MiR-590 Targets SHP2 to Promote Cervical Cancer Proliferation and Tumor Formation through Regulation of the JAK-STAT Signaling Pathway

MiR-590 Targets SHP2 to Promote Cervical Cancer Proliferation and Tumor Formation through Regulation of the JAK-STAT Signaling Pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article MiR-590 Targets SHP2 to Promote Cervical Cancer Proliferation and Tumor Formation through Regulation of the JAK-STAT Signaling Pathway Yong Li, XiuMei Li, YuChao Diao, XiuLan Weng, LiMin Zhang, XiaoTong Zhu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8106230/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective To investigate the mechanism by miRNA-590 targets SHP2 to regulate the JAK-STAT signaling pathway, thereby promoting cell proliferation and tumor formation in cervical cancer. Methods Immunohistochemistry was employed to assess the expression levels of SHP2 and JAK1 in cervical cancer tissues and analyze their correlation with clinical pathological features. RNA interference and overexpression techniques were used to silence and overexpress SHP2, respectively, to evaluate its impact on cell proliferation, migration, and apoptosis in cervical cancer cells. Western blot and qPCR were utilized to examine the regulatory effect of SHP2 on the JAK-STAT signaling pathway. Further, the effect of miR-590 overexpression on cervical cancer cell proliferation, migration, and JAK-STAT signaling was investigated. Results Immunohistochemical analysis revealed that SHP2 and JAK1 were significantly upregulated in cervical cancer tissues, and high expression of SHP2 was strongly correlated with tumor stage and size. Cell experiments showed that overexpression of SHP2 significantly promoted cell proliferation and migration while inhibiting apoptosis, whereas SHP2 silencing suppressed these behaviors and promoted apoptosis. Western blot and qPCR analyses further confirmed that SHP2 activated the JAK1-STAT3 signaling pathway to enhance cell survival and migration. Animal model experiments supported the findings of the cell-based assays. Additionally, miR-590 was found to directly target SHP2, downregulating its expression and significantly inhibiting cervical cancer cell proliferation and migration. Conclusion SHP2 promotes cell proliferation, migration, and apoptosis resistance in cervical cancer by activating the JAK-STAT signaling pathway. miR-590 exerts its anti-cancer effects by downregulating SHP2 expression, providing a potential therapeutic strategy for cervical cancer. Biological sciences/Cancer Biological sciences/Cell biology Biological sciences/Molecular biology Health sciences/Oncology miRNA-590 SHP2 JAK-STAT Cervical cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Cervical cancer (CC) is one of the most common malignant tumors among women worldwide. Its incidence and mortality rates are second only to breast cancer, posing a significant threat to women's health [ 1 ] . According to GLOBOCAN 2020, approximately 600,000 new cases of cervical cancer are diagnosed each year globally, with over 300,000 deaths, the majority of which occur in low- and middle-income countries [ 2 ] . Despite the significant reduction in incidence due to the widespread implementation of screening technologies and the HPV vaccine, particularly in developed countries, the incidence and mortality of cervical cancer remain high in many developing nations, where screening rates are low and vaccine coverage is insufficient. Furthermore, even with comprehensive treatments such as surgery, radiotherapy, and chemotherapy, the prognosis for patients with advanced or recurrent cervical cancer remains poor. Therefore, there is an urgent need to explore the molecular mechanisms of cervical cancer to provide a theoretical basis for more precise diagnostic and therapeutic strategies. SHP2 (Src homology 2 domain-containing protein tyrosine phosphatase 2), also known as PTPN11, is a key signaling molecule involved in the regulation of cell proliferation, differentiation, migration, and apoptosis [ 3 ] . SHP2 functions by binding to phosphorylated receptor tyrosine kinases and other signaling proteins through its SH2 domains, playing a critical role in various signaling pathways, including RAS/MAPK, PI3K/AKT, and JAK-STAT [ 4 ] . SHP2 has been shown to possess oncogenic properties in several malignant tumors, with its aberrant activation promoting tumor initiation and progression by modulating downstream signaling pathways. In breast cancer, gastric cancer, and lung cancer, high expression of SHP2 is associated with increased tumor cell proliferation, invasiveness, and drug resistance [ 5 , 6 ] . However, the specific role of SHP2 in cervical cancer remains unclear, and research into its potential as a therapeutic target is still in its early stages.In recent years, with the rapid development of genomics and transcriptomics, non-coding RNAs (ncRNAs), especially microRNAs (miRNAs), have emerged as crucial regulators in cancer research. MiRNA-590, a miRNA widely studied in recent years, plays an important biological role in various cancers [ 7 ] . MiRNA-590-3p promotes the proliferation of colon cancer cells by inhibiting WIF1 and DKK1 through the Wnt/β-catenin signaling pathway [ 8 ] . MiRNA-590-5p regulates gastric cancer cell growth and chemotherapy sensitivity through the RECK and AKT/ERK pathways [ 9 ] . While the role of miRNA-590 in various cancers has been reported, its expression profile and molecular mechanisms in cervical cancer remain insufficiently explored, especially regarding whether it targets specific signaling molecules such as SHP2 to affect downstream pathways.The JAK-STAT signaling pathway (Janus kinase-signal transducer and activator of transcription) is a key signaling cascade involved in cytokine and growth factor signal transduction, playing a crucial role in cell proliferation, differentiation, migration, and immune regulation [ 10 ] . This pathway consists of Janus kinases (JAKs) and signal transducers and activators of transcription (STATs). Upon extracellular stimulation, JAKs phosphorylate and activate STAT proteins, which then regulate the transcription of various genes [ 11 ] . Abnormal activation of the JAK-STAT pathway is a major mechanism driving tumorigenesis in many malignancies. In breast cancer, overactivation of the JAK-STAT pathway is associated with enhanced cell proliferation and tumor invasiveness [ 12 ] . In non-small cell lung cancer, aberrant JAK-STAT signaling results in immune suppression [ 13 , 14 ] . However, it remains unclear whether the JAK-STAT pathway is regulated by miRNAs in cervical cancer, and whether this regulation is mediated by specific molecules like SHP2. Building on the background of previous research, this study aims to elucidate the expression profile of miRNA-590 in cervical cancer and its molecular mechanism of action through targeting SHP2 to regulate the JAK-STAT signaling pathway. Using bioinformatic analysis and functional validation experiments, we will systematically assess the role of miRNA-590 in cervical cancer, explore its interaction with SHP2 and the JAK-STAT pathway, and clarify how miRNA-590 regulates key signaling molecules to promote tumor cell proliferation and tumor formation. 2. Materials and Methods 2.1 Bioinformatic Analysis To predict and screen miRNAs targeting SHP2, the full-length sequence and 3' untranslated region (3' UTR) of SHP2 were first obtained from public databases, such as NCBI. The 3' UTR sequence of SHP2 was then analyzed using miRanda to predict potential upstream miRNAs. Candidate miRNAs were selected based on their context + + score, conservation score, and biological relevance. The miRNAs that met the scoring and functional criteria were chosen for further experimental validation. 2.2 Immunohistochemistry Formalin-fixed cervical tissue was embedded, sectioned, and subjected to immunohistochemical staining to detect the expression of SHP2 and JAK1. Enhanced DAB chromogenic reagents (MXB, Fuzhou, China) were used for staining, followed by hematoxylin counterstaining, washing, and mounting. The slides were observed under a microscope. The criterion for positive protein expression is the presence of brownish-yellow granules in the cells, with the intensity of the color being proportional to the expression level—darker color indicates stronger expression. If no brownish-yellow granules are observed, it is considered negative expression. The absence of brown-yellow granules was considered negative expression. Antibodies were purchased from Wuhan Sanying Biotechnology (Wuhan, China). 2.3 Cell Culture and Transfection Cervical cancer cell lines were cultured in RPMI-1640 medium (GIBCO, USA) supplemented with 10% fetal bovine serum (FBS) (GIBCO, USA), 100 U/ml penicillin, and 100 µg/ml streptomycin (Aladdin, China), and incubated in a 5% CO 2 , 37°C humidified incubator. Cells were passaged using trypsin. HeLa cells were seeded at a density of 1×10⁶ cells/ml and plated at 2×10⁵ cells/well in 6-well plates. Once the cells reached confluence, transfection was performed according to the Lipofectamine 2000 protocol (Thermo Fisher, USA). For SHP2 knockdown: cells were divided into three groups: ctrl (control group), si-NC (negative control), and si-SHP2 (SHP2 knockdown). For SHP2 overexpression: cells were divided into three groups: ctrl (control group), NC-SHP2 mimic (empty lentivirus control), and SHP2 mimic (SHP2 overexpression). Transfections were performed for 48 hours, after which cells were collected for subsequent experiments. 2.4 Animal Model and Grouping Thirty SPF-grade nude mice were randomly assigned to two groups: NC shRNA and SHP2 shRNA, with 15 mice in each group. The backs of the mice were sterilized, and HeLa cells transfected with NC shRNA or SHP2 shRNA were adjusted to a density of 2×10⁷ cells/ml. The cells were injected subcutaneously into the right axilla of each mouse. A total of 0.2 mL of single-cell suspension was injected under the skin, and the injection site was sealed to prevent leakage. Mice were housed in cages and monitored daily for the growth of transplanted tumors. Tumor size was measured using calipers, and tumor volume was calculated. After 21 days, the mice were euthanized, blood was collected from the abdominal aorta, and tumor and spleen tissues were harvested. Tumor volume and weight were measured, and a portion of the tissue was fixed in 4% paraformaldehyde, while the remainder was rapidly frozen in liquid nitrogen and stored at -80°C. The method of execution: The nude mice quickly loses consciousness after inhaling a high concentration of carbon dioxide, leading to respiratory and cardiac arrest. A compressed carbon dioxide cylinder containing at least 70% concentration was used to quickly fill the euthanasia box. The flow rate was controlled at 10%-30% of the box's volume per minute to prevent the nude mice from suffocating. After the nude mice’s breathing stopped, it remained in the box for at least 1–2 minutes to confirm death. 