghai Lengton Bioscience Co., LTD, Shanghai, China). An enzyme counter was utilized to measure the absorbance at 450 nm. The concentrations of LPS, DAO, BNP, and TMAO in serum were calculated from the standard curve. Histopathological examination of the jejunum, ileum, and cardiac tissues Rat myocardial tissue, proximal jejunum, and distal ileum tissues were collected, fixed in 10% formalin solution, dehydrated, embedded in paraffin wax and sectioned into slices with a thickness of 4 µm. Hematoxylin and eosin (H&E) staining was performed on jejunum, ileum, and partial cardiac sections, while Masson's trichrome staining was used specifically for partial cardiac sections. Finally, the slides were sealed with neutral balsam sealant. High-resolution images were acquired using an automated digital pathology slide scanner (KF-PRO-020, KFBIO KONFOONG Bioinformation Tech CO., LTD, Ningbo, China). The cardiomyocyte cross-sectional diameter, cardiomyocyte area, and myocardial fibrosis area were quantitatively analyzed utilizing Image-Pro Plus software (Meyer Instruments, INC., Houston, USA). Each group of rat ileal tissue (1 mm3) was fixed in 2.5% glutaraldehyde. The tissue was refixed in 1% osmium tetroxide, followed by phosphoric acid rinses and graded dehydration at 4°C. The samples were then embedded in Epon812 embedding medium at 37°C, 45°C and 60°C for 4 hours each. The embedded tissues were cut into approximately 1 µm semithin sections, double stained with a mixture of 3% uranyl acetate and lead citrate to enhance contrast, and examined under a transmission electron microscope (JEM-1200EX, JEOL Ltd., Tokyo, Japan) to observe ultrastructural changes such as changes in microvilli morphology and tight junction integrity. RT‒PCR for mRNA expression in myocardium and ileum tissues Total RNA was extracted from myocardial and ileal tissues of the Sham2 group and the TAC + CL group using TRIzol reagent according to the instruction manual. The concentration was determined by an ultramicro spectrophotometer (Tnano-800, TUOHE Electromechanical Technology Co., Ltd., Shanghai, China), and 1 µg of RNA was reverse transcribed into cDNA. The amplification protocol included predenaturation at 95 ℃ for 30 s once, denaturation at 95 ℃ (15 s) followed by annealing/extension at 60 ℃ (30 s) for 40 cycles with melting curves at 95 ℃ (10 s), 65 ℃ (5 s), and then again at 95 ℃ (0.5℃). Three replicate wells were set up in each group to calculate the expression of BNP, ANP, and Col1a1 mRNA in myocardial tissue and ZO-1 mRNA in ileum tissue using the ddCT analysis protocol with primers designed by Platinum Bio-Tech (Shanghai, China). Primer sequences for ANP, BNP, Col1a1, ZO-1 and β-Actin are listed in Table 1 . Table 1 Primer sequences used in RT‒PCR. Genes Forward primer Reverse primer ANP GATTTCAAGAACCTGCTAGACCAC CTTCATCGGTCTGCTCGCTC BNP TTAGGTCTCAAGACAGCGCC TAAAACAACCTCAGCCCGTCA Col1a1 CACTGCAAGAACAGCGTAGC AAGTTCCGGTGTGACTCGTG ZO-1 AACAGAGCCGAGCAGTTAGC GCAACATCAGCAATCGGTCC β-Actin CGCAGCTCAGTAACAGTCCG CTCTGTGTGGGATTGGTGGCT Analysis of the intestinal microbiome Cecal content samples were snap-frozen and stored at − 80°C after collection. DNA extraction and amplification total genomic DNA was extracted using a MagPure Soil DNA LQ Kit (Magan) according to the manufacturer’s instructions. DNA concentration and integrity were measured with a NanoDrop 2000 (Thermo Fisher Scientific, USA) and agarose gel electrophoresis. The extracted DNA was used as a template for PCR amplification of bacterial 16S rRNA genes with barcoded primers and Takara Ex Taq (Takara). For bacterial diversity analysis, V3-V4 variable regions of 16S rRNA genes were amplified with universal primers 343F (5’-TACGGRAGGCAGCAG-3’) and 798R (5’-AGGGTATCTAATCCT-3’). The amplicon quality was visualized using agarose gel electrophoresis. The PCR products were purified with AMPure XP beads (Agencourt) and amplified for another round of PCR. After being purified with AMPure XP beads again, the final amplicon was quantified using the Qubit dsDNA Assay Kit (Thermo Fisher Scientific, USA). The concentrations were then adjusted for sequencing. Sequencing was performed on an Illumina NovaSeq 6000 with 250 bp paired-end reads. (Illumina Inc., San Diego, CA; OE Biotech Company, Shanghai, China). The representative read of each ASV was selected using the QIIME 2 package. Raw sequencing data were in FASTQ format. Paired-end reads were then preprocessed using cutadapt software to detect and cut off the adapter. After trimming, the paired-end reads were filtered for low-quality sequences, denoised, and merged, and the chimera reads were detected and cut off using DADA2 with the default parameters of QIIME2 (2020.11). Finally, the software output the representative reads and the ASV abundance table. Linear discriminant analysis (LDA) effect size (LEfSe) testing was performed pairwise (between groups) to identify differentially abundant bacterial taxa (from phylum to species level). PICRUSt2 software was used to predict the composition of known microbial gene functions so that differences in function between samples and subgroups could be counted. Analysis of nontargeted metabolomics One hundred microliters of sample were added to a 1.5 mL Eppendorf tube. Subsequently, 400 µL of an ice-cold mixture of methanol and acetonitrile (2/1, vol/vol, containing L-2-chlorophenylalanine, 2 µg/mL) was added, and the mixtures were vortexed for 1 min. The whole samples were extracted by ultrasonication for 10 min in an ice-water bath and stored at -20 ℃ for 30 min. The extract was centrifuged at 4 ° C (13,000 rpm) for 10 min. Then, 200 µL of supernatant in a glass vial was dried in a freeze concentration centrifugal dryer. A 300 µL mixture of methanol and water (1/4, vol/vol) was added to each sample, and the samples were vortexed for 30 s, extracted by ultrasonication for 3 min in an ice-water bath, and then placed at -20 ° C for 2 h. The samples were centrifuged at 4 ° C (13,000 rpm) for 10 min. The supernatants (150 µL) from each tube were collected with crystal syringes, filtered through 0.22 µm microfilters, and transferred to LC vials. Vials were stored at -80 ° C until LCMS analysis. QC samples were prepared by mixing aliquots of all samples to form a pooled sample. The analytical instrument was a liquid mass spectrometer system consisting of an ACQUITY UPLC I-Class and an ultrahigh-performance liquid chromatography tandem QE high-resolution mass spectrometer. Chromatographic conditions: the column was ACQUITY UPLC HSS T3 (100 mm×2.1 mm, 1.8 um); the column temperature was 45 ℃; the mobile phases were A-water (containing 0.1% formic acid) and B-acetonitrile; the flow rate was 0.35 mL/min; and the injection volume was 3 µL. The mass spectrometry information was analyzed by the metabolomics data processing software Progenesis QI v2.3. Analysis. Statistical analysis Statistical analyses of body weight, cardiac ultrasound, pathology, and serology were performed using GraphPad Prism 9.0 software (GraphPad Inc., La Jolla, CA, USA), and the Kruskal‒Wallis test was used to test whether there was a significant difference between multiple groups because the sample size of each group was < 10. The Mann‒Whitney U test was used to test whether there was a significant difference between two groups. The Mann‒Whitney U test was used to calculate the difference in intestinal species or metabolites between different subgroups. p values were considered statistically significant at p < 0.05 and p < 0.01. Declarations Acknowledgements We thank experimental center of Affiliated Hospital of Shandong University of Traditional Chinese Medicine of China for providing experimental platform. Professor Guohua Dai of Affiliated Hospital of Shandong University of Traditional Chinese Medicine of China for advice and help throughout the study. F unding This work was supported by the Ji 'nan Science and Technology Program Clinical（Grant No .202134024）, Qilu Traditional Chinese Medicine Advantage Specialty Cluster- Chest Pain Alliance（Grant No. 2021-02）, Young Scientific Research Innovation Team of Affiliated Hospital of Shandong University of Traditional Chinese Medicine. Author information Authors and Affiliations College of First Clinical Medicine, Shandong University of Traditional Chinese Medicine, 250014, Jinan, China Jiahui Liu, Xunan Wei & Miaomiao Zhang Shandong Provincial Third Hospital, 250031, Jinan, China Yonggang Dai College of Traditional Chinese Medicine, Shandong University of Traditional Chinese Medicine, 250014, Jinan, China Gongyi Li Affiliated Hospital of Shandong University of Traditional Chinese Medicine , 250014, Jinan, China Junwei Liang, Yan Cheng & Lili Chi Contributions C.L.L., and C.Y. conceived and designed the experiments. L.J.H., W.X.N., L.G.Y., and Z.M.M. performed the animal experiments. L.J.H., and Z.M.M. analyzed the data. D.Y.G. contributed reagents/materials/analysis tools. L.J.W. and W.X.N. wrote the manuscript. All authors have read and agreed to the published version of the manuscript. Corresponding authors Correspondence to Yan Cheng & Lili Chi Ethics declarations : The authors declare no conflict of interest. Data Availability: The data presented in this study are available on request from the corresponding author. References Bui, A. L., Horwich, T. B. & Fonarow, G. C. Epidemiology and risk profile of heart failure. Nat. Rev. Cardiol. 8, 30–41 (2011). Wang, H. et al. Prevalence and Incidence of Heart Failure Among Urban Patients in China: A National Population-Based Analysis. Circ. Heart Fail. 14, e008406 (2021). Ren, J., Wu, N. N., Wang, S., Sowers, J. R. & Zhang, Y. Obesity cardiomyopathy: evidence, mechanisms, and therapeutic implications. Physiol. Rev. 101, 1745–1807 (2021). Arutyunov, G. P., Kostyukevich, O. I., Serov, R. A., Rylova, N. V. & Bylova, N. A. Collagen accumulation and dysfunctional mucosal barrier of the small intestine in patients with chronic heart failure. Int. J. Cardiol. 125, 240–245 (2008). Sandek, A. et al. Intestinal blood flow in patients with chronic heart failure: a link with bacterial growth, gastrointestinal symptoms, and cachexia. J. Am. Coll. Cardiol. 64, 1092–1102 (2014). Anker, S. D. et al. ESPEN Guidelines on Parenteral Nutrition: on cardiology and pneumology. Clin. Nutr. Edinb. Scotl. 28, 455–460 (2009). Celik, T., Iyisoy, A., Yuksel, U. C. & Jata, B. The small intestine: a critical linkage in pathophysiology of cardiac cachexia. Int. J. Cardiol. 143, 200–201 (2010). Aquilani, R. et al. Is nutritional intake adequate in chronic heart failure patients? J. Am. Coll. Cardiol. 42, 1218–1223 (2003). Rozentryt, P. et al. The effects of a high-caloric protein-rich oral nutritional supplement in patients with chronic heart failure and cachexia on quality of life, body composition, and inflammation markers: a randomized, double-blind pilot study. J. Cachexia Sarcopenia Muscle 1, 35–42 (2010). Lewis, C. V. & Taylor, W. R. Intestinal barrier dysfunction as a therapeutic target for cardiovascular disease. Am. J. Physiol. Heart Circ. Physiol. 319, H1227–H1233 (2020). Chakaroun, R. M., Massier, L. & Kovacs, P. Gut Microbiome, Intestinal Permeability, and Tissue Bacteria in Metabolic Disease: Perpetrators or Bystanders? Nutrients 12, 1082 (2020). Yuzefpolskaya, M. et al. Gut microbiota, endotoxemia, inflammation, and oxidative stress in patients with heart failure, left ventricular assist device, and transplant. J. Heart Lung Transplant. Off. Publ. Int. Soc. Heart Transplant. 39, 880–890 (2020). Hansen, T. H., Gøbel, R. J., Hansen, T. & Pedersen, O. The gut microbiome in cardio-metabolic health. Genome Med. 7, 33 (2015). Wang, H. et al. Aberrant Gut Microbiome Contributes to Intestinal Oxidative Stress, Barrier Dysfunction, Inflammation and Systemic Autoimmune Responses in MRL/lpr Mice. Front. Immunol. 