SaUGTs regulate YE-induced phytoalexins homeostasis in Sorbus aucuparia suspension cells

SaUGTs regulate YE-induced phytoalexins homeostasis in Sorbus aucuparia suspension cells | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 17 March 2025 V1 Latest version Share on SaUGTs regulate YE-induced phytoalexins homeostasis in Sorbus aucuparia suspension cells Authors : wenjin zhang 0000-0002-3541-7282 [email protected] , Xiaojia Zhang , Le Liang , Jian Yang , and Lanping Guo Authors Info & Affiliations https://doi.org/10.22541/au.174219347.79432929/v1 Published BMC Plant Biology Version of record Peer review timeline 159 views 172 downloads Contents Abstract Supplementary Material Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Background: Glycosyltransferases (GTs) are principal post-reactive modifying enzymes responsible for establishing natural glycosidic bonds in secondary metabolites, playing a critical regulatory role in plant cellular metabolic homeostasis. Biphenyl, dibenzofuran, and their glycosides, the most abundant phytoalexins in the apple subfamily, are synthesized de novo after infection by bacteria or fungi. Nevertheless, the biological functions of GTs in Sorbus aucuparia remain largely uncharacterised. Purpose: This study systematically evaluated the impact of Sorbus aucuparia uridine diphosphate glycosyltransferases (SaUGTs) on biphenyl phytoalexin metabolism and growth patterns in Sorbus aucuparia suspension cells (SASCs) under yeast extract (YE)-induced biotic stress. Methods: The study established standardized SASCs cultures with controlled induction protocols using YE for biotic stress simulation. A multi-omics framework integrated phenotypic analyses, targeted metabolomics (UPLC-QTOF-MS), transcriptional profiling (quantitative PCR), and enzymatic functional assays. Results: YE treatment induced a biomass decline in SASCs, coinciding with substantial accumulation of biphenyl derivatives and glycosides. Temporal profiling revealed dynamic fluctuations in metabolite concentrations, reflecting sequential biosynthetic transformations. Stress exposure elevated soluble protein content and significantly up-regulated SaUGTs expression. YE-induced SaUGTs promote glycosylation of de novo-synthesised biphenyl phytoalexins (noraucuparin, aucuparin) and 2′-hydroxyaucuparin, with optimal cell growth occurring during metabolic equilibrium between aglycones and glycosides. Conclusion: These findings suggest a previously unrecognised regulatory strategy, whereby SASCs alleviate biotic stress through GT-mediated maintenance of phytoalexin-glycoside homeostasis, thus preventing detrimental over-activation of defence mechanisms. SaUGTs regulate YE-induced phytoalexins homeostasis in Sorbus aucuparia suspension cells Wenjin Zhang a , Xiaojia Zhang a , Le Liang a , Jian Yang b , Lanping Guo b 11 Abbreviations: GTs, Glycosyltransferases; OPLS-DA, orthogonal partial least squares discriminant analysis; Rt, retention time; SASCs, Sorbus aucuparia suspension cells; SaUGTs, Sorbus aucuparia uridine diphosphate glycosyltransferases; VIPs, variable weight values; YE, yeast extract. * Corresponding authors at: China Academy of Chinese Medical Sciences, No.16, Nanxiao street, Dongzhimen, Dongcheng District, Beijing, 100700, China. E-mail addresses: [email protected] (L. Guo). a Key Laboratory of Protection, Development and Utilization of Medicinal Resources in Liupanshan Area, Department of Pharmacology, College of Pharmacy, Ningxia Medical University, Yinchuan, 750000, China b State Key Laboratory of Dao-di Herbs Breeding Base, Joint Laboratory of Infinitus (China) Herbs Quality Research, National Resource Center for Chinese Materia Medica, China Academy of Chinese Medical Sciences, Beijing, 100700, PR China ABSTRACT Background: Glycosyltransferases (GTs) are principal post-reactive modifying enzymes responsible for establishing natural glycosidic bonds in secondary metabolites, playing a critical regulatory role in plant cellular metabolic homeostasis. Biphenyl, dibenzofuran, and their glycosides, the