CCL3 aggravates intestinal tissue damage in NEC by promoting macrophage chemotaxis and M1 macrophage polarization.

CCL3 aggravates intestinal tissue damage in NEC by promoting macrophage chemotaxis and M1 macrophage polarization. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article CCL3 aggravates intestinal tissue damage in NEC by promoting macrophage chemotaxis and M1 macrophage polarization. Xi Yuan, Wei Liu, Yue Li, Kai Chen, Hongdong Li, Yibing Yin, Dapeng Chen, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1283126/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Necrotizing enterocolitis (NEC) is a life-threatening inflammatory gastrointestinal disease in neonates, the mechanism of which is poorly elucidated. Intestinal mucosal barrier imbalance due to excessive inflammatory response is an important endogenous cause of NEC. Our study elucidates a novel mechanism of NEC development, in which CCL3 regulated the chemotaxis, polarization, and function of macrophages to promote NET progression. Our data show that CCL3 is highly expressed in the intestinal tissues of NEC patients and mice and induce macrophage infiltration. Transcriptome data from high-throughput sequencing showed that CCL3 strongly induced macrophages switch into a pro-inflammatory phenotype. Mechanistically, in vivo experiments confirmed that CCL3 induced M1 polarization of macrophages in NEC intestinal tissue, thereby aggravating inflammatory injury of intestinal tissue which can be reversed by anti-CCL3 treatment; in accordance, in vitro e xperiments showed that CCL3 could significantly enhance the expression of M1-related genes (e.g. iNOS, IRF5, CD86) in both peritoneal macrophages and bone marrow derived macrophages while inhibit the expression of M2-related genes (e.g. Arg-1, FIZZ1, YM1), which could also be reversed by anti-CCl3 treatment. Herein, our study has elucidated a novel mechanism of CCL3 involvement in the pathogenesis of NEC, in which the upregulated CCL3 expression exacerbated inflammatory intestinal damage via regulating macrophage chemotaxis and M1 phenotype polarization, suggesting that blocking CCL3 may be a potential strategy for effective intervention of NEC. NEC CCL3 Macrophage inflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Necrotizing enterocolitis (NEC) is a life-threatening illness in premature infants and is the leading cause of gastrointestinal related death in newborns[ 1 ]. In children with gestational age ≤33 weeks or birth weight ≤ 2500 g, the incidence of NEC is as high as 13%, with an average mortality of 20-30% and even 50% in those who require surgery[ 2 ]. In recent years, with the increased survival rate of low birth weight infants and premature infants, the incidence of NEC has also increased [ 3 ]. Although mild cases are curable, severe cases are usually accompanied with severe comorbidities like peritonitis, intestinal perforation, sepsis, multiple organ failure, leading to death[ 4 ]. And a high percentage of survivors suffer sequelae such as malabsorption[ 5 ], gastroxia gastroxynsis[ 6 ], intestinal stricture[ 7 ], and short bowel syndrome[ 8 ]. The etiology of NEC is complex and poorly elucidated yet. Increasing clinical and animal experiments has provided evidence for various predisposing factors and mechanisms of NEC, including preterm birth, low birth weight[ 9 ], bacterial colonization[ 10 ], non-breastfeeding [ 11 ]and so on. The pathology of NEC is characterized by intestinal mucosal injury and diffuse or local intestinal necrosis due to multifactorial intestinal dyshomeostasis[ 1 ], that involves complex inflammatory responses and local immune disorders, in which cytokines, chemokines and related immune cells play important roles[ 12 , 13 ]. Our current study indicated that CC motif chemokine ligand 3 (CCL3) is highly expressed in the intestinal lesions of NEC patients, mediates macrophage infiltration and induces M1-type polarization, thus participating in the occurrence and development of NEC. CCL3 is a pleiotropic chemokine, which plays an important role in a variety of infectious diseases[ 14 , 15 ], immune-related diseases [ 16 , 17 ]and oncology diseases[ 18 ]. CCL3 can not only directly participate in immune regulation, but also works by recruiting certain types of immune cells and regulating their functions[ 17 ]. The role and mechanism of CCL3 in NEC has been poorly understood. Our study provided the novel molecular pathological mechanism of CCL3 in driving NEC development, made an important supplement for the understanding of the pathological mechanism of NEC, and provided a new strategy for the treatment of NEC. Materials And Methods Intestinal tissue specimen This study was approved by the Ethics Committee of Children's Hospital of Chongqing Medical University and was conducted in accordance with the principles of the Declaration of Helsinki. Clinical NEC is classified as stage I, II, or III based on the Bell’s classification for evaluation of NEC severity. Neonates with severe NEC (Bell stage II or III) that met surgical criteria were performed necrotic bowel resection and enterostomy. The necrotic small intestine and the non-necrotic margins of surgical resection were collected for clinical study. Experimental NEC Model This experiment was reviewed and approved by the Animal Ethics Committee of Chongqing Medical University. 7-10 days’ old neonatal C57BL/6 mouse pups (male and female) were purchased from the Animal Center of Chongqing Medical University and fed in a neonatal incubator at 28°C. Mouse pups in the NEC group were fed with 20-30ul/g hypertonic formula milk by gavage every 4 hours for a total of 5 times/day. The formula milk contained Similac 60/40 (Abbott Laboratories, Saint-Laurent, Canada) and Esbilac (PetAg, Hampshire, Illinois). In addition, the pups were exposed to cold stimulation (4°C, 10min) and hypoxic environment (100% N2, 90 s) twice a day, and were fed with lipopolysaccharide (LPS, Sigma-Aldrich, St. Louis) 5ug/g/d by gavage[19]. In the NEC+CCL3 group, the pups were given NEC according to the above-mentioned protocol and injected with Recombinant Mouse CCL3/MIP-1 alpha Protein (R&D, USA) 50ng/ml. In the NEC+Anti-CCL3 group, the pups were treated according to the above-mentioned protocol. The pups were given NEC and intraperitoneally injected Mouse CCL3/MIP-1 alpha Antibody (R&D, USA) 50ng/ml. The pups in the healthy control group were breastfed by their mothers without any stress factors. Pups were excluded due to improper feeding or death within 24 hours after NEC induction. 96 hours after NEC induction, all surviving pups were euthanized, and ileum samples were collected for further analysis. RT-PCR Total RNA from intestinal tissue or cells was extracted using Trizol reagent (Invitrogen) and then reversely transcribed into cDNA using PrimeScript RT kit (RR037A, Takara, Japan) according to manufacturer's instructions. Real-time PCR (RT-PCR) was performed using SYBR Premix Ex Taq II kit (RR820A, Takara, Japan) and Applied Biosystems 7500 fast real-time PCR system (ABI, Torrance, CA). GAPDH was used as an internal reference. Primer information can be found in Supplementary Table 1. Table 1. Gene-Specific Oligonucleotide Primers Used for Q-PCR Gene Serial number Primer sequence product size(bp) Human ARG1 NM_000045 Forward5′- TGGACAGACTAGGAATTGGCA-3′ Reverse 5′ - CCAGTCCGTCAACATCAAAACT′ 102 Mouse ARG1 NM_007482 Forward5′- TTGGGTGGATGCTCACACTG-3′ Reverse 5′ - GTACACGATGTCTTTGGCAGA-3′ 166 Human INOS NM_000625 Forward5′- AGGGACAAGCCTACCCCTC-3′ Reverse 5′ - CTCATCTCCCGTCAGTTGGT-3′ 168 Mouse INOS NM_010927 Forward5′- GGAGTGACGGCAAACATGACT-3′ Reverse 5′ - TCGATGCACAACTGGGTGAAC-3′ 127 Human CD86 NM_175862 Forward5′- CTGCTCATCTATACACGGTTACC-3′ Reverse 5′ - GGAAACGTCGTACAGTTCTGTG-3′ 133 Mouse CD86 NM_019388 Forward5′- CTGGACTCTACGACTTCACAATG-3′ Reverse 5′ - AGTTGGCGATCACTGACAGTT-3′ 131 Human FIZZ1 NM_032579 Forward5′- CCGTCCTCTTGCCTCCTTC-3′ Reverse 5′ - CTTTTGACACTAGCACACGAGA-3′ 173 Mouse FIZZ1 NM_020509 Forward5′- CCAATCCAGCTAACTATCCCTCC-3′ Reverse 5′ - ACCCAGTAGCAGTCATCCCA-3′ 108 Mouse YM1 NP_034022 Forward5′- CAGGTCTGGCAATTCTTCTGAA-3′ Reverse 5′ - GTCTTGCTCATGTGTGTAAGTGA-3′ 197 Mouse IRF5 NM_012157 Forward5′-AGAGACAGGGAAGTACACTGAAG-3′ Reverse 5′ - TGGAAGTCACGGCTTTTGTTAAG-3′ 96 Primers were designed from the published sequences in the GenBank database under the indicated accession numbers. F forward primer, R reverse primer ELISA Assay ELISA kits for IL-1β, IL-10 and IFN-γ were purchased from BioLegend, Inc. and operate according to the manufacturer’s instructions. Isolation and culture of mouse bone marrow derived macrophages (BMDM) Bone marrow cells were isolated from the femur and tibia of 16-18g male C57BL/6J mice and induced to differentiate into macrophages in the DMEM complete medium supplemented with 10ng/ml M-CSF (Peprotech，USA), 10% fetal bovine serum (Ausbian，Australia), 1% penicillin/streptomycin (Gibco，USA). The culture medium was refreshed on the day 3 and 5, and then on days 7, rCCL3/ anti-CCL3-treated cells were collected from the petri dish with a cell spatula. The cells were centrifuged at 500 RCF for 5 min to form a precipitate and then suspended in full DMEM medium for further use. Isolation and culture of mouse peritoneal macrophages (PMφ) Mice were intraperitoneally injected with 1ml sterile liquid paraffin and euthanized 3-5 days later. The mice were disinfected with 70% alcohol and their limbs were fixed on the operating board. The abdomens of the mice were massaged for several minutes. And then the skin to the left or right of the midline at the bottom of the peritoneum is cut lengthwise by surgical scissors to expose the clear peritoneum. 