12, 651191 (2021). Riehle, C. & Bauersachs, J. Small animal models of heart failure. Cardiovasc. Res. 115, 1838–1849 (2019). Günther, C., Neumann, H., Neurath, M. F. & Becker, C. Apoptosis, necrosis and necroptosis: cell death regulation in the intestinal epithelium. Gut 62, 1062–1071 (2013). Wang, X. D., Wang, Q., Andersson, R. & Ihse, I. Alterations in intestinal function in acute pancreatitis in an experimental model. Br. J. Surg. 83, 1537–1543 (1996). Song, G. et al. Fructose Stimulated Colonic Arginine and Proline Metabolism Dysbiosis, Altered Microbiota and Aggravated Intestinal Barrier Dysfunction in DSS-Induced Colitis Rats. Nutrients 15, 782 (2023). Usuda, H., Okamoto, T. & Wada, K. Leaky Gut: Effect of Dietary Fiber and Fats on Microbiome and Intestinal Barrier. Int. J. Mol. Sci. 22, 7613 (2021). Tang, W. H. W., Kitai, T. & Hazen, S. L. Gut Microbiota in Cardiovascular Health and Disease. Circ. Res. 120, 1183–1196 (2017). Thaiss, C. A. et al. Hyperglycemia drives intestinal barrier dysfunction and risk for enteric infection. Science 359, 1376–1383 (2018). Takala, J. Determinants of splanchnic blood flow. Br. J. Anaesth. 77, 50–58 (1996). Wang, D.-H., Pei, Y., Yang, J. & Wang, Z. Digestive tract morphology and food habits in six species of rodents. Folia Zool. -Praha- 52, 51–55 (2003). Petith, M. M., Wilson, H. D. & Schedl, H. P. Vitamin D dependence of in vivo calcium transport and mucosal calcium binding protein in rat large intestine. Gastroenterology 76, 99–104 (1979). Huo, J.-Y. et al. Intestinal Barrier Dysfunction Exacerbates Neuroinflammation via the TLR4 Pathway in Mice With Heart Failure. Front. Physiol. 12, 712338 (2021). Boccella, N. et al. Transverse aortic constriction induces gut barrier alterations, microbiota remodeling and systemic inflammation. Sci. Rep. 11, 7404 (2021). Castillo-Rodriguez, E. et al. Impact of Altered Intestinal Microbiota on Chronic Kidney Disease Progression. Toxins 10, 300 (2018). Zhou, X. et al. Gut-dependent microbial translocation induces inflammation and cardiovascular events after ST-elevation myocardial infarction. Microbiome 6, 66 (2018). Liu, Z. et al. The intestinal microbiota associated with cardiac valve calcification differs from that of coronary artery disease. Atherosclerosis 284, 121–128 (2019). Wang, Z. et al. The Nutritional Supplement L-Alpha Glycerylphosphorylcholine Promotes Atherosclerosis. Int. J. Mol. Sci. 22, 13477 (2021). Le Roy, T. et al. The intestinal microbiota regulates host cholesterol homeostasis. BMC Biol. 17, 94 (2019). Koren, O. et al. Human oral, gut, and plaque microbiota in patients with atherosclerosis. Proc. Natl. Acad. Sci. 108, 4592–4598 (2011). Kain, V. et al. Obesogenic diet in aging mice disrupts gut microbe composition and alters neutrophil:lymphocyte ratio, leading to inflamed milieu in acute heart failure. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 33, 6456–6469 (2019). Jiang, S. et al. A reduction in the butyrate producing species Roseburia spp. and Faecalibacterium prausnitzii is associated with chronic kidney disease progression. Antonie Van Leeuwenhoek 109, 1389–1396 (2016). Lozano, C. P. et al. Associations of the Dietary Inflammatory Index with total adiposity and ectopic fat through the gut microbiota, LPS, and C-reactive protein in the Multiethnic Cohort–Adiposity Phenotype Study. Am. J. Clin. Nutr. 115, 1344–1356 (2021). Huang, J. et al. Sodium Alginate Modulates Immunity, Intestinal Mucosal Barrier Function, and Gut Microbiota in Cyclophosphamide-Induced Immunosuppressed BALB/c Mice. J. Agric. Food Chem. 69, 7064–7073 (2021). Zhang, L. et al. LC-MS-based metabolomics reveals metabolic changes in short- and long-term administration of Compound Danshen Dripping Pills against acute myocardial infarction in rats. Phytomedicine Int. J. Phytother. Phytopharm. 104, 154269 (2022). Tseng, H.-C. et al. Lysophosphatidylcholine induces cyclooxygenase-2-dependent IL-6 expression in human cardiac fibroblasts. Cell. Mol. Life Sci. CMLS 75, 4599–4617 (2018). Tang, W. H. W. et al. Intestinal microbial metabolism of phosphatidylcholine and cardiovascular risk. N. Engl. J. Med. 368, 1575–1584 (2013). Tappia, P. S. et al. Depressed responsiveness of phospholipase C isoenzymes to phosphatidic acid in congestive heart failure. J. Mol. Cell. Cardiol. 33, 431–440 (2001). Wang, Z. et al. Gut flora metabolism of phosphatidylcholine promotes cardiovascular disease. Nature 472, 57–63 (2011). Koeth, R. A., Wang, Z., Levison, B. S., Buffa, J. & Org, E. Intestinal microbiota metabolism of L-carnitine, a nutrient in red meat, promotes atherosclerosis - PubMed. Nat Med 19, 576–585 (2013). Chen, M. et al. Resveratrol Attenuates Trimethylamine-N-Oxide (TMAO)-Induced Atherosclerosis by Regulating TMAO Synthesis and Bile Acid Metabolism via Remodeling of the Gut Microbiota. mBio 7, e02210-02215 (2016). Hashimoto, T. & Brooks, G. A. Mitochondrial lactate oxidation complex and an adaptive role for lactate production. Med. Sci. Sports Exerc. 40, 486–494 (2008). Evans, R. K., Schwartz, D. D. & Gladden, L. B. Effect of myocardial volume overload and heart failure on lactate transport into isolated cardiac myocytes. J. Appl. Physiol. Bethesda Md 1985 94, 1169–1176 (2003). Halestrap, A. P., Wang, X., Poole, R. C., Jackson, V. N. & Price, N. T. Lactate transport in heart in relation to myocardial ischemia. Am. J. Cardiol. 80, 17A-25A (1997). Ko, C.-W., Qu, J., Black, D. D. & Tso, P. Regulation of intestinal lipid metabolism: current concepts and relevance to disease. Nat. Rev. Gastroenterol. Hepatol. 17, 169–183 (2020). Sinha, S. R. et al. Dysbiosis-Induced Secondary Bile Acid Deficiency Promotes Intestinal Inflammation. Cell Host Microbe 27, 659–670.e5 (2020). Hanafi, N. I., Mohamed, A. S., Sheikh Abdul Kadir, S. H. & Othman, M. H. D. Overview of Bile Acids Signaling and Perspective on the Signal of Ursodeoxycholic Acid, the Most Hydrophilic Bile Acid, in the Heart. Biomolecules 8, 159 (2018). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3266597","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":227301612,"identity":"cd8d08ad-7b2c-4954-b10f-4cb4f7cdfaad","order_by":0,"name":"Jiahui Liu","email":"","orcid":"","institution":"Shandong University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jiahui","middleName":"","lastName":"Liu","suffix":""},{"id":227301613,"identity":"1bcd0954-82dd-49cb-abb9-36a0beca4757","order_by":1,"name":"Xiunan Wei","email":"","orcid":"","institution":"Shandong University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiunan","middleName":"","lastName":"Wei","suffix":""},{"id":227301615,"identity":"332751bd-64b1-47af-a12a-b74a8065d4c7","order_by":2,"name":"Yonggang Dai","email":"","orcid":"","institution":"Shandong Provincial Third Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yonggang","middleName":"","lastName":"Dai","suffix":""},{"id":227301616,"identity":"1ed458d8-aeef-4fd7-8e01-58eb20bb2e72","order_by":3,"name":"Gongyi Li","email":"","orcid":"","institution":"Shandong University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Gongyi","middleName":"","lastName":"Li","suffix":""},{"id":227301618,"identity":"4518cffc-fd9b-4c20-bca1-e4b57e1d83e4","order_by":4,"name":"Miaomiao Zhang","email":"","orcid":"","institution":"Shandong University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Miaomiao","middleName":"","lastName":"Zhang","suffix":""},{"id":227301620,"identity":"8e8fce93-4e1c-4ba2-a405-8acc3c8c69f3","order_by":5,"name":"Junwei Liang","email":"","orcid":"","institution":"Affiliated Hospital of Shandong University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Junwei","middleName":"","lastName":"Liang","suffix":""},{"id":227301622,"identity":"7dd672ae-3c86-4b6f-95f8-e956bebb9098","order_by":6,"name":"Yan Cheng","email":"","orcid":"","institution":"Affiliated Hospital of Shandong University of Traditional Chinese Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Cheng","suffix":""},{"id":227301624,"identity":"215bacef-bcc5-426c-a0f4-6466c507ffd2","order_by":7,"name":"Lili Chi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvElEQVRIiWNgGAWjYDACCcbGAwkFEgx87I2NDz4QqaXhQIKBBAMbz+FmwxnEaWFgOMBgwMDAJpHeJs1BjA7+2c0NBx4YWCS2ST5skGZgsJPTbSBkyZ2DYIcltkknNhgXMCQbmx0goAWoGKEleQbDgcRtxGuRPNhwmIc0LcDQbiZKi8QNiBbjNp7EZsYZBkT4hX9G+sOHPyrqZPvZjz//8aHCTo6gFhhwbIC4k0jlIGBPgtpRMApGwSgYaQAAA75FGeTfS/4AAAAASUVORK5CYII=","orcid":"","institution":"Affiliated Hospital of Shandong University of Traditional Chinese Medicine","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Lili","middleName":"","lastName":"Chi","suffix":""}],"badges":[],"createdAt":"2023-08-15 17:14:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3266597/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3266597/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":42018503,"identity":"194c3253-bcde-4e72-85e2-4909f0f5534a","added_by":"auto","created_at":"2023-08-23 14:49:19","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":174107,"visible":true,"origin":"","legend":"\u003cp\u003eThe general condition, small intestine propulsion rate, echocardiography and serology of the rat groups were compared. (A) Rats in the AAC+CL group and TAC+CL group exhibited symptoms of abdominal distension, diarrhea and ascites. (B) Changes in body weight in rats among groups between 0-8 weeks. (C)Intestinal propulsive rate; (D-G)Statistical analysis of LVIDs,LVIDd,EF,FS in the seven groups; (H-K)BNP,TMAO,DAO,LPS level of serum. Data are presented as medians and quartiles (IQRs). *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs. CON group. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05, \u003csup\u003e##\u003c/sup\u003e \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs. Sham1 group. \u003csup\u003e\u0026amp;\u003c/sup\u003e\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05, \u003csup\u003e\u0026amp;\u0026amp;\u003c/sup\u003e\u003cem\u003ep\u0026lt;\u003c/em\u003e0.01 vs. Sham2 group.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3266597/v1/7645e3fc1c35fdee454fecf7.png"},{"id":42017147,"identity":"54d7bc9a-ac4f-44ce-a518-2f7cbb56928c","added_by":"auto","created_at":"2023-08-23 14:41:19","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":855090,"visible":true,"origin":"","legend":"\u003cp\u003eH\u0026amp;E staining and Masson staining in myocardial tissue among rat groups. (A-G) H\u0026amp;E staining results of myocardial tissue of rats in the CON group, Sham 1 group, Sham 2, AAC group, TAC group, AAC+CL group, and TAC+CL group are presented in sequence. (H) Comparison of cardiomyocyte area among the groups. (I-O) The Masson staining results of myocardial tissue of rats in the CON group, Sham 1 group, Sham 2, AAC group, TAC group, AAC+CL group, and TAC+CL group are presented in sequence. (P) Comparison of the myocardial fibrosis area proportion among the groups. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs. CON group. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs. Sham1 group. \u003csup\u003e\u0026amp;\u003c/sup\u003e\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05, \u003csup\u003e\u0026amp;\u0026amp;\u003c/sup\u003e\u003cem\u003ep\u0026lt;\u003c/em\u003e0.01 vs. Sham2 group.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3266597/v1/779709f3d7686b6fe7a82c00.png"},{"id":42017150,"identity":"fcdab4cd-fc43-478e-84d2-e554dd25605d","added_by":"auto","created_at":"2023-08-23 14:41:19","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":632230,"visible":true,"origin":"","legend":"\u003cp\u003eH\u0026amp;E staining in jejunum and ileal tissue, electric microscopy in ileal tissue among rat groups, and relative mRNA expression of myocardial and ileal tissues. (A-G) The H\u0026amp;E staining results of jejunum tissue of rats in the CON group, Sham 1 group, Sham 2, AAC group, TAC group, AAC+CL group, and TAC+CL group are presented in sequence. (H) Comparison of the villi/crypt ratio among the groups. (I-O) The H\u0026amp;E staining results of ileal tissue of rats in the CON group, Sham 1 group, Sham 2, AAC group, TAC group, AAC+CL group, and TAC+CL group are presented in sequence. (P) Comparison of the number of ileal villi among the groups. (Q-W) The electron microscopy results of ileal tissue of rats in the CON group, Sham 1 group, Sham 2, AAC group, TAC group, AAC+CL group, and TAC+CL group are presented in sequence. *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs. CON group. