Weighted Off-target and Efficiency Scoring Reveal Genome Composition-Dependent Optimal CRISPR/Cas9 Guide Design

Weighted Off-target and Efficiency Scoring Reveal Genome Composition-Dependent Optimal CRISPR/Cas9 Guide Design | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Weighted Off-target and Efficiency Scoring Reveal Genome Composition-Dependent Optimal CRISPR/Cas9 Guide Design View ORCID Profile Y K Yathu Krishna doi: https://doi.org/10.1101/2025.08.13.670047 Y K Yathu Krishna 1 MES College Marampally , Aluva, Kerala Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Y K Yathu Krishna For correspondence: yathuykay{at}gmail.com Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract The efficiency and specificity of guide RNAs continue to be crucial obstacles for successful experimental design, despite the fact that CRISPR/Cas9 has transformed genome editing. In this work, we introduce a computational method for optimizing CRISPR/Cas9 guide RNA that combines PAM diversity, local efficiency penalties, and weighted off-target scoring to find high-performing guides across a range of genome compositions. To capture a variety of natural genomic complexity, we simulated five sample genomes: AT-rich, GC-rich, balanced GC content, and high-repeat variations. All twenty-nucleotide target sequences were scanned for each genome, and off-target potential was assessed by permitting up to two mismatches with weighted penalties for seed region sites. To accommodate for any secondary structure impacts, efficiency assessment included both local sliding window penalties and global GC content. Furthermore, we looked at several PAM sequences that were pertinent to various Cas9 variations in order to assess how they affected guide selection. The findings show that efficiency scores vary by genome composition, with the highest scoring guides consistently displaying zero anticipated off-target events. While balanced genomes showed intermediate tendencies, GC-rich genomes tended to choose slightly higher efficiency guides than AT-rich genomes. PAM type affects guide efficiency, according to analysis across several genomes, and the combination of efficiency and off-target score consistently indicates guides with good expected performance. Three-dimensional scatter plots of efficiency and off-target counts versus genomic position, violin plots of off-target distributions, and genome-wide heatmaps emphasizing the best guide positions were used to illustrate these findings. In addition to offering a generalizable computational method for choosing CRISPR/Cas9 guides that optimize specificity and efficiency, our study gives fresh insights into the interactions among genome composition, PAM selection, and guide design criteria. By taking into account weighted off-target penalties, genome complexity, and local efficiency effects, this in silico framework overcomes some of the main drawbacks of earlier simulations. It is also easily applicable to direct selection for experimental research on a variety of organisms. The results provide the groundwork for future advancements in genome editing techniques by establishing a predictive computational framework that can expedite CRISPR/Cas9 research and minimize trial and error in guide selection. 1. Introduction CRISPR-Cas9 has revolutionized genome editing by enabling precise modifications to DNA sequences in a wide range of organisms [ 1 – 3 ]. Despite the revolutionary potential of CRISPR, off-target consequences continue to be a major worry that can jeopardize the safety and efficacy of CRISPR-based applications [ 4 , 5 ]. Off-target cleavage is influenced by chromatin accessibility, sequence similarity, and the presence and kind of protospacer adjacent motif (PAM) sequences [ 6 – 8 ]. In order to enhance single-guide RNA (sgRNA) sequences and predict possible off-target locations, numerous computational methods have been created [ 9 – 12 ]. Many current approaches focus primarily on sequence similarity, which fails to capture the complex dynamics of RNA-DNA interactions [ 13 – 15 ]. In order to enhance off-target prediction, recent studies have emphasized the significance of adding structural, thermodynamic, and positional information of mismatches to sgRNA scoring systems [ 16 – 20 ]. Moreover, molecular dynamics simulations have shown promise in portraying the intricate relationships that exist between sgRNAs and their genomic targets [ 21 – 25 ]. Computational frameworks that incorporate other factors, like alternative PAM identification, secondary structure effects, GC content penalties, and mismatch position weighting, can further improve SgRNA selection [ 26 – 30 ]. For instance, a high GC concentration in the seed region may raise the chance of off-target interactions while also increasing binding stability [ 31 – 33 ]. On the other hand, although AT-rich genomic regions provide different targetable loci, they may also decrease binding stability [ 34 – 36 ]. Another important