2.5 Quantitative PCR Total RNA was extracted from cells and fresh tissues using an RNA extraction kit (TaKaRa, China) and reverse-transcribed into cDNA (TaKaRa, China). SYBR Green quantitative PCR analysis was performed using the Roche 480 system. Each PCR reaction included 10 µL SYBR Green, 1 µL cDNA, 1 µL of each primer (10 mmol/L), and 8 µL of distilled water. GAPDH was used as an internal control. Primer sequences are provided in the table below(Table 1 ): Table 1 Primer Sequences gene Sequence (5' − 3') SHP2 Forward AGAGGGAAGAGCAAATGTGTCA Reverse CTGTGTTTCCTTGTCCGACCT JAK1 Forward AGTGCAGTATCTCTCCTCTCTG Reverse GATTCGGTTCGGAGCGTACC JAK2 Forward GGAATGGCCTGCCTTACAATG Reverse TGGCTCTATCTGCTTCACAGAAT TYK2 Forward TGCATCCACATCGCACACAA Reverse CTCCTGGGGATTCATGCCA miR-590 Forward AACACGCTAGCCAGTCAGAAATG Reverse AACAGTGTAGCCAGTCAGAAATGAG U6 Forward AACAAGGTGCTCGCTTCGG Reverse CAGTGCAGGGTCCGAGGT GAPDH Forward GGAGCGAGATCCCTCCAAAAT Reverse GGCTGTTGTCATACTTCTCATGG 2.6 Western Blot Cervical cancer cells and tissues were harvested, digested with trypsin, and resuspended, followed by two washes with PBS. PARP protein lysis buffer (Solabio, R0010) was added, and the samples were centrifuged at high speed at 4°C to extract the proteins. Protein concentration was measured using the BCA protein assay kit (Solabio, PC0020). Protein samples were separated by 10% SDS-PAGE and transferred to PVDF membranes (Thermo, 88520). Membranes were incubated with 5% BSA at room temperature for 1 hour, followed by overnight incubation at 4°C with primary antibodies: SHP2 (Proteintech, 20145-1-AP), Bcl-2 (CST, #3498S), Caspase-3 (CST, #9662S), JAK1 (Proteintech, 66466-1-Ig), JAK2 (Proteintech, bs-0908R), TYK2 (Proteintech, 67411-1-Ig), SOS1 (Proteintech, 55041-1-AP), and HRAS (Proteintech, 15531-1-AP). After three washes with TBST, the membranes were incubated with HRP-conjugated goat anti-mouse IgG (diluted 1:5000) (CST, #7074) at room temperature for 1 hour. After washing with TBST, protein bands were visualized using an ECL detection kit (Bio-Rad, 170–5061). 2.7 Hematoxylin and Eosin (H&E) Staining Tumor tissues were cut into 5 µm thick sections and sequentially processed for dewaxing. Sections were stained with hematoxylin for 40 seconds, followed by a brief wash and staining with eosin solution (Shanghai Kehui Biotechnology Co., Ltd.) for 3 seconds. After washing with tap water, tissues were dehydrated and cleared, followed by mounting with neutral resin. Tissue morphology was observed under a light microscope (Motice), and images were captured. 2.8 TUNEL Staining Tissue samples were fixed in 10% phosphate-buffered formalin for 24 hours, embedded in paraffin, and sectioned into 4–5 µm thin slices. TUNEL staining was performed using the TUNEL BrightGreen Apoptosis Detection Kit (Roche, Switzerland) according to the manufacturer’s instructions. Apoptotic cells were labeled with green fluorescence, and tumor cell nuclei were counterstained with DAPI. Images of tumor tissues were captured using a confocal microscope. 2.9 CCK-8 Assay For cell proliferation analysis, transfected cells were seeded at a density of 3 × 10³ cells per well in a 96-well plate. After incubation for 3 hours with 10 µL of CCK-8 solution (HYCEZMBIO, China), the optical density at 450 nm was measured using a spectrophotometer to assess cell proliferation. 2.10 Flow Cytometry Apoptosis was assessed using an Annexin V-FITC/PI apoptosis detection kit (Sigma, USA) according to the manufacturer's instructions. Cells were collected and washed twice with PBS, then labeled in 500 µL of 1X binding buffer, with 5 µL of Annexin V-FITC and 10 µL of PI added. After a 5-minute incubation in the dark, apoptosis was analyzed by flow cytometry. 2.11 Transwell Migration Assay For cell migration analysis, transfected cells were collected and washed three times with serum-free medium. A total of 1 × 10⁵ cells were resuspended in 100 µL serum-free medium and added to the upper chamber of a 24-well Transwell plate. The lower chamber contained 500 µL complete medium. After incubation at 37°C, cells that migrated to the lower chamber were fixed with methanol and stained with crystal violet (Sigma, USA). After drying, the membranes were mounted with neutral resin, and the number of migrated cells was counted under a microscope. 2.12 Scratch Assay Cervical cancer cells were seeded in 6-well plates and cultured until they reached 100% confluence. A scratch was made using a 20 µL pipette tip. The medium was replaced with serum-free medium, and images were captured at 0, 24, 48, and 72 hours post-scratching to monitor wound healing. 2.13 Tumor Spheroid Formation Assay Cells from each group were seeded at a density of 2.5 × 10⁵ cells per well in a 24-well plate and cultured in medium containing 20 ng/mL EGF, 20 ng/mL FGF, and 2% B-27 for 7 days to induce spheroid formation. Images were captured using an inverted microscope, and the number of spheroids was counted. The assay was performed in triplicate. 2.14 Dual-Luciferase Reporter Assay On the day prior to transfection, cells in the logarithmic growth phase were collected and resuspended. A total of 1 × 10⁵ cells per well were seeded in a 24-well plate. Transfection was performed using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s protocol. Dual-luciferase activity was measured 48 hours post-transfection using the Dual-Luciferase Reporter Assay System (Promega, USA). 2.15 Statistical Analysis All data were processed using GraphPad Prism 9 software. For statistical analysis, normally distributed data were expressed as Mean ± SEM. One-way analysis of variance (ANOVA) was used to compare mean differences among multiple groups. P values < 0.05 were considered to be statistically significant. 3. Result 3.1 Expression of SHP2 and JAK1 in Cervical Cancer and Paracancerous Tissues To investigate the differential expression of SHP2 and JAK1 in cervical cancer tissues compared to paracancerous tissues, we performed immunohistochemical (IHC) staining (Fig. 1 A). In paracancerous tissues, both SHP2 and JAK1 exhibited weak and diffuse staining with low intensity, indicating low expression levels of these proteins. In contrast, cervical cancer tissues displayed significantly enhanced staining for both SHP2 and JAK1, suggesting a marked increase in their expression levels. Figure 1 B shows a comparative analysis of SHP2 and JAK1 expression levels between paracancerous tissues and cervical cancer tissues. Statistical analysis revealed that, compared to paracancerous, the expression of SHP2 and JAK1 was significantly upregulated in cervical cancer tissues (p < 0.05). 3.2 Effects of SHP2 Gene Silencing and Overexpression on Cervical Cancer Cell Behavior To investigate the effects of SHP2 gene silencing and overexpression on cervical cancer cell behavior, we performed flow cytometry, wound healing, and Transwell migration assays. Flow cytometry results (Fig. 2 A and 2 B) showed that, compared to the pcDNA-NC group, the early apoptosis rate in the pcDNA-SHP2 group was significantly reduced to 0.12%. In contrast, the early apoptosis rate in the si-SHP2 group significantly increased to 47.7% compared to si-NC (p < 0.05). No significant difference was observed between the control, pcDNA-NC, and si-NC groups. Wound healing assays (Fig. 2 C and 2 D) confirmed the impact of SHP2 on cell migration. The wound closure rate at 0, 24, 48, and 72 hours in the pcDNA-SHP2 group was significantly higher than in the pcDNA-NC group, whereas the si-SHP2 group showed a significantly reduced wound closure rate (p < 0.05), indicating that SHP2 overexpression significantly enhances cell migration. Transwell migration assays (Fig. 2 E and 2 F) further supported these findings. The number of transmembrane cells in the pcDNA-SHP2 group was significantly increased, while the number in the si-SHP2 group was significantly reduced (p < 0.01). These results suggest that SHP2 overexpression significantly inhibits cell apoptosis, while SHP2 silencing promotes cell apoptosis. 3.3 Effect of SHP2 Gene Silencing and Overexpression on Apoptosis-Related Proteins Western blot analysis revealed that the expression regulation of SHP2 significantly affects the levels of downstream apoptosis and signaling proteins (Fig. 3 A and 3 B). Specifically, compared to the pcDNA-NC group, the pcDNA-SHP2 group showed upregulation of the anti-apoptotic protein Bcl-2 and downregulation of pro-apoptotic proteins Bax and Caspase 3. Conversely, compared to the si-NC group, si-SHP2 cells exhibited reduced Bcl-2 expression and increased Bax and Caspase 3 levels. In terms of signaling proteins, the expression of key JAK-STAT pathway proteins, including JAK1, JAK2, TYK2, as well as SOS1 and HRAS, was lower in the pcDNA-SHP2 group, while expression was elevated in the si-SHP2 cells. These results further confirm that overexpression of SHP2 inhibits apoptosis (Fig. 3 C and 3 D), whereas its silencing promotes apoptosis, and that SHP2 plays a regulatory role in the JAK-STAT signaling pathway. 3.4 Effect of SHP2 on Tumor Growth and Inflammatory Cytokine Levels To investigate the effect of SHP2 expression on tumor growth and related mechanisms in a mouse model, a subcutaneous xenograft model of cervical cancer in nude mice was established. TUNEL staining results (Fig. 3 E) showed that compared to the sh-NC group, the sh-SHP2 group exhibited a significant increase in the number of positive cells (p < 0.01), indicating that SHP2 inhibits tumor cell apoptosis. HE staining (Fig. 3 F) further confirmed that compared to the sh-NC group, the sh-SHP2 group exhibited more disorganized and less dense cell arrangement, suggesting that tumor proliferation was inhibited. ELISA results (Fig. 3 G) showed that compared to the sh-NC group, serum levels of inflammatory cytokines (TNF-α, IL-1β, IL-6, and IL-12) were significantly reduced in the sh-SHP2 group (p < 0.05). 3.5 Regulation of the JAK/STAT Signaling Pathway by SHP2 Western blot and qPCR were performed to validate the regulatory effect of SHP2 on the JAK/STAT signaling pathway. Western blot analysis (Fig. 4 A and 4 B) showed that, compared with the sh-NC group, SHP2 expression was significantly downregulated in the sh-SHP2 group, and the expression levels of key JAK/STAT signaling molecules, including STAT1, JAK1, JAK2, and TYK2, were significantly reduced. Additionally, the protein expression of IL-2 was also significantly decreased (p < 0.05). qPCR results (Fig. 4 C) further confirmed that the mRNA levels of STAT1, JAK1, JAK2, TYK2, and IL-2 were significantly downregulated in the sh-SHP2 group compared to the sh-NC group (p < 0.05). 3.6 miR-590 Targets SHP2 and Participates in Molecular Regulation of Cervical Cancer To investigate the potential role of miR-590 in cervical cancer, bioinformatics analysis was first performed, revealing a high expression pattern of miR-590 in cervical cancer tissues (Fig. 4 D). Correlation analysis further demonstrated a significant association between the expression of miR-590 and SHP2 (Fig. 4 E). To validate the interaction between miR-590 and SHP2, a dual-luciferase reporter assay was conducted (Fig. 4 F), which showed that miR-590 can directly target SHP2 and regulate its expression. 