10ml precooled PBS containing EDTA was injected into the abdominal cavity of mice and collected in a 15mL centrifuge tube after several lavages. The cells were washed with PBS for 3 times and then cultured in a cell culture plate for 45-60 min. The cells were then washed with PBS for 2 times to discard the non-adherent cells, and the adherent cells were cultured in complete DMEM medium for further use. Isolation of leukocytes from mouse intestinal tissue After the 4th day of NEC mouse modeling, all surviving pups were euthanized, and intestinal tissue samples were collected. Bowel was dissected longitudinally and washed in PBS until PBS clarified to remove feces. Intestinal tissue was then cut into 0.5x0.5 cm segments and suspended in DMEM medium containing 5 mM ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich), 2 mM 1,4-dithiothreitol (DTT; Sigma-Aldrich) ) and 1% FBS, and then shaken in a shaker (180RCF) and incubated (37℃) for 2x 20 min to separate the epithelial layer. the intestinal tissue without epithelial layer was minced and supplemented with 1 mg/ml (0.15 U/mg) collagenase D (Roche), 1% fetal bovine serum (FBS; Biological Industries) and 1000 U/ml DNAse type I ( Worthington Biochemical Corporation's DMEM was incubated in a shaker at 37 degrees (180RCF) for 30 minutes, and finally the supernatant containing the cells was filtered through a 70 mm filter (Falcon, Corning) to obtain a single cell solution. Flow Cytometry (FCM) The cell suspension was incubated with different fluorescent-labeled surface molecular antibodies and isotype control antibodies for 30 min, then the cells were washed and detected by flow cytometry and analyzed according to the product instructions. Antibody information is shown in Table 2 Table 2 Antibody SOURCE IDENTIFIER Anti-mouse CD11b BD Horizon Cat#561690 Anti-mouse Ly/6G BD Horizon Cat#562060 Anti-mouse F4/80 BD Horizon Cat#565410 Anti-mouse CD3 BD Horizon Cat#565643 Anti-mouse CD4 BD Horizon Cat#743156 Anti-mouse CD8 eBioscience Cat#45-0081-82 Anti-mouse CD86 BD Horizon Cat#561963 Anti-mouse CD206 eBioscience Cat#17-2061-82 Results CCL3 is highly expressed in NEC intestinal lesions and aggravates the intestinal damage To determine the expression of CCL3 in NEC, intestinal tissue from NEC patients undergoing surgery was homogenized for ELISA test. The results showed that the level of CCl3 in the homogenized necrotic intestinal tissue of NEC patients was significantly higher than that of the surgically excised, relatively non-necrotic adjacent sites, as shown in Fig.1A. Then, an NEC animal model was established for further study, and both ELISA results (Fig.1B) and immunohistochemical results (Fig.1C) showed that CCL3 expression in NEC mice was significantly higher than that in the control group. To characterize the role of CCL3 in NEC, mice in the intervention group were intraperitoneally injected with the recombinant CCL3 protein (rCCL3) or CCL3 neutralizing antibody (anti-CCL3) during modeling and maintained at an appropriate dose after modeling, while mice in the control group were intraperitoneally injected with PBS. Intestinal gross appearance (Fig.1D) and pathological results (Fig.1E) showed that the intestinal tissue damage in rCCL3 group was more severe than that in the control group, accompanied by severe intestinal flatulence and bleeding (Fig.1D), as well as necrotizing changes such as intestinal epithelial shedding and intestinal mucosal thinning (Fig.1E), all of which were significantly alleviated in the anti-CCL3 group. These results indicate that the increased expression of CCL3 is a harmful endogenous factor in the development of NEC. CCL3 promotes inflammation and macrophage recruitment in the intestinal tissues of NEC mice. Considering that CCL3 aggravates intestinal tissue damage during NEC, we further evaluated the effects of CCL3 on intestinal tissue inflammation and leukocyte infiltration. ELISA results showed that inflammatory cytokines IFN-γ and IL-1β were significantly increased in the rCCL3 treatment group, but significantly decreased in the anti-CCL3 treatment group (Fig.2A and B). The intestinal tissues of model mice were then digested to prepare single-cell suspensions for the detection of leukocyte infiltration. FCM revealed a significant increase in CD11b + F4/80 + macrophages in the intestine of NEC mice injected with rCCL3, which was reversed by anti-CCL3 treatment (Fig. C and D). CCL3 can also promoted the recruitment of a small number of CD11b + LY/6G + neutrophils (Fig. E and F), but has little effects on the accounts of lymphocytes (CD3, CD4, CD8) (Fig. G-K). Next, primary peritoneal macrophages (PMφ) were isolated and treated with rCCL3 or anti-CCL3, and culture supernatants were collected for the detection of inflammatory factors. IFN-γ and IL-1β levels in the supernatant of rCCL3 treatment group were significantly increased, while those in anti-CCL3 treatment group decreased (Fig. L and M), which was consistent with the results of in vivo experiments, further confirm the regulation of CCL3 on macrophages in NEC. These results suggest that CCL3 mediates macrophage chemotaxis and participates in NEC-related intestinal inflammation. Transcriptomics reveal the proinflammatory profile of CCL3-stimulated macrophages To further clarify the role of CCL3-activated macrophages in NEC, bone marrow derived macrophages (BMDM) were isolated and the spectral characteristics of rCCL3 and anti-CCL3-stimulated macrophages were evaluated by high-throughput sequencing. The volcano map of differentially expressed genes (DEGs) showed significant differences in gene expression between the CCL3-treated group, the anti-CCl3-treated group and control groups (Fig.3 A). To further analyze the DEGs results, Venn diagrams were used to describe the overlap of upregulation genes, and the results showed a higher rate of difference in DEGs between the control and rCCL3 groups than between the control and anti-CCL3 groups (Fig.3 B). Each small square on the heat map represents a DEGs, and all genes are listed in the supplementary material (Supplementary data 1). Importantly, cluster analysis revealed that CCL3 treatment has substantial impacts on the pro-inflammatory response of macrophages, as some inflammatory cytokines (NLRP3, TNF, IL-1B, IL-6, IL-12), chemokines (CCL5, CXCL10, CCL2, CCL7), and M1-type macrophage-related genes (iNOS, CD38, CD86) were highlighted in DEGs of rCCL3-treated macrophages (Fig.3 C), and the representative highlighted DEGs in rCCL3 group were summarized in Table 1. To further specify the functional regulation of CCL3 on macrophages, GO analysis was performed thereafter. DEGs were divided into three categories: biological process (BP), molecular function (MF) or cellular component (CC). Significant differences in GO analysis of DEGs in different groups were defined as P<0.05 . Notably, functional annotations by GO analysis indicated that DEGs in rCCL3 pretreatment group were mainly were associated with positive regulation of immune response, positive regulation of cytokine production and proliferation of leukocytes, etc. (Fig.3 F-H). To identify the relevant biological pathways involved in these effects, sequencing data were further analyzed using the Kyoto Encyclopedia of Genes and Genomes (KEGG) (Fig. 3D) and the Reactome Signaling Pathway database (Fig.3 E) according to the criteria of P<0.05 . The data suggested that major pathways of DEGs after rCCL3 stimulation included chemokine signaling pathway, and cytokine-cytokine receptor interaction, et al. Based on the analysis of these data, we conclude here that macrophages treated with rCCL3 were highly expressing substantial pro-inflammatory factors associated with the M1 phenotype, whereas the anti-CCL3 group showed the opposite results. Table3 Partial representative DEGs highly expressed in rCCL3 group Gene ID Gene name Log2FC P-Value ENSMUSG00000027398 Il1b 8.625474027 <10^-5 ENSMUSG00000020826 Nos2 8.393199099 <10^-5 ENSMUSG00000029084 CD38 7.463980027 <10^-5 ENSMUSG00000035042 Ccl5 6.738212218 <10^-5 ENSMUSG00000024401 Tnf 4.370028163 <10^-5 ENSMUSG00000025498 Irf7 3.148264233 <10^-5 ENSMUSG00000032691 Nlrp3 3.120521887 <10^-5 ENSMUSG00000051439 Cd14 2.477026117 <10^-5 ENSMUSG00000018459 Slc13a3 2.311923179 2.02E-74 ENSMUSG00000022901 Cd86 1.275628056 1.45E-10 Table 3 Partial representative data and detailed data can be obtained from the authors for reasonable reasons. CCL3 mediates M1 macrophage polarization in intestinal tissue of NEC. Since RNA-Seq data have identified that CCL3 regulate macrophage into a pro-inflammatory phenocyte, we then sought to examine the expression of different phenotypes of macrophage-related genes in intestinal tissues of patients and NEC mice. Compared with the control group, the expression of iNOS and CD86, two representative marker of M1 macrophages, was higher in the necrotic intestinal tissue of NEC patients, while the expression of M2-related genes Arg-1 [20]was lower (Fig.4 A-C). In NEC mouse model, the expression of M1 macrophage-related genes iNOS, CD86 and IRF5 [21]was also increased in rCCL3-treated mice compared with the control group, consistent with that of human results (Fig.4 D-G). On the contrary, the expression of M2 macrophage-related genes Arg1, FIZZ1 and YM1 [22]decreased in rCCL3-treated mice compared with the control group (Fig.4 H-J). Unsurprisingly, the anti-CCL3 group showed the opposite results to the rCCL3 group (Fig.4 E-J). Then, intestinal tissue from mice in different treatment groups was digested to prepare single-cell suspensions for the detection of macrophage phenotype. FCM results showed a significant increase in F4/80+CD86+ cells in the intestine of NEC mice treated with rCCL3, which was not observed in the anti-CCl3 group (Fig.4 K-L). Together, these data suggest that CCL3 promotes polarization of M1-type macrophages in the intestinal tissues of NEC patients and mice. CCL3 promotes M1 macrophage polarization in PMφ and BMDM in vitro. We then sought to verify the regulatin of CLL3 on macrophage phenotype by using peritoneal macrophages (PMφ) and BMDMs in vitro . FCM was used to detect the phenotype of PMφ treated with rCCL3 and anti-CCL3. The results showed that the proportion of F4/80 + CD86 + cells in rCCL3-treated cells increased, while the proportion of F4/80 + CD206 + cells decreased; The opposite was observed in the anti-CCl3 treated cells. In addition, in GM-CSF and rIL-4 stimulated BMDMs, the proportion of F4/80 + CD86 + cells was also increased with CLL3 treatment, while no significant difference was observed in the proportion of F4/80 + CD206 + cells with/without CCL3 treatment. Intriguely, both M1-related genes and M2-related genes were highly expressed in M2 macrophages after CCL3 treatment, indicating that CCL3 promoted the transition from M2 to M1 macrophages. Furthermore, we assessed the change of M1 macrophage-related genes and M2 macrophage-related genes, and found that PMφ and BMDM in the CCL3-treated group highly expressed M1 macrophage-related genes, but low expressed M2 macrophage-related genes, which was highly consistent with the results of the in vivo experiment. These evidences supported that CCL3 can promote the pro-inflammatory phenotype of macrophages, which may be closely related to the aggravation of NEC related intestinal tissue injury. Therefore, blockade of CCL3 may be a potential novel immunotherapy strategy to reduce NEC-related intestinal tissue damage. Discussion NEC has emerged as one of the most destructive diseases occurring in neonatal intensive care[ 23 ].Progress in our understanding of the pathophysiology, prevention and treatment of NEC has been hampered for many reasons[ 4 ]. Included among these is the fact that the true underlying causes of intestinal barrier imbalance are complex and poorly elucidated. In the current study, we revealed that CCL3 was a harmful endogenous factor in the development and progression of NEC, as CCL3 promoted macrophage infiltration and strongly induced the inflammatory phenotype (M1) during NEC, thus enhancing the expression of inflammatory factors in intestinal tissue, which in turn aggravates the inflammatory intestinal injury. Blocking CCL3 effectively reduced NEC-related intestinal tissue injury. As a pleiotropic chemokine, CCl3 plays an important role in a variety of diseases by regulating inflammation and immunity, including chemotaxis of various leukocytes to inflammatory sites and direct regulation of inflammatory responses, etc.