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs. Sham1 group. \u003csup\u003e\u0026amp;\u003c/sup\u003e\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05, \u003csup\u003e\u0026amp;\u0026amp;\u003c/sup\u003e\u003cem\u003ep\u0026lt;\u003c/em\u003e0.01 vs. Sham2 group. (X) Differences in the relative mRNA expression levels of BNP, ANP, Col1a1 in myocardial tissues and ZO-1 in ileal tissues were observed between the Sham2 group and TAC+CL group. *\u003cem\u003ep\u0026lt;\u003c/em\u003e0.05.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3266597/v1/df82748a9e7620ad09332ab8.png"},{"id":42017146,"identity":"16381cbf-f42c-42db-9717-9345cd5797b7","added_by":"auto","created_at":"2023-08-23 14:41:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":145545,"visible":true,"origin":"","legend":"\u003cp\u003eRelationship between microbiota and serum metabolites in the CHF\u0026amp;ID model. (A) Differences in the intestinal flora at the genus level between the Sham2 group and the TAC+CL group. (B) Results of LEFSE analysis. The histogram shows the phyla, classes, orders, families and genera with LAD scores \u0026gt;|3|. Red represents the CON group, and green represents the TAC+CL group. (C) Relative abundance heatmap of microbiota functions based on the KEGG database on the third level. (D) Hierarchical clustering analysis (HCA) for the Sham2 group and TAC+CL group metabolites based on their z-normalized abundances. (E) Pearson correlation was utilized to investigate the associationbetween gut microbiota and metabolites. (F) The network of associations between microbiota and serous BNP, TMAO, DAO, and LPS concentrations. The red lines represent positive correlations, while the green lines represent negative correlations. The thickness of the line represents the level of the correlation coefficient.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3266597/v1/9c26a923c80a8f428411a272.png"},{"id":42019668,"identity":"defda832-f9cd-442b-84da-d0b29f35caaa","added_by":"auto","created_at":"2023-08-23 14:57:19","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":145532,"visible":true,"origin":"","legend":"\u003cp\u003eThis study revealed the pathological mechanism of CHF\u0026amp;ID.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3266597/v1/ee1cc27594ce1550eaed9e93.png"},{"id":42018501,"identity":"6eecf9d0-2f0d-4ec3-8326-b599b99d8ed8","added_by":"auto","created_at":"2023-08-23 14:49:19","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":331236,"visible":true,"origin":"","legend":"\u003cp\u003eDifferent molding methods. (A) Abdominal aortic constriction (AAC)group.(B) Transverse aortic constriction (TAC) group, (C) AAC combined with cecum ligation (AAC+CL) group. (D-E) TAC combined with cecum ligation (TAC+CL) group.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3266597/v1/2fb41ee5ae955641f264d246.png"},{"id":51349164,"identity":"fbb08695-b878-4e1c-bbef-62425387370b","added_by":"auto","created_at":"2024-02-20 04:36:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2577063,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3266597/v1/d39748d8-9531-469a-b70e-b3cd54dfd3f7.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"A Rat Model of Chronic Heart Failure Combined with Intestinal Dysfunction and Alterations in the Microbiome and Metabolomics","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCHF is a prevalent and life-threatening disease affecting over 37.7\u0026nbsp;million individuals globally\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e, with its incidence steadily increasing year by year\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. As the leading cause of hospitalization among the Chinese population, CHF imposes a significant burden on healthcare systems\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. CHF affects multiple organs throughout the body, with the intestinal tract being particularly susceptible to damage. This can result in intestinal biological, physical, immune and chemical barriers, leading to ID and even failure\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Consequently, ID results in the translocation of bacteria and their metabolites into the bloodstream, exacerbating heart failure\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Additionally, ID-induced symptoms such as nausea, vomiting, anorexia, diarrhea, constipation, abdominal distension and pain can contribute to malnutrition and further burden patients with this condition\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. The impact of malnutrition and subsequent cachexia on the clinical course of congestive heart failure and the quality of life of patients has been demonstrated by numerous studies\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. The intestinal mucosal barrier and intestinal microbiota have emerged as novel therapeutic targets for cardiovascular disease\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. The pathophysiology of CHF \u0026amp; ID remains poorly understood, with limited research conducted on this topic. Recent studies have highlighted the significance of dysbiosis\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e and metabolic disorders\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e as not only pathological factors in CHF but also crucial contributors to the development of ID\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. These viewpoints suggest that dysbiosis and metabolic disorders may serve as primary etiological factors underlying CHF and ID.\u003c/p\u003e \u003cp\u003eAnimal models are important tools for studying the developmental regression of the disease and the therapeutic effects of drugs. Animal models of aortic arch constriction (TAC) and abdominal aortic constriction (AAC) are widely used in the study of CHF\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Animal models of ID are commonly used in the study of sepsis\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, acute pancreatitis\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e, and inflammatory bowel disease\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. However, there is a lack of research on the construction and evaluation of animal models of CHF \u0026amp; ID comorbidities. In this study, we compared and evaluated four modeling methods, namely, AAC, TAC, AAC\u0026thinsp;+\u0026thinsp;CL, and TAC\u0026thinsp;+\u0026thinsp;CL, to find the best rat CHF\u0026amp;ID modeling method, which can provide a tool for the study of pathological mechanisms and drugs for this disease. In addition, this study examined the intestinal microbiota and serum metabolites of rats in the TAC\u0026thinsp;+\u0026thinsp;CL group to investigate the pathogenesis.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eSymptoms and behavior of rats\u003c/p\u003e \u003cp\u003eAll rats in the model groups survived except for one death each in the AAC and AAC\u0026thinsp;+\u0026thinsp;CL groups during the modeling period. The Sham 1 and Sham 2 groups had poorer mobility, grip strength, and mental status than the CON group in the first week after surgery, lower food and water intake, and less feces than the CON group, with no abnormal secretion. They recovered to baseline levels in the second to eighth weeks. Compared with the sham and CON groups, the rats in each model group had more withered and loose hair, increased eyelid secretion, decreased mobility and grip strength, decreased food and water intake, depressed mental state, slow reaction, and different degrees of asthma and sputum, and individually exhibited pink foamy sputum, foot and paw, head and facial edema, in addition to the above symptoms. The AAC\u0026thinsp;+\u0026thinsp;CL and TAC\u0026thinsp;+\u0026thinsp;CL groups also showed abdominal distension, diarrhea, and hydroperitoneum (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eThe weight change curves of rats in each group from 0 to 8 weeks can be seen (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). The growth trend of rats in each group from 0 to 4 weeks was the same. The rats in the CON, Sham1, and Sham2 groups continued to increase in body weight after 4 weeks. The growth trend of each model group leveled off after 4 weeks, especially the TAC and AAC\u0026thinsp;+\u0026thinsp;CL groups, which showed a significant decreasing trend after week 7, and the AAC and TAC\u0026thinsp;+\u0026thinsp;CL groups stopped growing after week 4. At the end of the experiment, there was no statistically significant difference in body weight between the Sham 1 and Sham 2 groups compared to the CON group. Compared to the CON group, all model groups showed a significant decrease in body weight (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). Compared to the sham groups, the AAC, AAC\u0026thinsp;+\u0026thinsp;CL, and TAC groups showed a significant decrease in body weight (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01). There was no statistically significant difference in body weight between the model groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). We hypothesized that the body weight of rats in the TAC\u0026thinsp;+\u0026thinsp;CL group did not significantly differ from that in the sham2 group, possibly due to the pronounced presence of ascites during later stages.\u003c/p\u003e \u003cp\u003eComparison of small intestinal transit rates\u003c/p\u003e \u003cp\u003eWe evaluated the small intestinal transit rate by gavage with methylene blue solution (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). There was no statistically significant difference in the small intestinal transit rate in the sham group compared with the CON group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), and there was a significant decrease in all model groups (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01). Compared with that in the Sham1 group, the small intestinal transit rate decreased in the AAC and AAC\u0026thinsp;+\u0026thinsp;CL groups (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). Compared with the Sham2 group, the small intestinal transit rate decreased in the TAC and TAC\u0026thinsp;+\u0026thinsp;CL groups (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). There was no statistically significant difference in the small intestinal transit rate between the model groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003eComparison of cardiac function\u003c/p\u003e \u003cp\u003eWe evaluated the cardiac function of rats in each group by echocardiography at 8 weeks after modeling (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e(D-G)). left ventricular ejection fraction (EF), fractional shortening (FS), and left ventricular internal diameter systolic (LVIDs) in the AAC group were significantly lower (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) than those in the CON and Sham1 groups, while there was no statistically significant difference in left ventricular internal diameter diastolic (LVIDd) compared with the CON group. In the TAC group, LVIDs, LVIDd, EF, and FS were significantly lower (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) than those in the CON and Sham2 groups. LVIDs, EF, and FS in the AAC\u0026thinsp;+\u0026thinsp;CL group were significantly lower (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) than those in the CON group, but there was no significant difference compared to the Sham1 group. LVIDs, LVIDd, EF, and FS in the TAC\u0026thinsp;+\u0026thinsp;CL group were significantly lower (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01) than those in the CON and Sham1 groups.