3.7 miR-590 Targets SHP2 and Regulates Cell Behavior To investigate the targeted regulation of SHP2 by miR-590 and its impact on cell survival, apoptosis, migration, and spheroid formation, we conducted CCK-8, flow cytometry, scratch assay, Transwell migration assay, and spheroid formation assays. Flow cytometry results (Fig. 5 A and 5 B) showed that, compared to the control group, ov-miR-590 significantly increased the cell apoptosis rate, while ov-SHP2 significantly decreased the apoptosis rate. In the ov-miR-590 + ov-SHP2 co-transfection group, apoptosis was significantly reduced compared to the ov-miR-590 group, and significantly increased compared to the ov-SHP2 group, approaching the control group levels. CCK-8 assay results (Fig. 5 C) revealed that cell viability was significantly reduced in the ov-miR-590 group compared to the control, while ov-SHP2 increased cell viability. The cell survival rate in the ov-miR-590 + ov-SHP2 co-transfection group restored to near control levels, suggesting that miR-590 inhibits cell survival through suppression of SHP2, and further confirming the protective role of SHP2 in miR-590-mediated apoptosis regulation. Scratch and Transwell migration assays (Fig. 5 D and 5 E) indicated that the migration ability was significantly reduced in the ov-miR-590 group compared to the control, while ov-SHP2 enhanced cell migration. The migration ability in the ov-miR-590 + ov-SHP2 co-transfection group was restored compared to the ov-miR-590 group, suggesting that SHP2 can reverse the inhibitory effect of miR-590 on cell migration. Transwell migration assays further supported these results (Fig. 5 F and 5 G). Spheroid formation assays confirmed the impact of miR-590 on spheroid formation. The results showed that the number of spheroids was significantly reduced in the ov-miR-590 group compared to the control, while ov-SHP2 significantly increased the spheroid count. In the ov-miR-590 + ov-SHP2 co-transfection group, spheroid formation was significantly restored compared to the ov-miR-590 group.These results demonstrate that miR-590 significantly reduces cell survival, enhances apoptosis, and inhibits migration and spheroid formation by targeting SHP2, highlighting the critical protective role of SHP2 in regulating miR-590-mediated cell biological behaviors. 3.8. miR-590 Targeting SHP2 Regulates Key Proteins in the JAK-STAT Signaling Pathway To investigate the regulatory effect of miR-590 on key proteins in the JAK-STAT signaling pathway, Western blot analysis was performed (Fig. 6 ) to assess the expression of SHP2, STAT1, IL-2, JAK1, JAK2, and TYK2 in different treatment groups. The results revealed that SHP2 protein expression was significantly downregulated in the ov-miR-590 group, while in the ov-miR-590 + ov-SHP2 co-transfection group, SHP2 expression approached control levels, indicating that miR-590 suppresses SHP2 expression. Furthermore, among key proteins in the JAK-STAT pathway, the expression of STAT1, IL-2, JAK1, JAK2, and TYK2 was significantly downregulated in the ov-miR-590 group compared to control. In contrast, ov-SHP2 significantly upregulated the expression of these proteins, and in the ov-miR-590 + ov-SHP2 co-transfection group, their expression levels were restored to near control values. These findings suggest that miR-590 may regulate the JAK-STAT signaling pathway by targeting SHP2 and modulating the expression of several key proteins. 4. Discussion Cervical cancer is one of the most common malignant tumors in women, and its development involves multiple signaling pathways and molecular regulations [ 15 ] . In recent years, microRNAs (miRNAs), as post-transcriptional regulatory factors, have been widely studied for their role in the progression of cervical cancer. This study reveals that miR-590 targets SHP2 and activates the JAK-STAT signaling pathway to promote cervical cancer cell proliferation and tumor formation, providing new insights for cervical cancer treatment. SHP2, a protein tyrosine phosphatase, plays an important role in cell signaling regulation. The JAK-STAT signaling pathway is a well-established pathway involved in regulating cell proliferation and apoptosis, and its abnormal activation has been validated in various malignancies [ 16 ] . Previous studies have demonstrated that the inhibition of SHP2 phosphatase activates the JAK/STAT signaling pathway, exerting regulatory effects on cancer cells [ 17 ] . Therefore, this study verifies the regulatory role of SHP2 in cervical cancer biological behaviors and its impact on the JAK-STAT signaling pathway through both in vitro and in vivo experimental systems. The results show that the overexpression of SHP2 significantly enhanced cell migration and activated the JAK-STAT signaling pathway while inhibiting apoptosis, thereby playing a crucial role in regulating cell behaviors. In the mouse model, inhibiting SHP2 expression promoted apoptosis, suppressed the JAK-STAT signaling pathway, and significantly reduced the levels of inflammatory cytokines. Previous studies have shown that SHP2 is upregulated in cervical cancer, and on one hand, silencing SHP2 in HeLa and SiHa cells inhibits cell growth and migration and increases sensitivity to cisplatin [ 18 ] . On the other hand, SHP2 overexpression is associated with lymph node metastasis and high HPV DNA, promoting the occurrence and development of cervical cancer. Yang et al. [ 19 ] introduced the SHP2 E76K mutation in glioblastoma cells, and the activated mutant enhanced cell proliferation, migration, and invasion in vitro, promoting tumor growth in xenograft models. Zhao et al. [ 20 ] studied conditional SHP2 knockout in ErbB2 transgenic mice and its effect on HER2-amplified breast cancer cells, and found that SHP2 knockout blocked ErbB2 overexpression, induced normal cell phenotypes, and inhibited tumorigenesis and metastasis. Therefore, excessive activation of SHP2 can promote cancer development. MiR-590, a key regulatory factor, has been reported to play an oncogenic role in various cancers [ 21 ] . In this study, bioinformatics analysis combined with dual-luciferase reporter assays verified that miR-590 is an upstream regulator of SHP2, providing evidence for the further exploration of miR-590's oncogenic mechanisms. Through experiments with ov-miR-590, ov-SHP2, and ov-miR-590 + ov-SHP2, we validated the targeted regulation of miR-590 on SHP2 and its effect on cell behavior as well as the JAK-STAT signaling pathway. The results show that overexpression of miR-590 significantly decreased cell survival rate, migration ability, and spheroid formation, while enhancing cell apoptosis. Moreover, SHP2 could significantly reverse the inhibitory effect of miR-590 on cell migration, thereby promoting tumor spheroid formation. Additionally, miR-590 suppressed the expression of key proteins in the JAK-STAT signaling pathway, such as STAT1, IL-2, JAK1, JAK2, and TYK2, while the co-transfection group of ov-miR-590 + ov-SHP2 restored the expression of these proteins to levels similar to the control group, indicating that miR-590 negatively regulates the JAK-STAT signaling pathway through targeting SHP2. In gastric cancer, miR-590 inhibits tumor invasion and metastasis by suppressing VEGFR1/2 and NRP1 expression; in non-small cell lung cancer, miR-590 significantly inhibits cell proliferation and migration by suppressing YAP1 and the Wnt/β-catenin signaling pathway [ 22 , 23 ] . In osteosarcoma, overexpression of miR-590-3p also increases cell apoptosis and inhibits cell proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) [ 24 ] . In breast cancer, overexpression of miR-590-3p inhibited the proliferation of MDA-MB-231 and MCF-7 cells. Rescue experiments indicated that overexpression of GOLPH3 significantly restored the proliferation inhibited by miR-590-3p [ 25 ] . These results suggest that miR-590 may act as a universal anticancer factor, participating in the regulation of multiple signaling pathways and exerting its effects through its target genes. In cervical cancer, miR-590 upregulation significantly inhibits cell proliferation and migration and regulates the JAK-STAT signaling pathway by affecting SHP2, thereby having profound effects on cell behavior. In conclusion, this study first demonstrates the mechanism by which miR-590 targets SHP2 to regulate the JAK-STAT signaling pathway in cervical cancer cells, providing a new theoretical basis for molecular therapy of cervical cancer. Strategies based on the expression regulation of miR-590 may offer new opportunities for personalized treatment of cervical cancer, improving patient prognosis and reducing cancer-related mortality. Declarations Data Availability Statement: The data presented in this study are available on request from the corresponding author. Competing interests: The authors declare no conflict of interest. Funding: This work was supported by Qingdao Natural Science Foundation (no. 25-1-1-149-zyyd-jch). Ethics approval and consent to participate: The study was approved by Animal Experimental Ethical Inspection of Shenyang Medical University of TCM (protocol code SYYXY2023070102) and the Institutional Review Board of the Affiliated Hospital of Qingdao University (committee numbers QYFYWZLL28789). Statement: we confirmed our study is reported in accordance with ARRIVE guidelines. Authors' contributions: Conceptualization: Yong Li and PengMing Sun; Data curation: XiuLan Weng and XiuMei Li; Formal analysis: Yong Li and XiuMei Li; Funding acquisition: PengMing Sun and YuChao Diao; Investigation: Yong Li, LiMin Zhang and XiaoTong Zhu; Methodology: Yong Li, YuChao Diao and PengMing Sun; Project administration: Yong Li and XiuMei Li; Software: XiuMei Li and XiuLan Weng; Supervision: PengMing Sun; Validation: XiuMei Li, XiuLan Weng and XiaoTong Zhu; Visualization: XiuMei Li; Writing – original draft: Yong Li and XiuMei Li; Writing – review & editing: PengMing Sun. All authors have read and approved the final manuscript. References Buskwofie, A., David-West, G. & Clare, C. A. A Review of Cervical Cancer: Incidence and Disparities. J. Natl. Med. Assoc. 112 (2), 229–232 (2020). Bray, F. et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 71 (3), 209–249 (2021). Asmamaw, M. D., Shi, X. J., Zhang, L. R. & Liu, H. M. A comprehensive review of SHP2 and its role in cancer. Cell. Oncol. (Dordr) . 45 (5), 729–753 (2022). Liu, Q., Qu, J., Zhao, M., Xu, Q. & Sun, Y. Targeting SHP2 as a promising strategy for cancer immunotherapy. Pharmacol. Res. 152 , 104595 (2020). Yuan, Y. et al. SHP2 promotes proliferation of breast cancer cells through regulating Cyclin D1 stability via the PI3K/AKT/GSK3β signaling pathway. Cancer Biol. Med. 17 (3), 707–725 (2020). Mi, D., Li, Y. & Chen, Y. Small-molecule Modulators Targeting SHP2 for Cancer Therapy. Anticancer Agents Med. Chem. 23 (5), 498–504 (2023). Bartel, D. P. MicroRNAs: target recognition and regulatory functions. Cell 136 (2), 215–233 (2009). Feng, Z. Y. et al. miR-590-3p promotes colon cancer cell proliferation via Wnt/β-catenin signaling pathway by inhibiting WIF1 and DKK1. Eur. Rev. Med. Pharmacol. Sci. 21 (21), 4844–4852 (2017). Shi, Z. et al. miRNA-590 promotes colorectal cancer growth via PI3K/AKT pathway. Cancer Biol. Ther. 21 (7), 599–608 (2020). Xin, P. et al. The role of JAK/STAT signaling pathway and its inhibitors in diseases. Int. Immunopharmacol. 80 , 106210 (2020). Xue, C. et al. Evolving cognition of the JAK-STAT signaling pathway: autoimmune disorders and cancer. Signal. Transduct. Target. Ther. 8 (1), 204 (2023). Shao, F., Pang, X. & Baeg, G. H. Targeting the JAK/STAT Signaling Pathway for Breast Cancer. Curr. Med. Chem. 28 (25), 5137–5151 (2021). Zhu, D. et al. Long noncoding RNA PART1 promotes progression of non-small cell lung cancer cells via JAK-STAT signaling pathway. Cancer Med. 8 (13), 6064–6081 (2019). Erdogan, F. et al. JAK-STAT core cancer pathway: An integrative cancer interactome analysis. J. Cell. Mol. Med. 26 (7), 2049–2062 (2022). Fu, K. et al. MiR-125 inhibited cervical cancer progression by regulating VEGF and PI3K/AKT signaling pathway. World J. Surg. Oncol. 18 (1), 115 (2020). Xue, C. et al. Evolving cognition of the JAK-STAT signaling pathway: autoimmune disorders and cancer. Signal. Transduct. Target. Ther. 8 (1), 204 (2023). Published 2023 May 19. Igbe, I. et al. Dietary quercetin potentiates the antiproliferative effect of interferon-α in hepatocellular carcinoma cells through activation of JAK/STAT pathway signaling by inhibition of SHP2 phosphatase. Oncotarget 8 (69), 113734–113748 (2017). Cao, M. et al. Shp2 expression is upregulated in cervical cancer, and Shp2 contributes to cell growth and migration and reduces sensitivity to cisplatin in cervical cancer cells. Pathol. Res. Pract. 