[ 17 ]. By binding to receptors on immune cells, CCL3 promotes the production of inflammatory cytokines, and overactive of CCL3 has a direct detrimental effect on the prognosis of the disease[ 16 , 24 ]. In this study, RNA-Seq data showed that CCL3 induced extensive inflammatory gene expression in macrophages. In vivo and in vitro experiments confirmed that CCL3 directly induced M1 macrophages polarization, thereby leading to increased expression of inflammatory factors, which is closely related to NEC-mediated intestinal tissue injury. Macrophages are essential immune cells in the innate immune system, and their polarization imbalance can lead to intestinal barrier dysfunction, intestinal microbial environment imbalance, and increased levels of pro-inflammatory cytokines[ 25 ]. Our study elucidated the pathogenic role of CCL3-mediated hyperpolarization of M1 macrophages in the production of inflammatory cytokines and impairment of intestinal barrier function. Since blocking CCL3 can significantly reduce NEC-related intestinal injury, such as severe intestinal edema, intestinal villus shedding, intestinal wall thinning, and intestinal tissue necrosis. Our study provides a potential new approach for clinical intervention of NEC. Although our study sheds light on the underlying mechanism by which CCL3 aggravates NEC-related intestinal injury, there are still some problems worth discussing. For example, it is still unclear why CCL3 is overexpressed in the lesion site of NEC patients and the underlying regulatory mechanisms of CCL3 produdution. Although macrophages predominate in CCL3-mediated leukocyte infiltration of intestinal tissue, however, the target cells of CCL3 may not be limited to macrophage. As neutrophils are also recruited by CCL3 in our study, the regulation of CCL3 on neutrophils is also worthy of further discussion. In Fig. 5 C and D, M2 macrophages in the rCCL3-treated group were strongly inverse polarized into M1 macrophages, represented by a significant increase in the proportion of F4/80 + CD86 + cells. However, no significant reduction in the proportion of M2 macrophages was observed in the rCCL3-treated group, one possible explanation maybe due to the increased proportion of dual-yang cells expressing both M1 and M2 markers after rCCL3 treatment. M2 Mφ treated with rCCL3 subsequently expressed M1-type markers, which may be an important process in the transformation of M2 macrophages to M1-type induced by CCL3. In conclusion, our study elucidates that CCL3, as a harmful endogenous factor of NEC, exacerbates NEC-mediated inflammatory intestinal injury by regulating macrophage chemotaxis and polarization of inflammatory phenotypes. Blockade of CCL3 with anti-CCL3 can effectively reduce NE-related intestinal tissue, which provides a new idea for the clinical treatment of NEC. Abbreviations Arg-1 Arginase 1 BMDM bone marrow derived macrophages CCL3 CC motif chemokine ligand 3 DEGs differentially expressed genes FBS fetal bovine serum FCM Flow Cytometry FIZZ1 found in inflammatory zone 1 iNOS Inducible Nitric-Oxide Synthase IRF5 interferon regulatory factor 5 Mφ macrophages NEC Necrotizing enterocolitis RNA-seq RNA sequencing RT-PCR real-time PCR YM1 chitinase-like protein 3, Chil3. Declarations Acknowledgments We thank Dr. Jinfeng Hou (Department of Gastrointestinal and Neonatal Surgery, Children's Hospital of Chongqing Medical University) and Dr. Xiaohong Die (Department of Gastrointestinal and Neonatal Surgery, Children's Hospital of Chongqing Medical University) for clinical samples collection. Author’ contributions Z.S., and D.C. conceived and designed the experiments. X.Y., W.L., Y.L. and H.L. performed the experiments. W.L. and Y.Y. collected and analyzed the data. Z.S. and X.Y. wrote of the manuscript. All authors had reviewed and approved the final submitted and published versions. Funding The study was supported, in part, by the National Natural Science Foundation of China (Grant Number: 81801956 to Zhixin Song.), Chongqing Municipal Health Commission (Grant Number: 2020MSXM050 to Dapeng Chen.), Distinguished Young Scholars of the Children's Hospital of Chongqing Medical University (Zhixin Song.). This study was approved by the Ethics Committee of Children's Hospital of Chongqing Medical University and the Animal Ethics Committee of Chongqing Medical University. Competing interests The authors declare that they have no competing interests. References Neu, J., and W. A. Walker. 2011. Necrotizing enterocolitis. The New England journal of medicine 364 (3): 255–264. Frost, B. L., et al. 2017. New Medical and Surgical Insights Into Neonatal Necrotizing Enterocolitis: A Review. JAMA pediatrics 171 (1): 83–88. Ou, J., et al., Nutrition in Necrotizing Enterocolitis and Following Intestinal Resection . Nutrients, 2020. 12(2). Niño, D. F., C. P. Sodhi, and D. J. Hackam. 2016. Necrotizing enterocolitis: new insights into pathogenesis and mechanisms. Nature reviews. Gastroenterology & hepatology 13 (10): 590–600. Hunter, C. J., et al. 2008. Understanding the susceptibility of the premature infant to necrotizing enterocolitis (NEC). Pediatric research 63 (2): 117–123. Reisinger, K. W., et al. 2014. Breast-feeding improves gut maturation compared with formula feeding in preterm babies. Journal of pediatric gastroenterology and nutrition 59 (6): 720–724. Heida, F. H., et al. 2016. Risk factors associated with postnecrotizing enterocolitis strictures in infants. Journal of pediatric surgery 51 (7): 1126–1130. Amin, S. C., et al. 2013. Short bowel syndrome in the NICU. Clinics in perinatology 40 (1): 53–68. Elfvin, A., et al., Low birthweight, gestational age, need for surgical intervention and gram-negative bacteraemia predict intestinal failure following necrotising enterocolitis. Acta paediatrica (Oslo, Norway: 1992), 2015. 104 (8): p. 771-776. Collado, M. C., et al. 2015. Factors influencing gastrointestinal tract and microbiota immune interaction in preterm infants. Pediatric research 77 (6): 726–731. Good, M., C. P. Sodhi, and D. J. Hackam. 2014. Evidence-based feeding strategies before and after the development of necrotizing enterocolitis. Expert review of clinical immunology 10 (7): 875–884. Zhou, Y., et al. 2017. Inflammation and Apoptosis: Dual Mediator Role for Toll-like Receptor 4 in the Development of Necrotizing Enterocolitis. Inflammatory bowel diseases 23 (1): 44–56. MohanKumar, K., et al. 2012. Gut mucosal injury in neonates is marked by macrophage infiltration in contrast to pleomorphic infiltrates in adult: evidence from an animal model. American journal of physiology. Gastrointestinal and liver physiology 303 (1): G93–G102. Deniffel, D., et al., Otitis Media and Nasopharyngeal Colonization in Mice . Infection and immunity, 2017. 85(11). Russell, C. D., et al. 2017. The Human Immune Response to Respiratory Syncytial Virus Infection. Clinical microbiology reviews 30 (2): 481–502. Gibaldi, D., et al. 2020. CCL3/Macrophage Inflammatory Protein-1α Is Dually Involved in Parasite Persistence and Induction of a TNF- and IFNγ-Enriched Inflammatory Milieu in -Induced Chronic Cardiomyopathy. Frontiers in immunology 11: 306. Schaller, T. H., et al. 2017. Chemokines as adjuvants for immunotherapy: implications for immune activation with CCL3. Expert review of clinical immunology 13 (11): 1049–1060. Ishida, Y., et al. 2020. Prevention of CaCl-induced aortic inflammation and subsequent aneurysm formation by the CCL3-CCR5 axis. Nature communications 11 (1): 5994. Kovler, M. L., C. P. Sodhi, and D. J. Hackam, Precision-based modeling approaches for necrotizing enterocolitis. Disease models & mechanisms, 2020. 13(6). Arlauckas, S. P., et al. 2018. Arg1 expression defines immunosuppressive subsets of tumor-associated macrophages. Theranostics 8 (21): 5842–5854. Corbin, A. L., et al., IRF5 guides monocytes toward an inflammatory CD11c macrophage phenotype and promotes intestinal inflammation . Science immunology, 2020. 5(47). Zhu, L., et al. 2014. TSC1 controls macrophage polarization to prevent inflammatory disease. Nature communications 5: 4696. Horbar, J. D., et al. 2012. Mortality and neonatal morbidity among infants 501 to 1500 grams from 2000 to 2009. Pediatrics 129 (6): 1019–1026. Pelisch, N., et al. 2020. CCL3 contributes to secondary damage after spinal cord injury. Journal of neuroinflammation 17 (1): 362. Na, Y. R., et al. 2019. Macrophages in intestinal inflammation and resolution: a potential therapeutic target in IBD. Nature reviews. Gastroenterology & hepatology 16 (9): 531–543. Supplementary Supplementary Data 1 is not available with this version Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1283126","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":79657406,"identity":"36a278fe-e3ee-4e3f-ae97-d9be457b26f3","order_by":0,"name":"Xi Yuan","email":"","orcid":"","institution":"Chongqing Medical University Affiliated Children's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xi","middleName":"","lastName":"Yuan","suffix":""},{"id":79657407,"identity":"cf70cd2a-4490-49fd-8ab3-1ca0a4663c70","order_by":1,"name":"Wei Liu","email":"","orcid":"","institution":"Chongqing Medical University Affiliated Children's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Liu","suffix":""},{"id":79657408,"identity":"9b075256-3ad2-4659-b062-be77b9eeab44","order_by":2,"name":"Yue Li","email":"","orcid":"","institution":"Chongqing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Li","suffix":""},{"id":79657409,"identity":"8a5b1948-fe68-4fa0-b8a7-d44c1617fb40","order_by":3,"name":"Kai Chen","email":"","orcid":"","institution":"Chongqing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"Chen","suffix":""},{"id":79657410,"identity":"dbde50f7-2de8-4d7b-8344-ab0f3ea57cb9","order_by":4,"name":"Hongdong Li","email":"","orcid":"","institution":"Chongqing Medical University Affiliated Children's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hongdong","middleName":"","lastName":"Li","suffix":""},{"id":79657411,"identity":"8fe2ce7c-44f8-40f9-b3be-fc4444c69a72","order_by":5,"name":"Yibing Yin","email":"","orcid":"","institution":"Chongqing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yibing","middleName":"","lastName":"Yin","suffix":""},{"id":79657412,"identity":"c77983c6-978c-4250-8701-451d436a4382","order_by":6,"name":"Dapeng Chen","email":"","orcid":"","institution":"Chongqing Medical University Affiliated