most abundant phytoalexins in the apple subfamily, are synthesized de novo after infection by bacteria or fungi. Nevertheless, the biological functions of GTs in Sorbus aucuparia remain largely uncharacterised. Purpose: This study systematically evaluated the impact of Sorbus aucuparia uridine diphosphate glycosyltransferases (SaUGTs) on biphenyl phytoalexin metabolism and growth patterns in Sorbus aucuparia suspension cells (SASCs) under yeast extract (YE)-induced biotic stress. Methods: The study established standardized SASCs cultures with controlled induction protocols using YE for biotic stress simulation. A multi-omics framework integrated phenotypic analyses, targeted metabolomics (UPLC-QTOF-MS), transcriptional profiling (quantitative PCR), and enzymatic functional assays. Results: YE treatment induced a biomass decline in SASCs, coinciding with substantial accumulation of biphenyl derivatives and glycosides. Temporal profiling revealed dynamic fluctuations in metabolite concentrations, reflecting sequential biosynthetic transformations. Stress exposure elevated soluble protein content and significantly up-regulated SaUGTs expression. YE-induced SaUGTs promote glycosylation of de novo-synthesised biphenyl phytoalexins (noraucuparin, aucuparin) and 2′-hydroxyaucuparin, with optimal cell growth occurring during metabolic equilibrium between aglycones and glycosides. Conclusion: These findings suggest a previously unrecognised regulatory strategy, whereby SASCs alleviate biotic stress through GT-mediated maintenance of phytoalexin-glycoside homeostasis, thus preventing detrimental over-activation of defence mechanisms. Keywords: Glycosyltransferases; Phytoalexins; Biphenyl; Biotic stress Introduction Plants are characterized by their capability to synthesize a wide variety of secondary metabolites, thereby forming a coordinated defense process out of chaotic reactions (Yang et al., 2018; Zhang et al., 2022). Numerous studies have shown that the release of phytoalexins increases significantly after plants respond to biotic and abiotic stresses. As a result, they participate in a complex defence system that allows plants to control invading microorganisms (Jeandet, 2015; Shah and Smith, 2020). A large number of phytoalexins have been isolated and identified from various plants. Some of these are camalexin in cruciferous plants (Liao et al., 2022), capsidiol and scopoletin in Solanaceae (Song and Wu, 2024); pisatin in Leguminosae (Bizuneh, 2021); aucuparin in apple subfamily plants (Busnena et al., 2023); N-acylptamine phytoexin in rice (Zhang et al., 2022); and scopoletin in many plant species (Campos et al., 2019; Parasecolo et al., 2024). As an important “chemical defence” substance, phytoalexins need to be present in plants at a certain concentration to act accordingly (Gupta and Roy, 2021). An important strategy for maintaining concentrations of active metabolites is chemical modification, which can alter the bioavailability and activity of compounds. Molecular glycosylation is the most widespread type of modification reaction in plants (Majeed et al., 2024). Glycosyltransferases (GTs) are the enzymes specifically responsible for catalysing this type of glycosylation (Andreu et al., 2023). GTs transfer reactive glycosyl groups from nucleotide sugars (usually from uridine diphosphate glucose) to a range of small-molecule receptors, such as secondary metabolites, pathogenic infections and internal and external plant toxicants (Yang et al., 2023). Many UGTs have been reported for their role in plant stress resistance (Zhang et al., 2022). In many cases, in vitro studies have identified secondary metabolites, such as phenylpropanoids and flavonoids, as UGT substrates. However, their function in vivo remains elusive (Liu et al., 2018; Speeckaert et al., 2022), and the exact contribution of GTs in the plant response to biotic stress is unclear (Al-Khayri et al., 2023; Le Roy et al., 2016; Rehman et al., 2018). At an early stage, our research group obtained UGTs (SaUGT5 and SaUGT7) from Sorbus