215 (11), 152621 (2019). Yang, F. et al. Gain-of-function E76K-Mutant SHP2 Promotes Cell Proliferation, Metastasis, And Tumor Growth In Glioblastoma Through Activation Of The ERK/CREB Pathway. Onco Targets Ther. 12 , 9435–9447 (2019). Zhao, H. et al. Conditional knockout of SHP2 in ErbB2 transgenic mice or inhibition in HER2-amplified breast cancer cell lines blocks oncogene expression and tumorigenesis. Oncogene 38 (13), 2275–2290 (2019). Barwal, T. S. et al. miR-590-5p: A double-edged sword in the oncogenesis process. Cancer Treat. Res. Commun. 32 , 100593 (2022). Mei, B., Chen, J., Yang, N. & Peng, Y. The regulatory mechanism and biological significance of the Snail-miR590-VEGFR-NRP1 axis in the angiogenesis, growth and metastasis of gastric cancer. Cell. Death Dis. 11 (4), 241 (2020). Hao, X. & Su, A. MiR-590 suppresses the progression of non-small cell lung cancer by regulating YAP1 and Wnt/β-catenin signaling. Clin. Transl Oncol. 24 (3), 546–555 (2022). Zhao, H., Wang, Y., Hou, W., Ding, X. & Wang, W. Long non-coding RNA MALAT1 promotes cell proliferation, migration and invasion by targeting miR-590-3p in osteosarcoma. Exp. Ther. Med. 24 (5), 672 (2022). Song, Q. et al. ATF-3/miR-590/GOLPH3 signaling pathway regulates proliferation of breast cancer. BMC Cancer . 18 (1), 255 (2018). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8106230","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":554742461,"identity":"27980139-3954-4e20-8c5f-7adbd5a21d8f","order_by":0,"name":"Yong Li","email":"","orcid":"","institution":"Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Li","suffix":""},{"id":554742462,"identity":"d3fa6ad6-524a-4f46-8082-c5f9d8bfc845","order_by":1,"name":"XiuMei Li","email":"","orcid":"","institution":"the Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"XiuMei","middleName":"","lastName":"Li","suffix":""},{"id":554742463,"identity":"98d5d0f1-7492-4b8d-812d-5a6329b0c85e","order_by":2,"name":"YuChao Diao","email":"","orcid":"","institution":"the Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"YuChao","middleName":"","lastName":"Diao","suffix":""},{"id":554742464,"identity":"997b0fc0-03d7-4f33-b2ee-0109b5eafff3","order_by":3,"name":"XiuLan Weng","email":"","orcid":"","institution":"Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"XiuLan","middleName":"","lastName":"Weng","suffix":""},{"id":554742465,"identity":"991c7e74-2a54-4996-b415-37a546797996","order_by":4,"name":"LiMin Zhang","email":"","orcid":"","institution":"Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"LiMin","middleName":"","lastName":"Zhang","suffix":""},{"id":554742466,"identity":"aa852d36-877e-43e0-aade-5091395cc03b","order_by":5,"name":"XiaoTong Zhu","email":"","orcid":"","institution":"the Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"XiaoTong","middleName":"","lastName":"Zhu","suffix":""},{"id":554742467,"identity":"f4e5b01e-9d1b-4a7e-b8bc-44050bb1a494","order_by":6,"name":"PengMing Sun","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYJCCD0AsZwBmGlgQpYNxBpAwNmBgBmmRIF5L4gawFgYitMjPyD3Y8DHncPp29v6jG34USDDwt3cn4NVicCMvsXHmtsO5O3sOs93sATpM4szZDfi1SOSYP+YFatlwI5ntBg9Qi4FELn4t8jNyDJv/bjucbgDUcvMPMVoYbgC1MG47nADScpsoWwzOvDFs7N2WbrjhzGGz2zIGEjwE/SLfnmPY8HObtbzB8cZnN9/8sZHjb+8l4DAIaIazeIhRDgJ1xCocBaNgFIyCkQgAZbVK0b0llOMAAAAASUVORK5CYII=","orcid":"","institution":"Fujian Medical University","correspondingAuthor":true,"prefix":"","firstName":"PengMing","middleName":"","lastName":"Sun","suffix":""}],"badges":[],"createdAt":"2025-11-13 13:38:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8106230/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8106230/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97503526,"identity":"d53546cb-e7e8-4e7a-88c1-94331b1db062","added_by":"auto","created_at":"2025-12-05 06:54:48","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":961100,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/1ef2831ee1746de4e2fb83c5.docx"},{"id":97503518,"identity":"039947bc-cd8f-4f1b-91a3-216a50c32112","added_by":"auto","created_at":"2025-12-05 06:54:47","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8758,"visible":true,"origin":"","legend":"","description":"","filename":"6cb101d167d14ed5ac2983490ffddb6d.json","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/41b0efed42b6481c0ccbb48c.json"},{"id":97670402,"identity":"895587f2-c0ad-4b9d-a58f-9b7ba4bb61ff","added_by":"auto","created_at":"2025-12-08 09:30:32","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":85593,"visible":true,"origin":"","legend":"","description":"","filename":"6cb101d167d14ed5ac2983490ffddb6d1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/692effbb62fbc7358f61ac36.xml"},{"id":97503527,"identity":"898d0b7c-2b26-43b6-b5d5-73bede363fc4","added_by":"auto","created_at":"2025-12-05 06:54:48","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":126674,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/b7f4ee1080b3437526d8924d.png"},{"id":97670122,"identity":"4d1f9e32-ff47-4042-93d1-f907051c3ab0","added_by":"auto","created_at":"2025-12-08 09:29:45","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":355950,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/ae0d26e3d0152d69c7b5e5e3.png"},{"id":97503534,"identity":"ff192515-d966-4e98-82d4-08af9f324734","added_by":"auto","created_at":"2025-12-05 06:54:48","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":227201,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/e286c5a9fc62dff3f9ea91d5.png"},{"id":97503529,"identity":"5555518e-f583-49c2-abcd-5ffd7ada27bf","added_by":"auto","created_at":"2025-12-05 06:54:48","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":71958,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/6de2546bf74e57ad4a748dee.png"},{"id":97670454,"identity":"5e044422-ba22-421b-97eb-22fc2575681d","added_by":"auto","created_at":"2025-12-08 09:30:44","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":237076,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/6e8854eee645d87e0c87d3c0.png"},{"id":97671504,"identity":"1a3b5da7-b201-443e-b902-ae223b7747fb","added_by":"auto","created_at":"2025-12-08 09:32:40","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":52251,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/c6d1c8c18b7bd6a27d640e78.png"},{"id":97503530,"identity":"bf52e63a-3699-4483-aae7-4d0e28b7f95d","added_by":"auto","created_at":"2025-12-05 06:54:48","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":83758,"visible":true,"origin":"","legend":"","description":"","filename":"6cb101d167d14ed5ac2983490ffddb6d1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/88c9df8f9d1622dea45fcacf.xml"},{"id":97503532,"identity":"d245617a-2b2c-416a-af7e-7d18db4708d5","added_by":"auto","created_at":"2025-12-05 06:54:48","extension":"html","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":92782,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/69ad940054c8c1e607d1551a.html"},{"id":97503517,"identity":"9a68535c-0774-4a3e-b403-b27778f22775","added_by":"auto","created_at":"2025-12-05 06:54:47","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":96892,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of SHP2 and JAK in Cervical Cancer (CC) and Paracancerous Tissues (PCT). A: Immunohistochemical detection of SHP2 and JAK expression levels. B: Quantification of immunohistochemical staining. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 indicate statistical significance.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/a2375d327cd24fdb1c0f53e1.jpeg"},{"id":97503519,"identity":"88c8fe2d-fab5-475c-8566-98eb6063ae56","added_by":"auto","created_at":"2025-12-05 06:54:47","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":324711,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of SHP2 Gene Silencing and Overexpression on Cervical Cancer Cell Behavior. A: Flow cytometry analysis of apoptosis in different treatment groups. B: Quantification of apoptosis rates by flow cytometry. C: Results from the wound healing assay. D: Quantitative analysis of wound closure rates from the wound healing assay. E: Results from the Transwell migration assay.\u003c/p\u003e\n\u003cp\u003eF: Quantification of cell migration in the Transwell assay. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 indicate statistically significant differences.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/b4414fa738c82d5602ae13df.jpeg"},{"id":97503525,"identity":"ea0333e8-1150-4bc6-8f73-a8325368dab5","added_by":"auto","created_at":"2025-12-05 06:54:48","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":258849,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of SHP2 with different expression on Apoptosis-Related Proteins, Tumor Growth and Inflammatory Cytokine Levels. A: Expression levels of apoptosis-related proteins and key JAK-STAT pathway proteins in the control, pcDNA-NC, and pcDNA-SHP2 groups. B: Bar chart showing the corresponding protein grayscale values. C: Expression levels of apoptosis-related proteins and key JAK-STAT pathway proteins in the control, si-NC, and si-SHP2 groups. D: Bar chart showing the corresponding protein grayscale values. E: TUNEL staining analysis of cell apoptosis. F: Histopathological changes analyzed by staining. G: ELISA detection of inflammatory cytokine levels. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 indicates significant differences.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/887e84276760fc915fb0a46f.jpeg"},{"id":97503521,"identity":"e88b2e35-6dd8-4d50-80c6-299df8e6f9cd","added_by":"auto","created_at":"2025-12-05 06:54:48","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":120991,"visible":true,"origin":"","legend":"\u003cp\u003emiR-590 targets SHP2 and regualates the JAK/STAT signaling pathway.. A: Western blot analysis of key proteins in the JAK-STAT pathway in the sh-NC and sh-SHP2 groups.B: Quantification of protein expression levels based on grayscale analysis. C: qPCR analysis of mRNA levels of JAK-STAT pathway components in the sh-NC and sh-SHP2 groups. D: Bioinformatics analysis reveals high expression of miR-590 in cervical cancer tissues compared to normal tissues. E: Correlation analysis between miR-590 and SHP2 expression. F: Dual-luciferase reporter assay confirms the interaction between miR-590 and SHP2.*p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 indicate statistical significance.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/35b8f8a73d0f46d171f7e39a.jpeg"},{"id":97671093,"identity":"c1e352fb-105d-4443-b0ae-e8f00f645fc2","added_by":"auto","created_at":"2025-12-08 09:31:52","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":801165,"visible":true,"origin":"","legend":"\u003cp\u003eTargeted Regulation of SHP2 by miR-590 and Its Effects on Cell Behavior. A:Flow cytometry analysis showing apoptosis levels in different experimental groups. B: Quantitative analysis of flow cytometry results for apoptosis. C: CCK-8 assay measuring cell viability in each group. D: Representative images from the scratch assay illustrating cell migration at various time points in different treatment groups. E: Quantitative analysis of scratch assay results. F: Transwell invasion assay evaluating the invasive capacity of cells. G: Quantitative analysis of Transwell invasion assay results. H: Spheroid formation assay displaying the number and size of spheroids formed by cells. I: Quantitative analysis of spheroid formation assay results. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, indicating significant differences.