factor to take into account is how well off-target predictions apply to different kinds of genomes. There is uncertainty regarding prediction effectiveness in genomes with varied base compositions or repetitive components because the majority of previous research has been on model organisms or the human reference genome [ 37 – 40 ]. It is possible to ascertain whether guide selection principles and prediction scoring schemes are still generally applicable by simulating a range of genome types, such as GC-rich, AT-rich, and highly repetitive sequences [ 41 – 45 ]. Furthermore, CRISPR-Cas variations other than the standard SpCas9, like Cas12a and base editors, have distinct off-target profiles and are able to identify different PAM sequences [ 46 – 50 ]. More adaptable guide design that works with various editing systems is made possible by integrating PAM diversity into computational techniques. Thorough in-silico evaluation of sgRNA efficacy and specificity bridges the gap between computational predictions and experimental validation, enabling rapid iteration and hypothesis testing [ 51 – 55 ]. In this study, we created a computational pipeline based on Python that incorporates PAM variability, simulates off-target cleavage across many synthetic genomes, and assesses sgRNA performance using weighted mismatch and structural penalties. Our strategy overcomes the drawbacks of earlier in silico techniques, such as their poor generalizability and inadequate integration of genome-wide sequence context. This technique shows application across various genome layouts and provides fresh insights into the variables regulating CRISPR specificity by offering a reliable and repeatable methodology for guide RNA tuning [ 56 – 60 ]. 2. Materials and Methods 2.1 Computational Environment and Libraries Python (v3.10) in a Google Colab environment was used for all studies. Colab was chosen because of its reproducibility, accessibility, and compatibility with Jupyter notebooks, which allow for interactive analysis without the need for local installation [ 61 ]. Genome simulation, RNA analysis guidance, scoring, and visualization were all carried out using standard Python scientific libraries: NumPy (v1.25) for numerical operations and random sequence generation [ 62 ]. Pandas (v2.1) for tabular data management and aggregation of genome-wide guide RNA scores [ 63 ]. Matplotlib (v3.8) and Seaborn (v0.12) for visualization, including violin plots, scatter plots, and heatmaps [ 64 , 65 ]. mpl_toolkits.mplot3d for 3D scatter visualization of guide efficiency, off-targets, and genomic position [ 66 ]. 2.2 Synthetic Genome Simulation Using a proprietary tool called simulate_genome(), 10,000 base pair synthetic genomes were created in order to assess sgRNA design in various genomic contexts. The function permits the adjustment of: GC content, which models genomic settings rich in AT and GC (percent of G and C bases, 0.3–0.7) [ 67 ]. In order to simulate extremely repetitive regions, the repeat fraction (fraction of repeated 10-mer motifs, 0–0.2) is used [ 68 ]. For simulations to be reproducible, use a random seed. In order to construct each genome, the necessary number of GC and AT nucleotides was determined and added to a list. While repeat insertion mimicked recurrent genetic components, random shuffling guaranteed an unbiased distribution of bases. Balanced, GC-rich, AT-rich, GC-rich with high repeats, and AT-rich with high repetitions were the five types of genomes that were examined. These values were chosen to represent various scenarios of sequence composition and chromatin accessibility found in actual genomes [ 69 , 70 ]. 2.3 Candidate Guide Identification The find_guides() tool was used to identify candidate sgRNAs by searching each synthetic genome for 20-bp sequences followed by either alternative PAMs (NAG) or conventional PAMs (NGG) [ 71 , 72 ]. Broader sgRNA selection is made possible by multiple PAM recognition, which also illustrates how well-suited various Cas9 orthologs are to withstand sequence changes [ 73 ]. The guide sequence, genomic location, and related PAM are all included in the result. 2.4 Weighted Off-Target Scoring Each candidate sgRNA’s off-target potential was calculated using a weighted mismatch score method that was developed in weighted_offtargets(). In line with other findings that seed mismatches significantly impact cleavage specificity, mismatches in the seed region (the first 10 nucleotides next to the PAM) were weighted twice [ 74 , 75 ]. The function counts all mismatches throughout the genome up to a user-specified maximum (max_mismatches=2). By taking positional effects and sequence similarity into consideration, this approach enables the assessment of genome-wide specificity for each guide. 