aucuparia suspension cells (SASCs), which catalyse biphenyl phytoalexins glycosylation in vitro with high efficiency (unpublished). However, eukaryotic proteins obtained in prokaryotic expression systems may lack biological activity due to differences in the intracellular and extracellular environments (mainly the availability of intracellular substrates). The catalytic specificity of recombinant UGTs in vitro does not fully explain their action in vivo (Zhang et al., 2022). Studies have shown that biphenyl- and dibenzofuran-like phytoalexins specific to the apple subfamily have anti-pathogenic activity (Shukla et al., 2019). More than thirty biphenyl and dibenzofuran components have been isolated from the apple subfamily, and our team has reported many under-appreciated glycosylation products of biphenyl and dibenzofuran compounds that are more bactericidal than their aglycone and carbendazim (Li et al., 2019a). As a common physiological phenomenon, glycosylation of small molecules is a key regulatory mechanism for metabolic homeostasis in plant cells, and plant stress responses involve a large number of glycosylation modifications (Zhang et al., 2017). The long growth cycles, complex types and diverse sources of secondary metabolites of perennial medicinal plants have limited studies on the mechanisms of secondary metabolic responses of medicinal plants to environmental stresses due to long research cycles, poor sample homogeneity, and poor experimental controllability (Huang et al., 2016). Preliminary studies revealed that SASCs exhibit homogeneity, stability, good dispersion, fast growth rate, and easy control of experimental conditions. Through the screening of inducers, yeast extract (YE) was used to simulate the complex factors present in environmental stresses and induced the most significant changes in phytoalexin metabolites in Sorbus pohuashanensis (Mo et al., 2014). Herein, SASCs were used as a model material for secondary metabolites of perennial medicinal plants in response to environmental stress, and the phytoalexins metabolism of YE-induced SASCs and the corresponding SaUGTs expression were studied to explore the metabolic regulation effect of SaUGTs in S. aucuparia. Materials and methods SASCs culture and YE-induced biotic stress SASCs were cultured in 500 mL jars containing 200 mL of MS liquid medium; the samples were transferred every 12–14 days and incubated in the dark at 25°C and 120 r·min -1 . SASCs was filtered under reduced pressure, weighed 3.5 g (70 g·L -1 ), and inoculated into 50 mL of the liquid medium in 250 mL conical flasks for incubation (Yuan et al., 2021). YE powder was dissolved in ultrapure water, prepared as a 60 g·L -1 mother liquor and sterilized at 121 °C for 15 min to a final concentration of 3 g·L -1 (Zhou et al., 2016). SASCs were subcultured for 5 days and treated with YE induction agent or an equal volume of sterile water with induction times set at 0, 12, 24, and 48 h. Biomass of SASC s Fresh and dry weights of cells were measured under different treatments. SASCs were collected by suction filtration with a vacuum pump, rinsed three times with distilled water, vacuum filtered until there were no water droplets, and weighed to obtain the fresh weight of the cells. The harvested cells were baked at 40°C to a constant weight, which was the stem cell weight (biomass). SASCs intracellular soluble proteins Weigh about 0.1 g of SASCs under each treatment condition, add 2 mL of PBS buffer (pH=7.4), ultrasonically crush, 10,000 g, centrifuge for 20 min at 4℃, and the supernatant is the soluble protein extraction solution. The soluble protein content in the cells was determined by the Kormas Brilliant Blue G-250 methode. The absorbance (A) value was measured at 595 nm and bovine serum protein was used as the standard curve. Three biological replicates were set up for each treatment. Metabolism analysis of SASCs biphenyl phytoalexins The treated cells were collected by suction filtration and dried in an oven at 40°C to a constant weight. About 100 mg of dried cells