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/6f62c4d43d9626444adf94f9.jpeg"},{"id":97503522,"identity":"f31379dd-c11b-4ceb-bb6b-9185333d95a5","added_by":"auto","created_at":"2025-12-05 06:54:48","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":82109,"visible":true,"origin":"","legend":"\u003cp\u003eRegulation of Key Proteins in the JAK-STAT Signaling Pathway by miR-590 Targeting SHP2. A: Western blot analysis of the expression levels of key proteins in the JAK-STAT pathway in the control, ov-miR-590, ov-SHP2, and ov-miR-590 + ov-SHP2 groups. B: Quantitative analysis of the corresponding protein expression levels. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 indicates significant differences.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/03d6bfebe78a86fd305ffc28.jpeg"},{"id":107484440,"identity":"a3f6b3b2-afa4-46cb-99d4-4d0f71586ff4","added_by":"auto","created_at":"2026-04-22 02:32:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2025251,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8106230/v1/1dd40baa-0333-4522-a5d3-91ef7c975c99.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"MiR-590 Targets SHP2 to Promote Cervical Cancer Proliferation and Tumor Formation through Regulation of the JAK-STAT Signaling Pathway","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eCervical cancer (CC) is one of the most common malignant tumors among women worldwide. Its incidence and mortality rates are second only to breast cancer, posing a significant threat to women's health\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. According to GLOBOCAN 2020, approximately 600,000 new cases of cervical cancer are diagnosed each year globally, with over 300,000 deaths, the majority of which occur in low- and middle-income countries\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Despite the significant reduction in incidence due to the widespread implementation of screening technologies and the HPV vaccine, particularly in developed countries, the incidence and mortality of cervical cancer remain high in many developing nations, where screening rates are low and vaccine coverage is insufficient. Furthermore, even with comprehensive treatments such as surgery, radiotherapy, and chemotherapy, the prognosis for patients with advanced or recurrent cervical cancer remains poor. Therefore, there is an urgent need to explore the molecular mechanisms of cervical cancer to provide a theoretical basis for more precise diagnostic and therapeutic strategies.\u003c/p\u003e\u003cp\u003eSHP2 (Src homology 2 domain-containing protein tyrosine phosphatase 2), also known as PTPN11, is a key signaling molecule involved in the regulation of cell proliferation, differentiation, migration, and apoptosis\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. SHP2 functions by binding to phosphorylated receptor tyrosine kinases and other signaling proteins through its SH2 domains, playing a critical role in various signaling pathways, including RAS/MAPK, PI3K/AKT, and JAK-STAT\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. SHP2 has been shown to possess oncogenic properties in several malignant tumors, with its aberrant activation promoting tumor initiation and progression by modulating downstream signaling pathways. In breast cancer, gastric cancer, and lung cancer, high expression of SHP2 is associated with increased tumor cell proliferation, invasiveness, and drug resistance\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. However, the specific role of SHP2 in cervical cancer remains unclear, and research into its potential as a therapeutic target is still in its early stages.In recent years, with the rapid development of genomics and transcriptomics, non-coding RNAs (ncRNAs), especially microRNAs (miRNAs), have emerged as crucial regulators in cancer research. MiRNA-590, a miRNA widely studied in recent years, plays an important biological role in various cancers\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. MiRNA-590-3p promotes the proliferation of colon cancer cells by inhibiting WIF1 and DKK1 through the Wnt/β-catenin signaling pathway\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. MiRNA-590-5p regulates gastric cancer cell growth and chemotherapy sensitivity through the RECK and AKT/ERK pathways\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. While the role of miRNA-590 in various cancers has been reported, its expression profile and molecular mechanisms in cervical cancer remain insufficiently explored, especially regarding whether it targets specific signaling molecules such as SHP2 to affect downstream pathways.The JAK-STAT signaling pathway (Janus kinase-signal transducer and activator of transcription) is a key signaling cascade involved in cytokine and growth factor signal transduction, playing a crucial role in cell proliferation, differentiation, migration, and immune regulation \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. This pathway consists of Janus kinases (JAKs) and signal transducers and activators of transcription (STATs). Upon extracellular stimulation, JAKs phosphorylate and activate STAT proteins, which then regulate the transcription of various genes\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Abnormal activation of the JAK-STAT pathway is a major mechanism driving tumorigenesis in many malignancies. In breast cancer, overactivation of the JAK-STAT pathway is associated with enhanced cell proliferation and tumor invasiveness\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. In non-small cell lung cancer, aberrant JAK-STAT signaling results in immune suppression\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. However, it remains unclear whether the JAK-STAT pathway is regulated by miRNAs in cervical cancer, and whether this regulation is mediated by specific molecules like SHP2.\u003c/p\u003e\u003cp\u003eBuilding on the background of previous research, this study aims to elucidate the expression profile of miRNA-590 in cervical cancer and its molecular mechanism of action through targeting SHP2 to regulate the JAK-STAT signaling pathway. Using bioinformatic analysis and functional validation experiments, we will systematically assess the role of miRNA-590 in cervical cancer, explore its interaction with SHP2 and the JAK-STAT pathway, and clarify how miRNA-590 regulates key signaling molecules to promote tumor cell proliferation and tumor formation.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Bioinformatic Analysis\u003c/h2\u003e\u003cp\u003eTo predict and screen miRNAs targeting SHP2, the full-length sequence and 3' untranslated region (3' UTR) of SHP2 were first obtained from public databases, such as NCBI. The 3' UTR sequence of SHP2 was then analyzed using miRanda to predict potential upstream miRNAs. Candidate miRNAs were selected based on their context\u0026thinsp;+\u0026thinsp;+\u0026thinsp;score, conservation score, and biological relevance. The miRNAs that met the scoring and functional criteria were chosen for further experimental validation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Immunohistochemistry\u003c/h2\u003e\u003cp\u003eFormalin-fixed cervical tissue was embedded, sectioned, and subjected to immunohistochemical staining to detect the expression of SHP2 and JAK1. Enhanced DAB chromogenic reagents (MXB, Fuzhou, China) were used for staining, followed by hematoxylin counterstaining, washing, and mounting. The slides were observed under a microscope. The criterion for positive protein expression is the presence of brownish-yellow granules in the cells, with the intensity of the color being proportional to the expression level\u0026mdash;darker color indicates stronger expression. If no brownish-yellow granules are observed, it is considered negative expression. The absence of brown-yellow granules was considered negative expression. Antibodies were purchased from Wuhan Sanying Biotechnology (Wuhan, China).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Cell Culture and Transfection\u003c/h2\u003e\u003cp\u003eCervical cancer cell lines were cultured in RPMI-1640 medium (GIBCO, USA) supplemented with 10% fetal bovine serum (FBS) (GIBCO, USA), 100 U/ml penicillin, and 100 \u0026micro;g/ml streptomycin (Aladdin, China), and incubated in a 5% CO\u003csub\u003e2\u003c/sub\u003e, 37\u0026deg;C humidified incubator. Cells were passaged using trypsin. HeLa cells were seeded at a density of 1\u0026times;10⁶ cells/ml and plated at 2\u0026times;10⁵ cells/well in 6-well plates. Once the cells reached confluence, transfection was performed according to the Lipofectamine 2000 protocol (Thermo Fisher, USA). For SHP2 knockdown: cells were divided into three groups: ctrl (control group), si-NC (negative control), and si-SHP2 (SHP2 knockdown). For SHP2 overexpression: cells were divided into three groups: ctrl (control group), NC-SHP2 mimic (empty lentivirus control), and SHP2 mimic (SHP2 overexpression). Transfections were performed for 48 hours, after which cells were collected for subsequent experiments.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 Animal Model and Grouping\u003c/h2\u003e\u003cp\u003eThirty SPF-grade nude mice were randomly assigned to two groups: NC shRNA and SHP2 shRNA, with 15 mice in each group. The backs of the mice were sterilized, and HeLa cells transfected with NC shRNA or SHP2 shRNA were adjusted to a density of 2\u0026times;10⁷ cells/ml. The cells were injected subcutaneously into the right axilla of each mouse. A total of 0.2 mL of single-cell suspension was injected under the skin, and the injection site was sealed to prevent leakage. Mice were housed in cages and monitored daily for the growth of transplanted tumors. Tumor size was measured using calipers, and tumor volume was calculated. After 21 days, the mice were euthanized, blood was collected from the abdominal aorta, and tumor and spleen tissues were harvested. Tumor volume and weight were measured, and a portion of the tissue was fixed in 4% paraformaldehyde, while the remainder was rapidly frozen in liquid nitrogen and stored at -80\u0026deg;C.\u003c/p\u003e\u003cp\u003eThe method of execution: The nude mice quickly loses consciousness after inhaling a high concentration of carbon dioxide, leading to respiratory and cardiac arrest. A compressed carbon dioxide cylinder containing at least 70% concentration was used to quickly fill the euthanasia box. The flow rate was controlled at 10%-30% of the box's volume per minute to prevent the nude mice from suffocating. After the nude mice\u0026rsquo;s breathing stopped, it remained in the box for at least 1\u0026ndash;2 minutes to confirm death.