Children's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Dapeng","middleName":"","lastName":"Chen","suffix":""},{"id":79657413,"identity":"ffe0bbf8-be28-472b-a525-74fd7add21a3","order_by":7,"name":"Zhixin Song","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABNklEQVRIie2SMUvDQBSAXwhclhPXV1LtX0gJhGz9Kz0KmeIkZCpyIlyXaNc6+RtcoqMhkCl2DrRDugQEh7pICx28xihiAnV0uI/juMe7j/fecQAKxX9F4wgE9HR/pgA6/0pYBxTiVQqV4V+U6rIDn2UOKL3JdfKyfXTZjRm+F+vdsjswYg6bIGLcuIoQxsvfipXNPbeToU26zw/9W1FSShnXwvmCcZoGCGnZUNB3rL7AU4JnkXnEEzkL47ompCJTqPGk0dhMKkwgJeiXJt1J5XhVK73XVgVy3y7iqopPTEqkgt9VaKtiZZmjXQo5C3pOp5olX/FYzmIL6p27w7TZ2CS037bigt3NRiXKFxsY01FcbILFydRI7vP1uNkYAMEfwVO9E9gvgGGLIP/HuqHU9xUKhUJR8QH4uG6AuScFpAAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-0473-2941","institution":"Chongqing Medical University Affiliated Children's Hospital","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Zhixin","middleName":"","lastName":"Song","suffix":""}],"badges":[],"createdAt":"2022-01-21 11:20:48","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1283126/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1283126/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":17820612,"identity":"3b8b5413-e6c6-4ded-80a2-6d3a1d69ec74","added_by":"auto","created_at":"2022-01-31 19:14:35","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1372159,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression and role of CCL3 in NEC. (A) expression of CCL3 in intestinal tissue of patients, detected by ELISA kit (N=5-8). (B) expression of CCL3 in intestinal tissue of mice, detected by ELISA kit (N=10-15). (C) expression of CCL3 in intestinal tissue of patients, detected by immune-histochemistry (DAB chromogenic, Scale bar=50μm). (D) Macroscopic view of mouse intestinal tissue from Control, NEC, NEC+rCCL3, NEC+anti-CCL3 groups. (E) Representative images of H\u0026amp;E-stained sections from Control, NEC, NEC+rCCL3, NEC+anti-CCL3 groups (Scale Bar =100μm). Data are expressed as mean ± SD. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 when compared between groups.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-1283126/v1/cb508f665cf95f37f52f415c.png"},{"id":17821056,"identity":"f115a458-6d6e-47ca-b92b-59058d215c26","added_by":"auto","created_at":"2022-01-31 19:17:35","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":724143,"visible":true,"origin":"","legend":"\u003cp\u003eThe chemotaxis and inflammatory regulation of CCL3 in NEC. (A-B) IL-1β and IFN-γ expression in the intestinal lysates of NEC mice treated with rCCL3 or anti-CCL3. (n=3-5) (C-K) FCM analysis was performed to evaluate the chemotactic effects of rCCL3 (50ng/ml) and anti-CCL3 (50ng/ml) on CD11b\u003csup\u003e+\u003c/sup\u003eF4/80\u003csup\u003e+\u003c/sup\u003e cells, CD11b\u003csup\u003e+\u003c/sup\u003eLY/6G\u003csup\u003e+ \u003c/sup\u003ecells and T cells (CD3, CD4, CD8). (L-M) Levels of IL-1β and IFN-γ in the supernatant of macrophage treated with rCCL3 or anti-CCL3. All data are expressed as mean ± SD. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 when compared between groups.\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-1283126/v1/1e0983c22cd450e870ccabfa.png"},{"id":17821055,"identity":"58b63cdc-85ca-46e3-8981-eeb665bc9bf4","added_by":"auto","created_at":"2022-01-31 19:17:35","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":421234,"visible":true,"origin":"","legend":"\u003cp\u003eGene expression profiles of BMDMs treated with rCCL3 and anti-CCL3. (A) Volcanic map analysis showed differences in gene expression between rCCL3 group, anti-CCL3 group and control group, detected by RNA-Seq (n=3 per group). (B) Venn diagram analysis showing upregulation of DEGs in rCCL3 vs. control group (yellow) and anti-CCL3 vs. control group (purple). (C) Stratified clustering and heat maps showing RNA-Seq data of DEGs in BMDMs pretreated with rCCL3 or anti-CCL3. (D-E) DEGs data analysis in rCCL3-stimulated macrophages based on KEGG and Reactome databases. (F-H) GO analysis was used to classify the biological processes, molecular functions, or cellular components involved in DEGs after rCCL3 and anti-CCl3 stimulation.\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-1283126/v1/bcd3cfb230fe14b96ee79636.png"},{"id":17820615,"identity":"7b187864-77cd-4e9f-ac73-b567ae4b3ceb","added_by":"auto","created_at":"2022-01-31 19:14:35","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":692928,"visible":true,"origin":"","legend":"\u003cp\u003eCCL3 mediates M1 macrophage polarization in NEC. (A-C) RT-PCR analysis of the relative mRNA expression of M1 and M2 macrophage-associated genes in the intestines of NEC neonates (2\u003csup\u003e-ΔΔCT\u003c/sup\u003e). (D) Expression of iNOS (DAB staining) in the sections of the intestinal tissue in mouse with or without NEC. (E-J) RT-PCR analysis of the mRNA expression of M1 and M2 macrophage-associated genes in the intestines of Ctrl, NEC, NEC+rCCL3 (50ng/ml), NEC+anti-CCL3 (50ng/ml) groups. (K-L) FCM analysis was performed to evaluate the effects of rCCL3 and anti-CCL3 on macrophages polarization in the intestines of Ctrl, NEC, NEC+rCCL3, NEC+anti-CCL3 groups. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 when compared between groups.\u0026nbsp;\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-1283126/v1/65b29343a034634c2cdab8fd.png"},{"id":17820614,"identity":"f8bc7aa3-b732-40d8-936f-2e78cbbdc9c1","added_by":"auto","created_at":"2022-01-31 19:14:35","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":612917,"visible":true,"origin":"","legend":"\u003cp\u003eThe role of CCL3 in inducing M1 Mφ polarization. (A-B) Flow cytometry analysis was performed to evaluate the effects of rCCL3 (10ng/ml) and anti-CCL3 (10ng/ml) on PMφ polarization. (C-D) Flow cytometry analysis was performed to evaluate the effects of rCCL3 (10ng/ml) on BMDMs polarization. (E-N) RT-PCR analysis of M1 and M2 macrophage-related genes expression in PMφ and BMDMs treated with rCCL3/anti-CCL3. Data are expressed as mean ± SD. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 when compared between groups.\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-1283126/v1/3dfcf94c51d5eb065af6cc82.png"},{"id":19954674,"identity":"4ddf3b3c-a233-4237-a363-de5eaa5087f2","added_by":"auto","created_at":"2022-04-04 22:58:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4305815,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1283126/v1/db2eff09-5377-4da4-9aa2-82d2550a059c.pdf"}],"financialInterests":"","formattedTitle":"CCL3 aggravates intestinal tissue damage in NEC by promoting macrophage chemotaxis and M1 macrophage polarization.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNecrotizing enterocolitis (NEC) is a life-threatening illness in premature infants and is the leading cause of gastrointestinal related death in newborns[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In children with gestational age \u0026le;33 weeks or birth weight \u0026le; 2500 g, the incidence of NEC is as high as 13%, with an average mortality of 20-30% and even 50% in those who require surgery[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In recent years, with the increased survival rate of low birth weight infants and premature infants, the incidence of NEC has also increased [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Although mild cases are curable, severe cases are usually accompanied with severe comorbidities like peritonitis, intestinal perforation, sepsis, multiple organ failure, leading to death[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. And a high percentage of survivors suffer sequelae such as malabsorption[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], gastroxia gastroxynsis[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], intestinal stricture[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], and short bowel syndrome[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe etiology of NEC is complex and poorly elucidated yet. Increasing clinical and animal experiments has provided evidence for various predisposing factors and mechanisms of NEC, including preterm birth, low birth weight[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], bacterial colonization[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], non-breastfeeding [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]and so on. The pathology of NEC is characterized by intestinal mucosal injury and diffuse or local intestinal necrosis due to multifactorial intestinal dyshomeostasis[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], that involves complex inflammatory responses and local immune disorders, in which cytokines, chemokines and related immune cells play important roles[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Our current study indicated that CC motif chemokine ligand 3 (CCL3) is highly expressed in the intestinal lesions of NEC patients, mediates macrophage infiltration and induces M1-type polarization, thus participating in the occurrence and development of NEC. CCL3 is a pleiotropic chemokine, which plays an important role in a variety of infectious diseases[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], immune-related diseases [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]and oncology diseases[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. CCL3 can not only directly participate in immune regulation, but also works by recruiting certain types of immune cells and regulating their functions[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The role and mechanism of CCL3 in NEC has been poorly understood. Our study provided the novel molecular pathological mechanism of CCL3 in driving NEC development, made an important supplement for the understanding of the pathological mechanism of NEC, and provided a new strategy for the treatment of NEC.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eIntestinal tissue specimen\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Ethics Committee of Children\u0026apos;s Hospital of Chongqing Medical University\u0026nbsp;and was conducted in accordance with the principles of the Declaration of Helsinki. Clinical NEC is classified as stage I, II, or III based on the Bell\u0026rsquo;s classification for evaluation of NEC severity. Neonates with severe NEC (Bell stage II or III) that met surgical criteria were performed necrotic bowel resection and enterostomy. The necrotic small intestine and the non-necrotic margins of surgical resection were collected for clinical study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExperimental NEC Model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis experiment was reviewed and approved by the Animal Ethics Committee of Chongqing Medical University. 