DNA aptamer targeting USE1 as a novel biomarker for lung cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article DNA aptamer targeting USE1 as a novel biomarker for lung cancer Min-Jee Kim, Kyuha Yum, Dajeong Kim, Jong Bum Lee, Peter Chang-Whan Lee This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4767665/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Lung cancer, the second most diagnosed cancer worldwide and the leading cause of cancer-related mortality, presents significant challenges, including early detection and effective treatment. In this study, we developed a diagnostic kit utilizing a novel aptamer targeting UBA6-specific E2 conjugating enzyme 1 (USE1), a biomarker implicated in the pathogenesis of lung cancer. Materials and methods Through Systematic Evolution of Ligands by EXponential enrichment (SELEX), we identified aptamers with high affinity and specificity to USE1. To evaluate the detection ability of these aptamers for the USE1 protein, in vitro and in vivo assays, including Enzyme-Linked OligoNucleotide Assays (ELONA) and immunoprecipitation with lung cancer cell lines and tissue samples, were performed. We also developed a novel fluorescence biosensing kit featuring a self-assembled biotin-modified DNA microsphere (DNAMS) and streptavidin quantum dot (STA-QD) conjugation for the detection of USE1. Results In vitro assays, such as ELONA and immunoprecipitation, demonstrated the robust detection of USE1 using these aptamers. Validation of the aptamers using lung cancer cell lines and patient tissue samples showed a sensitivity of 100.0% and a specificity of 80.0%. Additionally, the novel fluorescence biosensing kit, which features a self-assembled biotin-modified DNA microsphere (DNAMS) and streptavidin quantum dot (STA-QD) conjugation, facilitated easy visual detection of USE1. Conclusion Overall, this study not only advances the current understanding of aptamer-based diagnostics but also presents a promising approach for early lung cancer detection, with the potential to improve patient outcomes. Graphic abstract USE1 Lung cancer Aptamer Fluorescence biosensing kit Self-assembled biotin-modified DNA microsphere Streptavidin quantum dot Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Lung cancer is the second most diagnosed cancer worldwide and the leading cause of cancer-related deaths [ 1 ]. In 2023, approximately 2.2 million new cases and 1.8 million deaths due to lung cancer were recorded, emphasizing its critical impact on global health [ 1 , 2 ]. The comprehensive treatment paradigm for early-stage lung cancer has evolved rapidly over the past 20 years. Radical resection of cancer lesions remains the preferred treatment option for early-stage lung cancer. Unfortunately, only 18% of patients at initial presentation are eligible for such curative interventions [ 3 ]. Furthermore, the postoperative survival rates for patients with lung cancer remain suboptimal, with five-year survival rates ranging from 90% in stage I to a mere 12% in stage III. Undoubtedly, the survival of patients with lung cancer is markedly dependent on early detection and appropriate treatment. Among the array of biomarkers for the early detection of lung cancer, UBA6-specific E2 conjugating enzyme 1 (USE1), a member of the E2 enzyme family in the ubiquitin-proteasome system (UPS), is emerging as a novel biomarker and therapeutic target. USE1 specifically interacts with the UBA6 enzyme rather than the conventional E1 enzyme [ 4 – 6 ]. The UPS plays a crucial role in protein homeostasis and is involved in numerous cellular processes, including DNA repair, endocytic trafficking, and immune response. Consequently, dysregulation of the UPS is associated with several human diseases, including multiple cancer types [ 7 ]. In our previous study, the USE1 protein was found to be markedly overexpressed in lung cancer tissues; however, its knockdown significantly delayed tumor growth, migration, and invasion. These findings underscore the potential of USE1 as a significant biomarker for the detection of lung cancer [ 8 ]. The main challenge in developing reliable diagnostic sensors based on conventional antibodies is the variability in their affinity across different manufacturing processes and batches. To overcome these limitations, synthetic aptamers—short strands of DNA or RNA—have been employed due to their high affinity and specificity, which are solely due to their nucleotide sequences [ 9 , 10 ]. Unlike antibodies, aptamers are generated through artificial selection, do not trigger immunogenic responses in the host immune system, and are easily modified and conjugated with other drugs or carriers [ 11 , 12 ]. These advantages broaden their applicability in diagnostics across diverse platforms, including optical, colorimetric, fluorescence, electrochemical, microfluidic, PET (positron-emission tomography), CT (computed tomography), MRI (magnetic resonance imaging), and others [ 13 – 15 ]. In this study, the Systematic Evolution of Ligands by EXponential enrichment (SELEX) was employed to develop specific DNA aptamers targeting the USE1 protein. The aptamers, named Aptamer 1 and 1e, were then evaluated using lung cancer cell lines and tissue samples to determine their binding efficacy. Subsequently, a diagnostic kit was developed using self-assembly, biotin-modified DNA microstructures conjugated with streptavidin quantum dots to detect Aptamer 1 that targets the USE1 protein. Based on our results, these aptamers possess robust targeting capabilities, which highlight their potential as part of a diagnostic kit for the early detection of lung cancer. Methods Patients and lung cancer tissue samples The experiments were conducted after obtaining informed consent from patients and approval from the Institutional Review Board of Asan Medical Center (2014 − 0960). Surgically resected human lung tissues were acquired from the Asan Bio Resource Center (Resource No. 2014-20(89)). His-Tag Protein SELEX Procedures The human USE1-targeting aptamer was isolated using a His-tag protein SELEX method. In the initial round of SELEX, the single-strand DNA (ssDNA) library, consisting of 10^15 molecules, was incubated with 2 mg of recombinant His-tagged human full-length USE1 (His-USE1) protein and nickel-nitrilotriacetic acid (Ni-NTA) magnetic agarose beads at 25°C for 30 minutes in His-tag binding buffer (2.95 mM KCl, 1 mM MgCl2, 2.4 mM CaCl2, 0.1% Tween 20, and 10 mM imidazole in 1X PBS, pH 7.0). Ni-NTA magnetic agarose beads bound with USE1 and aptamers were precipitated using a magnet. Unbound aptamers were removed through repeated washing with the binding buffer. USE1 was eluted with the bound aptamers using His-tag elution buffer (500 mM imidazole and 0.02% Tween 20 in PBS). After the 10th round of SELEX, the USE1-bound aptamers were sequenced. Aptamer structure and aptamer/protein docking site prediction The secondary structure of aptamers was predicted using the M-fold web software (available at M-fold). The potential docking sites for aptamer and USE1 protein interactions were identified using the HDOCK server (HDOCK). ELONA (Enzyme-Linked OligoNucleotide assays) An ELISA-like assay, ELONA (Enzyme-Linked OligoNucleotide Assays) [ 16 ] adapted for DNA aptamers, was performed as outlined in Supplementary Fig. 3. The USE1 protein was diluted to 723 nM using 0.1 M sodium phosphate buffer (pH 7.4). Thereafter, 100 µL/well of this solution was incubated overnight at 4°C in a polystyrene 96-well microtiter plate (MaxiSorpTM; Th. Geyer). Following coating, the wells were washed three times with 200 µL of washing buffer (0.3 M NaCl/PBS containing 0.05% Tween 20) and then blocked with 200 µL of 2% BSA in blocking buffer (0.3 M NaCl/PBS containing 0.05% Tween 20) for 1 hour at room temperature. After three additional washes with 200 µL of washing buffer, 100 µL of either 5′- or 3′-biotinylated aptamers (5′ Bio or 3′ Bio) diluted to 10,000 nM in binding buffer (100 mM NaCl, 20 mM Tris-HCl pH 7.6, 10 mM MgCl 2 , 5 mM KCl, 1 mM CaCl 2 , 0.005% Tween 20) was added to each well. The plate was incubated at room temperature for 1.5 hours with mild shaking to facilitate the binding of the aptamers to the immobilized protein. Following the binding reaction, the wells were washed three times with 200 µL of binding buffer to remove unbound oligonucleotides. A streptavidin-HRP conjugate solution (Thermo Scientific) was diluted 1:10,000 in binding buffer to 0.2–0.25 µg/mL. Thereafter, 100 µL of this solution was dispensed into each well; incubation was performed at room temperature for 1 hour with mild shaking. After five washes with 200 µL of binding buffer, 100 µL of 3,3′,5,5′-tetramethylbenzidine (TMB) substrate solution (Thermo Fisher Scientific) was added to each well and incubated for 30 minutes at room temperature in the dark. The reaction was terminated by adding 50 µL/well of 0.5 M H2SO4. The optical density was measured at 370 nm or 450 nm using a SpectraMAX spectrophotometer. As specified in the Results and Discussion section, the results of up to four independent experiments were generally averaged, with each experiment representing one microtiter plate and including one to four replicates of each specific interaction. Cell culture and transfection Lung cancer cell lines, including HEK293T, A549, H1270, H292, and H1299, were obtained from the American Type Culture Collection (ATCC) and cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The cells were maintained at 37°C in a humidified atmosphere containing 5% CO 2 . Transfection was performed using the iNfect transfection reagent (Intron, Korea), according to the manufacturer’s instructions. Cells were harvested 48 hours post-transfection for subsequent analyses. For siRNA-mediated knockdown, Lipofectamine RNAiMax (Invitrogen) was used according to the manufacturer’s protocol. Immunoblotting Tissue and cell lysates were prepared using a 1% SDS lysis buffer (40 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% SDS, 1 mM EDTA) supplemented with protease inhibitors (Complete Mini, EDTA-free; Roche). The lysates were centrifuged at 13,500 ×g for 30 minutes, and the supernatants were collected. Western blotting was conducted using primary antibodies against His-tag (sc-803, Santa Cruz Biotechnology, 1:1000 dilution), biotin (A150-109A, Thermo Fisher Scientific, 1:1000 dilution), α-Myc (sc-40, Santa Cruz Biotechnology, 1:1000 dilution), USE1 (1:1000 dilution), and α-alpha-tubulin (ab7291, Abcam, 1:5000 dilution), followed by horseradish peroxidase-conjugated secondary antibodies (Thermo Fisher Scientific). Detection was performed via enhanced chemiluminescence (Bio-Rad). Development of the USE1 protein biosensing kit The circularization of linear DNA, self-assembly of biotin-modified DNA monomers, STA-QD conjugation, and dot blot analysis are described in the supplementary