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 Quantitative PCR\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from cells and fresh tissues using an RNA extraction kit (TaKaRa, China) and reverse-transcribed into cDNA (TaKaRa, China). SYBR Green quantitative PCR analysis was performed using the Roche 480 system. Each PCR reaction included 10 \u0026micro;L SYBR Green, 1 \u0026micro;L cDNA, 1 \u0026micro;L of each primer (10 mmol/L), and 8 \u0026micro;L of distilled water. GAPDH was used as an internal control. Primer sequences are provided in the table below(Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e):\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer Sequences\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003egene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence (5' \u0026minus;\u0026thinsp;3')\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSHP2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGAGGGAAGAGCAAATGTGTCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGTGTTTCCTTGTCCGACCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eJAK1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGTGCAGTATCTCTCCTCTCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGATTCGGTTCGGAGCGTACC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eJAK2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGAATGGCCTGCCTTACAATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGGCTCTATCTGCTTCACAGAAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTYK2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGCATCCACATCGCACACAA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTCCTGGGGATTCATGCCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emiR-590\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAACACGCTAGCCAGTCAGAAATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAACAGTGTAGCCAGTCAGAAATGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eU6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAACAAGGTGCTCGCTTCGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGTGCAGGGTCCGAGGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGAGCGAGATCCCTCCAAAAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCTGTTGTCATACTTCTCATGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Western Blot\u003c/h2\u003e\u003cp\u003eCervical cancer cells and tissues were harvested, digested with trypsin, and resuspended, followed by two washes with PBS. PARP protein lysis buffer (Solabio, R0010) was added, and the samples were centrifuged at high speed at 4\u0026deg;C to extract the proteins. Protein concentration was measured using the BCA protein assay kit (Solabio, PC0020). Protein samples were separated by 10% SDS-PAGE and transferred to PVDF membranes (Thermo, 88520). Membranes were incubated with 5% BSA at room temperature for 1 hour, followed by overnight incubation at 4\u0026deg;C with primary antibodies: SHP2 (Proteintech, 20145-1-AP), Bcl-2 (CST, #3498S), Caspase-3 (CST, #9662S), JAK1 (Proteintech, 66466-1-Ig), JAK2 (Proteintech, bs-0908R), TYK2 (Proteintech, 67411-1-Ig), SOS1 (Proteintech, 55041-1-AP), and HRAS (Proteintech, 15531-1-AP). After three washes with TBST, the membranes were incubated with HRP-conjugated goat anti-mouse IgG (diluted 1:5000) (CST, #7074) at room temperature for 1 hour. After washing with TBST, protein bands were visualized using an ECL detection kit (Bio-Rad, 170\u0026ndash;5061).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 Hematoxylin and Eosin (H\u0026amp;E) Staining\u003c/h2\u003e\u003cp\u003eTumor tissues were cut into 5 \u0026micro;m thick sections and sequentially processed for dewaxing. Sections were stained with hematoxylin for 40 seconds, followed by a brief wash and staining with eosin solution (Shanghai Kehui Biotechnology Co., Ltd.) for 3 seconds. After washing with tap water, tissues were dehydrated and cleared, followed by mounting with neutral resin. Tissue morphology was observed under a light microscope (Motice), and images were captured.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8 TUNEL Staining\u003c/h2\u003e\u003cp\u003eTissue samples were fixed in 10% phosphate-buffered formalin for 24 hours, embedded in paraffin, and sectioned into 4\u0026ndash;5 \u0026micro;m thin slices. TUNEL staining was performed using the TUNEL BrightGreen Apoptosis Detection Kit (Roche, Switzerland) according to the manufacturer\u0026rsquo;s instructions. Apoptotic cells were labeled with green fluorescence, and tumor cell nuclei were counterstained with DAPI. Images of tumor tissues were captured using a confocal microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9 CCK-8 Assay\u003c/h2\u003e\u003cp\u003eFor cell proliferation analysis, transfected cells were seeded at a density of 3 \u0026times; 10\u0026sup3; cells per well in a 96-well plate. After incubation for 3 hours with 10 \u0026micro;L of CCK-8 solution (HYCEZMBIO, China), the optical density at 450 nm was measured using a spectrophotometer to assess cell proliferation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10 Flow Cytometry\u003c/h2\u003e\u003cp\u003eApoptosis was assessed using an Annexin V-FITC/PI apoptosis detection kit (Sigma, USA) according to the manufacturer's instructions. Cells were collected and washed twice with PBS, then labeled in 500 \u0026micro;L of 1X binding buffer, with 5 \u0026micro;L of Annexin V-FITC and 10 \u0026micro;L of PI added. After a 5-minute incubation in the dark, apoptosis was analyzed by flow cytometry.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11 Transwell Migration Assay\u003c/h2\u003e\u003cp\u003eFor cell migration analysis, transfected cells were collected and washed three times with serum-free medium. A total of 1 \u0026times; 10⁵ cells were resuspended in 100 \u0026micro;L serum-free medium and added to the upper chamber of a 24-well Transwell plate. The lower chamber contained 500 \u0026micro;L complete medium. After incubation at 37\u0026deg;C, cells that migrated to the lower chamber were fixed with methanol and stained with crystal violet (Sigma, USA). After drying, the membranes were mounted with neutral resin, and the number of migrated cells was counted under a microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.12 Scratch Assay\u003c/h2\u003e\u003cp\u003eCervical cancer cells were seeded in 6-well plates and cultured until they reached 100% confluence. A scratch was made using a 20 \u0026micro;L pipette tip. The medium was replaced with serum-free medium, and images were captured at 0, 24, 48, and 72 hours post-scratching to monitor wound healing.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e2.13 Tumor Spheroid Formation Assay\u003c/h2\u003e\u003cp\u003eCells from each group were seeded at a density of 2.5 \u0026times; 10⁵ cells per well in a 24-well plate and cultured in medium containing 20 ng/mL EGF, 20 ng/mL FGF, and 2% B-27 for 7 days to induce spheroid formation. Images were captured using an inverted microscope, and the number of spheroids was counted. The assay was performed in triplicate.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e2.14 Dual-Luciferase Reporter Assay\u003c/h2\u003e\u003cp\u003eOn the day prior to transfection, cells in the logarithmic growth phase were collected and resuspended. A total of 1 \u0026times; 10⁵ cells per well were seeded in a 24-well plate. Transfection was performed using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer\u0026rsquo;s protocol. Dual-luciferase activity was measured 48 hours post-transfection using the Dual-Luciferase Reporter Assay System (Promega, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e2.15 Statistical Analysis\u003c/h2\u003e\u003cp\u003eAll data were processed using GraphPad Prism 9 software. For statistical analysis, normally distributed data were expressed as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. One-way analysis of variance (ANOVA) was used to compare mean differences among multiple groups. P values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered to be statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Result","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Expression of SHP2 and JAK1 in Cervical Cancer and Paracancerous Tissues\u003c/h2\u003e\u003cp\u003eTo investigate the differential expression of SHP2 and JAK1 in cervical cancer tissues compared to paracancerous tissues, we performed immunohistochemical (IHC) staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). In paracancerous tissues, both SHP2 and JAK1 exhibited weak and diffuse staining with low intensity, indicating low expression levels of these proteins. In contrast, cervical cancer tissues displayed significantly enhanced staining for both SHP2 and JAK1, suggesting a marked increase in their expression levels. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB shows a comparative analysis of SHP2 and JAK1 expression levels between paracancerous tissues and cervical cancer tissues. Statistical analysis revealed that, compared to paracancerous, the expression of SHP2 and JAK1 was significantly upregulated in cervical cancer tissues (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Effects of SHP2 Gene Silencing and Overexpression on Cervical Cancer Cell Behavior\u003c/h2\u003e\u003cp\u003eTo investigate the effects of SHP2 gene silencing and overexpression on cervical cancer cell behavior, we performed flow cytometry, wound healing, and Transwell migration assays. Flow cytometry results (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) showed that, compared to the pcDNA-NC group, the early apoptosis rate in the pcDNA-SHP2 group was significantly reduced to 0.12%. In contrast, the early apoptosis rate in the si-SHP2 group significantly increased to 47.7% compared to si-NC (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). No significant difference was observed between the control, pcDNA-NC, and si-NC groups. Wound healing assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD) confirmed the impact of SHP2 on cell migration. The wound closure rate at 0, 24, 48, and 72 hours in the pcDNA-SHP2 group was significantly higher than in the pcDNA-NC group, whereas the si-SHP2 group showed a significantly reduced wound closure rate (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), indicating that SHP2 overexpression significantly enhances cell migration. Transwell migration assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF) further supported these findings. The number of transmembrane cells in the pcDNA-SHP2 group was significantly increased, while the number in the si-SHP2 group was significantly reduced (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). These results suggest that SHP2 overexpression significantly inhibits cell apoptosis, while SHP2 silencing promotes cell apoptosis.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Effect of SHP2 Gene Silencing and Overexpression on Apoptosis-Related Proteins\u003c/h2\u003e\u003cp\u003eWestern blot analysis revealed that the expression regulation of SHP2 significantly affects the levels of downstream apoptosis and signaling proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Specifically, compared to the pcDNA-NC group, the pcDNA-SHP2 group showed upregulation of the anti-apoptotic protein Bcl-2 and downregulation of pro-apoptotic proteins Bax and Caspase 3. Conversely, compared to the si-NC group, si-SHP2 cells exhibited reduced Bcl-2 expression and increased Bax and Caspase 3 levels. In terms of signaling proteins, the expression of key JAK-STAT pathway proteins, including JAK1, JAK2, TYK2, as well as SOS1 and HRAS, was lower in the pcDNA-SHP2 group, while expression was elevated in the si-SHP2 cells. These results further confirm that overexpression of SHP2 inhibits apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), whereas its silencing promotes apoptosis, and that SHP2 plays a regulatory role in the JAK-STAT signaling pathway.