7-10 days\u0026rsquo; old neonatal C57BL/6 mouse pups (male and female) were purchased from the Animal Center of Chongqing Medical University and fed in a neonatal incubator at 28\u0026deg;C. Mouse pups in the NEC group were fed with 20-30ul/g hypertonic formula milk by gavage every 4 hours for a total of 5 times/day. The formula milk contained Similac 60/40 (Abbott Laboratories, Saint-Laurent, Canada) and Esbilac (PetAg, Hampshire, Illinois). In addition, the pups were exposed to cold stimulation (4\u0026deg;C, 10min) and hypoxic environment (100% N2, 90 s) twice a day, and were fed with lipopolysaccharide (LPS, Sigma-Aldrich, St. Louis) 5ug/g/d by gavage[19]. In the NEC+CCL3 group, the pups were given NEC according to the above-mentioned protocol and injected with Recombinant Mouse CCL3/MIP-1 alpha Protein (R\u0026amp;D, USA) 50ng/ml. In the NEC+Anti-CCL3 group, the pups were treated according to the above-mentioned protocol. The pups were given NEC and intraperitoneally injected Mouse CCL3/MIP-1 alpha Antibody (R\u0026amp;D, USA) 50ng/ml. The pups in the healthy control group were breastfed by their mothers without any stress factors. Pups were excluded due to improper feeding or death within 24 hours after NEC induction. 96 hours after NEC induction, all surviving pups were euthanized, and ileum samples were collected for further analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA from intestinal tissue or cells was extracted using Trizol reagent (Invitrogen) and then reversely transcribed into cDNA using PrimeScript RT kit (RR037A, Takara, Japan) according to manufacturer\u0026apos;s instructions. Real-time PCR (RT-PCR) was performed using SYBR Premix Ex Taq II kit (RR820A, Takara, Japan) and Applied Biosystems 7500 fast real-time PCR system (ABI, Torrance, CA). GAPDH was used as an internal reference. Primer information can be found in Supplementary Table 1.\u003c/p\u003e\n\u003cp\u003eTable\u0026nbsp;1. \u0026nbsp;Gene-Specific Oligonucleotide Primers Used for Q-PCR\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"18.634686346863468%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSerial number\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"57.74907749077491%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer sequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eproduct size(bp)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eHuman ARG1\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.634686346863468%\"\u003e\n \u003cp\u003eNM_000045\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"57.74907749077491%\"\u003e\n \u003cp\u003eForward5\u0026prime;- TGGACAGACTAGGAATTGGCA-3\u0026prime;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026prime; - CCAGTCCGTCAACATCAAAACT\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e102\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMouse ARG1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.634686346863468%\"\u003e\n \u003cp\u003eNM_007482\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"57.74907749077491%\"\u003e\n \u003cp\u003eForward5\u0026prime;- TTGGGTGGATGCTCACACTG-3\u0026prime;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026prime; - GTACACGATGTCTTTGGCAGA-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e166\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eHuman INOS\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.634686346863468%\"\u003e\n \u003cp\u003eNM_000625\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"57.74907749077491%\"\u003e\n \u003cp\u003eForward5\u0026prime;- AGGGACAAGCCTACCCCTC-3\u0026prime;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026prime; - CTCATCTCCCGTCAGTTGGT-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e168\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMouse INOS\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.634686346863468%\"\u003e\n \u003cp\u003eNM_010927\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"57.74907749077491%\"\u003e\n \u003cp\u003eForward5\u0026prime;- GGAGTGACGGCAAACATGACT-3\u0026prime;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026prime; - TCGATGCACAACTGGGTGAAC-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e127\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eHuman CD86 \u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.634686346863468%\"\u003e\n \u003cp\u003eNM_175862\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"57.74907749077491%\"\u003e\n \u003cp\u003eForward5\u0026prime;- CTGCTCATCTATACACGGTTACC-3\u0026prime;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026prime; - GGAAACGTCGTACAGTTCTGTG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e133\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMouse CD86\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.634686346863468%\"\u003e\n \u003cp\u003eNM_019388\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"57.74907749077491%\"\u003e\n \u003cp\u003eForward5\u0026prime;- CTGGACTCTACGACTTCACAATG-3\u0026prime;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026prime; - AGTTGGCGATCACTGACAGTT-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e131\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eHuman FIZZ1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.634686346863468%\"\u003e\n \u003cp\u003eNM_032579\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"57.74907749077491%\"\u003e\n \u003cp\u003eForward5\u0026prime;- CCGTCCTCTTGCCTCCTTC-3\u0026prime;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026prime; - CTTTTGACACTAGCACACGAGA-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e173\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMouse FIZZ1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.634686346863468%\"\u003e\n \u003cp\u003eNM_020509\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"57.74907749077491%\"\u003e\n \u003cp\u003eForward5\u0026prime;- CCAATCCAGCTAACTATCCCTCC-3\u0026prime;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026prime; - ACCCAGTAGCAGTCATCCCA-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e108\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMouse YM1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.634686346863468%\"\u003e\n \u003cp\u003eNP_034022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"57.74907749077491%\"\u003e\n \u003cp\u003eForward5\u0026prime;- CAGGTCTGGCAATTCTTCTGAA-3\u0026prime;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026prime; - GTCTTGCTCATGTGTGTAAGTGA-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e197\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMouse IRF5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.634686346863468%\"\u003e\n \u003cp\u003eNM_012157\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"57.74907749077491%\"\u003e\n \u003cp\u003eForward5\u0026prime;-AGAGACAGGGAAGTACACTGAAG-3\u0026prime;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eReverse 5\u0026prime; - TGGAAGTCACGGCTTTTGTTAAG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.808118081180812%\"\u003e\n \u003cp\u003e96\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003ePrimers were designed from the published sequences in the GenBank database under the indicated accession numbers. F forward primer, R reverse primer\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eELISA Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eELISA kits for IL-1\u0026beta;, IL-10 and IFN-\u0026gamma; were purchased from BioLegend, Inc. and operate according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation and culture of mouse bone marrow derived macrophages (BMDM)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBone marrow cells were isolated from the femur and tibia of 16-18g male C57BL/6J mice and induced to differentiate into macrophages in the DMEM complete medium supplemented with 10ng/ml M-CSF (Peprotech，USA), 10% fetal bovine serum (Ausbian，Australia), 1% penicillin/streptomycin (Gibco，USA). The culture medium was refreshed on the day 3 and 5, and then on days 7, rCCL3/ anti-CCL3-treated cells were collected from the petri dish with a cell spatula. The cells were centrifuged at 500 RCF for 5 min to form a precipitate and then suspended in full DMEM medium for further use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation and culture of mouse peritoneal macrophages (PM\u0026phi;)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMice were intraperitoneally injected with 1ml sterile liquid paraffin and euthanized 3-5 days later. The mice were disinfected with 70% alcohol and their limbs were fixed on the operating board. The abdomens of the mice were massaged for several minutes. And then the skin to the left or right of the midline at the bottom of the peritoneum is cut lengthwise by surgical scissors to expose the clear peritoneum. 10ml precooled PBS containing EDTA was injected into the abdominal cavity of mice and collected in a 15mL centrifuge tube after several lavages. The cells were washed with PBS for 3 times and then cultured in a cell culture plate for 45-60 min. The cells were then washed with PBS for 2 times to discard the non-adherent cells, and the adherent cells were cultured in complete DMEM medium for further use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of leukocytes from mouse intestinal tissue\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter the 4th day of NEC mouse modeling, all surviving pups were euthanized, and intestinal tissue samples were collected. Bowel was dissected longitudinally and washed in PBS until PBS clarified to remove feces. Intestinal tissue was then cut into 0.5x0.5 cm segments and suspended in DMEM medium containing 5 mM ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich), 2 mM 1,4-dithiothreitol (DTT; Sigma-Aldrich) ) and 1% FBS, and then shaken in a shaker (180RCF) and incubated (37℃) for 2x 20 min to separate the epithelial layer. the intestinal tissue without epithelial layer was minced and supplemented with 1 mg/ml (0.15 U/mg) collagenase D (Roche), 1% fetal bovine serum (FBS; Biological Industries) and 1000 U/ml DNAse type I ( Worthington Biochemical Corporation\u0026apos;s DMEM was incubated in a shaker at 37 degrees (180RCF) for 30 minutes, and finally the supernatant containing the cells was filtered through a 70 mm filter (Falcon, Corning) to obtain a single cell solution.