was accurately weighed in an Eppendorf tube. Samples were sonicated in 1.5 mL of 80% methanol for 30 min and then centrifuged at 12,000 rpm for 10 min. The supernatant was filtered through a 0.22 µm PTFE membrane. Metabolite analysis of SASCs was performed on a Waters ACQUITY UPLC I-Class/Xevo, using a Masslynx-controlled Waters Xevo G2 Q-TOF mass spectrometer (version 4.1, Waters Corporation, Milford, MA, USA). Samples were separated on an Acquity UPLC BEH C18 column (2.1 mm × 100 mm, 1.7 µm). The temperature of the column was 40°C. The binary gradient consisted of mobile phase A (formic acid/water = 0.1:99.9 v/v) and mobile phase B (formic acid/acetonitrile = 0.1:99.9 v/v). The gradient elution conditions were: 0 min, 5% B; 1 min, 5% B; 6 min, 40% B; 8 min, 52% B; 12 min, 85% B; 15 min, 98% B. The injection volume was 2 µL, and the flow rate was 0.5 mL·min -1 . The Waters Xevo G2 Q-TOF mass spectrometer was operated in negative ion mode. Data from 50-1500 were collected for each test sample. High purity N 2 was used as the nebulising gas and ultra-high purity He as the collision gas. Source parameters were as follows: capillary voltage, 2.50 kV; sampling cone voltage, 35.0 V; source offset, 80.0 V; desolvation temperature, 500°C; cone gas flow rate, 50 L·h -1 ; desolvation gas flow rate, 800 L·h -1 . To ensure mass accuracy and reproducibility, leucine-enkephalin was used as the reference locking mass (m/z 554.2615) for the LockSpray interface. Total RNA isolation, cDNA synthesis, and expression analysis For samples induced for 0, 12, 24, and 48 h, suspension cells were obtained, and 1.3 mL of culture medium was poured into RNase-Free EP tubes. The tubes were centrifuged at 8,000 g for 5 min, the supernatant was discarded and the precipitated cells were collected. Total RNA was extracted according to the instructions of Omega’s Plant Total RNA Extraction Kit (Cat. No.: R6827-02). RNA samples were quantified by measuring absorbance at 260 nm. First-strand cDNA was synthesised from total RNA using the PrimeScript™ 1st Strand cDNA Synthesis Kit (Takara). The expression changes of SaUGT5 and SaUGT7 genes in SASCs were detected by fluorescence quantitative PCR using cDNA as template and actin as housekeeping gene. The primers for real-time fluorescence quantification are shown in Table 1. The reaction system was 5 μL of 2×SYBR Green mix, 0.5 μL of forward and reverse primers, 1 μL of cDNA and ddH 2 O supplemented to 10 μL. The reaction procedure was 50°C for 2 min; 95°C for 10 min; 95°C for 15 s and 60°C for 1 min for 45 cycles. Fluorescent signals were collected after each cycle, and amplification and solubility curves (60°C–95°C) were analysed after the reactions (Li et al., 2019b). Each sample was repeated three times and the relative expression levels of the SaUGT5 and SaUGT7 genes were calculated using the 2 -ΔΔCt method (Pfaffl, 2001). Three experiments were carried out independently for each strain. Significant differences were analysed using GraphPad InStat 3 statistical software. In vitro catalytic activity of soluble proteins The in vitro catalytic activity of soluble proteins was verified by using UDPG-Noraucuparin, UDPG-2′-Hydroxyaucuparin, and UDP-Xyl-Aucuparin substrate pairs with standards as glycosyl donors and acceptors, respectively, according to the YE-induced metabolism of biphenyl and dibenzofuran- like phytoalexins. The reaction was carried out at 30℃ for 4 h. The reaction was terminated by the addition of 2 times the amount of chromatographic methanol (600 μL), shaken and mixed, and the supernatant was collected and filtered through an organic membrane at 0.22 μm for 15 min. UPLC-Q-TOF-MS/MS was used for the analysis. The conversion (%) was calculated from the peak area (Aproduct/Asubstrate+product) × 100% using no addition of UDPG as control (Chen et al., 2019). The samples were separated on an Acquity UPLC BEH C18 column (2.1 mm × 100 mm, 1.7 µm). The column temperature was 35°C. The binary gradient consisted of mobile phase A (formic acid/water 0.1:99.9 v/v) and mobile phase B (formic acid/acetonitrile 0.1:99.9 v/v). The gradient elution program was 0-4 min, 10%-40% B; 4.0-5.0 min, 40%-52% B; 5.0-8.0 min, 52%-72% B; 8.0-8.2 min, 72%-95% B. The injection volume was 4 µL and the flow rate was 0.5 mL·min -1 . The Waters Xevo G2 Q-TOF mass spectrometer was run in negative ion The Waters Xevo G2 Q-TOF mass spectrometer was run in negative ion mode. Data were collected for each test sample from 50-1500. High purity N 2 was used as the nebulising gas and ultra-high purity He was used as the collision gas. Source parameters were as follows: capillary voltage, 2.50 kV; sampling cone voltage, 35.0 V; source offset, 80.0 V; desolvation temperature, 500°C; cone gas flow rate, 50 L·h -1 ; desolvation gas flow rate, 800 L·h -1 . To ensure mass accuracy and reproducibility, leucine enkephalin was used as the reference locking mass for the LockSpray interface (m/z 554.2615). Data processing and analysis The raw mass spectrometry data acquired by UPLC-Q-TOF-MS/MS were imported into Progenesis QI v2.1 (Waters Corp., Milford, USA), a software package for peak alignment, identification, noise filtering, and normalisation, for data extraction. After the previous procedures, the final 2D data matrix of retention time (Rt), mass-to-charge ratio, and peak intensity/area were obtained. The data arrays were imported into SIMCA-P 13.0 (Umetrics AB, Umea, Sweden) software for unsupervised principal component analysis, and supervised orthogonal partial least squares discriminant analysis (OPLS-DA) was conducted to obtain the different chemical compositions. Based on the S-plots and the variable weight values (VIPs), the variables with large differences in the original matrix were selected as candidate markers for the changes in SASCs after YE induction treatment. Furthermore, the structural information of the differential metabolites was initially inferred based on the retention times, molecular ion peaks, and secondary mass spectra of the above markers. Biomass dynamics under biotic stress induction Uninduced SASC cultures exhibited progressive biomass accumulation over time, accompanied by dynamic pH shifts in the medium. This environmental transition correlated with biphasic growth kinetics—initial acceleration followed by growth attenuation—in control groups (Fig. 1). YE-induced cultures demonstrated markedly enhanced biomass yields (48% increase vs. control at 48 h, p<0.05), revealing intrinsic stress acclimatization capacity. The metabolic flexibility evidenced by sustained proliferation under induced stress suggests the activation of multilevel regulatory networks, effectively mitigating the inhibitory environment while optimizing resource allocation for cellular expansion. Temporal variation in soluble protein concentration under YE induction Uninduced SASCs cultures displayed monophasic soluble protein dynamics, characterized by an initial ascending phase (0-12 h), followed by progressive decline and ultimate stabilization after 24 h (Fig. 2). YE induction significantly amplified this pattern, eliciting a 187% surge in soluble protein concentration at 12 h compared to untreated controls. Subsequent monitoring revealed progressive normalization, with protein levels achieving parity between induced and control groups by 48 h. Notably, the ascending phase corresponded temporally with SaUGT7 transcriptional upregulation, suggesting enzymatic regulation of protein metabolism during early stress adaptation. Unlike the transient stress response in induced cultures, control groups exhibited baseline recapitulation at 24 h post-culture initiation, indicating intrinsic metabolic reset mechanisms independent of external stimuli. YE-induced metabolism of biphenyl phytoalexins in SASCs YE induction triggered significant metabolic reprogramming in SASCs, with distinct temporal shifts in secondary metabolite profiles compared to untreated controls (0 h) (Fig. S1, BPI). The most pronounced compositional changes occurred at 24 h post-induction, characterized by both quantitative and qualitative alterations in