\u003c/p\u003e \u003cp\u003eComparison of serum BNP, TMAO, DAO, and LPS concentrations\u003c/p\u003e \u003cp\u003eAfter modeling, serum concentrations of BNP, TMAO, DAO, and LPS were determined for each group to evaluate cardiac function and the intestinal mucosal barrier (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e(H-K)). No statistically significant difference was observed in the levels of serum BNP, TMAO, DAO, and LPS between the sham group and the CON group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Compared with the CON and sham groups, the levels of BNP and TMAO were differentially elevated in all model groups (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05, \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01). The levels of DAO and LPS were significantly higher in the AAC\u0026thinsp;+\u0026thinsp;CL and TAC\u0026thinsp;+\u0026thinsp;CL groups than in the CON group and the sham group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating the presence of leaky gut in these two groups. Compared to the CON group, the AAC group exhibited significantly elevated levels of DAO and LPS, while no significant difference was observed compared to the Sham1 group. No significant difference in DAO (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) was found between the TAC group and the CON group, but higher LPS levels were detected in the former (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). There was no significant difference in DAO and LPS levels between the TAC group and the Sham2 group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHistopathological changes in cardiac tissues\u003c/p\u003e \u003cp\u003eWe performed H\u0026amp;E staining on the myocardial tissues of rats in each group and analyzed the pathological and histological changes after modeling (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e(A-G)). The myocardial tissue of both the CON and sham groups exhibited a compact structure without inflammatory cell infiltration, with well-organized and uniform cardiomyocytes, as well as nuclei sizes that were consistent throughout. In all model groups, myocardial tissue showed a loosely arranged structure with increased interstitial space between cells. In addition, inflammatory cell infiltration was observed. Cardiomyocytes were disorganized and hypertrophic, with some nuclei missing. Compared to the CON group, a significant increase in cardiomyocyte area was observed in the AAC, TAC, AAC\u0026thinsp;+\u0026thinsp;CL, and TAC\u0026thinsp;+\u0026thinsp;CL groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Furthermore, there was a significant increase in cardiomyocyte area in the AAC and AAC\u0026thinsp;+\u0026thinsp;CL groups compared to the Sham1 group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In addition, both the TAC and TAC\u0026thinsp;+\u0026thinsp;CL groups showed a significant increase in cardiomyocyte area compared to the Sham2 group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eMasson's staining results of rat myocardial tissues in each group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e(I-O)) showed a significant increase in the area of collagen fibers within the interstitial matrix of rat myocardial cells and an increase in the area of collagen fibrils in each model group compared with both the CON and sham groups. According to the results obtained from ImageJ software measurements (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eP), the percentage of myocardial fibrosis area was significantly increased in each model group compared to the CON group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Furthermore, all model groups exhibited a significant increase in the percentage of myocardial fibrosis area compared to the Sham groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHistopathological changes in jejunum and ileum tissues\u003c/p\u003e \u003cp\u003eAs shown by the results of H\u0026amp;E staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e(A-G)) and the jejunal villus length/crypt depth ratio (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH) of the rat jejunum in each group, the jejunal villi in the CON and Sham groups were compact and neatly arranged, with slender and elongated morphology, abundant crypts, and a normal number of cup cells. The jejunal villi of the model groups were sparse and disorganized in their arrangement, with a wide, shortened and truncated morphology, and some of them were broken. The number of jejunal villi was reduced, and the number of cup cells was increased in the model groups. Furthermore, the jejunal villus length/crypt depth ratio in each model group was significantly decreased compared with that in the CON and sham groups \u003cem\u003e(p\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). The results of H\u0026amp;E staining of the ileum in each group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e(I-O)) showed that the ileal villi and epithelial cells in the CON and sham groups had an intact structural organization without any infiltration of inflammatory cells. In contrast, the model group showed sparse, broken, and detached ileal villi, atrophied glands, and inflammatory cell infiltration. Additionally, a significant decrease in the number of ileal villi was observed in each model group compared to the CON and sham groups (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eP).\u003c/p\u003e \u003cp\u003eThe microvilli on the surface of ileal epithelial cells in the CON and Sham groups exhibited dense and orderly arrangements, normal lengths, absence of shedding, tight and clear TJs, and normal mitochondrial morphology. In contrast, the model groups displayed loose and disorganized microvilli with shortened or broken lengths, widened or fuzzy cell gaps, and swollen mitochondria. Notably, significant alterations were observed in the AAC\u0026thinsp;+\u0026thinsp;CL and TAC\u0026thinsp;+\u0026thinsp;CL groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e(Q-W)).\u003c/p\u003e \u003cp\u003eTAC\u0026thinsp;+\u0026thinsp;CL modeling induces myocardial tissue remodeling and intestinal barrier damage in rats\u003c/p\u003e \u003cp\u003eAll of the above results suggest that the TAC\u0026thinsp;+\u0026thinsp;CL modeling method has a better CHF\u0026amp;ID characterization and a lower mortality rate compared with the other three methods. Next, we determined the expression levels of BNP, ANP and Col1a1 mRNA in myocardial tissue and ZO-1 mRNA in ileal tissue of rats in the TAC\u0026thinsp;+\u0026thinsp;CL group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eX). Compared with the Sham2 group, BNP, ANP and Col1a1 mRNA expression levels in myocardial tissues were upregulated (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and ZO-1 mRNA expression levels in ileal tissues were decreased (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results confirm the development of cardiomyocyte hypertrophy and fibrosis and the impairment of intestinal barrier function in the TAC\u0026thinsp;+\u0026thinsp;CL rat model, further suggesting its stability.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTAC\u0026thinsp;+\u0026thinsp;CL alters intestinal microbiota and serum metabolites\u003c/p\u003e \u003cp\u003ePrevious studies have demonstrated alterations in the intestinal microbiota in patients with CHF, but changes in the intestinal microbiota specific to CHF\u0026amp;ID remain unknown. In this study, we analyzed the cecal contents of the CHF\u0026amp;ID model to investigate shifts in intestinal microbial composition. The Kruskal‒Wallis test revealed that at the genus level, there was an enrichment in the abundance of \u003cem\u003eBacteroides, Ruminococcaceae_UCG-005, NK4A214_group, Family_XIII_AD3011_group, Allobaculum, Fournierella, Lachnospiraceae_UCG-010, Holdemania\u003c/em\u003e and \u003cem\u003eBifidobacterium\u003c/em\u003e in the TAC\u0026thinsp;+\u0026thinsp;CL group, while \u003cem\u003eRoseburia, Oscillibacter\u003c/em\u003e and \u003cem\u003eTuzzerella showed a decrease\u003c/em\u003e (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). To display indicator species visually, we performed a linear discriminant analysis (LDA) effect size analysis (LEfSe) with LDA score＞3 and p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Compared with the Sham2 group, 10 genus-level differential taxa, including \u003cem\u003eg__Bacteroides, g__UCG_005, g__Christensenellaceae_R_7_group, g__NK4A214_group, g__Family_XIII_AD3011_group, g__Candidatus_Soleaferrea, g__Allobaculum, g__Bifidobacterium, g__Fournierella, and g__Blautia\u003c/em\u003eAlterations, were found to be enriched in the rat intestinal microbiota after modeling. Kyoto Encyclopedia of Genes and Genomes (KEGG) was used to annotate the function of the microbiota. Twenty-three KEGG pathways were significantly altered in the TAC\u0026thinsp;+\u0026thinsp;CL group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC), including biosynthesis of unsaturated fatty acids, fatty acid degradation, choline metabolism in cancer, alanine, aspartate and glutamate metabolism, arginine and proline metabolism, arginine biosynthesis, necroptosis, and cardiac muscle contraction.\u003c/p\u003e \u003cp\u003eHierarchical clustering was performed on the expression of the top 50 significant metabolites ranked by variable importance of projection (VIP), and among those significantly upregulated were LysoPC(0:0/18:2(9Z,12Z)), LysoPC(18:3(9Z,12Z,15Z)/0:0), PC(17:1(9Z)/0:0), ethenyl acetate, glycoursodeoxycholic acid, 11-hydroxyhexadecanoylcarnitine, alanine lactate, etc. (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). The downregulated metabolites included PA(a-21:0/PGF2alpha), beta-D-fructose 2,6-bisphosphate, and N-undecylbenzenesulfonic acid (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01). The majority of the aforementioned metabolites were classified within the Super Class of Lipids and Lipid-like molecules, indicating that lipid metabolism may play a crucial role in the pathogenesis of CHF\u0026amp;ID.\u003c/p\u003e \u003cp\u003eCorrelation analysis between intestinal microbiota and serum metabolites\u003c/p\u003e \u003cp\u003eTo investigate the underlying mechanism contributing to the observed outcomes in the CHF\u0026amp;ID animal model, we conducted correlation analyses between intestinal microbiota and serum metabolites. We selected the top 20 entries with the most significant microbial differences and metabolite differences separately and calculated their correlations (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). The intestinal microbiota exhibited a significant correlation with serum metabolites, wherein \u003cem\u003eBifidobacterium\u003c/em\u003e showed a strong association with metabolites such as 3-sulfodeoxycholic acid and lysoPC(20:3(8Z,11Z,14Z)/0:0) (|r| \u0026gt; 0.8, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Additionally, \u003cem\u003eFamily_XIII_AD3011_group\u003c/em\u003e was strongly correlated with chenodeoxycholic acid and tetracosahexaenoic acid (|r|\u0026gt;0.8, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01), while \u003cem\u003eLachnospiraceae_UCG-010\u003c/em\u003e demonstrated a robust relationship with 3-sulfodeoxycholic acid (|r|\u0026gt;0.8, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The findings of this study suggest a significant correlation between alterations in the microbiome of CHF\u0026amp;ID rats and changes in serum metabolites, particularly with respect to bile acid metabolism within lipid metabolism.