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow Cytometry (FCM)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cell suspension was incubated with different fluorescent-labeled surface molecular antibodies and isotype control antibodies for 30 min, then the cells were washed and detected by flow cytometry and analyzed according to the product instructions. Antibody information is shown in Table 2\u003c/p\u003e\n\u003cp\u003eTable 2\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.87121212121212%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAntibody\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.810606060606062%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSOURCE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.31818181818182%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIDENTIFIER\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.87121212121212%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnti-mouse CD11b\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.810606060606062%\"\u003e\n \u003cp\u003eBD Horizon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.31818181818182%\"\u003e\n \u003cp\u003eCat#561690\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.87121212121212%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnti-mouse Ly/6G\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.810606060606062%\"\u003e\n \u003cp\u003eBD Horizon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.31818181818182%\"\u003e\n \u003cp\u003eCat#562060\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.87121212121212%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnti-mouse F4/80\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.810606060606062%\"\u003e\n \u003cp\u003eBD Horizon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.31818181818182%\"\u003e\n \u003cp\u003eCat#565410\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.87121212121212%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnti-mouse CD3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.810606060606062%\"\u003e\n \u003cp\u003eBD Horizon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.31818181818182%\"\u003e\n \u003cp\u003eCat#565643\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.87121212121212%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnti-mouse CD4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.810606060606062%\"\u003e\n \u003cp\u003eBD Horizon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.31818181818182%\"\u003e\n \u003cp\u003eCat#743156\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.87121212121212%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnti-mouse CD8\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.810606060606062%\"\u003e\n \u003cp\u003eeBioscience\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.31818181818182%\"\u003e\n \u003cp\u003eCat#45-0081-82\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.87121212121212%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnti-mouse CD86\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.810606060606062%\"\u003e\n \u003cp\u003eBD Horizon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.31818181818182%\"\u003e\n \u003cp\u003eCat#561963\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"30.87121212121212%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnti-mouse CD206\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.810606060606062%\"\u003e\n \u003cp\u003eeBioscience\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.31818181818182%\"\u003e\n \u003cp\u003eCat#17-2061-82\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eCCL3 is highly expressed in NEC intestinal lesions and aggravates the intestinal damage\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine the expression of CCL3 in NEC, intestinal tissue from NEC patients undergoing surgery was homogenized for ELISA test. The results showed that the level of CCl3 in the homogenized necrotic intestinal tissue of NEC patients was significantly higher than that of the surgically excised, relatively non-necrotic adjacent sites, as shown in Fig.1A. Then, an NEC animal model was established for further study, and both ELISA results (Fig.1B) and immunohistochemical results (Fig.1C) showed that CCL3 expression in NEC mice was significantly higher than that in the control group. To characterize the role of CCL3 in NEC, mice in the intervention group were intraperitoneally injected with the recombinant CCL3 protein (rCCL3) or CCL3 neutralizing antibody (anti-CCL3) during modeling and maintained at an appropriate dose after modeling, while mice in the control group were intraperitoneally injected with PBS. Intestinal gross appearance (Fig.1D) and pathological results (Fig.1E) showed that the intestinal tissue damage in rCCL3 group was more severe than that in the control group, accompanied by severe intestinal flatulence and bleeding (Fig.1D), as well as necrotizing changes such as intestinal epithelial shedding and intestinal mucosal thinning (Fig.1E), all of which were significantly alleviated in the anti-CCL3 group. These results indicate that the increased expression of CCL3 is a harmful endogenous factor in the development of NEC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCCL3 promotes inflammation and macrophage recruitment in the intestinal tissues of NEC mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConsidering that CCL3 aggravates intestinal tissue damage during NEC, we further evaluated the effects of CCL3 on intestinal tissue inflammation and leukocyte infiltration. ELISA results showed that inflammatory cytokines IFN-\u0026gamma; and IL-1\u0026beta; were significantly increased in the rCCL3 treatment group, but significantly decreased in the anti-CCL3 treatment group (Fig.2A and B). The intestinal tissues of model mice were then digested to prepare single-cell suspensions for the detection of leukocyte infiltration. FCM revealed a significant increase in CD11b\u003csup\u003e+\u003c/sup\u003eF4/80\u003csup\u003e+\u003c/sup\u003e macrophages in the intestine of NEC mice injected with rCCL3, which was reversed by anti-CCL3 treatment (Fig. C and D). CCL3 can also promoted the recruitment of a small number of CD11b\u003csup\u003e+\u003c/sup\u003eLY/6G\u003csup\u003e+\u003c/sup\u003e neutrophils (Fig. E and F), but has little effects on the accounts of lymphocytes (CD3, CD4, CD8) (Fig. G-K). Next, primary peritoneal macrophages (PM\u0026phi;) were isolated and treated with rCCL3 or anti-CCL3, and culture supernatants were collected for the detection of inflammatory factors. IFN-\u0026gamma; and IL-1\u0026beta; levels in the supernatant of rCCL3 treatment group were significantly increased, while those in anti-CCL3 treatment group decreased (Fig. L and M), which was consistent with the results of \u003cem\u003ein vivo\u0026nbsp;\u003c/em\u003eexperiments, further confirm the regulation of CCL3 on macrophages in NEC. These results suggest that CCL3 mediates macrophage chemotaxis and participates in NEC-related intestinal inflammation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptomics reveal the proinflammatory profile of CCL3-stimulated macrophages\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further clarify the role of CCL3-activated macrophages in NEC, bone marrow derived macrophages (BMDM) were isolated and the spectral characteristics of rCCL3 and anti-CCL3-stimulated macrophages were evaluated by high-throughput sequencing. The volcano map of differentially expressed genes (DEGs) showed significant differences in gene expression between the CCL3-treated group, the anti-CCl3-treated group and control groups (Fig.3 A). To further analyze the DEGs results, Venn diagrams were used to describe the overlap of upregulation genes, and the results showed a higher rate of difference in DEGs between the control and rCCL3 groups than between the control and anti-CCL3 groups (Fig.3 B). Each small square on the heat map represents a DEGs, and all genes are listed in the supplementary material (Supplementary data 1). Importantly, cluster analysis revealed that CCL3 treatment has substantial impacts on the pro-inflammatory response of macrophages, as some inflammatory cytokines (NLRP3, TNF, IL-1B, IL-6, IL-12), chemokines (CCL5, CXCL10, CCL2, CCL7), and M1-type macrophage-related genes (iNOS, CD38, CD86) were highlighted in DEGs of rCCL3-treated macrophages (Fig.3 C), and the representative highlighted DEGs in rCCL3 group were summarized in Table 1. To further specify the functional regulation of CCL3 on macrophages, GO analysis was performed thereafter. DEGs were divided into three categories: biological process (BP), molecular function (MF) or cellular component (CC). Significant differences in GO analysis of DEGs in different groups were defined as \u003cem\u003eP\u0026lt;0.05\u003c/em\u003e. Notably, functional annotations by GO analysis indicated that DEGs in rCCL3 pretreatment group were mainly were associated with positive regulation of immune response, positive regulation of cytokine production and proliferation of leukocytes, etc. (Fig.3 F-H). To identify the relevant biological pathways involved in these effects, sequencing data were further analyzed using the Kyoto Encyclopedia of Genes and Genomes (KEGG) (Fig. 3D) and the Reactome Signaling Pathway database (Fig.3 E) according to the criteria of \u003cem\u003eP\u0026lt;0.05\u003c/em\u003e. The data suggested that major pathways of DEGs after rCCL3 stimulation included chemokine signaling pathway, and cytokine-cytokine receptor interaction, et al. Based on the analysis of these data, we conclude here that macrophages treated with rCCL3 were highly expressing substantial pro-inflammatory factors associated with the M1 phenotype, whereas the anti-CCL3 group showed the opposite results.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable3 Partial representative DEGs highly expressed in rCCL3 group\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene ID\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eLog2FC\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-Value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eENSMUSG00000027398\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIl1b\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003e8.625474027\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;10^-5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eENSMUSG00000020826\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eNos2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003e8.393199099\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;10^-5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eENSMUSG00000029084\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCD38\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003e7.463980027\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;10^-5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eENSMUSG00000035042\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCcl5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003e6.738212218\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;10^-5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eENSMUSG00000024401\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTnf \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003e4.370028163\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;10^-5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eENSMUSG00000025498\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIrf7\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003e3.148264233\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;10^-5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eENSMUSG00000032691\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eNlrp3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003e3.120521887\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;10^-5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eENSMUSG00000051439\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCd14\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003e2.477026117\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt;10^-5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eENSMUSG00000018459\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSlc13a3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003e2.311923179\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003e2.02E-74\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eENSMUSG00000022901\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCd86\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.632653061224488%\"\u003e\n \u003cp\u003e\u003cstrong\u003e1.275628056\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"18.367346938775512%\"\u003e\n \u003cp\u003e\u003cstrong\u003e1.45E-10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eTable 3 Partial representative data and detailed data can be obtained from the authors for reasonable reasons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCCL3 mediates M1 macrophage polarization in intestinal tissue of NEC.