materials. Fluorescence/quencher aptamer probe for USE1 protein detection To construct the aptamer probe, 80 nM of Aptamer 1 (ADNA), 40 nM of fluorescence-tagged DNA (FDNA, sequence: 5’-3’ GCA AGC TTG TTC GAG CCA G /F/), and 120 nM of quencher DNA (QDNA, sequence: 5’-3’ /Q/ CCC TAT GCC AAA C) were combined. The mixture was initially heated to 90°C and then allowed to reach thermal equilibrium. The temperature was gradually reduced by 1°C per minute until a final temperature of 20°C was achieved. Finally, the solution was incubated for an additional 30 minutes. For the aptamer probe binding assay with the USE1 protein, 8 nM of the aptamer probe and 1 mM of MgCl 2 were pre-mixed in a total volume of 50 µL of PBS and incubated at 15°C for 10 minutes. Prior to reaching the final incubation temperature of 37°C, different concentrations of the USE1 protein (0, 0.1, 0.3, 1, and 3 µM) were added, and the mixture was incubated for 60 minutes. After incubation at 22°C for 30 minutes, fluorescence measurements were performed every minute. Results Selection of aptamers targeting USE1 using SELEX Figure 1 illustrates the schematic of the SELEX process used to select His-Tagged USE1-targeting aptamers. To identify aptamers that target USE1, a library containing 10 15 molecules of random-sequence aptamers was used. The SELEX process was completed after 10 rounds, and aptamers that showed specificity for USE1 were identified via DNA sequencing. Based on the aptamer array results, three aptamers (aptamers 1, 2, and 3) were selected for further analysis (Table 1 ). The predicted structures, docking simulations (HDOCK, http://hdock.phys.hust.edu.cn/ ), and dissociation constants (K d ) of aptamers 1, 2, and 3 are presented in Supplementary Figs. 1 and 2. Table 1 Aptamers used in this study No. Size (mer) 5' to 3' 1 95 CACCTAATACGACTCACTATAGCGGATCCGATGGGTGGGGGGGTGGGTAGGATCCGTTCGGGGTTTGGCATAGGGTCTGGCTCGAACAAGCTTGC 1a 18 CTGGCTCGAACAAGCTGC 1b 28 GCATAGGGTCTGGCTCGAACAAGCTTGC 1c 32 CCTAACACGATTCACTATAGCTCGGGGTTTGG 1d 36 CACCTAATACGACTCACTATAGTTCGGGGTTTGGCA 1e 36 CACCTAACACGATTCACTATAGCTCGGGGTTTGGCA 2 98 CACCTAATACGACTCACTATAGCGGACAGGGCTGGTGTGGCTGGCGTCCGGCTCGAACAAGGCTGGTGTGGCTGGCGTTCTGGCTCGAACAAGCTTGC 3 90 CACCTAATACGACTCACTATAGCGGATCCGACAGAATGCCATCACCATGTCTAGACCTATTGGCTTTGCGACTGGCTCGAACAAGCTTGC Evaluation of the in vitro binding affinity of aptamers using ELONA and immunoblotting An aptamer-based ELONA was developed to evaluate the binding affinity of the aptamers for purified USE1 protein, as previously described [ 16 ]. Among the three aptamers, aptamer 1 (10 µM) exhibited the highest intensity with purified USE1 protein (6 µM) in a time-dependent manner based on ELONA (Supplementary Fig. 3 and Fig. 2 A). To reduce the cost of chemical synthesis and improve tissue penetration and structural stability, full-length aptamer 1 was further truncated into five sequences (Table 1 and Fig. 2 B). Subsequent ELONAs with each truncated aptamer (10 µM) and purified USE1 protein (6 µM) were conducted to compare binding affinities. Aptamer 1e exhibited the highest binding capacity compared to the other truncated forms, including 1a, 1b, 1c, and 1d (Fig. 2 C). The binding affinities of aptamers 1 and 1e for the purified USE1 protein, demonstrated in time- and dose-dependent manners, are shown in Figs. 2 D-F. To explore the interaction between USE1 and the aptamers, in vitro Ni-NTA and streptavidin pull-down assays were performed using purified His-USE1 protein and biotinylated aptamers. The results confirmed a direct interaction between the USE1 protein and aptamers 1 and 1e in the in vitro assays (Figs. 3 A-D). Consistently, aptamers 1 and 1e directly interacted with the USE1 protein in 293T cells overexpressing USE1, based on immunoprecipitation analysis (Supplementary Figs. 4A and B). Overall, both aptamers 1 and 1e exhibited effective binding affinity for the USE1 protein based on the in vitro assays and ELONA. Detection of the USE1 Protein in Lung Cancer Cells and Tissue Using Aptamers 1 and 1e Previous studies have demonstrated that the protein level of USE1 is elevated in 92% of patients with lung cancer, underscoring its significance as a biomarker for the proliferation, invasion, and migration of lung cancer. Consequently, we evaluated the detection capabilities of aptamers 1 and 1e for the USE1 protein in lung cancer cells and tissues, employing these aptamers as biosensors. Using ELONA, aptamers 1 (10 nM) and 1e (1 µM) successfully detected the USE1 protein in 100 ng of lysate from A549 lung cancer cells. This detection was consistent even after overexpression of USE1 with an HA-USE1 plasmid or knockdown with USE1 siRNA (Figs. 3 E-G). Furthermore, these aptamers identified the USE1 protein in smaller amounts (50 ng) of lysates from various lung cancer cell lines, including A549, H1270, H292, and H1299 (Supplementary Figs. 4C-F). The detection capability of the aptamers was also assessed in 30 lung cancer tissues with elevated USE1 protein levels and their paired adjacent non-tumoral lung tissues. All samples showed higher binding signals compared to their adjacent non-tumor tissues (Figs. 3 H-I). Receiver operating characteristic (ROC) curves with 95% confidence intervals revealed a binding signal cutoff value of 2.77 for lung cancer detection, with sensitivity and specificity of 100.0% and 80.0%, respectively (Fig. 3 J, AUC 0.923, p < 0.001). In conclusion, both aptamers 1 and 1e effectively detected the USE1 protein in lung cancer cells and tissues using ELONA. Streptavidin-Quantum Dot (STA-QD) DNA Microsphere (DNAMS) Dot Blot Analysis for the Targeting of USE1 with Aptamer 1 In the realm of molecular diagnostics for various diseases, the in vitro amplification of nucleic acids forms the foundation of all modern methods. Among the diverse amplification techniques, rolling circle amplification (RCA) enables the synthesis of nucleic acid products with predetermined nucleotide sequences. Therefore, we developed a dot blot analysis to detect USE1-targeting aptamer 1 using self-assembled biotin-modified DNAMS and STA-QD conjugation (STA-QD DNAMS) (Fig. 4 A-B). Dynamic light scattering analysis confirmed a mean diameter of approximately 1,000 nm for the biotin-modified DNAMS. Following the conjugation of STA-QD to biotin-modified DNAMS, the size increased compared to that of the biotin-modified DNAMS alone. Fluorescence microscopy validated the successful conjugation of STA-QD to biotin-modified DNAMS. The biotin-modified DNAMS were labeled using Hoechst 33342, exhibiting blue fluorescence, while the conjugated STA-QD displayed red fluorescence (Fig. 4 C). To evaluate the effectiveness and optimization of the polyvinylidene fluoride (PVDF) membrane with a biotinylated aptamer model, an experiment was conducted using biotinylated aptamer 1 and STA-QD (Fig. 4 D). As the amount of biotinylated aptamer 1 increased from 10 to 20 pmole, the intensity of the USE1 protein signal generally increased, whereas the BSA control dot showed minimal change. However, at 50 pmole of aptamer, the signal intensity in the control group (BSA) was elevated to a level similar to that in the USE1 group, resulting in no significant difference between the BSA and USE1 groups. Consequently, we concluded that the optimal amount of aptamer 1 for detecting USE1 is 20 pmole. Following validation of the dot blot analysis setup for detecting the USE1 protein with STA-QD, we optimized the use of biotinylated aptamer 1 for effective detection of the USE1 protein with STA-QD DNAMS using the aforementioned method. Consistently, 20 pmole of biotinylated aptamer was identified as the optimal condition for detecting USE1 (Fig. 4 E). Notably, even at 50 pmole of biotinylated aptamer 1, the intensity difference with BSA was significant, unlike with STA-QD. This discrepancy might be attributed to the larger size of STA-QD DNAMS and the numerical advantage of multiple STA-QD conjugations on DNAMS, which reduce off-target effects and enhance signal amplification. Using the optimized conditions from previous experiments, we conducted dot blot assays to determine the limit of detection (LOD) for the USE1 protein with STA-QD DNAMS. Aptamer 1 and STA-QD DNAMS were used to detect the USE1 protein at concentrations of 0.05, 0.5, 5, 50, and 500 nM in a dose-dependent manner (Fig. 4 F). The LOD for the USE1 protein was determined to be 10 nM, as the intensity difference was insignificant below this concentration. In conclusion, the combination of biotinylated aptamer models and STA-QD DNAMS provides a sensitive and reliable platform for detecting the USE1 protein across a range of concentrations. Fluorescence biosensing kit for the targeting of USE1 via aptamer 1 detection Fluorescence-based biosensing is an effective method for detecting cancer biomarkers[ 17 ]. To facilitate the clinical application of this technology for lung cancer detection, we developed a fluorescence biosensing kit using STA-QD DNAMS targeting USE1 with aptamer 1. A PVDF membrane was integrated into a 3D-printed scaffold with two wells: control and test lines. The fluorescence signal was measured using a UV lamp (Fig. 5 A). The control setup of the kit included streptavidin as a positive control, while the test setup included bovine serum albumin (BSA) as a negative control and USE1 as the target protein. A fluorescence signal appeared in the test line containing the USE1 protein, indicating that the biosensing kit successfully detected the USE1 protein using aptamer 1 and STA-QD DNAMS. In contrast, the test line with BSA in the negative control group displayed a negligible signal compared to that in the USE1 group. The difference in fluorescence signal was visible to the naked eye (Fig. 5 B). To obtain more quantitative results, the mean fluorescence intensity (MFI) was measured using ImageJ software. As expected, the USE1 test line had an intensity comparable to the control line, while the BSA test line exhibited almost no signal. These results support the potential utility of our biosensing approach in clinical settings, providing a rapid and convenient method for the specific identification of USE1 as a biomarker for lung cancer. Discussion In this study, we successfully identified and validated an aptamer that can detect USE1, a significant biomarker for lung cancer. Validation was conducted using various methods, including Western blot, ELONA, and a Quencher DNA system, utilizing the USE1 protein, lung cancer cell lines, and lung cancer tissue samples. Additionally, we developed a STA-QD DNAMS fluorescence sensing method that effectively detects the USE1-targeting aptamer, leading to the creation of a diagnostic kit for lung cancer. Lung cancer remains the most prevalent cancer and the second leading cause of cancer-related mortality worldwide [ 1 , 2 ]. It can be cured via resection surgery if detected early[ 1 , 2 ]. However, the lack of efficient early detection technologies or reliable molecular biomarkers often results in late diagnosis, thereby missing the ideal therapeutic window[ 3 ]. To improve patient survival, diagnostic technologies that use molecular biomarkers capable of sensitively and selectively recognizing lung cancer cells must be developed. Previously, our research team discovered that the USE1 protein is upregulated in 98.1% of patients with lung cancer. The overexpression of the USE1 protein was found to promote the proliferation, migration, and invasion of lung cancer cells. Notably, USE1 contains a conserved D-box domain and is regulated by the anaphase-promoting complex, suggesting its pivotal role in the pathogenesis of lung cancer and highlighting its potential as a novel biomarker [ 8 ]. Based on these findings, we developed a practical diagnostic kit using aptamers that target the USE1 protein. Aptamers are short single-stranded segments of DNA (ssDNA), RNA (ssRNA), or synthetic nucleic acid analogs (XNA) that bind their targets with high affinity and specificity by folding into various secondary and tertiary structures [ 11 , 18 ]. Unlike antibodies, aptamers do not require immunogenicity to activate the host immune system, are synthesized chemically, and are easily modified and conjugated with other drugs or carriers [ 19 ]. Owing to these properties, aptamers have been extensively studied in various applications, including disease diagnosis, therapeutics, and biomarker discovery [ 10 , 20 ]. Since the inception of Cell-SELEX for targeting lung cancer cells [ 21 ], several aptamers have been identified for the detection of lung cancer using lung cancer cell lines, tissue lysates, or patient blood samples. For instance, Zamay GS et al. [ 22 ] identified four aptamers that specifically bind to lung adenocarcinoma cells using blood circulating tumor cells (CTCs). These aptamers were applied not only to detect CTCs and apoptotic bodies but also to associated protein biomarkers for lung cancer, including vimentin, annexin A2, annexin A5, histone 2B, neutrophil defensin, and clusterin. Zhou et al. [ 23 ] identified a novel biomarker for small-cell lung cancer (SCLC) through Cell-SELEX-generated aptamers; aptamer C12 was found to target high-density lipoprotein binding protein (HDLBP). Subsequent knockdown of HDLBP by siRNA inhibited the proliferation and metastasis of SCLC cells in vitro and decelerated tumor formation in vivo. More recently, the AP-9R aptamer was developed using Cell-SELEX to target cancer stem cells of lung cancer, with annexin A2 identified as the target protein. The expression of annexin A2 was associated with stemness, metastasis, and poor clinical outcomes in lung cancer, suggesting its role as a cancer stem cell (CSC) marker and regulator, with potential theragnostic applications for lung cancer [ 24 ]. These aptamers, which target lung cancer cell lines, tissue lysates, and patient serum, were validated as detectors of biomarkers by identifying the target proteins and assessing the impact on lung cancer development or progression. However, the specificity and sensitivity of these aptamers may be compromised as they do not commence from the exact target molecule and might inadvertently detect other cancers or normal molecules. In contrast to previous studies, the present study aimed to develop a lung cancer detection kit using an aptamer that specifically targets the USE1 protein, which is already well-studied due to its role as a novel biomarker and its involvement in lung cancer pathogenesis. By directly targeting USE1, our approach aims to enhance the sensitivity and specificity of lung cancer detection. This strategic focus is expected to yield a diagnostic tool that not only improves the accuracy of lung cancer diagnostics but also contributes to earlier and more effective treatment interventions. Among the three aptamers developed in this study, aptamer 1 exhibited the best binding affinity to USE1, with a dissociation constant of 10 nM. To reduce synthesis costs and improve tissue penetration and structural stability, aptamer 1 was truncated to aptamer 1e, which demonstrated similarly high binding affinity. Aptamers 1 and 1e effectively interacted with USE1 in vitro and in vivo based on immunoprecipitation assays and could identify lung cancer tissues with 100% sensitivity and 80% specificity based on ELONA. These results confirm that aptamers 1 and 1e are effective detectors of the USE1 protein not only in vitro and in lung carcinoma cell lines but also in actual patient cancer tissues, underscoring their potential for clinical application in lung cancer diagnostics. RCA is a method in which nucleic acids are synthesized using a circular template [ 25 ]. This technique is not only used to amplify and subsequently detect analyte molecules but also to generate functionally active nucleic acids that mediate the detection of other biotargets [ 26 ]. Self-assembled DNAMS was produced via RCA with several functionalized dNTPs, which can exhibit DNAMS fluorescence and allow the attachment of other functional moieties through strong interactions, such as chemical conjugation or biotin–streptavidin interaction [ 25 , 26 ]. Building on this technology, we developed a USE1-targeting aptamer detection kit using self-assembled biotin-modified DNAMS and STA-QD conjugation. This kit enables successful identification of the USE1-associated aptamer 1 through simple visual inspection, offering a promising tool for early and effective lung cancer diagnosis. This integration of STA-QD DNAMS with a USE1-targeted aptamer implies the potential for sophisticated diagnostic applications in lung cancer, potentially improving clinical outcomes through early detection. In this study, aptamers targeting USE1, a critical biomarker for lung cancer, were successfully developed and validated. Aptamer 1 and its truncated form, Aptamer 1e, exhibited high binding affinity and specificity to USE1, demonstrating effectiveness in various in vitro assays and in distinguishing lung cancer tissues from non-tumoral samples. The integration of these aptamers into a newly formulated diagnostic kit, utilizing RCA-generated, biotin-modified DNA microstructures with STA-QD conjugation, marks a significant advancement in lung cancer diagnostics. This kit, designed for simple visual inspection, is characterized by high sensitivity and specificity, and has the potential to substantially enhance the early detection and treatment of lung cancer. Overall, this approach could be transformative, setting a new standard for biomarker-based diagnostics and potentially decreasing the mortality rate of lung cancer through earlier intervention. Declarations Acknowledgements We thank Ms. Ji Won You and Tae Hyeong Lee for technical support Data availability No datasets were generated or analysed during the current study Ethics approval and consent to participate The experiments were conducted after obtaining informed consent from patients and approval from the Institutional Review Board of Asan Medical Center (2014-0960). Surgically resected human lung tissues were acquired from the Asan Bio Resource Center (Resource No. 2014-20(89)). Competing interests The authors declare no competing interests. Author Contribution K.Y., D.K. and M.K. performed the experiments and analysed the data; K.Y., D.K. and J.B.L developed the methods; P.C.L. and J.B.L supervised the project; M.K., P.C.L and J.B.L wrote the manuscript. References Siegel RL, Miller KD, Wagle NS, Jemal A: Cancer statistics, 2023. CA Cancer J Clin 2023, 73: 17-48. Jenkins R, Walker J, Roy UB: 2022 cancer statistics: Focus on lung cancer. Future Oncol 2023. Weber DJ: New Developments in Lung Cancer Screening. Radiol Technol 2024, 95: 211-214. Lee PC, Sowa ME, Gygi SP, Harper JW: Alternative ubiquitin activation/conjugation cascades interact with N-end rule ubiquitin ligases to control degradation of RGS proteins. Mol Cell 2011, 43: 392-405. Antao AM, Tyagi A, Kim KS, Ramakrishna S: Advances in Deubiquitinating Enzyme Inhibition and Applications in Cancer Therapeutics. Cancers (Basel) 2020, 12 . Deng L, Meng T, Chen L, Wei W, Wang P: The role of ubiquitination in tumorigenesis and targeted drug discovery. Signal Transduct Target Ther 2020, 5: 11. Sun T, Liu Z, Yang Q: The role of ubiquitination and deubiquitination in cancer metabolism. Mol Cancer 2020, 19: 146. Kim SJ, Hyeong Lee T, Hee Nam S, Kim JH, Oh S, Sook Cho Y, Sup Lee M, Choi S, Lee PC: Association of Uba6-Specific-E2 (USE1) With Lung Tumorigenesis. J Natl Cancer Inst 2017, 109: 1-11. Yu H, Alkhamis O, Canoura J, Liu Y, Xiao Y: Advances and Challenges in Small-Molecule DNA Aptamer Isolation, Characterization, and Sensor Development. Angew Chem Int Ed Engl 2021, 60: 16800-16823. Zhang Y, Lai BS, Juhas M: Recent Advances in Aptamer Discovery and Applications. Molecules 2019, 24 . Li Y, Tam WW, Yu Y, Zhuo Z, Xue Z, Tsang C, Qiao X, Wang X, Wang W, Li Y, et al: The application of Aptamer in biomarker discovery. Biomark Res 2023, 11: 70. Gupta R, Rahi Alhachami F, Khalid I, Majdi HS, Nisar N, Mohamed Hasan Y, Sivaraman R, Romero Parra RM, Al Mashhadani ZI, Fakri Mustafa Y: Recent Progress in Aptamer-Functionalized Metal-Organic Frameworks-Based Optical and Electrochemical Sensors for Detection of Mycotoxins. Crit Rev Anal Chem 2022 : 1-22. Yang C, Jiang Y, Hao SH, Yan XY, Hong F, Naranmandura H: Aptamers: an emerging navigation tool of therapeutic agents for targeted cancer therapy. J Mater Chem B 2021, 10: 20-33. Mohammadinejad A, Gaman LE, Aleyaghoob G, Gaceu L, Mohajeri SA, Moga MA, Badea M: Aptamer-Based Targeting of Cancer: A Powerful Tool for Diagnostic and Therapeutic Aims. Biosensors (Basel) 2024, 14 . Gan Z, Roslan MAM, Abd Shukor MY, Halim M, Yasid NA, Abdullah J, Md Yasin IS, Wasoh H: Advances in Aptamer-Based Biosensors and Cell-Internalizing SELEX Technology for Diagnostic and Therapeutic Application. Biosensors (Basel) 2022, 12 . Stoltenburg R, Krafcikova P, Viglasky V, Strehlitz B: G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA. Sci Rep 2016, 6: 33812. Huang G, Su C, Wang L, Fei Y, Yang J: The Application of Nucleic Acid Probe-Based Fluorescent Sensing and Imaging in Cancer Diagnosis and Therapy. Front Chem 2021, 9: 705458. Bing T, Zhang N, Shangguan D: Cell-SELEX, an Effective Way to the Discovery of Biomarkers and Unexpected Molecular Events. Adv Biosyst 2019, 3: e1900193. Bayat P, Nosrati R, Alibolandi M, Rafatpanah H, Abnous K, Khedri M, Ramezani M: SELEX methods on the road to protein targeting with nucleic acid aptamers. Biochimie 2018, 154: 132-155. Kaur H: Recent developments in cell-SELEX technology for aptamer selection. Biochim Biophys Acta Gen Subj 2018, 1862: 2323-2329. Chen HW, Medley CD, Sefah K, Shangguan D, Tang Z, Meng L, Smith JE, Tan W: Molecular recognition of small-cell lung cancer cells using aptamers. ChemMedChem 2008, 3: 991-1001. Zamay GS, Kolovskaya OS, Zamay TN, Glazyrin YE, Krat AV, Zubkova O, Spivak E, Wehbe M, Gargaun A, Muharemagic D, et al: Aptamers Selected to Postoperative Lung Adenocarcinoma Detect Circulating Tumor Cells in Human Blood. Mol Ther 2015, 23: 1486-1496. Zhou W, Zhao L, Yuan H, Xu L, Tan W, Song Y, Fang X: A new small cell lung cancer biomarker identified by Cell-SELEX generated aptamers. Exp Cell Res 2019, 382: 111478. Wu YY, Hsieh IS, Tung CH, Weng CH, Wu JE, Yu JS, Hong TM, Chen YL: A novel DNA aptamer targeting lung cancer stem cells exerts a therapeutic effect by binding and neutralizing Annexin A2. Mol Ther Nucleic Acids 2022, 27: 956-968. Garafutdinov RR, Sakhabutdinova AR, Gilvanov AR, Chemeris AV: Rolling Circle Amplification as a Universal Method for the Analysis of a Wide Range of Biological Targets. Russ J Bioorg Chem 2021, 47: 1172-1189. Gu L, Yan W, Liu L, Wang S, Zhang X, Lyu M: Research Progress on Rolling Circle Amplification (RCA)-Based Biomedical Sensing. Pharmaceuticals (Basel) 2018, 11 Additional Declarations No competing interests reported. Supplementary Files GraphicAbstract.png JNTadditionalfile1.