\u003c/p\u003e \u003cp\u003eIntestinal microbiota is associated with alterations in serum indicators of CHF and ID\u003c/p\u003e \u003cp\u003eCorrelation analysis was performed to investigate the relationship between the intestinal microbiota and serum indicators of CHF, including BNP and TMAO, as well as serum indicators of ID, such as LPS and DAO. A total of 24 genera exhibited correlation coefficients |6|\u0026gt;0.6 with these four indicators, and the significant associations were visualized using network diagrams (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Notably, BNP showed a significantly positive correlation with \u003cem\u003eTuzzerella\u003c/em\u003e (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The levels of TMAO were found to be positively correlated with \u003cem\u003eOscillibacter\u003c/em\u003e and \u003cem\u003eTuzzerella\u003c/em\u003e (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). LPS was significantly and positively associated with \u003cem\u003eTuzzerella\u003c/em\u003e, \u003cem\u003eRuminiclostridium\u003c/em\u003e, and \u003cem\u003ePeptococcus\u003c/em\u003e (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). DAO showed a significant negative correlation with NK4A214_group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01), while it exhibited a significant positive correlation with \u003cem\u003eRoseburia, Tuzzerella, Pygmaiobacter, Acetatifactor\u003c/em\u003e, and \u003cem\u003ePeptococcus\u003c/em\u003e (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Furthermore, the presence of \u003cem\u003eTuzzerella\u003c/em\u003e was significantly linked to all four serologic indicators and may serve as the key causative agent for CHF\u0026amp;ID.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe intestinal tract serves not only as a site for nutrient absorption but also as a critical defense mechanism against the entry of harmful substances into the body. Impairment of the intestinal mucosal barrier leads to ID\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, which has been observed in several systemic diseases\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. The intestinal tract has an abundant vascular and blood supply that is highly susceptible to ischemia, congestion and anoxia\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. CHF represents the advanced stage of several chronic cardiovascular diseases and often results in circulatory disturbances. Therefore, ID is implicated as both an early contributor to the pathogenesis of CHF and a late factor in recovery, while also triggering or exacerbating systemic inflammatory response syndrome and multiorgan failure\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. However, despite its significance in CHF development, the underlying mechanisms of CHF \u0026amp; ID remain unclear, and there is a dearth of reports on animal models for this condition. Thus, it is crucial to establish stable and reliable animal models for studying disease mechanisms and evaluating drug efficacy.\u003c/p\u003e \u003cp\u003eTAC and AAC are the most commonly utilized modeling methods for CHF. In this study, we applied these two modeling methods and observed nonsignificant changes in LPS and DAO levels compared with the sham groups. We postulate that ID is a comorbidity that arises in the mid-to-late stage of CHF and gradually develops from the disease process, whereas TAC and AAC have an 8-week modeling cycle that may not fully capture ID. To overcome this limitation, we utilized absorbable surgical sutures for the ligation of the distal third of the cecum to establish an experimental model of ID. Studies have demonstrated that the rat cecum, which is a crucial organ for fermenting plant-based foods\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e and absorbing nutrients such as vitamins and calcium\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e, possesses abundant blood vessels and is larger than its human counterpart. Ligation of the cecum in rats results in both ischemia and reperfusion of the terminal ileum, leading to pseudo-obstruction that hinders digestion and absorption processes, ultimately causing ID. In conjunction with aortic narrowing, this results in a comprehensive model encompassing both diseases. The success and fidelity of the modeling were confirmed through histopathological examination of the heart and small intestine, cardiac ultrasound imaging, and measurements of BNP, LPS, TMAO, and DAO. The findings demonstrated that all four modeling approaches induced myocardial hypertrophy, myocardial fibrosis, and impaired cardiac function, along with elevated levels of TMAO and BNP in rats. However, in terms of the overall condition of rats, as well as jejunal villus/crypt ratio, ileal villus number, and intestinal barrier function serum indicators such as DAO and LPS, the characterization obtained by AAC\u0026thinsp;+\u0026thinsp;CL and TAC\u0026thinsp;+\u0026thinsp;CL exhibited greater similarity to ID. Combined with the observed mortality rate, our findings suggest that the TAC CL molding method exhibits stability, low mortality rates and high repeatability. The TAC\u0026thinsp;+\u0026thinsp;CL group exhibited a significant upregulation in the PCR results of myocardial tissue BNP, ANP, and Col1a1, and this was further supported by increased ileal tissue ZO-1 expression. Both Huo \u003cem\u003eet al\u003c/em\u003e.\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e and Nicola \u003cem\u003eet al\u003c/em\u003e.\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e reported an increase in intestinal permeability, as well as significantly elevated mRNA expression of intestinal ZO-1 and LPS levels in the HF model, which is similar to our findings. However, in contrast to other studies that consider ID as a pathological manifestation of the disease, we have classified it as a distinct disease entity. Therefore, in this study, we not only observed the absence of small intestinal villi, disorganization of epithelial structure, and inflammatory response in rats but also identified gastrointestinal symptoms such as reduced food intake, abdominal distention, and altered bowel movements that are consistent with clinical manifestations in patients with CHF\u0026amp;ID\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. This comprehensive evaluation better captures the intricate clinical features and pathological mechanisms.\u003c/p\u003e \u003cp\u003eIn recent years, numerous studies have demonstrated the crucial role of intestinal microbiota in the development of CHF through metabolic, immune and renal vascular pathways\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. However, investigations into changes in intestinal microbiota among CHF patients with intestinal comorbidities remain limited. To address this gap, we employed a combination of microbiome and metabolome approaches to analyze the characterization and relationship between intestinal microbiota and serum metabolome in a TAC\u0026thinsp;+\u0026thinsp;CL-induced CHF\u0026amp;ID model. Our findings not only shed light on the pathogenesis of this disease but also identify novel biomarkers. We observed alterations in the intestinal microbiota of CHF\u0026amp;ID model rats compared to the Sham2 group, including an enrichment of \u003cem\u003eBacteroides and Lachnospiraceae\u003c/em\u003e. Zhou \u003cem\u003eet al\u003c/em\u003e.\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e reported that in patients with ST-segment elevation myocardial infarction, intestinal \u003cem\u003eLactobacillus, Bacteroides\u003c/em\u003e, and \u003cem\u003eStreptococcus\u003c/em\u003e were predominant in their blood samples. Liu \u003cem\u003eet al\u003c/em\u003e.\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e reported that \u003cem\u003eBacteroides plebeius\u003c/em\u003e and \u003cem\u003eFusobacterium\u003c/em\u003e were enriched in patients with valvular calcification. Additionally, \u003cem\u003eBacteroides sp., Bacteroides plebeius\u003c/em\u003e, and \u003cem\u003eLactobacillus\u003c/em\u003e were associated with hyperlipidemia. Finally, an increased abundance of \u003cem\u003eBacteroides spp.\u003c/em\u003e and a decreased abundance of \u003cem\u003eRoseburia\u003c/em\u003e were found in high-fat Apoe-/- mice fed L-alpha-glycerylphosphorylcholine. Our findings on bacterial colonization align with previous studies, indicating that \u003cem\u003eOscillibacter\u003c/em\u003e and \u003cem\u003eTuzzerella\u003c/em\u003e may play a role in reducing the risk of cardiovascular diseases such as atherosclerosis\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e and dyslipidemia\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e, as well as other chronic conditions such as obesity\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e and chronic kidney disease\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. These bacteria are considered potential pathogens for these diseases. Interestingly, we observed a significant correlation between \u003cem\u003eTuzzerella\u003c/em\u003e and BNP and TMAO, which are serum indicators of CHF, and LPS and DAO, which are serum indicators of ID. Previous studies have reported a strong association between LPS and \u003cem\u003eTuzzerella\u003c/em\u003e in obese patients\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e and in models of cyclophosphamide-induced intestinal mucosal barrier injury\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. These findings suggest that \u003cem\u003eTuzzerella\u003c/em\u003e may play a role in mediating myocardial remodeling, leaky gut syndrome, and metabolic endotoxemia.\u003c/p\u003e \u003cp\u003eOur metabolomic analysis revealed elevated levels of LysoPC (0:0/18:2(9Z,12Z)), LysoPC (18:3(9Z,12Z,15Z)/0:0), and PC (17:1(9Z)/0:0). Previous studies have demonstrated that lysophosphatidylcholines (lysoPCs) can induce inflammation by activating macrophages and T lymphocytes\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Furthermore, lysoPCs and phosphatidylcholines (PCs) are established markers for atherosclerosis and cardiac damage\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Tappia \u003cem\u003eet al\u003c/em\u003e.\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e discovered that phosphatidic acid can enhance cardiac contractile performance by increasing Ca2\u0026thinsp;+\u0026thinsp;levels through the activation of phospholipase C, while defects in phosphatidic acid-mediated signaling pathways were observed in failing hearts. Our study also revealed a decrease in the levels of phosphatidic acid. Interestingly, KEGG pathway analysis of intestinal microbiota showed significant enrichment of lipid pathways such as unsaturated fatty acid biosynthesis, fatty acid degradation, and choline metabolism in cancer. Choline, phosphatidylcholines\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e, and carnitine\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e serve as precursors for TMAO production, which increases the risk of cardiovascular events. Specific intestinal microbiota, such as \u003cem\u003ePrevotella spp.\u003c/em\u003e and \u003cem\u003eBacteroides spp.\u003c/em\u003e, catabolize these substances to trimethylamine (TMA), which is further metabolized by the liver into TMAO\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e, highlighting the crucial role of lipid metabolism in this disease. Additionally, our study revealed a significant elevation in alanine lactate levels. Both alanine and lactate are glycolysis products that increase in pathological conditions. The study conducted by Raimo \u003cem\u003eet al\u003c/em\u003e.\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e revealed a significant correlation between alanine and CAD events. Studies\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e,\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e proposed that lactate promotes the excessive production of reactive oxygen species, which in turn mediates oxidative stress and mitochondrial damage, ultimately leading to the development of myocardial infarction and heart failure. Furthermore, D-lactate and L-lactate, two conformers of lactate, are widely employed as markers for detecting intestinal mucosal damage and assessing the integrity of the intestinal mucosal barrier. These findings suggest that these metabolites may serve as common pathological products in both CHF and ID diseases.