specialized metabolites. Multivariate OPLS-DA analysis of 0 h and 24 h timepoints confirmed model validity with permutation testing demonstrating absence of overfitting. Differential compound identification via S-plot analysis (|p(corr)|≥0.5) and VIP scoring (VIP>1.5) revealed six time-dependent biphenyl/dibenzofuran derivatives, including glycosylated forms (Fig. S1A-D). Accumulation dynamics showed strong temporal regulation: noraucuparin 5-O-β-D-Glc [m/z 377.1217] and 2’-glucosyloxy-aucuparin [m/z 407.1329] dominated early-phase biosynthesis (12 h), while aglycone-glycoside co-accumulation peaked at 24 h (Fig. 3). Structural elucidation integrated retention behavior, MS/MS fragmentation patterns (e.g., 162-Da glycosyl loss), and accurate mass matches (Table 2). Temporal regulation of SaUGTs Gene expression Transcriptional induction of SaUGT5 and SaUGT7 exhibited distinct temporal patterns under YE stress. SaUGT7 demonstrated transient upregulation peaking at 12 h, while SaUGT5 showed progressive activation that surpassed SaUGT7 expression levels from 24 h onward (Fig. 4). This diverging expression kinetics suggests functional specialization, with SaUGT5 potentially governing glucosylation processes during late-phase biosynthesis (24-48 h). Intriguingly, transcriptional equilibrium between both glycosyltransferases persisted during the critical metabolite synthesis window (12-24 h), indicative of coordinated regulation during phytoalexin maturation. Functional correlation between SaUGT expression and phytoalexin biosynthesis To clarify the possible interaction of the above indicators, a correlation analysis was performed. As shown in Fig. 5, SaUGT5 gene expression was significantly and positively correlated with noraucuparin 5-O-β-D-Glc, 2′-glucosyloxy-aucuparin, noreriobofuran 5-O-β-D-Glc, aucuparin 4-O-β-D-Xyl content and biomass, and in vitro activity assays showed that SaUGT5 catalyzed the production of noraucuparin, aucuparin, and 2′-hydroxyaucuparin into the corresponding glycosides. Biomass was significantly positively correlated with 2′-glucosyloxy-aucuparin and noreriobofuran content, but significantly negatively correlated with soluble protein content. These results suggest a metabolic sink prioritization under YE stress, where protein biosynthesis trade-offs may partially constrain SASCs growth vigor. In vitro catalytic activity of soluble proteins The loss of in vitro catalytic activity of the UDP-Xyl-aucuparin substrate pair by soluble proteins was due to differences in the in vitro and in vivo environment of the SASCs. 0 h of YE induction resulted in 7.2% conversion of UDPG-2′-hydroxyaucuparin by soluble proteins, whereas no 2′-hydroxyaucuparin and its glycosylated products were detected in the in vivo metabolites at 0 h. Hydroxyaucuparin and its glycosylated products were not detected in the in vivo metabolites at 0 h. This was because no 2′-hydroxyaucuparin substrate was produced in the SASCs under uninduced conditions, demonstrating that the availability of extracellular and intracellular substrates is one of the main factors affecting the catalytic activity of proteins in vitro and in vivo. At 12 h and 48 h of treatment, the conversion rates of soluble proteins to UDPG-2′-hydroxyaucuparin and UDPG-noraucuparin were higher under uninduced conditions than under YE-induced conditions in the same period. In contrast, at 24 h of YE induction, the conversion rates of soluble protein to UDPG-2′-hydroxyaucuparin and UDPG-noraucuparin were higher than those under non-YE-induced conditions during the same period (Fig. 6B). This trend was not consistent with changes in soluble protein content and gene expression levels of SaUGTs. Possible reasons for this are (1) there is a certain order of transformation in the synthesis of biphenyls and their glycosides, and the fluctuations in their contents are influenced by each other. (2) the synthesis of multiple biphenyl-like phytoalexins and their glycosides in plants induced de novo by YE, the synthesis of new substances is an energy-consuming process