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4767665","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":334997218,"identity":"352f670a-f761-461f-ae76-9d0212f94ce1","order_by":0,"name":"Min-Jee Kim","email":"","orcid":"","institution":"University of Ulsan College of Medicine, Asan Medical Center","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Min-Jee","middleName":"","lastName":"Kim","suffix":""},{"id":334997219,"identity":"24258d7e-437b-494a-96b7-2bcf15b061c4","order_by":1,"name":"Kyuha Yum","email":"","orcid":"","institution":"University of Seoul","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kyuha","middleName":"","lastName":"Yum","suffix":""},{"id":334997220,"identity":"8bf98092-71a2-4e96-9805-17a167fd061e","order_by":2,"name":"Dajeong Kim","email":"","orcid":"","institution":"University of Seoul","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Dajeong","middleName":"","lastName":"Kim","suffix":""},{"id":334997221,"identity":"2536c5fc-c67f-42f9-8ddf-5197c84ef01f","order_by":3,"name":"Jong Bum Lee","email":"","orcid":"","institution":"University of Seoul","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jong","middleName":"Bum","lastName":"Lee","suffix":""},{"id":334997222,"identity":"05d54497-2560-4a45-a645-9de682dbfb52","order_by":4,"name":"Peter Chang-Whan Lee","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIiWNgGAWjYFAC5gYGhgo4z4JBgrAWRqCWM3CeBJFaGNtI0WLOfrDxwcd5dtH8DewPH3xsk2CQnH0AvxbLnsRmw5nbknNnHOAxNpwJ1CLNl4Bfi8ENxjZp3m3MuRsYeNikeYFa5HgIOAyopf333zn1QC3sz38Tq6WNmbHhMFALgxkzSIs0IS0gv0j2HDueO+Mwj7HkjHMSPJI9BLSYsx8++OFHTXVuf3v7ww8fymzkJM4Q0GIAZzFDKELOQtYyCkbBKBgFowAXAACN3jsoiFkrIwAAAABJRU5ErkJggg==","orcid":"","institution":"University of Ulsan College of Medicine, Asan Medical Center","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Peter","middleName":"Chang-Whan","lastName":"Lee","suffix":""}],"badges":[],"createdAt":"2024-07-19 11:12:56","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4767665/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4767665/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":62733575,"identity":"240d1fff-aa4a-4c0f-b887-6dc0d72f122a","added_by":"auto","created_at":"2024-08-18 23:58:59","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":125945,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic of the His-tagged USE1 SELEX (Systematic Evolution of Ligands by Exponential Enrichment) process.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe SELEX method was employed using a library consisting of 10\u003csup\u003e15\u003c/sup\u003e random-sequence aptamers. The process was iteratively performed through 10 rounds, which ultimately led to the selection of specific aptamers. The selected aptamers were subsequently identified via DNA sequencing.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4767665/v1/1e058f968d955309eaf2a039.png"},{"id":62733579,"identity":"bf56a98a-367f-4395-a666-83768bbdbdea","added_by":"auto","created_at":"2024-08-18 23:59:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":207161,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of the binding affinity of aptamer 1 and truncated aptamer 1e with the USE1 protein using ELONA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Microtiter plates were coated with 723 nM of the USE1 protein. Subsequently, 10 μM of each 5′- or 3′-biotinylated Aptamer 1, 2, and 3 was added, and the optical density was measured hourly for a total of 15 h. Data points represent the average of four independent experiments, each conducted in duplicate.\u003c/p\u003e\n\u003cp\u003e(B) The secondary structures and docking simulations for aptamer 1 and truncated aptamer 1e were predicted using M-fold and HDOCK server, respectively.\u003c/p\u003e\n\u003cp\u003e(C) Microtiter plates were coated with 723 nM of the USE1 protein. Subsequently, 10 μM of each aptamer 1 and truncated forms 1a-e was added, and the optical density was measured hourly for a total of 15 h. Data points represent the average of four independent experiments, each conducted in duplicate.\u003c/p\u003e\n\u003cp\u003e(D) Microtiter plates were coated with 723 nM of the USE1 protein. Subsequently, 10 μM of each aptamer 1 and truncated forms 1e was added, and the optical density was measured hourly for a total of 20 h. Data points represent the average of four independent experiments, each conducted in duplicate.\u003c/p\u003e\n\u003cp\u003e(E) Microtiter plates were coated with 723 nM of the USE1 protein. Subsequently, 0 to 20 nM of aptamer 1 and 1.25 to 40 μM of truncated aptamer 1e were added, and the optical density was measured 1 h post-reaction. Data points represent the average of four independent experiments, each conducted in duplicate.\u003c/p\u003e\n\u003cp\u003e(F) Microtiter plates were coated with 723 nM of the USE1 protein. Subsequently, 0 to 20 nM of aptamer 1 and 1.25 to 40 μM of truncated aptamer 1e were added, and the optical density was measured hourly for a total of 20 h. Each data point represents the averaged of four independent experiments, each with two replicates.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4767665/v1/53b9ea34fface2961a8eebc3.png"},{"id":62733581,"identity":"6aad0693-18cd-4f0b-bcc5-6a1569db61e4","added_by":"auto","created_at":"2024-08-18 23:59:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":168380,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of the binding ability of aptamer 1 and truncated aptamer 1e with the USE1 protein using in vitro and in vivo immunoblotting and ELONA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Ni-NTA pull-down assay demonstrating the interaction between His-tagged USE1 protein and biotinylated Aptamer 1.\u003c/p\u003e\n\u003cp\u003e(B) Ni-NTA pull-down assay showing the binding between His-tagged USE1 protein and biotinylated Aptamer 1e.\u003c/p\u003e\n\u003cp\u003e(C) In vitro streptavidin immunoprecipitation assay using the His-tagged USE1 protein and biotinylated Aptamer 1.\u003c/p\u003e\n\u003cp\u003e(D) In vitro streptavidin immunoprecipitation assay with the His-tagged USE1 protein and biotinylated Aptamer 1e.\u003c/p\u003e\n\u003cp\u003e(E-G) Microtiter plates were coated with 100 ng of A549 cells subjected to different\u003c/p\u003e\n\u003cp\u003econditions (untreated, USE1 overexpressed, siRNA control, USE1 knockdown) and incubated with 10 nM of aptamer 1 (left) or 1 μM of truncated aptamer 1e (right). Optical density was measured 1 h post-reaction. Data points represent the average of four independent experiments, each with two replicates.\u003c/p\u003e\n\u003cp\u003e(H) Immunoblotting of 30 paired tumor and adjacent non-tumor tissues analyzed to detect USE1 protein expression.\u003c/p\u003e\n\u003cp\u003e(I) ELONA performed using lysates from 33 paired tumor and non-tumor adjacent tissues\u003c/p\u003e\n\u003cp\u003eand aptamer 1 to assess binding activity.\u003c/p\u003e\n\u003cp\u003e(J) Receiver operating characteristic (ROC) curve with 95% confidence intervals calculated to determine the cutoff value for distinguishing tumor from non-tumor adjacent tissue using ELONA data.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4767665/v1/c425fe2affa8012fcdb4fce1.png"},{"id":62733578,"identity":"fa76e1a1-94ef-4aa1-ba9c-b93cbdd1506c","added_by":"auto","created_at":"2024-08-18 23:59:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":310081,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSTA-QD DNAMS dot blot analysis for USE1 targeting aptamer 1 detection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Schematic of the synthesis of functional DNA microspheres (DNAMSs). To synthesize functional DNAMSs by rolling circle amplification (RCA), Phi29 DNA polymerase was used with biotin-dCTPs. Through RCA of circular DNA, biotin-expressed DNAMSs were fabricated.\u003c/p\u003e\n\u003cp\u003e(B) Schematic of dot blot analysis with the USE1 aptamer.\u003c/p\u003e\n\u003cp\u003e(C) Dynamic light scattering analysis revealing the size distribution of Biotin DNAMS and Streptavidin Quantum Dot conjugated DNAMS (STA-QD DNAMS). Hoechst 33342 stain (blue) highlights the core of STA-QD DNANS and the red signal indicates the conjugation of STA-QD.\u003c/p\u003e\n\u003cp\u003e(D) Dot blot analysis with BSA and USE1 protein for optimization of USE1 aptamer concentration with STA-QD.\u003c/p\u003e\n\u003cp\u003e(E) Dot blot analysis with BSA and USE1 protein for optimization of USE1 aptamer concentration with STA-QD DNAMS.\u003c/p\u003e\n\u003cp\u003e(F) Dot blot analysis for the limit of detection of BSA and USE1 protein with STA-QD DNAMS.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4767665/v1/3ea0d2f2f4771f3a48e3775a.png"},{"id":62733580,"identity":"becbfacb-2890-4fec-9d7e-ca68badc292c","added_by":"auto","created_at":"2024-08-18 23:59:00","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":240866,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFluorescence biosensing kit for USE1 targeting aptamer 1 detection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Schematic of USE1 protein sensing according to a kit developed using the USE1 aptamer.\u003c/p\u003e\n\u003cp\u003e(B) Visualization of USE1 protein fluorescence sensing in the kit format with the USE1 aptamer and STA-QD DNAMSs to demonstrate the operational effectiveness of kit.