\u003c/p\u003e \u003cp\u003eThe intestinal microbiota in the small intestine plays an important role in regulating host metabolism. Our analysis of intestinal microbiota-metabolite correlations in the CHF\u0026amp;ID model revealed significant alterations in \u003cem\u003eBifidobacterium\u003c/em\u003e, \u003cem\u003eFamily_XIII_AD3011_group\u003c/em\u003e, \u003cem\u003eLachnospiraceae_UCG-010\u003c/em\u003e, \u003cem\u003eRuminococcaceae_UCG-005\u003c/em\u003e and other intestinal microorganisms that are closely related to the metabolism of bile acids such as chenodeoxycholic acid, tetracosahexaenoic acid, and 3-sulfodeoxycholic acid\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. Bile acids (BAs) play a crucial role in coronary artery disease and intestinal mucosal barrier function. The interaction between the gut microbiota and host intestinal barrier is mediated by BAs and short-chain fatty acid metabolism. Sinha \u003cem\u003eet al\u003c/em\u003e.\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e reported that BAs possess anti-inflammatory properties and exert a protective effect on the intestinal mucosa by reducing stress on epithelial cells and modulating intestinal immunity via G protein-coupled receptor 5 expressed in immune cells. Following colectomy, patients with ulcerative colitis exhibit decreased levels of secondary bile acids and increased levels of primary bile acids. Desai \u003cem\u003eet al\u003c/em\u003e.\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e demonstrated that excess bile acids impede fatty acid oxidation in cardiomyocytes, leading to pathological manifestations such as cardiac hypertrophy and bradycardia in a model of bile acid overload induced by double knockout of \u003cem\u003eCholecardia, Fxr, and Shp.\u003c/em\u003e These findings suggest that bile acids may serve as important mediators of intestinal microbiota dysbiosis, resulting in damage to the intestinal mucosal barrier and remodeling of cardiomyocytes and leading to CHF and ID.\u003c/p\u003e \u003cp\u003eOverall, we have developed a more robust animal modeling approach for CHF\u0026amp;ID and identified significant changes in intestinal microbiota and serum metabolites in this model(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Our findings provide a clearer understanding of the role of microbiota and metabolism in CHF\u0026amp;ID, which lays a scientific foundation for developing treatments based on the cardio-intestinal axis. In future studies, we plan to explore the relationship between intestinal microbiota, metabolites, and CHF \u0026amp; ID using fecal bacteria transplantation and other advanced techniques.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eLaboratory animals\u003c/p\u003e \u003cp\u003eForty-two healthy male Wistar rats of SPF grade, weighing 6\u0026ndash;7 weeks of age and weighing 180\u0026thinsp;\u0026plusmn;\u0026thinsp;20 g, were obtained from Beijing Charles River Laboratory Animal Technology Co., Ltd. (SCXK(JING)2021-0006). The experimental procedures and animal care were conducted at the Experimental Animal Center of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine SYXK(LU)2018 0015, in compliance with national regulations on experimental animal management. This study was approved by the Animal Ethics Committee of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine (AWE-2022-009). All experimental animals adhered to ARRIVE guidelines and received humane treatment according to the National Research Council's Guidelines for the Care and Use of Laboratory Animals, following the principles of \"Reduce, Replace, and Optimize\" (3R).\u003c/p\u003e \u003cp\u003eAnimal model preparation\u003c/p\u003e \u003cp\u003eForty-two male Wistar rats were acclimatized for 7 days at a temperature of 24\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u003csup\u003e\u0026deg;\u003c/sup\u003eC, relative humidity of 60\u0026thinsp;\u0026plusmn;\u0026thinsp;5%, and a light-dark cycle of 12:12 h. The rats were then randomly assigned to the CON group, Sham 1 group, Sham 2 group, AAC group, TAC group, AAC\u0026thinsp;+\u0026thinsp;CL group, and TAC\u0026thinsp;+\u0026thinsp;CL group (n\u0026thinsp;=\u0026thinsp;6 each). Except for those in the CON group, all rats underwent routine anesthesia and preoperative skin preparation before being restrained on an operating table with their limbs and head immobilized. The surgical area was disinfected with iodophor.\u003c/p\u003e \u003cp\u003eIn the AAC group, a 3 cm midline incision was made along the subxiphoid process to expose the abdominal cavity layer by layer. The bowel was placed externally on saline-moistened gauze to keep the organs moist. The abdominal aorta, located 1.5-2 cm above the renal vein arteries, was identified and bluntly dissected. Subsequently, a 22 G disposable dental irrigation needle was positioned parallel to and near the abdominal aorta, followed by ligation using a 4\u0026thinsp;\u0026minus;\u0026thinsp;0 nonabsorbable suture. Thereafter, the dental irrigation needle was slowly withdrawn prior to closure of the incision layers and sterilization (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eIn the TAC group, a VentElite small animal ventilator (Harvard Apparatus Co., Ltd.) was externally connected to the cervical part of the trachea. The skin of the surgical area was incised, and the pectoral muscles were separated layer by layer. The second and third rib arches on the left side of the rats were cut, and an incision was opened with a spreader to fully expose the left side of the thoracic cavity. The thymus and aortic arch were bluntly separated, and a 22G disposable dental irrigation needle was placed immediately adjacent to the aortic arch. A 4\u0026thinsp;\u0026minus;\u0026thinsp;0 nonabsorbable suture was used to ligate both the aortic arch and the dental irrigation needle. After ligation, the dental irrigation needle was slowly withdrawn while closing each layer of the thoracic cavity prior to sterilization (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eIn the AAC\u0026thinsp;+\u0026thinsp;CL group, based on abdominal aortic reduction, the cecum was found and ligated in the middle and lower 1/3 of the cecum. The cecum was reintegrated into the abdominal cavity, and the abdomen was sutured layer by layer (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eIn the TAC\u0026thinsp;+\u0026thinsp;CL group, based on aortic arch narrowing, the abdominal cavity was opened by a 2-cm incision along the abdominal white line, the cecum was found and ligated in the middle and lower 1/3 of the cecum, the cecum was incorporated back into the abdominal cavity, and the abdomen was closed by layer-by-layer suturing (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e(D-E)).\u003c/p\u003e \u003cp\u003eIn the Sham1 group, the abdominal aorta was opened and isolated without ligation.\u003c/p\u003e \u003cp\u003eIn the Sham2 group, the thymus and aortic arch were bluntly separated without ligation.\u003c/p\u003e \u003cp\u003eAfter surgery, each surgical rat was housed in a single cage to avoid wound rupture and then housed in a combined cage after the surgical incision had healed.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eRecording symptoms and behaviors of rats\u003c/p\u003e \u003cp\u003eDuring the modeling period, the rats in each group were observed daily for hair, secretions, food and water consumption, feces, mobility, grip strength and mental status to evaluate their general condition. The changes in body weight were measured weekly.\u003c/p\u003e \u003cp\u003eEvaluation of small intestinal transit rate\u003c/p\u003e \u003cp\u003eAt week 8 after modeling, sampling was performed, and rats were given 2 ml of 2% methylene blue solution by gavage 30 minutes before sampling. The rats were sacrificed, their stomachs were ligated at both the pylorus and the end of the ileum, and the stomach and small intestine were removed. The displacement of the markers in the small intestine was measured, and the length of the whole small intestine was measured. The transit rate of the small intestine was measured for each group according to the following formula:\u003c/p\u003e \u003cp\u003eSmall intestine transit rate\u0026thinsp;=\u0026thinsp;the distance traveled by the methylene blue solution/the length of the small intestine \u0026times; 100\u003c/p\u003e \u003cp\u003eEchocardiography to determine cardiac function\u003c/p\u003e \u003cp\u003eEight weeks after surgery, echocardiography was performed on rats in each group. Rats were anesthetized with 1.5-2% inhaled isoflurane, placed on a heating pad and imaged using a Mindray UMT-200 ultrasound diagnostic device (Shenzhen Myriad Biomedical Electronics Co., Ltd.). Data on EF, FS, LVIDs, and LVIDd were collected, and the average of 3 consecutive cardiac cycles was taken for each index.\u003c/p\u003e \u003cp\u003eMeasurement of serum LPS, DAO, BNP, and TMAO concentrations\u003c/p\u003e \u003cp\u003eFollowing anesthesia, venous blood was obtained from the abdominal aorta, and cervical vertebrae were excised for euthanasia purposes. The collected blood was allowed to stand at room temperature for 1 hour before being centrifuged at 3000 rpm/min for 10 minutes. Subsequently, the serum was harvested and dispensed into 1 ml centrifuge tubes. The serum was centrifuged into 1 ml centrifuge tubes and operated according to the instructions of the ELISA kit (Shanghai Lengton Bioscience Co., LTD, Shanghai, China). An enzyme counter was utilized to measure the absorbance at 450 nm. The concentrations of LPS, DAO, BNP, and TMAO in serum were calculated from the standard curve.\u003c/p\u003e \u003cp\u003eHistopathological examination of the jejunum, ileum, and cardiac tissues\u003c/p\u003e \u003cp\u003eRat myocardial tissue, proximal jejunum, and distal ileum tissues were collected, fixed in 10% formalin solution, dehydrated, embedded in paraffin wax and sectioned into slices with a thickness of 4 \u0026micro;m. Hematoxylin and eosin (H\u0026amp;E) staining was performed on jejunum, ileum, and partial cardiac sections, while Masson's trichrome staining was used specifically for partial cardiac sections. Finally, the slides were sealed with neutral balsam sealant. High-resolution images were acquired using an automated digital pathology slide scanner (KF-PRO-020, KFBIO KONFOONG Bioinformation Tech CO., LTD, Ningbo, China). The cardiomyocyte cross-sectional diameter, cardiomyocyte area, and myocardial fibrosis area were quantitatively analyzed utilizing Image-Pro Plus software (Meyer Instruments, INC., Houston, USA).\u003c/p\u003e \u003cp\u003eEach group of rat ileal tissue (1 mm3) was fixed in 2.5% glutaraldehyde. The tissue was refixed in 1% osmium tetroxide, followed by phosphoric acid rinses and graded dehydration at 4\u0026deg;C. The samples were then embedded in Epon812 embedding medium at 37\u0026deg;C, 45\u0026deg;C and 60\u0026deg;C for 4 hours each. The embedded tissues were cut into approximately 1 \u0026micro;m semithin sections, double stained with a mixture of 3% uranyl acetate and lead citrate to enhance contrast, and examined under a transmission electron microscope (JEM-1200EX, JEOL Ltd., Tokyo, Japan) to observe ultrastructural changes such as changes in microvilli morphology and tight junction integrity.