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSince RNA-Seq data have identified that CCL3 regulate macrophage into a pro-inflammatory phenocyte, we then sought to examine the expression of different phenotypes of macrophage-related genes in intestinal tissues of patients and NEC mice. Compared with the control group, the expression of iNOS and CD86, two representative marker of M1 macrophages, was higher in the necrotic intestinal tissue of NEC patients, while the expression of M2-related genes Arg-1\u0026nbsp;[20]was lower (Fig.4 A-C). In NEC mouse model, the expression of M1 macrophage-related genes iNOS, CD86 and IRF5\u0026nbsp;[21]was also increased in rCCL3-treated mice compared with the control group, consistent with that of human results (Fig.4 D-G). On the contrary, the expression of M2 macrophage-related genes Arg1, FIZZ1 and YM1\u0026nbsp;[22]decreased in rCCL3-treated mice compared with the control group (Fig.4 H-J). Unsurprisingly, the anti-CCL3 group showed the opposite results to the rCCL3 group (Fig.4 E-J). Then, intestinal tissue from mice in different treatment groups was digested to prepare single-cell suspensions for the detection of macrophage phenotype. FCM results showed a significant increase in F4/80+CD86+ cells in the intestine of NEC mice treated with rCCL3, which was not observed in the anti-CCl3 group (Fig.4 K-L). Together, these data suggest that CCL3 promotes polarization of M1-type macrophages in the intestinal tissues of NEC patients and mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCCL3 promotes M1 macrophage polarization in PM\u0026phi; and BMDM\u003cem\u003e\u0026nbsp;in vitro.\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe then sought to verify the regulatin of CLL3 on macrophage phenotype by using peritoneal macrophages (PM\u0026phi;) and BMDMs \u003cem\u003ein vitro\u003c/em\u003e. FCM was used to detect the phenotype of PM\u0026phi; treated with rCCL3 and anti-CCL3. The results showed that the proportion of F4/80\u003csup\u003e+\u003c/sup\u003eCD86\u003csup\u003e+\u003c/sup\u003e cells in rCCL3-treated cells increased, while the \u0026nbsp;proportion of F4/80\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u003c/sup\u003e cells decreased; The opposite was observed in the anti-CCl3 treated cells. In addition, in GM-CSF and rIL-4 stimulated BMDMs, the proportion of F4/80\u003csup\u003e+\u003c/sup\u003eCD86\u003csup\u003e+\u003c/sup\u003e cells was also increased with CLL3 treatment, while no significant difference was observed in the proportion of F4/80\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u003c/sup\u003e cells with/without CCL3 treatment. Intriguely, both M1-related genes and M2-related genes were highly expressed in M2 macrophages after CCL3 treatment, indicating that CCL3 promoted the transition from M2 to M1 macrophages. Furthermore, we \u0026nbsp;assessed the change of M1 macrophage-related genes and M2 macrophage-related genes, and found that PM\u0026phi; and BMDM in the CCL3-treated group highly expressed M1 macrophage-related genes, but low expressed M2 macrophage-related genes, which was highly consistent with the results of the\u003cem\u003e\u0026nbsp;in vivo\u0026nbsp;\u003c/em\u003eexperiment. These evidences supported that CCL3 can promote the pro-inflammatory phenotype of macrophages, which may be closely related to the aggravation of NEC related intestinal tissue injury. Therefore, blockade of CCL3 may be a potential novel immunotherapy strategy to reduce NEC-related intestinal tissue damage.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eNEC has emerged as one of the most destructive diseases occurring in neonatal intensive care[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].Progress in our understanding of the pathophysiology, prevention and treatment of NEC has been hampered for many reasons[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Included among these is the fact that the true underlying causes of intestinal barrier imbalance are complex and poorly elucidated. In the current study, we revealed that CCL3 was a harmful endogenous factor in the development and progression of NEC, as CCL3 promoted macrophage infiltration and strongly induced the inflammatory phenotype (M1) during NEC, thus enhancing the expression of inflammatory factors in intestinal tissue, which in turn aggravates the inflammatory intestinal injury. Blocking CCL3 effectively reduced NEC-related intestinal tissue injury.\u003c/p\u003e \u003cp\u003eAs a pleiotropic chemokine, CCl3 plays an important role in a variety of diseases by regulating inflammation and immunity, including chemotaxis of various leukocytes to inflammatory sites and direct regulation of inflammatory responses, etc.[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. By binding to receptors on immune cells, CCL3 promotes the production of inflammatory cytokines, and overactive of CCL3 has a direct detrimental effect on the prognosis of the disease[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, RNA-Seq data showed that CCL3 induced extensive inflammatory gene expression in macrophages. \u003cem\u003eIn vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e experiments confirmed that CCL3 directly induced M1 macrophages polarization, thereby leading to increased expression of inflammatory factors, which is closely related to NEC-mediated intestinal tissue injury. Macrophages are essential immune cells in the innate immune system, and their polarization imbalance can lead to intestinal barrier dysfunction, intestinal microbial environment imbalance, and increased levels of pro-inflammatory cytokines[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Our study elucidated the pathogenic role of CCL3-mediated hyperpolarization of M1 macrophages in the production of inflammatory cytokines and impairment of intestinal barrier function. Since blocking CCL3 can significantly reduce NEC-related intestinal injury, such as severe intestinal edema, intestinal villus shedding, intestinal wall thinning, and intestinal tissue necrosis. Our study provides a potential new approach for clinical intervention of NEC.\u003c/p\u003e \u003cp\u003eAlthough our study sheds light on the underlying mechanism by which CCL3 aggravates NEC-related intestinal injury, there are still some problems worth discussing. For example, it is still unclear why CCL3 is overexpressed in the lesion site of NEC patients and the underlying regulatory mechanisms of CCL3 produdution. Although macrophages predominate in CCL3-mediated leukocyte infiltration of intestinal tissue, however, the target cells of CCL3 may not be limited to macrophage. As neutrophils are also recruited by CCL3 in our study, the regulation of CCL3 on neutrophils is also worthy of further discussion.\u003c/p\u003e \u003cp\u003eIn Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and D, M2 macrophages in the rCCL3-treated group were strongly inverse polarized into M1 macrophages, represented by a significant increase in the proportion of F4/80\u003csup\u003e+\u003c/sup\u003eCD86\u003csup\u003e+\u003c/sup\u003e cells. However, no significant reduction in the proportion of M2 macrophages was observed in the rCCL3-treated group, one possible explanation maybe due to the increased proportion of dual-yang cells expressing both M1 and M2 markers after rCCL3 treatment. M2 Mφ treated with rCCL3 subsequently expressed M1-type markers, which may be an important process in the transformation of M2 macrophages to M1-type induced by CCL3.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn conclusion, our study elucidates that CCL3, as a harmful endogenous factor of NEC, exacerbates NEC-mediated inflammatory intestinal injury by regulating macrophage chemotaxis and polarization of inflammatory phenotypes. Blockade of CCL3 with anti-CCL3 can effectively reduce NE-related intestinal tissue, which provides a new idea for the clinical treatment of NEC.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eArg-1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eArginase 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBMDM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ebone marrow derived macrophages\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCCL3\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCC motif chemokine ligand 3\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDEGs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edifferentially expressed genes\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFBS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efetal bovine serum\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFCM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFlow Cytometry\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFIZZ1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efound in inflammatory zone 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eiNOS Inducible Nitric-Oxide Synthase\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIRF5\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003einterferon regulatory factor 5\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMφ\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emacrophages\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNEC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNecrotizing enterocolitis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRNA-seq\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRNA sequencing\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRT-PCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ereal-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eYM1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003echitinase-like protein 3, Chil3.