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4767665/v1/5a872b9c2c6c915124fef7ef.png"},{"id":65389082,"identity":"c06f4197-f8ab-4df8-9c15-e744d409dbc7","added_by":"auto","created_at":"2024-09-26 21:31:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2145632,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4767665/v1/0c3784e7-92c6-4ded-919e-e3ba1c4553df.pdf"},{"id":62733576,"identity":"9e28129c-b7eb-4ed6-b889-93551c9e627e","added_by":"auto","created_at":"2024-08-18 23:59:00","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":116743,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-4767665/v1/77926849204c6eaa4f0abd9d.png"},{"id":62733582,"identity":"b93a5093-897c-4361-9f76-b1bc6e3399b8","added_by":"auto","created_at":"2024-08-18 23:59:00","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":1206358,"visible":true,"origin":"","legend":"","description":"","filename":"JNTadditionalfile1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4767665/v1/c424e2f7f8b61a05d213784d.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"DNA aptamer targeting USE1 as a novel biomarker for lung cancer","fulltext":[{"header":"Background","content":"\u003cp\u003eLung cancer is the second most diagnosed cancer worldwide and the leading cause of cancer-related deaths [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In 2023, approximately 2.2\u0026nbsp;million new cases and 1.8\u0026nbsp;million deaths due to lung cancer were recorded, emphasizing its critical impact on global health [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The comprehensive treatment paradigm for early-stage lung cancer has evolved rapidly over the past 20 years. Radical resection of cancer lesions remains the preferred treatment option for early-stage lung cancer. Unfortunately, only 18% of patients at initial presentation are eligible for such curative interventions [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Furthermore, the postoperative survival rates for patients with lung cancer remain suboptimal, with five-year survival rates ranging from 90% in stage I to a mere 12% in stage III. Undoubtedly, the survival of patients with lung cancer is markedly dependent on early detection and appropriate treatment.\u003c/p\u003e \u003cp\u003eAmong the array of biomarkers for the early detection of lung cancer, UBA6-specific E2 conjugating enzyme 1 (USE1), a member of the E2 enzyme family in the ubiquitin-proteasome system (UPS), is emerging as a novel biomarker and therapeutic target. USE1 specifically interacts with the UBA6 enzyme rather than the conventional E1 enzyme [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The UPS plays a crucial role in protein homeostasis and is involved in numerous cellular processes, including DNA repair, endocytic trafficking, and immune response. Consequently, dysregulation of the UPS is associated with several human diseases, including multiple cancer types [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In our previous study, the USE1 protein was found to be markedly overexpressed in lung cancer tissues; however, its knockdown significantly delayed tumor growth, migration, and invasion. These findings underscore the potential of USE1 as a significant biomarker for the detection of lung cancer [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe main challenge in developing reliable diagnostic sensors based on conventional antibodies is the variability in their affinity across different manufacturing processes and batches. To overcome these limitations, synthetic aptamers\u0026mdash;short strands of DNA or RNA\u0026mdash;have been employed due to their high affinity and specificity, which are solely due to their nucleotide sequences [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Unlike antibodies, aptamers are generated through artificial selection, do not trigger immunogenic responses in the host immune system, and are easily modified and conjugated with other drugs or carriers [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. These advantages broaden their applicability in diagnostics across diverse platforms, including optical, colorimetric, fluorescence, electrochemical, microfluidic, PET (positron-emission tomography), CT (computed tomography), MRI (magnetic resonance imaging), and others [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, the Systematic Evolution of Ligands by EXponential enrichment (SELEX) was employed to develop specific DNA aptamers targeting the USE1 protein. The aptamers, named Aptamer 1 and 1e, were then evaluated using lung cancer cell lines and tissue samples to determine their binding efficacy. Subsequently, a diagnostic kit was developed using self-assembly, biotin-modified DNA microstructures conjugated with streptavidin quantum dots to detect Aptamer 1 that targets the USE1 protein. Based on our results, these aptamers possess robust targeting capabilities, which highlight their potential as part of a diagnostic kit for the early detection of lung cancer.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePatients and lung cancer tissue samples\u003c/h2\u003e \u003cp\u003eThe experiments were conducted after obtaining informed consent from patients and approval from the Institutional Review Board of Asan Medical Center (2014\u0026thinsp;\u0026minus;\u0026thinsp;0960). Surgically resected human lung tissues were acquired from the Asan Bio Resource Center (Resource No. 2014-20(89)).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eHis-Tag Protein SELEX Procedures\u003c/h2\u003e \u003cp\u003eThe human USE1-targeting aptamer was isolated using a His-tag protein SELEX method. In the initial round of SELEX, the single-strand DNA (ssDNA) library, consisting of 10^15 molecules, was incubated with 2 mg of recombinant His-tagged human full-length USE1 (His-USE1) protein and nickel-nitrilotriacetic acid (Ni-NTA) magnetic agarose beads at 25\u0026deg;C for 30 minutes in His-tag binding buffer (2.95 mM KCl, 1 mM MgCl2, 2.4 mM CaCl2, 0.1% Tween 20, and 10 mM imidazole in 1X PBS, pH 7.0). Ni-NTA magnetic agarose beads bound with USE1 and aptamers were precipitated using a magnet. Unbound aptamers were removed through repeated washing with the binding buffer. USE1 was eluted with the bound aptamers using His-tag elution buffer (500 mM imidazole and 0.02% Tween 20 in PBS). After the 10th round of SELEX, the USE1-bound aptamers were sequenced.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eAptamer structure and aptamer/protein docking site prediction\u003c/h2\u003e \u003cp\u003eThe secondary structure of aptamers was predicted using the M-fold web software (available at M-fold). The potential docking sites for aptamer and USE1 protein interactions were identified using the HDOCK server (HDOCK).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eELONA (Enzyme-Linked OligoNucleotide assays)\u003c/h2\u003e \u003cp\u003eAn ELISA-like assay, ELONA (Enzyme-Linked OligoNucleotide Assays) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] adapted for DNA aptamers, was performed as outlined in Supplementary Fig.\u0026nbsp;3. The USE1 protein was diluted to 723 nM using 0.1 M sodium phosphate buffer (pH 7.4). Thereafter, 100 \u0026micro;L/well of this solution was incubated overnight at 4\u0026deg;C in a polystyrene 96-well microtiter plate (MaxiSorpTM; Th. Geyer). Following coating, the wells were washed three times with 200 \u0026micro;L of washing buffer (0.3 M NaCl/PBS containing 0.05% Tween 20) and then blocked with 200 \u0026micro;L of 2% BSA in blocking buffer (0.3 M NaCl/PBS containing 0.05% Tween 20) for 1 hour at room temperature. After three additional washes with 200 \u0026micro;L of washing buffer, 100 \u0026micro;L of either 5\u0026prime;- or 3\u0026prime;-biotinylated aptamers (5\u0026prime; Bio or 3\u0026prime; Bio) diluted to 10,000 nM in binding buffer (100 mM NaCl, 20 mM Tris-HCl pH 7.6, 10 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 5 mM KCl, 1 mM CaCl\u003csub\u003e2\u003c/sub\u003e, 0.005% Tween 20) was added to each well. The plate was incubated at room temperature for 1.5 hours with mild shaking to facilitate the binding of the aptamers to the immobilized protein.\u003c/p\u003e \u003cp\u003eFollowing the binding reaction, the wells were washed three times with 200 \u0026micro;L of binding buffer to remove unbound oligonucleotides. A streptavidin-HRP conjugate solution (Thermo Scientific) was diluted 1:10,000 in binding buffer to 0.2\u0026ndash;0.25 \u0026micro;g/mL. Thereafter, 100 \u0026micro;L of this solution was dispensed into each well; incubation was performed at room temperature for 1 hour with mild shaking. After five washes with 200 \u0026micro;L of binding buffer, 100 \u0026micro;L of 3,3\u0026prime;,5,5\u0026prime;-tetramethylbenzidine (TMB) substrate solution (Thermo Fisher Scientific) was added to each well and incubated for 30 minutes at room temperature in the dark. The reaction was terminated by adding 50 \u0026micro;L/well of 0.5 M H2SO4. The optical density was measured at 370 nm or 450 nm using a SpectraMAX spectrophotometer. As specified in the Results and \u003cspan refid=\"Sec15\" class=\"InternalRef\"\u003eDiscussion\u003c/span\u003e section, the results of up to four independent experiments were generally averaged, with each experiment representing one microtiter plate and including one to four replicates of each specific interaction.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and transfection\u003c/h2\u003e \u003cp\u003eLung cancer cell lines, including HEK293T, A549, H1270, H292, and H1299, were obtained from the American Type Culture Collection (ATCC) and cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The cells were maintained at 37\u0026deg;C in a humidified atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e. Transfection was performed using the iNfect transfection reagent (Intron, Korea), according to the manufacturer\u0026rsquo;s instructions. Cells were harvested 48 hours post-transfection for subsequent analyses. For siRNA-mediated knockdown, Lipofectamine RNAiMax (Invitrogen) was used according to the manufacturer\u0026rsquo;s protocol.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003eImmunoblotting\u003c/h2\u003e \u003cp\u003eTissue and cell lysates were prepared using a 1% SDS lysis buffer (40 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% SDS, 1 mM EDTA) supplemented with protease inhibitors (Complete Mini, EDTA-free; Roche). The lysates were centrifuged at 13,500 \u0026times;g for 30 minutes, and the supernatants were collected. Western blotting was conducted using primary antibodies against His-tag (sc-803, Santa Cruz Biotechnology, 1:1000 dilution), biotin (A150-109A, Thermo Fisher Scientific, 1:1000 dilution), α-Myc (sc-40, Santa Cruz Biotechnology, 1:1000 dilution), USE1 (1:1000 dilution), and α-alpha-tubulin (ab7291, Abcam, 1:5000 dilution), followed by horseradish peroxidase-conjugated secondary antibodies (Thermo Fisher Scientific). Detection was performed via enhanced chemiluminescence (Bio-Rad).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003eDevelopment of the USE1 protein biosensing kit\u003c/h2\u003e \u003cp\u003eThe circularization of linear DNA, self-assembly of biotin-modified DNA monomers, STA-QD conjugation, and dot blot analysis are described in the supplementary materials.