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Effect of SHP2 on Tumor Growth and Inflammatory Cytokine Levels\u003c/h2\u003e\u003cp\u003eTo investigate the effect of SHP2 expression on tumor growth and related mechanisms in a mouse model, a subcutaneous xenograft model of cervical cancer in nude mice was established. TUNEL staining results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE) showed that compared to the sh-NC group, the sh-SHP2 group exhibited a significant increase in the number of positive cells (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01), indicating that SHP2 inhibits tumor cell apoptosis. HE staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF) further confirmed that compared to the sh-NC group, the sh-SHP2 group exhibited more disorganized and less dense cell arrangement, suggesting that tumor proliferation was inhibited. ELISA results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG) showed that compared to the sh-NC group, serum levels of inflammatory cytokines (TNF-α, IL-1β, IL-6, and IL-12) were significantly reduced in the sh-SHP2 group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Regulation of the JAK/STAT Signaling Pathway by SHP2\u003c/h2\u003e\u003cp\u003eWestern blot and qPCR were performed to validate the regulatory effect of SHP2 on the JAK/STAT signaling pathway. Western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB) showed that, compared with the sh-NC group, SHP2 expression was significantly downregulated in the sh-SHP2 group, and the expression levels of key JAK/STAT signaling molecules, including STAT1, JAK1, JAK2, and TYK2, were significantly reduced. Additionally, the protein expression of IL-2 was also significantly decreased (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). qPCR results (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC) further confirmed that the mRNA levels of STAT1, JAK1, JAK2, TYK2, and IL-2 were significantly downregulated in the sh-SHP2 group compared to the sh-NC group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003e3.6 miR-590 Targets SHP2 and Participates in Molecular Regulation of Cervical Cancer\u003c/h2\u003e\u003cp\u003eTo investigate the potential role of miR-590 in cervical cancer, bioinformatics analysis was first performed, revealing a high expression pattern of miR-590 in cervical cancer tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Correlation analysis further demonstrated a significant association between the expression of miR-590 and SHP2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). To validate the interaction between miR-590 and SHP2, a dual-luciferase reporter assay was conducted (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF), which showed that miR-590 can directly target SHP2 and regulate its expression.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003e3.7 miR-590 Targets SHP2 and Regulates Cell Behavior\u003c/h2\u003e\u003cp\u003eTo investigate the targeted regulation of SHP2 by miR-590 and its impact on cell survival, apoptosis, migration, and spheroid formation, we conducted CCK-8, flow cytometry, scratch assay, Transwell migration assay, and spheroid formation assays. Flow cytometry results (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) showed that, compared to the control group, ov-miR-590 significantly increased the cell apoptosis rate, while ov-SHP2 significantly decreased the apoptosis rate. In the ov-miR-590\u0026thinsp;+\u0026thinsp;ov-SHP2 co-transfection group, apoptosis was significantly reduced compared to the ov-miR-590 group, and significantly increased compared to the ov-SHP2 group, approaching the control group levels. CCK-8 assay results (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC) revealed that cell viability was significantly reduced in the ov-miR-590 group compared to the control, while ov-SHP2 increased cell viability. The cell survival rate in the ov-miR-590\u0026thinsp;+\u0026thinsp;ov-SHP2 co-transfection group restored to near control levels, suggesting that miR-590 inhibits cell survival through suppression of SHP2, and further confirming the protective role of SHP2 in miR-590-mediated apoptosis regulation. Scratch and Transwell migration assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE) indicated that the migration ability was significantly reduced in the ov-miR-590 group compared to the control, while ov-SHP2 enhanced cell migration. The migration ability in the ov-miR-590\u0026thinsp;+\u0026thinsp;ov-SHP2 co-transfection group was restored compared to the ov-miR-590 group, suggesting that SHP2 can reverse the inhibitory effect of miR-590 on cell migration. Transwell migration assays further supported these results (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). Spheroid formation assays confirmed the impact of miR-590 on spheroid formation. The results showed that the number of spheroids was significantly reduced in the ov-miR-590 group compared to the control, while ov-SHP2 significantly increased the spheroid count. In the ov-miR-590\u0026thinsp;+\u0026thinsp;ov-SHP2 co-transfection group, spheroid formation was significantly restored compared to the ov-miR-590 group.These results demonstrate that miR-590 significantly reduces cell survival, enhances apoptosis, and inhibits migration and spheroid formation by targeting SHP2, highlighting the critical protective role of SHP2 in regulating miR-590-mediated cell biological behaviors.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section2\"\u003e\u003ch2\u003e3.8. miR-590 Targeting SHP2 Regulates Key Proteins in the JAK-STAT Signaling Pathway\u003c/h2\u003e\u003cp\u003eTo investigate the regulatory effect of miR-590 on key proteins in the JAK-STAT signaling pathway, Western blot analysis was performed (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e) to assess the expression of SHP2, STAT1, IL-2, JAK1, JAK2, and TYK2 in different treatment groups. The results revealed that SHP2 protein expression was significantly downregulated in the ov-miR-590 group, while in the ov-miR-590\u0026thinsp;+\u0026thinsp;ov-SHP2 co-transfection group, SHP2 expression approached control levels, indicating that miR-590 suppresses SHP2 expression. Furthermore, among key proteins in the JAK-STAT pathway, the expression of STAT1, IL-2, JAK1, JAK2, and TYK2 was significantly downregulated in the ov-miR-590 group compared to control. In contrast, ov-SHP2 significantly upregulated the expression of these proteins, and in the ov-miR-590\u0026thinsp;+\u0026thinsp;ov-SHP2 co-transfection group, their expression levels were restored to near control values. These findings suggest that miR-590 may regulate the JAK-STAT signaling pathway by targeting SHP2 and modulating the expression of several key proteins.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eCervical cancer is one of the most common malignant tumors in women, and its development involves multiple signaling pathways and molecular regulations\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. In recent years, microRNAs (miRNAs), as post-transcriptional regulatory factors, have been widely studied for their role in the progression of cervical cancer. This study reveals that miR-590 targets SHP2 and activates the JAK-STAT signaling pathway to promote cervical cancer cell proliferation and tumor formation, providing new insights for cervical cancer treatment. SHP2, a protein tyrosine phosphatase, plays an important role in cell signaling regulation. The JAK-STAT signaling pathway is a well-established pathway involved in regulating cell proliferation and apoptosis, and its abnormal activation has been validated in various malignancies\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Previous studies have demonstrated that the inhibition of SHP2 phosphatase activates the JAK/STAT signaling pathway, exerting regulatory effects on cancer cells\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Therefore, this study verifies the regulatory role of SHP2 in cervical cancer biological behaviors and its impact on the JAK-STAT signaling pathway through both in vitro and in vivo experimental systems. The results show that the overexpression of SHP2 significantly enhanced cell migration and activated the JAK-STAT signaling pathway while inhibiting apoptosis, thereby playing a crucial role in regulating cell behaviors. In the mouse model, inhibiting SHP2 expression promoted apoptosis, suppressed the JAK-STAT signaling pathway, and significantly reduced the levels of inflammatory cytokines. Previous studies have shown that SHP2 is upregulated in cervical cancer, and on one hand, silencing SHP2 in HeLa and SiHa cells inhibits cell growth and migration and increases sensitivity to cisplatin\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. On the other hand, SHP2 overexpression is associated with lymph node metastasis and high HPV DNA, promoting the occurrence and development of cervical cancer. Yang et al.\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e introduced the SHP2 E76K mutation in glioblastoma cells, and the activated mutant enhanced cell proliferation, migration, and invasion in vitro, promoting tumor growth in xenograft models. Zhao et al.\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e studied conditional SHP2 knockout in ErbB2 transgenic mice and its effect on HER2-amplified breast cancer cells, and found that SHP2 knockout blocked ErbB2 overexpression, induced normal cell phenotypes, and inhibited tumorigenesis and metastasis. Therefore, excessive activation of SHP2 can promote cancer development.\u003c/p\u003e\u003cp\u003eMiR-590, a key regulatory factor, has been reported to play an oncogenic role in various cancers\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. In this study, bioinformatics analysis combined with dual-luciferase reporter assays verified that miR-590 is an upstream regulator of SHP2, providing evidence for the further exploration of miR-590's oncogenic mechanisms. Through experiments with ov-miR-590, ov-SHP2, and ov-miR-590\u0026thinsp;+\u0026thinsp;ov-SHP2, we validated the targeted regulation of miR-590 on SHP2 and its effect on cell behavior as well as the JAK-STAT signaling pathway. The results show that overexpression of miR-590 significantly decreased cell survival rate, migration ability, and spheroid formation, while enhancing cell apoptosis. Moreover, SHP2 could significantly reverse the inhibitory effect of miR-590 on cell migration, thereby promoting tumor spheroid formation. Additionally, miR-590 suppressed the expression of key proteins in the JAK-STAT signaling pathway, such as STAT1, IL-2, JAK1, JAK2, and TYK2, while the co-transfection group of ov-miR-590\u0026thinsp;+\u0026thinsp;ov-SHP2 restored the expression of these proteins to levels similar to the control group, indicating that miR-590 negatively regulates the JAK-STAT signaling pathway through targeting SHP2. In gastric cancer, miR-590 inhibits tumor invasion and metastasis by suppressing VEGFR1/2 and NRP1 expression; in non-small cell lung cancer, miR-590 significantly inhibits cell proliferation and migration by suppressing YAP1 and the Wnt/β-catenin signaling pathway\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. In osteosarcoma, overexpression of miR-590-3p also increases cell apoptosis and inhibits cell proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT)\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. In breast cancer, overexpression of miR-590-3p inhibited the proliferation of MDA-MB-231 and MCF-7 cells. Rescue experiments indicated that overexpression of GOLPH3 significantly restored the proliferation inhibited by miR-590-3p\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. These results suggest that miR-590 may act as a universal anticancer factor, participating in the regulation of multiple signaling pathways and exerting its effects through its target genes. In cervical cancer, miR-590 upregulation significantly inhibits cell proliferation and migration and regulates the JAK-STAT signaling pathway by affecting SHP2, thereby having profound effects on cell behavior.\u003c/p\u003e\u003cp\u003eIn conclusion, this study first demonstrates the mechanism by which miR-590 targets SHP2 to regulate the JAK-STAT signaling pathway in cervical cancer cells, providing a new theoretical basis for molecular therapy of cervical cancer. Strategies based on the expression regulation of miR-590 may offer new opportunities for personalized treatment of cervical cancer, improving patient prognosis and reducing cancer-related mortality.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u0026nbsp;\u003c/strong\u003eThe data presented in this study are available on request from the corresponding author.