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Dr. Jinfeng Hou (Department of Gastrointestinal and Neonatal Surgery, Children\u0026apos;s Hospital of Chongqing Medical University) and Dr. Xiaohong Die (Department of Gastrointestinal and Neonatal Surgery, Children\u0026apos;s Hospital of Chongqing Medical University) for clinical samples collection.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZ.S., and D.C. conceived and designed the experiments. X.Y., W.L., Y.L. and H.L. performed the experiments. W.L. and Y.Y. collected and analyzed the data. Z.S. and X.Y. wrote of the manuscript. All authors had reviewed and approved the final submitted and published versions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was supported, in part, by the National Natural Science Foundation of China (Grant Number: 81801956 to Zhixin Song.), Chongqing Municipal Health Commission (Grant Number: 2020MSXM050 to Dapeng Chen.), Distinguished Young Scholars of the Children\u0026apos;s Hospital of Chongqing Medical University (Zhixin Song.).\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Ethics Committee of Children\u0026apos;s Hospital of Chongqing Medical University and the Animal Ethics Committee of Chongqing Medical University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eNeu, J., and W. A. Walker. 2011. Necrotizing enterocolitis. \u003cem\u003eThe New England journal of medicine\u003c/em\u003e 364 (3): 255\u0026ndash;264.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrost, B. L., et al. 2017. New Medical and Surgical Insights Into Neonatal Necrotizing Enterocolitis: A Review. \u003cem\u003eJAMA pediatrics\u003c/em\u003e 171 (1): 83\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOu, J., et al., \u003cem\u003eNutrition in Necrotizing Enterocolitis and Following Intestinal Resection\u003c/em\u003e. Nutrients, 2020. 12(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNi\u0026ntilde;o, D. F., C. P. Sodhi, and D. J. Hackam. 2016. Necrotizing enterocolitis: new insights into pathogenesis and mechanisms. \u003cem\u003eNature reviews. Gastroenterology \u0026amp; hepatology\u003c/em\u003e 13 (10): 590\u0026ndash;600.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHunter, C. J., et al. 2008. Understanding the susceptibility of the premature infant to necrotizing enterocolitis (NEC). \u003cem\u003ePediatric research\u003c/em\u003e 63 (2): 117\u0026ndash;123.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReisinger, K. W., et al. 2014. Breast-feeding improves gut maturation compared with formula feeding in preterm babies. \u003cem\u003eJournal of pediatric gastroenterology and nutrition\u003c/em\u003e 59 (6): 720\u0026ndash;724.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeida, F. H., et al. 2016. Risk factors associated with postnecrotizing enterocolitis strictures in infants. \u003cem\u003eJournal of pediatric surgery\u003c/em\u003e 51 (7): 1126\u0026ndash;1130.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmin, S. C., et al. 2013. Short bowel syndrome in the NICU. \u003cem\u003eClinics in perinatology\u003c/em\u003e 40 (1): 53\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElfvin, A., et al., \u003cem\u003eLow birthweight, gestational age, need for surgical intervention and gram-negative bacteraemia predict intestinal failure following necrotising enterocolitis.\u003c/em\u003e Acta paediatrica (Oslo, Norway: 1992), 2015. \u003cb\u003e104\u003c/b\u003e(8): p.\u0026nbsp;771-776.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollado, M. C., et al. 2015. Factors influencing gastrointestinal tract and microbiota immune interaction in preterm infants. \u003cem\u003ePediatric research\u003c/em\u003e 77 (6): 726\u0026ndash;731.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGood, M., C. P. Sodhi, and D. J. Hackam. 2014. Evidence-based feeding strategies before and after the development of necrotizing enterocolitis. \u003cem\u003eExpert review of clinical immunology\u003c/em\u003e 10 (7): 875\u0026ndash;884.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, Y., et al. 2017. Inflammation and Apoptosis: Dual Mediator Role for Toll-like Receptor 4 in the Development of Necrotizing Enterocolitis. \u003cem\u003eInflammatory bowel diseases\u003c/em\u003e 23 (1): 44\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohanKumar, K., et al. 2012. Gut mucosal injury in neonates is marked by macrophage infiltration in contrast to pleomorphic infiltrates in adult: evidence from an animal model. \u003cem\u003eAmerican journal of physiology. Gastrointestinal and liver physiology\u003c/em\u003e 303 (1): G93\u0026ndash;G102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeniffel, D., et al., \u003cem\u003eOtitis Media and Nasopharyngeal Colonization in Mice\u003c/em\u003e. Infection and immunity, 2017. 85(11).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRussell, C. D., et al. 2017. The Human Immune Response to Respiratory Syncytial Virus Infection. \u003cem\u003eClinical microbiology reviews\u003c/em\u003e 30 (2): 481\u0026ndash;502.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGibaldi, D., et al. 2020. CCL3/Macrophage Inflammatory Protein-1α Is Dually Involved in Parasite Persistence and Induction of a TNF- and IFNγ-Enriched Inflammatory Milieu in -Induced Chronic Cardiomyopathy. \u003cem\u003eFrontiers in immunology\u003c/em\u003e 11: 306.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaller, T. H., et al. 2017. Chemokines as adjuvants for immunotherapy: implications for immune activation with CCL3. \u003cem\u003eExpert review of clinical immunology\u003c/em\u003e 13 (11): 1049\u0026ndash;1060.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshida, Y., et al. 2020. Prevention of CaCl-induced aortic inflammation and subsequent aneurysm formation by the CCL3-CCR5 axis. \u003cem\u003eNature communications\u003c/em\u003e 11 (1): 5994.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKovler, M. L., C. P. Sodhi, and D. J. Hackam, Precision-based modeling approaches for necrotizing enterocolitis. Disease models \u0026amp; mechanisms, 2020. 13(6).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArlauckas, S. P., et al. 2018. Arg1 expression defines immunosuppressive subsets of tumor-associated macrophages. \u003cem\u003eTheranostics\u003c/em\u003e 8 (21): 5842\u0026ndash;5854.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCorbin, A. L., et al., \u003cem\u003eIRF5 guides monocytes toward an inflammatory CD11c macrophage phenotype and promotes intestinal inflammation\u003c/em\u003e. Science immunology, 2020. 5(47).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu, L., et al. 2014. TSC1 controls macrophage polarization to prevent inflammatory disease. \u003cem\u003eNature communications\u003c/em\u003e 5: 4696.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHorbar, J. D., et al. 2012. Mortality and neonatal morbidity among infants 501 to 1500 grams from 2000 to 2009. \u003cem\u003ePediatrics\u003c/em\u003e 129 (6): 1019\u0026ndash;1026.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePelisch, N., et al. 2020. CCL3 contributes to secondary damage after spinal cord injury. \u003cem\u003eJournal of neuroinflammation\u003c/em\u003e 17 (1): 362.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNa, Y. R., et al. 2019. \u003cem\u003eMacrophages in intestinal inflammation and resolution: a potential therapeutic target in IBD.\u003c/em\u003e Nature reviews. \u003cem\u003eGastroenterology \u0026amp; hepatology\u003c/em\u003e 16 (9): 531\u0026ndash;543.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Supplementary","content":"\u003cp\u003eSupplementary Data 1 is not available with this version\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"NEC, CCL3, Macrophage, inflammation","lastPublishedDoi":"10.21203/rs.3.rs-1283126/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1283126/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNecrotizing enterocolitis (NEC) is a life-threatening inflammatory gastrointestinal disease in neonates, the mechanism of which is poorly elucidated. Intestinal mucosal barrier imbalance due to excessive inflammatory response is an important endogenous cause of NEC. Our study elucidates a novel mechanism of NEC development, in which CCL3 regulated the chemotaxis, polarization, and function of macrophages to promote NET progression. Our data show that CCL3 is highly expressed in the intestinal tissues of NEC patients and mice and induce macrophage infiltration. Transcriptome data from high-throughput sequencing showed that CCL3 strongly induced macrophages switch into a pro-inflammatory phenotype. Mechanistically, \u003cem\u003ein vivo\u003c/em\u003e experiments confirmed that CCL3 induced M1 polarization of macrophages in NEC intestinal tissue, thereby aggravating inflammatory injury of intestinal tissue which can be reversed by anti-CCL3 treatment; in accordance, \u003cem\u003ein vitro e\u003c/em\u003experiments showed that CCL3 could significantly enhance the expression of M1-related genes (e.g. iNOS, IRF5, CD86) in both peritoneal macrophages and bone marrow derived macrophages while inhibit the expression of M2-related genes (e.g. Arg-1, FIZZ1, YM1), which could also be reversed by anti-CCl3 treatment. Herein, our study has elucidated a novel mechanism of CCL3 involvement in the pathogenesis of NEC, in which the upregulated CCL3 expression exacerbated inflammatory intestinal damage via regulating macrophage chemotaxis and M1 phenotype polarization, suggesting that blocking CCL3 may be a potential strategy for effective intervention of NEC.\u003c/p\u003e","manuscriptTitle":"CCL3 aggravates intestinal tissue damage in NEC by promoting macrophage chemotaxis and M1 macrophage polarization.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-01-31 19:14:33","doi":"10.21203/rs.3.rs-1283126/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"259da700-8ccf-417f-a36c-5301ac0a2498","owner":[],"postedDate":"January 31st, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-04-04T22:58:06+00:00","versionOfRecord":[],"versionCreatedAt":"2022-01-31 19:14:33","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1283126","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1283126","identity":"rs-1283126","version":["v1"]},"buildId":"FbvkV6FR0MCFSLy54lSbu","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}