and there is dynamic coordination of these substances in response to different stress conditions (stress intensity, stress duration). Discussion When plants are subjected to environmental stress, they rapidly redistribute energy, implement sacrificial strategies to balance growth and defence, and enhance stress resistance by appropriately reducing growth levels (Shahrajabian et al., 2023). Hence, medicinal plants often cannot grow and accumulate active ingredients simultaneously (Yuan et al., 2021). Biomass is a visual indicator of the effect of stress. After YE induction treatment, cell biomass showed a downward trend at 12 h post-treatment, which may be the price paid by SASCs for producing the enzymes required for secondary metabolic processes in response to stress (Isah, 2019). This indicates that SASCs are increasingly invested in control mechanisms to resist YE-induced biotic stress and that the more synthesized soluble proteins can be used to regulate and catalyse the synthesis of secondary metabolites. These secondary metabolites are often phytoalexins, which have been shown to reduce the adverse effects of external environmental stresses on plants (Li et al., 2019b), and many plant defence compounds are stored in a general glycosylated form that releases toxic substances in response to the attack (Morant et al., 2008; Zhang et al., 2022). Six biphenyl and dibenzofuran compounds were detected in the SASCs extracts after YE treatment, whereas the cells did not synthesize such compounds under normal culture conditions. These results indicated that the cells synthesized such compounds in response to the YE-induced biotic stress. The accumulation of these compounds fluctuated as the induction time increased. It has been hypothesized that there is a certain sequence of transformations in the synthesis of biphenyl compounds (Hüttner et al., 2010; Jain et al., 2017). In this study, 2’-glucosyloxy-aucuparin, noreriobofuran 5-O-β-D-Glc, noraucuparin 5-O-β-D-Glc, and noreriobofuran were found to be detectable at 12 h after YE induction and the accumulation fluctuated with induction time. In terms of the biphenyl and dibenzofuran phytoalexins biosynthetic pathway (Fig. 6C), Noraucuparin is an upstream compound in the noreriobofuran and aucuparin biosynthetic pathway, and noraucuparin 5-O-β-D-Glc, noreriobofuran 5-O-β-D-Glc are glycoside products modified by glycosylation of SaUGTs, and fluctuations in their content are influenced by each other. Noraucuparin was only detected at 24 h of YE induction and low relative levels because the corresponding downstream products were abundant at this time, but the overall levels were low. That is, noraucuparin is only partially converted to a downstream product. Aucuparin 4-O-β-D-Xyl was produced at 24 h and 48 h of YE induction and accumulated in a stable state with smaller fluctuations, probably because aucuparin was converted to 2′-hydroxyaucuparin in the early phase (12 h of YE induction). Aucuparin and 2′-hydroxyaucuparin were present as their glycosides (aucuparin 4-O-β-D-Xyl, 2’-glucosyloxy-aucuparin) throughout the experimental cycle of YE stress. This result clarifies to some extent the transformation that exists between the biphenyl compounds. At 12 h of YE induction, noraucuparin and aucuparin were present as noraucuparin 5-O-β-D-Glc and 2′-glucosyloxy-aucuparin, respectively (Fig. 3). At this time, SaUGT7 expression reached its highest level, three times that of the control, and played a major role in glycosylation. The metabolism of biphenyl and dibenzofuran phytoalexins peaked at 24 h after induction, and both were present in the form of aglycones and their glycosides. The fastest increase in SASCs biomass at this time may be due to the homologous regulation of cellular metabolism by phytoalexins glycosylation. The high expression of the SaUGT5 and SaUGT7 genes at 48 h of YE induction was responsible for the higher content of their corresponding glycosylated phytoalexins at the later stages of stress treatment (Fig. 4). Gene expression, protein