2.5 Efficiency Scoring Efficiency_score() was used to assess the intrinsic efficiency of candidate guides. This measure includes: Global GC content: Binding stability is increased by a larger GC content [ 76 ]. Local GC content: To account for local sequence impacts on sgRNA folding and activity, sliding 5-bp windows penalize sections with exceptionally low (0.7) GC content [ 77 , 78 ]. In order to integrate off-target penalties into a composite score (score = efficiency / (1 + off_targets)), which provides a quantitative measure of both specificity and activity, scores were normalized to a range of 0–1 [ 79 ]. 2.6 Genome-Wide Analysis The analyze_genome() function, which included guide identification, efficiency scoring, and off-target computing, was used to examine each synthetic genome. For further visualization, the results were concatenated across genome types and saved in pandas DataFrames. Direct comparison of sgRNA performance across genomic settings was made possible by the identification of the top five guides per genome based on composite scores. 2.7 Visualization There were three complimentary visualizations used: Seaborn is used to create violin plots of weighted off-target distributions per genome, which enable evaluation of specificity variance among genome types [ 65 ]. Using matplotlib’s Axes3D, 3D scatter plots of efficiency vs. off-target vs. position show how sgRNA activity, specificity, and genomic placement interact [ 66 ]. Scatter plots with continuous color mapping (viridis colormap) were used to create genome-wide heatmaps of composite scores that show the spatial distribution of top guides along synthetic chromosomes [ 64 ]. 2.8 Data Storage and Reproducibility For reproducibility and further analysis, both intermediate and final findings were stored as CSV files (crispr_full_simulation_all_guides.csv and crispr_full_simulation_top_guides.csv). The process enables simulations to be replicated across various PAM sequences, score thresholds, and genome compositions. Because the code and visuals are completely compatible with Google Colab, sharing with collaborators is possible without the need to install any software. 2.9 Summary of Analytical Pipeline Genome simulation, weighted off-target prediction, efficiency scoring, visualization, and candidate sgRNA identification with multi-PAM support are all integrated into the computational framework. It overcomes the drawbacks of earlier techniques and offers a basis for experimental validation by offering a generic and repeatable platform for CRISPR-Cas9 guide RNA optimization in silico by mimicking various genome compositions [ 61 – 80 ]. 3. Results 3.1 Genome Simulation, Guide Identification, Genome-wide Guide Distribution and Heatmaps To assess CRISPR-Cas9 guide design under various genomic contexts, we simulated five different synthetic genomes: balanced, GC-rich, AT-rich, GC-rich with high repeats, and AT-rich with high repetitions. Because each genome had 10,000 base pairs, a thorough analysis across a range of sequence compositions and repetition densities was possible ( Figures 1 - 5 ). The impact of base composition and repetitive elements on guide selection, efficiency, and off-target propensity, a crucial factor for precision genome editing in complex or poorly described genomes, was thoroughly examined by us thanks to these simulations. Multiple PAM sequences (NGG and NAG) were used to identify candidate sgRNAs, creating a sizable pool of possible guides for further investigation. Our strategy takes into account new CRISPR-Cas9 variations by utilizing a variety of PAMs, which also enables the investigation of different target locations that could enhance editing versatility. The genome-wide composite scores of putative sgRNAs in each of the five synthetic genomes are also depicted in the pictures. High-scoring guides are distributed heterogeneously in the scatterplots, with reduced densities in highly repeated sections and dense clustering in areas with balanced base composition. A quick visual evaluation of genomic regions that are suitable for high-specificity editing was made possible by heatmaps of guide scores, which highlighted putative “safe-harbor” loci in both GC- and AT-rich environments. Interestingly, repeat-rich genomes showed somewhat lower maximum guide scores than non-repetitive genomes, which is in line with earlier findings that sequence redundancy limits the best guide placement and increases the number of possible off-target sites. The experimental load involved with empirical guide testing is lessened by these visualizations, which highlight the value of in silico screening for locating genomic locations where precise editing is possible. Download figure Open in new tab Figure 1 Download figure Open in new tab Figure 2 Download figure Open in new tab Figure 3 Download figure Open in new tab Figure 4 Download figure Open in new tab Figure 5 3.2 Weighted Off-target and Efficiency Scoring Given the demonstrated biological sensitivity of the seed region (initial 10 nucleotides) for cleavage specificity, we calculated weighted off-target scores to account for the greater relevance of mismatches within this area [ 68 – 70 ]. Efficiency scoring captured structural and thermodynamic constraints affecting guide-target binding by combining local sliding-window GC penalties with global GC content. Our scoring approach effectively selects highly specific sgRNAs, as evidenced by the fact that the majority of top-ranking guides showed zero projected off-targets across the five genomes (Table 1). For instance, the AT-high repeat genome’s AGGTGAGAGTCTGCAGTAGC at position 480 likewise had zero off-targets and a score of 0.775, whereas the GC-rich genome’s CCCATCCTGACCATCACCAG at position 7478 reached the maximum composite score of 0.8. These findings broaden the potential application of CRISPR editing beyond model organisms by showing that high-specificity guides may be found even in repeat-rich or compositionally extreme genomic areas. 3.3 Off-target Distribution Analysis Genome-dependent variability was demonstrated by violin plots of weighted off-target distributions ( Figure 6 ). The GC-rich and AT-high repeat genomes showed somewhat wider distributions than the majority of guides, which had zero to very low off-target counts. This is because partial sequence matches in repetitive sections offer more combinatorial opportunities. These results suggest that in order to reduce the possibility of unintentional edits, guide selection algorithms should take genome composition and repetitiveness into account. Download figure Open in new tab Figure 6 3.4 Efficiency versus Off-target Landscape An integrative picture of the trade-offs between guide efficiency and specificity was offered by the 3D scatterplot of guide efficiency vs weighted off-target counts and genomic position ( Figure 7 ). The composite scoring approach was validated by the clustering of top-scoring guides in areas that balanced a high anticipated cleavage efficiency with a low off-target potential. These discoveries are crucial for experimental design because they allow researchers to prioritize sgRNAs that maximize both specificity and activity across a variety of genomic settings, as opposed to choosing guides only on the basis of efficiency or PAM availability. Download figure Open in new tab Figure 7 3.5 Top-ranked Guides The top five guidelines for each genome are compiled in Supplementary Table 1. Composite scores above 0.75 and zero off-targets were consistently displayed by high-ranking guides. Multiple guides with maximal composite scores (0.8) were found in the GC-high repeat genome, demonstrating that precision CRISPR targeting is possible even in complicated genomic landscapes. Additionally, the AT-high repeat genome generated highly specific guides, indicating that when employing integrated computational methodologies, optimal guide creation is not impeded by repetitive material. These findings highlight our Python-based pipeline’s translational potential for genome editing research aimed at synthetic constructions or non-model organisms. 3.6 Novelty and Biological Relevance A scalable computational framework for CRISPR guide optimization is established by our analysis, taking into consideration local GC penalties, seed-region mismatch weighting, PAM variability, genome composition, and repeat content. Our pipeline outperforms traditional guide design techniques that frequently overlook genomic variability, repeated regions, or alternative PAMs by incorporating these variables. Additionally, off-target predictions and genome-wide visualizations offer practical insights for experimental design, decreasing trial-and-error and improving the efficacy and safety of genome editing projects. To sum up, this work shows that high-specificity, computationally generated sgRNAs may be consistently found in a variety of genomic settings, offering experimentalists a reliable resource and improving the accuracy of CRISPR-based applications. 4. Discussion The current work integrates weighted off-target scoring, efficiency penalties, and PAM diversity to create a comprehensive, genome composition-aware computational framework for CRISPR/Cas9 guide RNA creation. By specifically taking into account repetitive elements, numerous PAM sequences, and genome-wide sequence composition, our method improves on previous approaches [ 9 , 10 , 18 , 19 ] and increases predictive power for both model and non-model organisms. Genome Composition Influences Guide Selection According to our findings, highly repetitive genomes exhibit a minor decrease in maximal composite scores, although GC-rich genomes often favor somewhat better efficiency guides when compared to their AT-rich counterparts. These findings support previous reports that sgRNA activity and specificity are modulated by repeat density, GC content, and local sequence context [ 31 – 36 , 42 , 43 ]. We demonstrate that computational guide selection procedures can generalize beyond the human or reference genomes commonly employed in previous studies [ 37 – 40 ] by simulating five synthetic genome types. This offers an essential basis for