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003eFluorescence/quencher aptamer probe for USE1 protein detection\u003c/h2\u003e \u003cp\u003eTo construct the aptamer probe, 80 nM of Aptamer 1 (ADNA), 40 nM of fluorescence-tagged DNA (FDNA, sequence: 5\u0026rsquo;-3\u0026rsquo; GCA AGC TTG TTC GAG CCA G /F/), and 120 nM of quencher DNA (QDNA, sequence: 5\u0026rsquo;-3\u0026rsquo; /Q/ CCC TAT GCC AAA C) were combined. The mixture was initially heated to 90\u0026deg;C and then allowed to reach thermal equilibrium. The temperature was gradually reduced by 1\u0026deg;C per minute until a final temperature of 20\u0026deg;C was achieved. Finally, the solution was incubated for an additional 30 minutes.\u003c/p\u003e \u003cp\u003eFor the aptamer probe binding assay with the USE1 protein, 8 nM of the aptamer probe and 1 mM of MgCl\u003csub\u003e2\u003c/sub\u003e were pre-mixed in a total volume of 50 \u0026micro;L of PBS and incubated at 15\u0026deg;C for 10 minutes. Prior to reaching the final incubation temperature of 37\u0026deg;C, different concentrations of the USE1 protein (0, 0.1, 0.3, 1, and 3 \u0026micro;M) were added, and the mixture was incubated for 60 minutes. After incubation at 22\u0026deg;C for 30 minutes, fluorescence measurements were performed every minute.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eSelection of aptamers targeting USE1 using SELEX\u003c/h2\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e illustrates the schematic of the SELEX process used to select His-Tagged USE1-targeting aptamers. To identify aptamers that target USE1, a library containing 10\u003csup\u003e15\u003c/sup\u003e molecules of random-sequence aptamers was used. The SELEX process was completed after 10 rounds, and aptamers that showed specificity for USE1 were identified via DNA sequencing. Based on the aptamer array results, three aptamers (aptamers 1, 2, and 3) were selected for further analysis (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The predicted structures, docking simulations (HDOCK, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://hdock.phys.hust.edu.cn/\u003c/span\u003e\u003cspan address=\"http://hdock.phys.hust.edu.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and dissociation constants (K\u003csub\u003ed\u003c/sub\u003e) of aptamers 1, 2, and 3 are presented in Supplementary Figs.\u0026nbsp;1 and 2.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAptamers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSize\u003c/p\u003e \u003cp\u003e(mer)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5' to 3'\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCTAATACGACTCACTATAGCGGATCCGATGGGTGGGGGGGTGGGTAGGATCCGTTCGGGGTTTGGCATAGGGTCTGGCTCGAACAAGCTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGGCTCGAACAAGCTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCATAGGGTCTGGCTCGAACAAGCTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTAACACGATTCACTATAGCTCGGGGTTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCTAATACGACTCACTATAGTTCGGGGTTTGGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCTAACACGATTCACTATAGCTCGGGGTTTGGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCTAATACGACTCACTATAGCGGACAGGGCTGGTGTGGCTGGCGTCCGGCTCGAACAAGGCTGGTGTGGCTGGCGTTCTGGCTCGAACAAGCTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCTAATACGACTCACTATAGCGGATCCGACAGAATGCCATCACCATGTCTAGACCTATTGGCTTTGCGACTGGCTCGAACAAGCTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of the in vitro binding affinity of aptamers using ELONA and immunoblotting\u003c/h2\u003e \u003cp\u003eAn aptamer-based ELONA was developed to evaluate the binding affinity of the aptamers for purified USE1 protein, as previously described [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Among the three aptamers, aptamer 1 (10 \u0026micro;M) exhibited the highest intensity with purified USE1 protein (6 \u0026micro;M) in a time-dependent manner based on ELONA (Supplementary Fig.\u0026nbsp;3 and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). To reduce the cost of chemical synthesis and improve tissue penetration and structural stability, full-length aptamer 1 was further truncated into five sequences (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Subsequent ELONAs with each truncated aptamer (10 \u0026micro;M) and purified USE1 protein (6 \u0026micro;M) were conducted to compare binding affinities. Aptamer 1e exhibited the highest binding capacity compared to the other truncated forms, including 1a, 1b, 1c, and 1d (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The binding affinities of aptamers 1 and 1e for the purified USE1 protein, demonstrated in time- and dose-dependent manners, are shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-F.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo explore the interaction between USE1 and the aptamers, in vitro Ni-NTA and streptavidin pull-down assays were performed using purified His-USE1 protein and biotinylated aptamers. The results confirmed a direct interaction between the USE1 protein and aptamers 1 and 1e in the in vitro assays (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-D). Consistently, aptamers 1 and 1e directly interacted with the USE1 protein in 293T cells overexpressing USE1, based on immunoprecipitation analysis (Supplementary Figs.\u0026nbsp;4A and B). Overall, both aptamers 1 and 1e exhibited effective binding affinity for the USE1 protein based on the in vitro assays and ELONA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDetection of the USE1 Protein in Lung Cancer Cells and Tissue Using Aptamers 1 and 1e\u003c/b\u003e \u003c/p\u003e \u003cp\u003ePrevious studies have demonstrated that the protein level of USE1 is elevated in 92% of patients with lung cancer, underscoring its significance as a biomarker for the proliferation, invasion, and migration of lung cancer. Consequently, we evaluated the detection capabilities of aptamers 1 and 1e for the USE1 protein in lung cancer cells and tissues, employing these aptamers as biosensors.\u003c/p\u003e \u003cp\u003eUsing ELONA, aptamers 1 (10 nM) and 1e (1 \u0026micro;M) successfully detected the USE1 protein in 100 ng of lysate from A549 lung cancer cells. This detection was consistent even after overexpression of USE1 with an HA-USE1 plasmid or knockdown with USE1 siRNA (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-G). Furthermore, these aptamers identified the USE1 protein in smaller amounts (50 ng) of lysates from various lung cancer cell lines, including A549, H1270, H292, and H1299 (Supplementary Figs.\u0026nbsp;4C-F). The detection capability of the aptamers was also assessed in 30 lung cancer tissues with elevated USE1 protein levels and their paired adjacent non-tumoral lung tissues. All samples showed higher binding signals compared to their adjacent non-tumor tissues (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH-I). Receiver operating characteristic (ROC) curves with 95% confidence intervals revealed a binding signal cutoff value of 2.77 for lung cancer detection, with sensitivity and specificity of 100.0% and 80.0%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ, AUC 0.923, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). In conclusion, both aptamers 1 and 1e effectively detected the USE1 protein in lung cancer cells and tissues using ELONA.\u003c/p\u003e \u003cp\u003e \u003cb\u003eStreptavidin-Quantum Dot (STA-QD) DNA Microsphere (DNAMS) Dot Blot Analysis for the Targeting of USE1 with Aptamer 1\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn the realm of molecular diagnostics for various diseases, the in vitro amplification of nucleic acids forms the foundation of all modern methods. Among the diverse amplification techniques, rolling circle amplification (RCA) enables the synthesis of nucleic acid products with predetermined nucleotide sequences. Therefore, we developed a dot blot analysis to detect USE1-targeting aptamer 1 using self-assembled biotin-modified DNAMS and STA-QD conjugation (STA-QD DNAMS) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B). Dynamic light scattering analysis confirmed a mean diameter of approximately 1,000 nm for the biotin-modified DNAMS. Following the conjugation of STA-QD to biotin-modified DNAMS, the size increased compared to that of the biotin-modified DNAMS alone. Fluorescence microscopy validated the successful conjugation of STA-QD to biotin-modified DNAMS. The biotin-modified DNAMS were labeled using Hoechst 33342, exhibiting blue fluorescence, while the conjugated STA-QD displayed red fluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo evaluate the effectiveness and optimization of the polyvinylidene fluoride (PVDF) membrane with a biotinylated aptamer model, an experiment was conducted using biotinylated aptamer 1 and STA-QD (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). As the amount of biotinylated aptamer 1 increased from 10 to 20 pmole, the intensity of the USE1 protein signal generally increased, whereas the BSA control dot showed minimal change. However, at 50 pmole of aptamer, the signal intensity in the control group (BSA) was elevated to a level similar to that in the USE1 group, resulting in no significant difference between the BSA and USE1 groups. Consequently, we concluded that the optimal amount of aptamer 1 for detecting USE1 is 20 pmole.\u003c/p\u003e \u003cp\u003eFollowing validation of the dot blot analysis setup for detecting the USE1 protein with STA-QD, we optimized the use of biotinylated aptamer 1 for effective detection of the USE1 protein with STA-QD DNAMS using the aforementioned method. Consistently, 20 pmole of biotinylated aptamer was identified as the optimal condition for detecting USE1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Notably, even at 50 pmole of biotinylated aptamer 1, the intensity difference with BSA was significant, unlike with STA-QD. This discrepancy might be attributed to the larger size of STA-QD DNAMS and the numerical advantage of multiple STA-QD conjugations on DNAMS, which reduce off-target effects and enhance signal amplification.