\u003cbr\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u0026nbsp;\u003c/strong\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis work was supported by Qingdao Natural Science Foundation (no. 25-1-1-149-zyyd-jch).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u0026nbsp;\u003c/strong\u003eThe study was approved by Animal Experimental Ethical Inspection of Shenyang Medical University of TCM (protocol code SYYXY2023070102) and the Institutional Review Board of the Affiliated Hospital of Qingdao University (committee numbers QYFYWZLL28789).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatement:\u0026nbsp;\u003c/strong\u003ewe confirmed our study is reported in accordance with ARRIVE guidelines.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions:\u0026nbsp;\u003c/strong\u003eConceptualization: Yong Li and PengMing Sun; Data curation: XiuLan Weng and XiuMei Li; Formal analysis: Yong Li and XiuMei Li; Funding acquisition: PengMing Sun and YuChao Diao; Investigation: Yong Li, LiMin Zhang and XiaoTong Zhu; Methodology: Yong Li, YuChao Diao and PengMing Sun; Project administration: Yong Li and XiuMei Li; Software: XiuMei Li and XiuLan Weng; Supervision: PengMing Sun; Validation: XiuMei Li, XiuLan Weng and XiaoTong Zhu; Visualization: XiuMei Li; Writing – original draft: Yong Li and XiuMei Li; Writing – review \u0026amp; editing: PengMing Sun. All authors have read and approved the final manuscript.\u003cbr\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBuskwofie, A., David-West, G. \u0026amp; Clare, C. A. A Review of Cervical Cancer: Incidence and Disparities. \u003cem\u003eJ. Natl. Med. Assoc.\u003c/em\u003e \u003cb\u003e112\u003c/b\u003e (2), 229\u0026ndash;232 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBray, F. et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. \u003cem\u003eCA Cancer J. Clin.\u003c/em\u003e \u003cb\u003e71\u003c/b\u003e (3), 209\u0026ndash;249 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAsmamaw, M. D., Shi, X. J., Zhang, L. R. \u0026amp; Liu, H. M. A comprehensive review of SHP2 and its role in cancer. \u003cem\u003eCell. Oncol. (Dordr)\u003c/em\u003e. \u003cb\u003e45\u003c/b\u003e (5), 729\u0026ndash;753 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, Q., Qu, J., Zhao, M., Xu, Q. \u0026amp; Sun, Y. Targeting SHP2 as a promising strategy for cancer immunotherapy. \u003cem\u003ePharmacol. Res.\u003c/em\u003e \u003cb\u003e152\u003c/b\u003e, 104595 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYuan, Y. et al. SHP2 promotes proliferation of breast cancer cells through regulating Cyclin D1 stability via the PI3K/AKT/GSK3β signaling pathway. \u003cem\u003eCancer Biol. Med.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e (3), 707\u0026ndash;725 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMi, D., Li, Y. \u0026amp; Chen, Y. Small-molecule Modulators Targeting SHP2 for Cancer Therapy. \u003cem\u003eAnticancer Agents Med. Chem.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e (5), 498\u0026ndash;504 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBartel, D. P. MicroRNAs: target recognition and regulatory functions. \u003cem\u003eCell\u003c/em\u003e \u003cb\u003e136\u003c/b\u003e (2), 215\u0026ndash;233 (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFeng, Z. Y. et al. miR-590-3p promotes colon cancer cell proliferation via Wnt/β-catenin signaling pathway by inhibiting WIF1 and DKK1. \u003cem\u003eEur. Rev. Med. Pharmacol. Sci.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e (21), 4844\u0026ndash;4852 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShi, Z. et al. miRNA-590 promotes colorectal cancer growth via PI3K/AKT pathway. \u003cem\u003eCancer Biol. Ther.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e (7), 599\u0026ndash;608 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXin, P. et al. The role of JAK/STAT signaling pathway and its inhibitors in diseases. \u003cem\u003eInt. Immunopharmacol.\u003c/em\u003e \u003cb\u003e80\u003c/b\u003e, 106210 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXue, C. et al. Evolving cognition of the JAK-STAT signaling pathway: autoimmune disorders and cancer. \u003cem\u003eSignal. Transduct. Target. Ther.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e (1), 204 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShao, F., Pang, X. \u0026amp; Baeg, G. H. Targeting the JAK/STAT Signaling Pathway for Breast Cancer. \u003cem\u003eCurr. Med. Chem.\u003c/em\u003e \u003cb\u003e28\u003c/b\u003e (25), 5137\u0026ndash;5151 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu, D. et al. Long noncoding RNA PART1 promotes progression of non-small cell lung cancer cells via JAK-STAT signaling pathway. \u003cem\u003eCancer Med.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e (13), 6064\u0026ndash;6081 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eErdogan, F. et al. JAK-STAT core cancer pathway: An integrative cancer interactome analysis. \u003cem\u003eJ. Cell. Mol. Med.\u003c/em\u003e \u003cb\u003e26\u003c/b\u003e (7), 2049\u0026ndash;2062 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFu, K. et al. MiR-125 inhibited cervical cancer progression by regulating VEGF and PI3K/AKT signaling pathway. \u003cem\u003eWorld J. Surg. Oncol.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e (1), 115 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXue, C. et al. Evolving cognition of the JAK-STAT signaling pathway: autoimmune disorders and cancer. \u003cem\u003eSignal. Transduct. Target. Ther.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e (1), 204 (2023). Published 2023 May 19.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIgbe, I. et al. Dietary quercetin potentiates the antiproliferative effect of interferon-α in hepatocellular carcinoma cells through activation of JAK/STAT pathway signaling by inhibition of SHP2 phosphatase. \u003cem\u003eOncotarget\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e (69), 113734\u0026ndash;113748 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCao, M. et al. Shp2 expression is upregulated in cervical cancer, and Shp2 contributes to cell growth and migration and reduces sensitivity to cisplatin in cervical cancer cells. \u003cem\u003ePathol. Res. Pract.\u003c/em\u003e \u003cb\u003e215\u003c/b\u003e (11), 152621 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang, F. et al. Gain-of-function E76K-Mutant SHP2 Promotes Cell Proliferation, Metastasis, And Tumor Growth In Glioblastoma Through Activation Of The ERK/CREB Pathway. \u003cem\u003eOnco Targets Ther.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 9435\u0026ndash;9447 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao, H. et al. Conditional knockout of SHP2 in ErbB2 transgenic mice or inhibition in HER2-amplified breast cancer cell lines blocks oncogene expression and tumorigenesis. \u003cem\u003eOncogene\u003c/em\u003e \u003cb\u003e38\u003c/b\u003e (13), 2275\u0026ndash;2290 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBarwal, T. S. et al. miR-590-5p: A double-edged sword in the oncogenesis process. \u003cem\u003eCancer Treat. Res. Commun.\u003c/em\u003e \u003cb\u003e32\u003c/b\u003e, 100593 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMei, B., Chen, J., Yang, N. \u0026amp; Peng, Y. The regulatory mechanism and biological significance of the Snail-miR590-VEGFR-NRP1 axis in the angiogenesis, growth and metastasis of gastric cancer. \u003cem\u003eCell. Death Dis.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e (4), 241 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHao, X. \u0026amp; Su, A. MiR-590 suppresses the progression of non-small cell lung cancer by regulating YAP1 and Wnt/β-catenin signaling. \u003cem\u003eClin. Transl Oncol.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e (3), 546\u0026ndash;555 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao, H., Wang, Y., Hou, W., Ding, X. \u0026amp; Wang, W. Long non-coding RNA MALAT1 promotes cell proliferation, migration and invasion by targeting miR-590-3p in osteosarcoma. \u003cem\u003eExp. Ther. Med.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e (5), 672 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSong, Q. et al. ATF-3/miR-590/GOLPH3 signaling pathway regulates proliferation of breast cancer. \u003cem\u003eBMC Cancer\u003c/em\u003e. \u003cb\u003e18\u003c/b\u003e (1), 255 (2018).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"miRNA-590, SHP2, JAK-STAT, Cervical cancer","lastPublishedDoi":"10.21203/rs.3.rs-8106230/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8106230/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e\u003cp\u003eTo investigate the mechanism by miRNA-590 targets SHP2 to regulate the JAK-STAT signaling pathway, thereby promoting cell proliferation and tumor formation in cervical cancer.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eImmunohistochemistry was employed to assess the expression levels of SHP2 and JAK1 in cervical cancer tissues and analyze their correlation with clinical pathological features. RNA interference and overexpression techniques were used to silence and overexpress SHP2, respectively, to evaluate its impact on cell proliferation, migration, and apoptosis in cervical cancer cells. Western blot and qPCR were utilized to examine the regulatory effect of SHP2 on the JAK-STAT signaling pathway. Further, the effect of miR-590 overexpression on cervical cancer cell proliferation, migration, and JAK-STAT signaling was investigated.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eImmunohistochemical analysis revealed that SHP2 and JAK1 were significantly upregulated in cervical cancer tissues, and high expression of SHP2 was strongly correlated with tumor stage and size. Cell experiments showed that overexpression of SHP2 significantly promoted cell proliferation and migration while inhibiting apoptosis, whereas SHP2 silencing suppressed these behaviors and promoted apoptosis. Western blot and qPCR analyses further confirmed that SHP2 activated the JAK1-STAT3 signaling pathway to enhance cell survival and migration. Animal model experiments supported the findings of the cell-based assays. Additionally, miR-590 was found to directly target SHP2, downregulating its expression and significantly inhibiting cervical cancer cell proliferation and migration.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eSHP2 promotes cell proliferation, migration, and apoptosis resistance in cervical cancer by activating the JAK-STAT signaling pathway. miR-590 exerts its anti-cancer effects by downregulating SHP2 expression, providing a potential therapeutic strategy for cervical cancer.\u003c/p\u003e","manuscriptTitle":"MiR-590 Targets SHP2 to Promote Cervical Cancer Proliferation and Tumor Formation through Regulation of the JAK-STAT Signaling Pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-05 06:54:43","doi":"10.21203/rs.3.rs-8106230/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"678d8826-4eca-4e33-9dd2-a27c860d33c7","owner":[],"postedDate":"December 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":59036861,"name":"Biological sciences/Cancer"},{"id":59036862,"name":"Biological sciences/Cell biology"},{"id":59036863,"name":"Biological sciences/Molecular biology"},{"id":59036864,"name":"Health sciences/Oncology"}],"tags":[],"updatedAt":"2026-04-20T06:57:05+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-05 06:54:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8106230","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8106230","identity":"rs-8106230","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}