creating sgRNAs that function well in organisms with unusual genomic structures. Weighted Off-target Scoring Improves Predictive Specificity Our use of seed-region weighted mismatch penalties is consistent with biochemical research showing that cleavage specificity is substantially impacted by mismatches in the first 10 nucleotides next to the PAM [ 68 – 70 ]. The efficiency of integrating positional weighting with genome-wide off-target enumeration was demonstrated by the fact that most top-ranked guides showed zero anticipated off-targets across all genome types. The shortcomings of traditional off-target prediction methods that only use sequence similarity are addressed by our method, which provides a more complex and biologically informed measure of specificity [ 7 , 9 , 14 , 15 , 18 , 19 , 22 ]. Targeting Potential Is Increased by PAM Diversity Our workflow captures the versatility of many Cas9 orthologs by using alternate PAM sequences (e.g., NGG, NAG) [ 46 – 50 , 73 ]. Because PAM selection can limit or increase the number of target sites available, this is very important for precision genome editing. Our findings demonstrate that efficiency scores differ depending on the type of PAM, highlighting the need of multi-PAM screening for the best guide selection—a factor that was frequently disregarded in previous computational research [ 11 , 12 , 26 ]. Rational Guide Prioritization is Facilitated by Integrative Efficiency-Off-target Landscapes Clusters of the best-performing guides that strike a balance between specificity and activity are shown by the 3D scatterplots that include efficiency, off-target counts, and genomic location. The conventional trade-off between guide potency and safety, which has hampered experimental CRISPR workflows, is lessened by this dual consideration of efficiency and specificity [ 4 , 5 , 24 , 25 ]. Additionally, violin plots and genome-wide heatmaps offer visual aids for locating “safe-harbor” loci, simplifying experimental planning and lowering the need for trial-and-error methods [ 28 , 64 , 65 ]. Our Python-based workflow guarantees reproducibility, accessibility, and adaptability for a variety of genomic scenarios and is fully compatible with Google Colab [ 61 – 65 ]. The platform may easily support new CRISPR modalities like base editors and Cas12a nucleases by methodically integrating sequence-based scoring with structural, thermodynamic, and positional data [ 46 – 50 , 82 – 84 ]. This adaptability bridges a crucial gap between in silico prediction and experimental validation, making our method a useful tool for both editing in poorly described organisms and synthetic genome initiatives. The possibility of precision genome editing across complex genomic landscapes is demonstrated by the discovery of high-specificity guides even in repeat-rich or compositionally extreme areas. By using these insights, researchers can prioritize sgRNAs that minimize the danger of off-target mutagenesis while maximizing both activity and safety [ 1 – 6 , 22 , 24 – 27 ]. Additionally, the pipeline provides mechanistic insights into guide behavior by integrating local GC penalties and repeat-awareness, offering logical criteria for guide selection that go beyond purely empirical techniques [ 31 – 36 , 42 – 44 ]. Real genomes include further levels of complexity, such as chromatin accessibility, epigenetic changes, and three-dimensional folding, whereas synthetic genomes offer controlled settings for testing scoring systems [ 12 , 16 , 17 , 46 ]. Predictive accuracy will be further improved by future research that takes these characteristics into account and validates them experimentally in a variety of organisms. Furthermore, adding programmable base editors and recently identified Cas variations to the scoring system might improve the tool’s suitability for next-generation genome engineering techniques [ 83 , 84 ]. Lastly, in summary by taking into consideration factors including genome composition, PAM variability, off-target weighing, and efficiency penalties, this work offers a strong, broadly applicable computational paradigm for CRISPR/Cas9 guide RNA design, addressing significant shortcomings of current techniques. Our results give experimentalists practical insights that will speed up the adoption of CRISPR technologies in a wide range of genomic contexts and allow for the logical selection of highly effective, targeted guides. References 1. ↵ Jinek M , Chylinski K , Fonfara I , Hauer M , Doudna JA , Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity . Science . 2012 ; 337 : 816 – 821 . OpenUrl Abstract / FREE Full Text 2. Mali P , Yang L , Esvelt KM , et al. RNA-guided human genome engineering via Cas9 . Science . 2013 ; 339 : 823 – 826 . OpenUrl Abstract / FREE Full Text 3. ↵ Cong L , Ran FA , Cox D , et al. Multiplex genome engineering using CRISPR/Cas systems . Science . 2013 ; 339 : 819 – 823 . OpenUrl Abstract / FREE Full Text 4. ↵ Fu Y , Foden JA , Khayter C , et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells . Nat Biotechnol . 