\u003c/p\u003e \u003cp\u003eUsing the optimized conditions from previous experiments, we conducted dot blot assays to determine the limit of detection (LOD) for the USE1 protein with STA-QD DNAMS. Aptamer 1 and STA-QD DNAMS were used to detect the USE1 protein at concentrations of 0.05, 0.5, 5, 50, and 500 nM in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). The LOD for the USE1 protein was determined to be 10 nM, as the intensity difference was insignificant below this concentration. In conclusion, the combination of biotinylated aptamer models and STA-QD DNAMS provides a sensitive and reliable platform for detecting the USE1 protein across a range of concentrations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eFluorescence biosensing kit for the targeting of USE1 via aptamer 1 detection\u003c/h2\u003e \u003cp\u003eFluorescence-based biosensing is an effective method for detecting cancer biomarkers[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. To facilitate the clinical application of this technology for lung cancer detection, we developed a fluorescence biosensing kit using STA-QD DNAMS targeting USE1 with aptamer 1. A PVDF membrane was integrated into a 3D-printed scaffold with two wells: control and test lines. The fluorescence signal was measured using a UV lamp (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe control setup of the kit included streptavidin as a positive control, while the test setup included bovine serum albumin (BSA) as a negative control and USE1 as the target protein. A fluorescence signal appeared in the test line containing the USE1 protein, indicating that the biosensing kit successfully detected the USE1 protein using aptamer 1 and STA-QD DNAMS. In contrast, the test line with BSA in the negative control group displayed a negligible signal compared to that in the USE1 group. The difference in fluorescence signal was visible to the naked eye (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eTo obtain more quantitative results, the mean fluorescence intensity (MFI) was measured using ImageJ software. As expected, the USE1 test line had an intensity comparable to the control line, while the BSA test line exhibited almost no signal. These results support the potential utility of our biosensing approach in clinical settings, providing a rapid and convenient method for the specific identification of USE1 as a biomarker for lung cancer.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we successfully identified and validated an aptamer that can detect USE1, a significant biomarker for lung cancer. Validation was conducted using various methods, including Western blot, ELONA, and a Quencher DNA system, utilizing the USE1 protein, lung cancer cell lines, and lung cancer tissue samples. Additionally, we developed a STA-QD DNAMS fluorescence sensing method that effectively detects the USE1-targeting aptamer, leading to the creation of a diagnostic kit for lung cancer.\u003c/p\u003e \u003cp\u003eLung cancer remains the most prevalent cancer and the second leading cause of cancer-related mortality worldwide [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. It can be cured via resection surgery if detected early[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. However, the lack of efficient early detection technologies or reliable molecular biomarkers often results in late diagnosis, thereby missing the ideal therapeutic window[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. To improve patient survival, diagnostic technologies that use molecular biomarkers capable of sensitively and selectively recognizing lung cancer cells must be developed.\u003c/p\u003e \u003cp\u003ePreviously, our research team discovered that the USE1 protein is upregulated in 98.1% of patients with lung cancer. The overexpression of the USE1 protein was found to promote the proliferation, migration, and invasion of lung cancer cells. Notably, USE1 contains a conserved D-box domain and is regulated by the anaphase-promoting complex, suggesting its pivotal role in the pathogenesis of lung cancer and highlighting its potential as a novel biomarker [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Based on these findings, we developed a practical diagnostic kit using aptamers that target the USE1 protein.\u003c/p\u003e \u003cp\u003eAptamers are short single-stranded segments of DNA (ssDNA), RNA (ssRNA), or synthetic nucleic acid analogs (XNA) that bind their targets with high affinity and specificity by folding into various secondary and tertiary structures [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Unlike antibodies, aptamers do not require immunogenicity to activate the host immune system, are synthesized chemically, and are easily modified and conjugated with other drugs or carriers [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Owing to these properties, aptamers have been extensively studied in various applications, including disease diagnosis, therapeutics, and biomarker discovery [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSince the inception of Cell-SELEX for targeting lung cancer cells [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], several aptamers have been identified for the detection of lung cancer using lung cancer cell lines, tissue lysates, or patient blood samples. For instance, Zamay GS et al. [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] identified four aptamers that specifically bind to lung adenocarcinoma cells using blood circulating tumor cells (CTCs). These aptamers were applied not only to detect CTCs and apoptotic bodies but also to associated protein biomarkers for lung cancer, including vimentin, annexin A2, annexin A5, histone 2B, neutrophil defensin, and clusterin. Zhou et al. [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] identified a novel biomarker for small-cell lung cancer (SCLC) through Cell-SELEX-generated aptamers; aptamer C12 was found to target high-density lipoprotein binding protein (HDLBP). Subsequent knockdown of HDLBP by siRNA inhibited the proliferation and metastasis of SCLC cells in vitro and decelerated tumor formation in vivo. More recently, the AP-9R aptamer was developed using Cell-SELEX to target cancer stem cells of lung cancer, with annexin A2 identified as the target protein. The expression of annexin A2 was associated with stemness, metastasis, and poor clinical outcomes in lung cancer, suggesting its role as a cancer stem cell (CSC) marker and regulator, with potential theragnostic applications for lung cancer [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. These aptamers, which target lung cancer cell lines, tissue lysates, and patient serum, were validated as detectors of biomarkers by identifying the target proteins and assessing the impact on lung cancer development or progression. However, the specificity and sensitivity of these aptamers may be compromised as they do not commence from the exact target molecule and might inadvertently detect other cancers or normal molecules.\u003c/p\u003e \u003cp\u003eIn contrast to previous studies, the present study aimed to develop a lung cancer detection kit using an aptamer that specifically targets the USE1 protein, which is already well-studied due to its role as a novel biomarker and its involvement in lung cancer pathogenesis. By directly targeting USE1, our approach aims to enhance the sensitivity and specificity of lung cancer detection. This strategic focus is expected to yield a diagnostic tool that not only improves the accuracy of lung cancer diagnostics but also contributes to earlier and more effective treatment interventions.\u003c/p\u003e \u003cp\u003eAmong the three aptamers developed in this study, aptamer 1 exhibited the best binding affinity to USE1, with a dissociation constant of 10 nM. To reduce synthesis costs and improve tissue penetration and structural stability, aptamer 1 was truncated to aptamer 1e, which demonstrated similarly high binding affinity. Aptamers 1 and 1e effectively interacted with USE1 in vitro and in vivo based on immunoprecipitation assays and could identify lung cancer tissues with 100% sensitivity and 80% specificity based on ELONA. These results confirm that aptamers 1 and 1e are effective detectors of the USE1 protein not only in vitro and in lung carcinoma cell lines but also in actual patient cancer tissues, underscoring their potential for clinical application in lung cancer diagnostics.\u003c/p\u003e \u003cp\u003eRCA is a method in which nucleic acids are synthesized using a circular template [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. This technique is not only used to amplify and subsequently detect analyte molecules but also to generate functionally active nucleic acids that mediate the detection of other biotargets [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Self-assembled DNAMS was produced via RCA with several functionalized dNTPs, which can exhibit DNAMS fluorescence and allow the attachment of other functional moieties through strong interactions, such as chemical conjugation or biotin\u0026ndash;streptavidin interaction [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBuilding on this technology, we developed a USE1-targeting aptamer detection kit using self-assembled biotin-modified DNAMS and STA-QD conjugation. This kit enables successful identification of the USE1-associated aptamer 1 through simple visual inspection, offering a promising tool for early and effective lung cancer diagnosis. This integration of STA-QD DNAMS with a USE1-targeted aptamer implies the potential for sophisticated diagnostic applications in lung cancer, potentially improving clinical outcomes through early detection.\u003c/p\u003e \u003cp\u003eIn this study, aptamers targeting USE1, a critical biomarker for lung cancer, were successfully developed and validated. Aptamer 1 and its truncated form, Aptamer 1e, exhibited high binding affinity and specificity to USE1, demonstrating effectiveness in various in vitro assays and in distinguishing lung cancer tissues from non-tumoral samples. The integration of these aptamers into a newly formulated diagnostic kit, utilizing RCA-generated, biotin-modified DNA microstructures with STA-QD conjugation, marks a significant advancement in lung cancer diagnostics. This kit, designed for simple visual inspection, is characterized by high sensitivity and specificity, and has the potential to substantially enhance the early detection and treatment of lung cancer. Overall, this approach could be transformative, setting a new standard for biomarker-based diagnostics and potentially decreasing the mortality rate of lung cancer through earlier intervention.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Ms. Ji Won You and Tae Hyeong Lee for technical support\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo datasets were generated or analysed during the current study\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe experiments were conducted after obtaining informed consent from patients and approval from the Institutional Review Board of Asan Medical Center (2014-0960). Surgically resected human lung tissues were acquired from the Asan Bio Resource Center (Resource No. 2014-20(89)).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eK.Y., D.K. and M.K. performed the experiments and analysed the data; K.Y., D.K. and J.B.L developed the methods; P.C.L. and J.B.L supervised the project; M.K., P.C.L and J.B.L wrote the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSiegel RL, Miller KD, Wagle NS, Jemal A: \u003cstrong\u003eCancer statistics, 2023.