\u003c/p\u003e \u003cp\u003eRT‒PCR for mRNA expression in myocardium and ileum tissues\u003c/p\u003e \u003cp\u003eTotal RNA was extracted from myocardial and ileal tissues of the Sham2 group and the TAC\u0026thinsp;+\u0026thinsp;CL group using TRIzol reagent according to the instruction manual. The concentration was determined by an ultramicro spectrophotometer (Tnano-800, TUOHE Electromechanical Technology Co., Ltd., Shanghai, China), and 1 \u0026micro;g of RNA was reverse transcribed into cDNA. The amplification protocol included predenaturation at 95 ℃ for 30 s once, denaturation at 95 ℃ (15 s) followed by annealing/extension at 60 ℃ (30 s) for 40 cycles with melting curves at 95 ℃ (10 s), 65 ℃ (5 s), and then again at 95 ℃ (0.5℃). Three replicate wells were set up in each group to calculate the expression of BNP, ANP, and Col1a1 mRNA in myocardial tissue and ZO-1 mRNA in ileum tissue using the ddCT analysis protocol with primers designed by Platinum Bio-Tech (Shanghai, China). Primer sequences for ANP, BNP, Col1a1, ZO-1 and β-Actin are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used in RT‒PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eANP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATTTCAAGAACCTGCTAGACCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCATCGGTCTGCTCGCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBNP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTAGGTCTCAAGACAGCGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAAAACAACCTCAGCCCGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCol1a1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACTGCAAGAACAGCGTAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGTTCCGGTGTGACTCGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZO-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACAGAGCCGAGCAGTTAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAACATCAGCAATCGGTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-Actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCAGCTCAGTAACAGTCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCTGTGTGGGATTGGTGGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAnalysis of the intestinal microbiome\u003c/p\u003e \u003cp\u003eCecal content samples were snap-frozen and stored at \u0026minus;\u0026thinsp;80\u0026deg;C after collection. DNA extraction and amplification total genomic DNA was extracted using a MagPure Soil DNA LQ Kit (Magan) according to the manufacturer\u0026rsquo;s instructions. DNA concentration and integrity were measured with a NanoDrop 2000 (Thermo Fisher Scientific, USA) and agarose gel electrophoresis. The extracted DNA was used as a template for PCR amplification of bacterial 16S rRNA genes with barcoded primers and Takara Ex Taq (Takara). For bacterial diversity analysis, V3-V4 variable regions of 16S rRNA genes were amplified with universal primers 343F (5\u0026rsquo;-TACGGRAGGCAGCAG-3\u0026rsquo;) and 798R (5\u0026rsquo;-AGGGTATCTAATCCT-3\u0026rsquo;). The amplicon quality was visualized using agarose gel electrophoresis. The PCR products were purified with AMPure XP beads (Agencourt) and amplified for another round of PCR. After being purified with AMPure XP beads again, the final amplicon was quantified using the Qubit dsDNA Assay Kit (Thermo Fisher Scientific, USA). The concentrations were then adjusted for sequencing. Sequencing was performed on an Illumina NovaSeq 6000 with 250 bp paired-end reads. (Illumina Inc., San Diego, CA; OE Biotech Company, Shanghai, China). The representative read of each ASV was selected using the QIIME 2 package. Raw sequencing data were in FASTQ format. Paired-end reads were then preprocessed using cutadapt software to detect and cut off the adapter. After trimming, the paired-end reads were filtered for low-quality sequences, denoised, and merged, and the chimera reads were detected and cut off using DADA2 with the default parameters of QIIME2 (2020.11). Finally, the software output the representative reads and the ASV abundance table. Linear discriminant analysis (LDA) effect size (LEfSe) testing was performed pairwise (between groups) to identify differentially abundant bacterial taxa (from phylum to species level). PICRUSt2 software was used to predict the composition of known microbial gene functions so that differences in function between samples and subgroups could be counted.\u003c/p\u003e \u003cp\u003eAnalysis of nontargeted metabolomics\u003c/p\u003e \u003cp\u003eOne hundred microliters of sample were added to a 1.5 mL Eppendorf tube. Subsequently, 400 \u0026micro;L of an ice-cold mixture of methanol and acetonitrile (2/1, vol/vol, containing L-2-chlorophenylalanine, 2 \u0026micro;g/mL) was added, and the mixtures were vortexed for 1 min. The whole samples were extracted by ultrasonication for 10 min in an ice-water bath and stored at -20 ℃ for 30 min. The extract was centrifuged at 4\u003csup\u003e\u0026deg;\u003c/sup\u003eC (13,000 rpm) for 10 min. Then, 200 \u0026micro;L of supernatant in a glass vial was dried in a freeze concentration centrifugal dryer. A 300 \u0026micro;L mixture of methanol and water (1/4, vol/vol) was added to each sample, and the samples were vortexed for 30 s, extracted by ultrasonication for 3 min in an ice-water bath, and then placed at -20\u003csup\u003e\u0026deg;\u003c/sup\u003eC for 2 h. The samples were centrifuged at 4\u003csup\u003e\u0026deg;\u003c/sup\u003eC (13,000 rpm) for 10 min. The supernatants (150 \u0026micro;L) from each tube were collected with crystal syringes, filtered through 0.22 \u0026micro;m microfilters, and transferred to LC vials. Vials were stored at -80\u003csup\u003e\u0026deg;\u003c/sup\u003eC until LCMS analysis. QC samples were prepared by mixing aliquots of all samples to form a pooled sample. The analytical instrument was a liquid mass spectrometer system consisting of an ACQUITY UPLC I-Class and an ultrahigh-performance liquid chromatography tandem QE high-resolution mass spectrometer. Chromatographic conditions: the column was ACQUITY UPLC HSS T3 (100 mm\u0026times;2.1 mm, 1.8 um); the column temperature was 45 ℃; the mobile phases were A-water (containing 0.1% formic acid) and B-acetonitrile; the flow rate was 0.35 mL/min; and the injection volume was 3 \u0026micro;L. The mass spectrometry information was analyzed by the metabolomics data processing software Progenesis QI v2.3. Analysis.\u003c/p\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses of body weight, cardiac ultrasound, pathology, and serology were performed using GraphPad Prism 9.0 software (GraphPad Inc., La Jolla, CA, USA), and the Kruskal‒Wallis test was used to test whether there was a significant difference between multiple groups because the sample size of each group was \u0026lt;\u0026thinsp;10. The Mann‒Whitney U test was used to test whether there was a significant difference between two groups. The Mann‒Whitney U test was used to calculate the difference in intestinal species or metabolites between different subgroups. p values were considered statistically significant at \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05 and \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.01.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank experimental center of\u0026nbsp;Affiliated Hospital of Shandong University of Traditional Chinese Medicine\u0026nbsp;of China for providing experimental platform. Professor Guohua Dai of\u0026nbsp;Affiliated Hospital of Shandong University of Traditional Chinese Medicine\u0026nbsp;of China for advice and help throughout the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eF\u003c/strong\u003e\u003cstrong\u003eunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Ji \u0026apos;nan Science and Technology Program Clinical（Grant No .202134024）, Qilu Traditional Chinese Medicine Advantage Specialty Cluster- Chest Pain Alliance（Grant No. 2021-02）, Young Scientific Research Innovation Team of Affiliated Hospital of Shandong University of Traditional Chinese Medicine.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors and Affiliations\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCollege of First Clinical Medicine, Shandong University of Traditional Chinese Medicine, 250014, Jinan, China\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJiahui Liu, Xunan Wei \u0026amp; Miaomiao Zhang\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eShandong Provincial Third Hospital, 250031, Jinan, China\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYonggang Dai\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCollege of Traditional Chinese Medicine, Shandong University of Traditional Chinese Medicine, 250014, Jinan, China\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGongyi Li\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAffiliated Hospital of Shandong University of Traditional Chinese Medicine\u003c/strong\u003e\u003cstrong\u003e, 250014, Jinan, China\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJunwei Liang, Yan Cheng \u0026amp; Lili Chi\u003c/p\u003e\n\u003cp\u003eContributions\u003c/p\u003e\n\u003cp\u003eC.L.L., and C.Y. conceived and designed the experiments. L.J.H., W.X.N., L.G.Y., and Z.M.M. performed the animal experiments. L.J.H., and Z.M.M. analyzed the data. D.Y.G. contributed reagents/materials/analysis tools. L.J.W. and W.X.N. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding authors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to Yan Cheng \u0026amp; Lili Chi\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003eThe authors declare no conflict of interest. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability:\u0026nbsp;\u003c/strong\u003eThe data presented in this study are available on request from the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBui, A. L., Horwich, T. B. \u0026amp; Fonarow, G. C. Epidemiology and risk profile of heart failure. Nat. Rev. Cardiol. 8, 30\u0026ndash;41 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, H. \u003cem\u003eet al.\u003c/em\u003e Prevalence and Incidence of Heart Failure Among Urban Patients in China: A National Population-Based Analysis. Circ. Heart Fail. 14, e008406 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen, J., Wu, N. N., Wang, S., Sowers, J. R. \u0026amp; Zhang, Y. Obesity cardiomyopathy: evidence, mechanisms, and therapeutic implications. Physiol. Rev. 101, 1745\u0026ndash;1807 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArutyunov, G. P., Kostyukevich, O. I., Serov, R. A., Rylova, N. V. \u0026amp; Bylova, N. A. Collagen accumulation and dysfunctional mucosal barrier of the small intestine in patients with chronic heart failure. Int. J. Cardiol. 125, 240\u0026ndash;245 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSandek, A. \u003cem\u003eet al.\u003c/em\u003e Intestinal blood flow in patients with chronic heart failure: a link with bacterial growth, gastrointestinal symptoms, and cachexia. J. Am. Coll. Cardiol. 64, 1092\u0026ndash;1102 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnker, S. D. \u003cem\u003eet al.\u003c/em\u003e ESPEN Guidelines on Parenteral Nutrition: on cardiology and pneumology. Clin. Nutr. Edinb. Scotl. 28, 455\u0026ndash;460 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCelik, T., Iyisoy, A., Yuksel, U. C. \u0026amp; Jata, B. The small intestine: a critical linkage in pathophysiology of cardiac cachexia. Int. J. Cardiol. 143, 200\u0026ndash;201 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAquilani, R. \u003cem\u003eet al.\u003c/em\u003e Is nutritional intake adequate in chronic heart failure patients? J. Am. Coll. Cardiol. 42, 1218\u0026ndash;1223 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRozentryt, P. \u003cem\u003eet al.\u003c/em\u003e The effects of a high-caloric protein-rich oral nutritional supplement in patients with chronic heart failure and cachexia on quality of life, body composition, and inflammation markers: a randomized, double-blind pilot study. J. Cachexia Sarcopenia Muscle 1, 35\u0026ndash;42 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLewis, C. V. \u0026amp; Taylor, W. R. Intestinal barrier dysfunction as a therapeutic target for cardiovascular disease. Am. J. Physiol. Heart Circ. Physiol. 319, H1227\u0026ndash;H1233 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChakaroun, R. M., Massier, L. \u0026amp; Kovacs, P. Gut Microbiome, Intestinal Permeability, and Tissue Bacteria in Metabolic Disease: Perpetrators or Bystanders? \u003cem\u003eNutrients\u003c/em\u003e 12, 1082 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuzefpolskaya, M. \u003cem\u003eet al.\u003c/em\u003e Gut microbiota, endotoxemia, inflammation, and oxidative stress in patients with heart failure, left ventricular assist device, and transplant. J. Heart Lung Transplant. Off. Publ. Int. Soc. Heart Transplant. 39, 880\u0026ndash;890 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHansen, T. H., G\u0026oslash;bel, R. J., Hansen, T. \u0026amp; Pedersen, O. The gut microbiome in cardio-metabolic health. Genome Med. 7, 33 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, H. \u003cem\u003eet al.\u003c/em\u003e Aberrant Gut Microbiome Contributes to Intestinal Oxidative Stress, Barrier Dysfunction, Inflammation and Systemic Autoimmune Responses in MRL/lpr Mice. Front. Immunol. 