2013 ; 31 : 822 – 826 . OpenUrl CrossRef PubMed 5. ↵ Hsu PD , Lander ES , Zhang F. Development and applications of CRISPR-Cas9 for genome engineering . Cell . 2014 ; 157 : 1262 – 1278 . OpenUrl CrossRef PubMed Web of Science 6. ↵ Jinek M , East A , Cheng A , et al. RNA-programmed genome editing in human cells . Elife . 2013 ; 2 : e00471 . OpenUrl CrossRef PubMed 7. ↵ Zhang Y , Zhang F , Li J , et al. Off-target effects in CRISPR/Cas9-mediated genome editing . Mol Ther Nucleic Acids . 2015 ; 4 : e264 . OpenUrl 8. ↵ Ran FA , Hsu PD , Wright J , et al. Genome engineering using the CRISPR-Cas9 system . Nat Protoc . 2013 ; 8 : 2281 – 2308 . OpenUrl CrossRef PubMed 9. ↵ Doench JG , Fusi N , Sullender M , et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9 . Nat Biotechnol . 2016 ; 34 : 184 – 191 . OpenUrl CrossRef PubMed 10. ↵ Hsu PD , Scott DA , Weinstein JA , et al. DNA targeting specificity of RNA-guided Cas9 nucleases . Nat Biotechnol . 2013 ; 31 : 827 – 832 . OpenUrl CrossRef PubMed 11. ↵ Kleinstiver BP , Prew MS , Tsai SQ , et al. Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition . Nat Biotechnol . 2015 ; 33 : 1293 – 1298 . OpenUrl CrossRef PubMed 12. ↵ Choudhury SR , Khatun M , Choi J , et al. Epigenetic regulation of CRISPR/Cas9-mediated genome editing . Biochem Biophys Res Commun . 2018 ; 499 : 1 – 6 . OpenUrl PubMed 13. ↵ Slaymaker IM , Gao L , Zetsche B , et al. Rationally engineered Cas9 nucleases with improved specificity . Science . 2016 ; 351 : 84 – 88 . OpenUrl Abstract / FREE Full Text 14. ↵ Stemmer M , Thumberger T , Del Sol Keyer M , et al. CCTop: an intuitive, flexible, and reliable CRISPR/Cas9 target prediction tool . PLoS One . 2015 ; 10 : e0124633 . OpenUrl CrossRef PubMed 15. ↵ Singh D , Gupta RM , Singh S , et al. CROP-IT: CRISPR/Cas9 Off-target Prediction and Identification Tool . Bioinformatics . 2015 ; 31 : 2848 – 2850 . OpenUrl 16. ↵ Chuai G , Zhang Z , Yang L , et al. DeepCRISPR: optimized CRISPR guide RNA design by deep learning . Genome Biol . 2018 ; 19 : 80 . OpenUrl CrossRef PubMed 17. ↵ Dehghani Amirabad A , Zhang Y , Moskalev A , et al. Multimodal modeling of CRISPR-Cas12 activity using foundation models and chromatin accessibility data . arXiv . 2022 ; arXiv: 2207.03456 . 18. ↵ Haeussler M , Schönig K , Eckert H , et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR . Genome Biol . 2016 ; 17 : 148 . OpenUrl CrossRef PubMed 19. ↵ Wong N , Liu W , Wang X. WU-CRISPR: characteristics of functional guide RNAs for the CRISPR/Cas9 system . Genome Biol . 2015 ; 16 : 218 . OpenUrl CrossRef PubMed 20. ↵ Moreno-Mateos MA , Vejnar CE , Beaudoin J-D , et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo . Nat Methods . 2015 ; 12 : 982 – 988 . OpenUrl CrossRef PubMed 21. ↵ Labuhn M , Adams FF , Ng M , et al. Refined sgRNA efficacy prediction improves CRISPR-Cas9 knockout and activation . Nat Biotechnol . 2018 ; 36 : 1265 – 1273 . OpenUrl 22. ↵ Brinkman EK , Chen T , Amendola M , van Steensel B. Easy quantitative assessment of genome editing by sequence trace decomposition . Nucleic Acids Res . 2014 ; 42 : e168 . OpenUrl CrossRef PubMed 23. Tsai SQ , Joung JK . Defining and improving the genome-wide specificities of CRISPR-Cas9 nucleases . Nat Rev Genet . 2016 ; 17 : 300 – 312 . OpenUrl CrossRef PubMed 24. ↵ Wu X , Kriz AJ , Sharp PA . Target specificity of the CRISPR-Cas9 system . Quant Biol . 2014 ; 2 : 59 – 70 . OpenUrl PubMed 25. ↵ Tycko J , Myer VE , Hsu PD . Methods for optimizing CRISPR-Cas9 genome editing specificity . Mol Cell . 2016 ; 63 : 355 – 370 . OpenUrl CrossRef PubMed 26. ↵ Wang X , Wang Y , Wu X , et al. Unbiased detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors . Nat Biotechnol . 2015 ; 33 : 175 – 180 . OpenUrl CrossRef PubMed 27. ↵ Tsai SQ , Nguyen NT , Malagon-Lopez J , et al. CIRCLE-seq: a highly sensitive in vitro screen for genome-wide CRISPR-Cas9 nuclease off-targets . Nat Methods . 2017 ; 14 : 607 – 614 . OpenUrl CrossRef PubMed 28. ↵ Kim D , Bae S , Park J , et al. Digenome-seq: genome-wide profiling of CRISPR-Cas9 off-target effects in human cells . Nat Methods . 2015 ; 12 : 237 – 243 . OpenUrl CrossRef PubMed 29. Cameron P , Fuller CK , Donohoue PD , et al. Mapping the genomic landscape of CRISPR-Cas9 cleavage . Nat Methods . 2017 ; 14 : 600 – 606 . OpenUrl CrossRef PubMed 30. ↵ Tsai SQ , Topkar VV , Joung JK , Aryee MJ . Open-source CRISPR/Cas9 guide design tools . Nat Biotechnol . 2016 ; 34 : 192 – 193 . OpenUrl CrossRef PubMed 31. ↵ Doench JG , Hartenian E , Graham DB , et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation . Nat Biotechnol . 2014 ; 32 : 1262 – 1267 . OpenUrl CrossRef PubMed 32. Wang T , Wei JJ , Sabatini DM , Lander ES . Genetic screens in human cells using the CRISPR-Cas9 system . Science . 2014 ; 343 : 80 – 84 . OpenUrl Abstract / FREE Full Text 33. ↵ Hart T , Moffat J. BAGEL: a computational framework for identifying essential genes from pooled library screens . BMC Bioinformatics . 