\u003c/strong\u003e \u003cem\u003eCA Cancer J Clin \u003c/em\u003e2023, \u003cstrong\u003e73:\u003c/strong\u003e17-48.\u003c/li\u003e\n\u003cli\u003eJenkins R, Walker J, Roy UB: \u003cstrong\u003e2022 cancer statistics: Focus on lung cancer.\u003c/strong\u003e \u003cem\u003eFuture Oncol \u003c/em\u003e2023.\u003c/li\u003e\n\u003cli\u003eWeber DJ: \u003cstrong\u003eNew Developments in Lung Cancer Screening.\u003c/strong\u003e \u003cem\u003eRadiol Technol \u003c/em\u003e2024, \u003cstrong\u003e95:\u003c/strong\u003e211-214.\u003c/li\u003e\n\u003cli\u003eLee PC, Sowa ME, Gygi SP, Harper JW: \u003cstrong\u003eAlternative ubiquitin activation/conjugation cascades interact with N-end rule ubiquitin ligases to control degradation of RGS proteins.\u003c/strong\u003e \u003cem\u003eMol Cell \u003c/em\u003e2011, \u003cstrong\u003e43:\u003c/strong\u003e392-405.\u003c/li\u003e\n\u003cli\u003eAntao AM, Tyagi A, Kim KS, Ramakrishna S: \u003cstrong\u003eAdvances in Deubiquitinating Enzyme Inhibition and Applications in Cancer Therapeutics.\u003c/strong\u003e \u003cem\u003eCancers (Basel) \u003c/em\u003e2020, \u003cstrong\u003e12\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eDeng L, Meng T, Chen L, Wei W, Wang P: \u003cstrong\u003eThe role of ubiquitination in tumorigenesis and targeted drug discovery.\u003c/strong\u003e \u003cem\u003eSignal Transduct Target Ther \u003c/em\u003e2020, \u003cstrong\u003e5:\u003c/strong\u003e11.\u003c/li\u003e\n\u003cli\u003eSun T, Liu Z, Yang Q: \u003cstrong\u003eThe role of ubiquitination and deubiquitination in cancer metabolism.\u003c/strong\u003e \u003cem\u003eMol Cancer \u003c/em\u003e2020, \u003cstrong\u003e19:\u003c/strong\u003e146.\u003c/li\u003e\n\u003cli\u003eKim SJ, Hyeong Lee T, Hee Nam S, Kim JH, Oh S, Sook Cho Y, Sup Lee M, Choi S, Lee PC: \u003cstrong\u003eAssociation of Uba6-Specific-E2 (USE1) With Lung Tumorigenesis.\u003c/strong\u003e \u003cem\u003eJ Natl Cancer Inst \u003c/em\u003e2017, \u003cstrong\u003e109:\u003c/strong\u003e1-11.\u003c/li\u003e\n\u003cli\u003eYu H, Alkhamis O, Canoura J, Liu Y, Xiao Y: \u003cstrong\u003eAdvances and Challenges in Small-Molecule DNA Aptamer Isolation, Characterization, and Sensor Development.\u003c/strong\u003e \u003cem\u003eAngew Chem Int Ed Engl \u003c/em\u003e2021, \u003cstrong\u003e60:\u003c/strong\u003e16800-16823.\u003c/li\u003e\n\u003cli\u003eZhang Y, Lai BS, Juhas M: \u003cstrong\u003eRecent Advances in Aptamer Discovery and Applications.\u003c/strong\u003e \u003cem\u003eMolecules \u003c/em\u003e2019, \u003cstrong\u003e24\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eLi Y, Tam WW, Yu Y, Zhuo Z, Xue Z, Tsang C, Qiao X, Wang X, Wang W, Li Y, et al: \u003cstrong\u003eThe application of Aptamer in biomarker discovery.\u003c/strong\u003e \u003cem\u003eBiomark Res \u003c/em\u003e2023, \u003cstrong\u003e11:\u003c/strong\u003e70.\u003c/li\u003e\n\u003cli\u003eGupta R, Rahi Alhachami F, Khalid I, Majdi HS, Nisar N, Mohamed Hasan Y, Sivaraman R, Romero Parra RM, Al Mashhadani ZI, Fakri Mustafa Y: \u003cstrong\u003eRecent Progress in Aptamer-Functionalized Metal-Organic Frameworks-Based Optical and Electrochemical Sensors for Detection of Mycotoxins.\u003c/strong\u003e \u003cem\u003eCrit Rev Anal Chem \u003c/em\u003e2022\u003cstrong\u003e:\u003c/strong\u003e1-22.\u003c/li\u003e\n\u003cli\u003eYang C, Jiang Y, Hao SH, Yan XY, Hong F, Naranmandura H: \u003cstrong\u003eAptamers: an emerging navigation tool of therapeutic agents for targeted cancer therapy.\u003c/strong\u003e \u003cem\u003eJ Mater Chem B \u003c/em\u003e2021, \u003cstrong\u003e10:\u003c/strong\u003e20-33.\u003c/li\u003e\n\u003cli\u003eMohammadinejad A, Gaman LE, Aleyaghoob G, Gaceu L, Mohajeri SA, Moga MA, Badea M: \u003cstrong\u003eAptamer-Based Targeting of Cancer: A Powerful Tool for Diagnostic and Therapeutic Aims.\u003c/strong\u003e \u003cem\u003eBiosensors (Basel) \u003c/em\u003e2024, \u003cstrong\u003e14\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eGan Z, Roslan MAM, Abd Shukor MY, Halim M, Yasid NA, Abdullah J, Md Yasin IS, Wasoh H: \u003cstrong\u003eAdvances in Aptamer-Based Biosensors and Cell-Internalizing SELEX Technology for Diagnostic and Therapeutic Application.\u003c/strong\u003e \u003cem\u003eBiosensors (Basel) \u003c/em\u003e2022, \u003cstrong\u003e12\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eStoltenburg R, Krafcikova P, Viglasky V, Strehlitz B: \u003cstrong\u003eG-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.\u003c/strong\u003e \u003cem\u003eSci Rep \u003c/em\u003e2016, \u003cstrong\u003e6:\u003c/strong\u003e33812.\u003c/li\u003e\n\u003cli\u003eHuang G, Su C, Wang L, Fei Y, Yang J: \u003cstrong\u003eThe Application of Nucleic Acid Probe-Based Fluorescent Sensing and Imaging in Cancer Diagnosis and Therapy.\u003c/strong\u003e \u003cem\u003eFront Chem \u003c/em\u003e2021, \u003cstrong\u003e9:\u003c/strong\u003e705458.\u003c/li\u003e\n\u003cli\u003eBing T, Zhang N, Shangguan D: \u003cstrong\u003eCell-SELEX, an Effective Way to the Discovery of Biomarkers and Unexpected Molecular Events.\u003c/strong\u003e \u003cem\u003eAdv Biosyst \u003c/em\u003e2019, \u003cstrong\u003e3:\u003c/strong\u003ee1900193.\u003c/li\u003e\n\u003cli\u003eBayat P, Nosrati R, Alibolandi M, Rafatpanah H, Abnous K, Khedri M, Ramezani M: \u003cstrong\u003eSELEX methods on the road to protein targeting with nucleic acid aptamers.\u003c/strong\u003e \u003cem\u003eBiochimie \u003c/em\u003e2018, \u003cstrong\u003e154:\u003c/strong\u003e132-155.\u003c/li\u003e\n\u003cli\u003eKaur H: \u003cstrong\u003eRecent developments in cell-SELEX technology for aptamer selection.\u003c/strong\u003e \u003cem\u003eBiochim Biophys Acta Gen Subj \u003c/em\u003e2018, \u003cstrong\u003e1862:\u003c/strong\u003e2323-2329.\u003c/li\u003e\n\u003cli\u003eChen HW, Medley CD, Sefah K, Shangguan D, Tang Z, Meng L, Smith JE, Tan W: \u003cstrong\u003eMolecular recognition of small-cell lung cancer cells using aptamers.\u003c/strong\u003e \u003cem\u003eChemMedChem \u003c/em\u003e2008, \u003cstrong\u003e3:\u003c/strong\u003e991-1001.\u003c/li\u003e\n\u003cli\u003eZamay GS, Kolovskaya OS, Zamay TN, Glazyrin YE, Krat AV, Zubkova O, Spivak E, Wehbe M, Gargaun A, Muharemagic D, et al: \u003cstrong\u003eAptamers Selected to Postoperative Lung Adenocarcinoma Detect Circulating Tumor Cells in Human Blood.\u003c/strong\u003e \u003cem\u003eMol Ther \u003c/em\u003e2015, \u003cstrong\u003e23:\u003c/strong\u003e1486-1496.\u003c/li\u003e\n\u003cli\u003eZhou W, Zhao L, Yuan H, Xu L, Tan W, Song Y, Fang X: \u003cstrong\u003eA new small cell lung cancer biomarker identified by Cell-SELEX generated aptamers.\u003c/strong\u003e \u003cem\u003eExp Cell Res \u003c/em\u003e2019, \u003cstrong\u003e382:\u003c/strong\u003e111478.\u003c/li\u003e\n\u003cli\u003eWu YY, Hsieh IS, Tung CH, Weng CH, Wu JE, Yu JS, Hong TM, Chen YL: \u003cstrong\u003eA novel DNA aptamer targeting lung cancer stem cells exerts a therapeutic effect by binding and neutralizing Annexin A2.\u003c/strong\u003e \u003cem\u003eMol Ther Nucleic Acids \u003c/em\u003e2022, \u003cstrong\u003e27:\u003c/strong\u003e956-968.\u003c/li\u003e\n\u003cli\u003eGarafutdinov RR, Sakhabutdinova AR, Gilvanov AR, Chemeris AV: \u003cstrong\u003eRolling Circle Amplification as a Universal Method for the Analysis of a Wide Range of Biological Targets.\u003c/strong\u003e \u003cem\u003eRuss J Bioorg Chem \u003c/em\u003e2021, \u003cstrong\u003e47:\u003c/strong\u003e1172-1189.\u003c/li\u003e\n\u003cli\u003eGu L, Yan W, Liu L, Wang S, Zhang X, Lyu M: \u003cstrong\u003eResearch Progress on Rolling Circle Amplification (RCA)-Based Biomedical Sensing.\u003c/strong\u003e\u003cem\u003ePharmaceuticals (Basel) \u003c/em\u003e2018, \u003cstrong\u003e11\u003c/strong\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"USE1, Lung cancer, Aptamer, Fluorescence biosensing kit, Self-assembled biotin-modified DNA microsphere, Streptavidin quantum dot","lastPublishedDoi":"10.21203/rs.3.rs-4767665/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4767665/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eBackground\u003c/b\u003e\u003c/p\u003e \u003cp\u003eLung cancer, the second most diagnosed cancer worldwide and the leading cause of cancer-related mortality, presents significant challenges, including early detection and effective treatment. In this study, we developed a diagnostic kit utilizing a novel aptamer targeting UBA6-specific E2 conjugating enzyme 1 (USE1), a biomarker implicated in the pathogenesis of lung cancer.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMaterials and methods\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThrough Systematic Evolution of Ligands by EXponential enrichment (SELEX), we identified aptamers with high affinity and specificity to USE1. To evaluate the detection ability of these aptamers for the USE1 protein, in vitro and in vivo assays, including Enzyme-Linked OligoNucleotide Assays (ELONA) and immunoprecipitation with lung cancer cell lines and tissue samples, were performed. We also developed a novel fluorescence biosensing kit featuring a self-assembled biotin-modified DNA microsphere (DNAMS) and streptavidin quantum dot (STA-QD) conjugation for the detection of USE1.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn vitro assays, such as ELONA and immunoprecipitation, demonstrated the robust detection of USE1 using these aptamers. Validation of the aptamers using lung cancer cell lines and patient tissue samples showed a sensitivity of 100.0% and a specificity of 80.0%. Additionally, the novel fluorescence biosensing kit, which features a self-assembled biotin-modified DNA microsphere (DNAMS) and streptavidin quantum dot (STA-QD) conjugation, facilitated easy visual detection of USE1.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusion\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOverall, this study not only advances the current understanding of aptamer-based diagnostics but also presents a promising approach for early lung cancer detection, with the potential to improve patient outcomes.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGraphic abstract\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e","manuscriptTitle":"DNA aptamer targeting USE1 as a novel biomarker for lung cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-18 23:58:55","doi":"10.21203/rs.3.rs-4767665/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"38a2ed40-67ec-4342-b91c-63515c4e8f1f","owner":[],"postedDate":"August 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-09-26T21:23:20+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-18 23:58:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4767665","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4767665","identity":"rs-4767665","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.