12, 651191 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRiehle, C. \u0026amp; Bauersachs, J. Small animal models of heart failure. Cardiovasc. Res. 115, 1838\u0026ndash;1849 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG\u0026uuml;nther, C., Neumann, H., Neurath, M. F. \u0026amp; Becker, C. Apoptosis, necrosis and necroptosis: cell death regulation in the intestinal epithelium. Gut 62, 1062\u0026ndash;1071 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, X. D., Wang, Q., Andersson, R. \u0026amp; Ihse, I. Alterations in intestinal function in acute pancreatitis in an experimental model. Br. J. Surg. 83, 1537\u0026ndash;1543 (1996).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong, G. \u003cem\u003eet al.\u003c/em\u003e Fructose Stimulated Colonic Arginine and Proline Metabolism Dysbiosis, Altered Microbiota and Aggravated Intestinal Barrier Dysfunction in DSS-Induced Colitis Rats. Nutrients 15, 782 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUsuda, H., Okamoto, T. \u0026amp; Wada, K. Leaky Gut: Effect of Dietary Fiber and Fats on Microbiome and Intestinal Barrier. Int. J. Mol. Sci. 22, 7613 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang, W. H. W., Kitai, T. \u0026amp; Hazen, S. L. Gut Microbiota in Cardiovascular Health and Disease. Circ. Res. 120, 1183\u0026ndash;1196 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThaiss, C. A. \u003cem\u003eet al.\u003c/em\u003e Hyperglycemia drives intestinal barrier dysfunction and risk for enteric infection. Science 359, 1376\u0026ndash;1383 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakala, J. Determinants of splanchnic blood flow. Br. J. Anaesth. 77, 50\u0026ndash;58 (1996).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, D.-H., Pei, Y., Yang, J. \u0026amp; Wang, Z. Digestive tract morphology and food habits in six species of rodents. Folia Zool. -Praha- 52, 51\u0026ndash;55 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetith, M. M., Wilson, H. D. \u0026amp; Schedl, H. P. Vitamin D dependence of in vivo calcium transport and mucosal calcium binding protein in rat large intestine. Gastroenterology 76, 99\u0026ndash;104 (1979).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuo, J.-Y. \u003cem\u003eet al.\u003c/em\u003e Intestinal Barrier Dysfunction Exacerbates Neuroinflammation via the TLR4 Pathway in Mice With Heart Failure. Front. Physiol. 12, 712338 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoccella, N. \u003cem\u003eet al.\u003c/em\u003e Transverse aortic constriction induces gut barrier alterations, microbiota remodeling and systemic inflammation. Sci. Rep. 11, 7404 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCastillo-Rodriguez, E. \u003cem\u003eet al.\u003c/em\u003e Impact of Altered Intestinal Microbiota on Chronic Kidney Disease Progression. Toxins 10, 300 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, X. \u003cem\u003eet al.\u003c/em\u003e Gut-dependent microbial translocation induces inflammation and cardiovascular events after ST-elevation myocardial infarction. Microbiome 6, 66 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, Z. \u003cem\u003eet al.\u003c/em\u003e The intestinal microbiota associated with cardiac valve calcification differs from that of coronary artery disease. Atherosclerosis 284, 121\u0026ndash;128 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Z. \u003cem\u003eet al.\u003c/em\u003e The Nutritional Supplement L-Alpha Glycerylphosphorylcholine Promotes Atherosclerosis. Int. J. Mol. Sci. 22, 13477 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe Roy, T. \u003cem\u003eet al.\u003c/em\u003e The intestinal microbiota regulates host cholesterol homeostasis. BMC Biol. 17, 94 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoren, O. \u003cem\u003eet al.\u003c/em\u003e Human oral, gut, and plaque microbiota in patients with atherosclerosis. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e 108, 4592\u0026ndash;4598 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKain, V. \u003cem\u003eet al.\u003c/em\u003e Obesogenic diet in aging mice disrupts gut microbe composition and alters neutrophil:lymphocyte ratio, leading to inflamed milieu in acute heart failure. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 33, 6456\u0026ndash;6469 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang, S. \u003cem\u003eet al.\u003c/em\u003e A reduction in the butyrate producing species Roseburia spp. and Faecalibacterium prausnitzii is associated with chronic kidney disease progression. Antonie Van Leeuwenhoek 109, 1389\u0026ndash;1396 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLozano, C. P. \u003cem\u003eet al.\u003c/em\u003e Associations of the Dietary Inflammatory Index with total adiposity and ectopic fat through the gut microbiota, LPS, and C-reactive protein in the Multiethnic Cohort\u0026ndash;Adiposity Phenotype Study. Am. J. Clin. Nutr. 115, 1344\u0026ndash;1356 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, J. \u003cem\u003eet al.\u003c/em\u003e Sodium Alginate Modulates Immunity, Intestinal Mucosal Barrier Function, and Gut Microbiota in Cyclophosphamide-Induced Immunosuppressed BALB/c Mice. J. Agric. Food Chem. 69, 7064\u0026ndash;7073 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, L. \u003cem\u003eet al.\u003c/em\u003e LC-MS-based metabolomics reveals metabolic changes in short- and long-term administration of Compound Danshen Dripping Pills against acute myocardial infarction in rats. Phytomedicine Int. J. Phytother. Phytopharm. 104, 154269 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTseng, H.-C. \u003cem\u003eet al.\u003c/em\u003e Lysophosphatidylcholine induces cyclooxygenase-2-dependent IL-6 expression in human cardiac fibroblasts. Cell. Mol. Life Sci. CMLS 75, 4599\u0026ndash;4617 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang, W. H. W. \u003cem\u003eet al.\u003c/em\u003e Intestinal microbial metabolism of phosphatidylcholine and cardiovascular risk. N. Engl. J. Med. 368, 1575\u0026ndash;1584 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTappia, P. S. \u003cem\u003eet al.\u003c/em\u003e Depressed responsiveness of phospholipase C isoenzymes to phosphatidic acid in congestive heart failure. J. Mol. Cell. Cardiol. 33, 431\u0026ndash;440 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Z. \u003cem\u003eet al.\u003c/em\u003e Gut flora metabolism of phosphatidylcholine promotes cardiovascular disease. Nature 472, 57\u0026ndash;63 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoeth, R. A., Wang, Z., Levison, B. S., Buffa, J. \u0026amp; Org, E. Intestinal microbiota metabolism of L-carnitine, a nutrient in red meat, promotes atherosclerosis - PubMed. Nat Med 19, 576\u0026ndash;585 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, M. \u003cem\u003eet al.\u003c/em\u003e Resveratrol Attenuates Trimethylamine-N-Oxide (TMAO)-Induced Atherosclerosis by Regulating TMAO Synthesis and Bile Acid Metabolism via Remodeling of the Gut Microbiota. \u003cem\u003emBio\u003c/em\u003e 7, e02210-02215 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHashimoto, T. \u0026amp; Brooks, G. A. Mitochondrial lactate oxidation complex and an adaptive role for lactate production. Med. Sci. Sports Exerc. 40, 486\u0026ndash;494 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEvans, R. K., Schwartz, D. D. \u0026amp; Gladden, L. B. Effect of myocardial volume overload and heart failure on lactate transport into isolated cardiac myocytes. J. Appl. Physiol. Bethesda Md 1985 94, 1169\u0026ndash;1176 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHalestrap, A. P., Wang, X., Poole, R. C., Jackson, V. N. \u0026amp; Price, N. T. Lactate transport in heart in relation to myocardial ischemia. Am. J. Cardiol. 80, 17A-25A (1997).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKo, C.-W., Qu, J., Black, D. D. \u0026amp; Tso, P. Regulation of intestinal lipid metabolism: current concepts and relevance to disease. Nat. Rev. Gastroenterol. Hepatol. 17, 169\u0026ndash;183 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSinha, S. R. \u003cem\u003eet al.\u003c/em\u003e Dysbiosis-Induced Secondary Bile Acid Deficiency Promotes Intestinal Inflammation. Cell Host Microbe 27, 659\u0026ndash;670.e5 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanafi, N. I., Mohamed, A. S., Sheikh Abdul Kadir, S. H. \u0026amp; Othman, M. H. D. Overview of Bile Acids Signaling and Perspective on the Signal of Ursodeoxycholic Acid, the Most Hydrophilic Bile Acid, in the Heart. Biomolecules 8, 159 (2018).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Chronic Heart Failure, Intestinal Dysfunction, Rat model, Intestinal microbiota, Serum Metabolites","lastPublishedDoi":"10.21203/rs.3.rs-3266597/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3266597/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIntestinal dysfunction (ID) is considered a critical comorbidity of chronic heart failure (CHF) and can exacerbate the condition. The pathophysiology underlying chronic heart failure combined with intestinal dysfunction (CHF\u0026amp;ID) remains elusive, and animal models are lacking. In this study, we compared four modeling methods, abdominal aortic constriction (AAC), transverse aortic constriction (TAC), TAC combined with cecum ligation (TAC\u0026thinsp;+\u0026thinsp;CL), and AAC combined with cecum ligation (AAC\u0026thinsp;+\u0026thinsp;CL), to establish a rat CHF\u0026amp;ID model. The results demonstrated that TAC\u0026thinsp;+\u0026thinsp;CL elicited a significant elevation in B-type natriuretic peptide (BNP) and trimethylamine N-oxide (TMAO) levels, accompanied by a notable decrease in heart function as assessed by echocardiography. Moreover, this method induced myocardial fibrosis, and cardiomyocyte hypertrophy in rats. Additionally, it was found to induce mechanical barrier damage to the small intestinal, including disorganization of epithelial structure, and increased diamine oxidase (DAO) and lipopolysaccharide (LPS) in rats. Afterward, analysis of the cecal intestinal microbiota using 16S rRNA sequencing technology revealed significant alterations in CHF\u0026amp;ID rats, characterized by an increased abundance of \u003cem\u003eBacteroides, Ruminococcaceae_UCG-005, NK4A214_group, Family_XIII_AD3011_group, Lachnospiraceae_UCG-010\u003c/em\u003e, and \u003cem\u003eBifidobacterium\u003c/em\u003e (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05), as well as a decreased abundance of \u003cem\u003eRoseburia, Oscillibacter and Tuzzerella\u003c/em\u003e (\u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). Detection of serum metabolites by the LC‒MS coupling technique revealed that LysoPC (0:0/18:2(9Z,12Z)), LysoPC (18:3(9Z,12Z,15Z)/0:0), PC (17:1(9Z)/0:0), glycoursodeoxycholic acid were upregulated. Correlation analysis showed that the intestinal microbiota was significantly associated with several lipid metabolites, cardiac remodeling and leaky gut indicators. These results suggest that intestinal microbiota disorders and serum metabolites crosstalk with each other to induce the development of CHF\u0026amp;ID.\u003c/p\u003e","manuscriptTitle":"A Rat Model of Chronic Heart Failure Combined with Intestinal Dysfunction and Alterations in the Microbiome and Metabolomics","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-08-23 14:41:14","doi":"10.21203/rs.3.rs-3266597/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5723e9fc-81ea-4f78-bb2a-b04d7e63c4f4","owner":[],"postedDate":"August 23rd, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":24132404,"name":"Health sciences/Diseases/Cardiovascular diseases"},{"id":24132405,"name":"Health sciences/Diseases/Gastrointestinal diseases"}],"tags":[],"updatedAt":"2024-02-20T04:35:53+00:00","versionOfRecord":[],"versionCreatedAt":"2023-08-23 14:41:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3266597","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3266597","identity":"rs-3266597","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}