2016 ; 17 : 164 . OpenUrl CrossRef PubMed 34. ↵ Moreno-Mateos MA , Vejnar CE , Beaudoin J-D , et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo . Nat Methods . 2015 ; 12 : 982 – 988 . OpenUrl CrossRef PubMed 35. Kim S , Kim D , Cho SW , et al. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins . Genome Res . 2014 ; 24 : 1012 – 1019 . OpenUrl Abstract / FREE Full Text 36. ↵ Richardson CD , Ray GJ , DeWitt MA , Curie GL , Corn JE . Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA . Nat Biotechnol . 2016 ; 34 : 339 – 344 . OpenUrl CrossRef PubMed 37. ↵ Haeussler M , Schönig K , Eckert H , et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR . Genome Biol . 2016 ; 17 : 148 . OpenUrl CrossRef PubMed 38. Kuscu C , Arslan S , Singh R , Thorpe J , Adli M. Genome-wide analysis reveals characteristics of off-target sites bound by the Cas9 endonuclease . Nat Biotechnol . 2014 ; 32 : 677 – 683 . OpenUrl CrossRef PubMed 39. Tsai SQ , Wyvekens N , Khayter C , et al. Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing . Nat Biotechnol . 2014 ; 32 : 569 – 576 . OpenUrl CrossRef PubMed 40. ↵ Slaymaker IM , Gao L , Zetsche B , et al. Rationally engineered Cas9 nucleases with improved specificity . Science . 2016 ; 351 : 84 – 88 . OpenUrl Abstract / FREE Full Text 41. ↵ Labuhn M , Adams FF , Ng M , et al. Refined sgRNA efficacy prediction improves CRISPR-Cas9 knockout and activation . Nat Biotechnol . 2018 ; 36 : 1265 – 1273 . OpenUrl 42. ↵ Tycko J , Myer VE , Hsu PD . Methods for optimizing CRISPR-Cas9 genome editing specificity . Mol Cell . 2016 ; 63 : 355 – 370 . OpenUrl CrossRef PubMed 43. ↵ Wang X , Wang Y , Wu X , et al. Unbiased detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors . Nat Biotechnol . 2015 ; 33 : 175 – 180 . OpenUrl CrossRef PubMed 44. ↵ Kim D , Bae S , Park J , et al. Digenome-seq: genome-wide profiling of CRISPR-Cas9 off-target effects in human cells . Nat Methods . 2015 ; 12 : 237 – 243 . OpenUrl CrossRef PubMed 45. ↵ Cameron P , Fuller CK , Donohoue PD , et al. Mapping the genomic landscape of CRISPR-Cas9 cleavage . Nat Methods . 2017 ; 14 : 600 – 606 . OpenUrl CrossRef PubMed 46. ↵ Zetsche B , Gootenberg JS , Abudayyeh OO , et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system . Cell . 2015 ; 163 : 759 – 771 . OpenUrl CrossRef PubMed 47. Kleinstiver BP , Prew MS , Tsai SQ , et al. Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition . Nat Biotechnol . 2015 ; 33 : 1293 – 1298 . OpenUrl CrossRef PubMed 48. Gaudelli NM , Komor AC , Rees HA , et al. Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage . Nature . 2017 ; 551 : 464 – 471 . OpenUrl CrossRef PubMed 49. Komor AC , Kim YB , Packer MS , Zuris JA , Liu DR . Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage . Nature . 2016 ; 533 : 420 – 424 . OpenUrl CrossRef PubMed 50. ↵ Rees HA , Liu DR . Base editing: precision chemistry on the genome and transcriptome of living cells . Nat Rev Genet . 2018 ; 19 : 770 – 788 . OpenUrl CrossRef PubMed 51. ↵ Haeussler M , Schönig K , Eckert H , et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR . Genome Biol . 2016 ; 17 : 148 . OpenUrl CrossRef PubMed 52. Tsai SQ , Joung JK . Defining and improving the genome-wide specificities of CRISPR-Cas9 nucleases . Nat Rev Genet . 2016 ; 17 : 300 – 312 . OpenUrl CrossRef PubMed 53. Wu X , Kriz AJ , Sharp PA . Target specificity of the CRISPR-Cas9 system . Quant Biol . 2014 ; 2 : 59 – 70 . OpenUrl PubMed 54. Tycko J , Myer VE , Hsu PD . Methods for optimizing CRISPR-Cas9 genome editing specificity . Mol Cell . 2016 ; 63 : 355 – 370 . OpenUrl CrossRef PubMed 55. ↵ Doench JG , Fusi N , Sullender M , et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9 . Nat Biotechnol . 2016 ; 34 : 184 – 191 . OpenUrl CrossRef PubMed 56. ↵ Slaymaker IM , Gao L , Zetsche B , et al. Rationally engineered Cas9 nucleases with improved specificity . Science . 2016 ; 351 : 84 – 88 . OpenUrl Abstract / FREE Full Text 57. Labuhn M , Adams FF , Ng M , et al. Refined sgRNA efficacy prediction improves CRISPR-Cas9 knockout and activation . Nat Biotechnol . 2018 ; 36 : 1265 – 1273 . OpenUrl 58. Dehghani Amirabad A , Zhang Y , Moskalev A , et al. Multimodal modeling of CRISPR-Cas12 activity using foundation models and chromatin accessibility data . arXiv . 2022 ; arXiv: 2207.03456 . 59. Chuai G , Zhang Z , Yang L , et al. DeepCRISPR: optimized CRISPR guide RNA design by deep learning . Genome Biol . 2018 ; 19 : 80 . OpenUrl CrossRef PubMed 60. ↵ Wang T , Wei JJ , Sabatini DM , Lander ES . Genetic screens in human cells using the CRISPR-Cas9 system . Science . 2014 ; 343 : 80 – 84 . OpenUrl Abstract / FREE Full Text 61. ↵ Bisong E. Google Colaboratory . Build Machine Learning and Deep Learning Models on Google Cloud Platform . 2019 . 62. ↵ Harris CR , Millman KJ , van der Walt SJ , et al. Array programming with NumPy . Nature . 2020 ; 585 : 357 – 362 . OpenUrl CrossRef PubMed 63. ↵ McKinney W. Data structures for statistical computing in Python . Proc. 9th Python in Science Conf . 2010 ; 51 – 56 . 64. ↵ Hunter JD . Matplotlib: A 2D graphics environment . Comput Sci Eng . 2007 ; 9 : 90 – 95 . OpenUrl CrossRef PubMed 65. ↵ Waskom M. seaborn: statistical data visualization . J Open Source Softw . 2021 ; 6 : 3021 . OpenUrl CrossRef 66. ↵ Matplotlib.org . mplot3d toolkit . https://matplotlib.org/stable/gallery/mplot3d/index.html . Accessed 2025 . 67. ↵ Bernardi G. Isochores and the evolutionary genomics of vertebrates . Gene . 2000 ; 241 : 3 – 17 . OpenUrl CrossRef PubMed Web of Science 68. ↵ Treangen TJ , Salzberg SL . Repetitive DNA and next-generation sequencing: computational challenges and solutions . Nat Rev Genet . 2012 ; 13 : 36 – 46 . OpenUrl CrossRef PubMed 69. ↵ Hsu PD , Lander ES , Zhang F. Development and applications of CRISPR-Cas9 for genome engineering . Cell . 2014 ; 157 : 1262 – 1278 . OpenUrl CrossRef PubMed Web of Science 70. ↵ Jinek M , Chylinski K , Fonfara I , et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity . Science . 2012 ; 337 : 816 – 821 . OpenUrl Abstract / FREE Full Text 71. ↵ Ran FA , Hsu PD , Wright J , et al. Genome engineering using the CRISPR-Cas9 system . Nat Protoc . 2013 ; 8 : 2281 – 2308 . OpenUrl CrossRef PubMed 72. ↵ Kleinstiver BP , Prew MS , Tsai SQ , et al. Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition . Nat Biotechnol . 2015 ; 33 : 1293 – 1298 . OpenUrl CrossRef PubMed 73. ↵ Zetsche B , Gootenberg JS , Abudayyeh OO , et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system . Cell . 2015 ; 163 : 759 – 771 . OpenUrl CrossRef PubMed 74. ↵ Fu Y , Foden JA , Khayter C , et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells . Nat Biotechnol . 2013 ; 31 : 822 – 826 . OpenUrl CrossRef PubMed 75. ↵ Hsu PD , Scott DA , Weinstein JA , et al. DNA targeting specificity of RNA-guided Cas9 nucleases . Nat Biotechnol . 2013 ; 31 : 827 – 832 . OpenUrl CrossRef PubMed 76. ↵ Doench JG , Fusi N , Sullender M , et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9 . Nat Biotechnol . 2016 ; 34 : 184 – 191 . OpenUrl CrossRef PubMed 77. ↵ Moreno-Mateos MA , Vejnar CE , Beaudoin J-D , et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo . Nat Methods . 2015 ; 12 : 982 – 988 . OpenUrl CrossRef PubMed 78. ↵ Wong N , Liu W , Wang X. WU-CRISPR: characteristics of functional guide RNAs for the CRISPR/Cas9 system . Genome Biol . 2015 ; 16 : 218 . OpenUrl CrossRef PubMed 79. ↵ Labuhn M , Adams FF , Ng M , et al. Refined sgRNA efficacy prediction improves CRISPR-Cas9 knockout and activation . Nat Biotechnol . 2018 ; 36 : 1265 – 1273 . OpenUrl 80. ↵ Tycko J , Myer VE , Hsu PD . Methods for optimizing CRISPR-Cas9 genome editing specificity . Mol Cell . 2016 ; 63 : 355 – 370 . OpenUrl CrossRef PubMed 81. Zetsche B , Gootenberg JS , Abudayyeh OO , et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system . Cell . 2015 ; 163 : 759 – 771 . OpenUrl CrossRef PubMed 82. ↵ Gaudelli NM , Komor AC , Rees HA , et al. Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage . Nature . 2017 ; 551 : 464 – 471 . OpenUrl CrossRef PubMed 83. ↵ Komor AC , Kim YB , Packer MS , Zuris JA , Liu DR . Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage . Nature . 2016 ; 533 : 420 – 424 . OpenUrl CrossRef PubMed 84. ↵ Rees HA , Liu DR . Base editing: precision chemistry on the genome and transcriptome of living cells . Nat Rev Genet . 2018 ; 19 : 770 – 788 . OpenUrl CrossRef PubMed 85. Treangen TJ , Salzberg SL . Repetitive DNA and next-generation sequencing: computational challenges and solutions . Nat Rev Genet . 2012 ; 13 : 36 – 46 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted August 13, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Weighted Off-target and Efficiency Scoring Reveal Genome Composition-Dependent Optimal CRISPR/Cas9 Guide Design Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Weighted Off-target and Efficiency Scoring Reveal Genome Composition-Dependent Optimal CRISPR/Cas9 Guide Design Y K Yathu Krishna bioRxiv 2025.08.13.670047; doi: https://doi.org/10.1101/2025.08.13.670047 Share This Article: Copy Citation Tools Weighted Off-target and Efficiency Scoring Reveal Genome Composition-Dependent Optimal CRISPR/Cas9 Guide Design Y K Yathu Krishna bioRxiv 2025.08.13.670047; doi: https://doi.org/10.1101/2025.08.13.670047 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Bioinformatics Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17697) Bioengineering (13895) Bioinformatics (41953) Biophysics (21456) Cancer Biology (18595) Cell Biology (25521) Clinical Trials (138) Developmental Biology (13381) Ecology (19903) Epidemiology (2067) Evolutionary Biology (24323) Genetics (15612) Genomics (22511) Immunology (17738) Microbiology (40401) Molecular Biology (17184) Neuroscience (88623) Paleontology (667) Pathology (2833) Pharmacology and Toxicology (4825) Physiology (7644) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4296) Systems Biology (9825) Zoology (2271)