content, and protein activity are not necessarily positively correlated (Buccitelli and Selbach, 2020). Combining metabolite information, which is the end product of gene expression, with gene and protein expression information can overcome the shortcomings of each, validating and complementing each other to obtain a relatively complete and clear understanding. Soluble protein content and its catalytic activity in vitro were analyzed to further validate the above results. The soluble protein content was consistent with the trend in gene expression levels of SaUGTs (Fig. 2 and Fig. 3). The catalytic activity of soluble proteins further confirmed that the availability of intracellular substrates is one of the main factors influencing the catalytic activity of proteins in vitro and in vivo. Biphenyl compounds and their glycosides are synthesized in a certain order of transformation, and fluctuations in their content are influenced by each other and the dynamic coordination of these substances in response to different stress conditions. This is an adaptive mechanism of SASCs in response to YE-induced biotic stresses. Herein, by analyzing the changes in biomass, biphenyl-like secondary metabolites content, intracellular soluble protein content, and SaUGTs expression, it was found that the mechanism of YE-induced SASCs synthesis of secondary metabolites is consistent with the hypothesis of the adversity effect of authentic medicinal materials. Furthermore, the relationship between SaUGTs and the metabolic balance of biphenyl phytoalexins and their glycosides and SASCs resistance was further proved. SaUGTs enhanced glycosylation of de novo synthesized biphenyl (noraucuparin, aucuparin) and dibenzofuran (2′-hydroxyaucuparin) phytoalexins by up-regulated expression induced by YE fungal inducers. Unlike glycosylation, which is the storage form of many plant defence compounds. The compounds 2′-glucosyloxy-aucuparin and noraucuparin 5-O-Glc were found to have stronger anti-pathogenic fungal activity than their aglycones. This may be a novel mechanism by which SASCs regulates biotic stress by maintaining the homeostasis of phytoalexins and their glycosides and avoiding excessive resistance responses of plants. To clarify the substrates and products of SaUGTs, the metabolic profiles of overexpressed SaUGTs, deletion mutants and wild type can be further compared by non-target metabolomic analysis in future studies. Author statement WJZ conducted experiments and wrote the manuscript. XJZ, JY and LL edited the manuscript. LPG contributed critical comments to the draft and approved the manuscript. All the authors reviewed the draft. Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgements This research was funded by the major projects of the National Natural Science Foundation of China (22407067); Ningxia Natural Science Foundation (2023AAC03196, 2024AAC03272); University-level Special Talent Initiation Project (XT2023024). References Al-Khayri, J.M., Rashmi, R., Toppo, V., Chole, P.B., Banadka, A., Sudheer, W.N., Nagella, P., Shehata, W.F., Al-Mssallem, M.Q., Alessa, F.M., 2023. Plant secondary metabolites: The weapons for biotic stress management. Metabolites 13, 716.Andreu, A., Ćorović, M., Garcia-Sanz, C., Santos, A.S., Milivojević, A., Ortega-Nieto, C., Mateo, C., Bezbradica, D., Palomo, J.M., 2023. Enzymatic glycosylation strategies in the production of bioactive compounds. Catalysts 13, 1359.Bizuneh, G.K., 2021. The chemical diversity and biological activities of phytoalexins. Adv. Trad. Med. 21, 31-43.Buccitelli, C., Selbach, M., 2020. mRNAs, proteins and the emerging principles of gene expression control. Nat. Rev. Genet. 21, 630-644.Busnena, B.A., Beerhues, L., Liu, B., 2023. Biphenyls and dibenzofurans of the rosaceous subtribe Malinae and their role as phytoalexins. Planta 258, 78.Campos, L., López-Gresa, M.P., Fuertes, D., Bellés, J.M., Rodrigo, I., Lisón, P., 2019. Tomato glycosyltransferase Twi1 plays a role in flavonoid glycosylation and defence against virus. BMC Plant. Biol. 19, 1-17.Chen, K., Hu, Z.M., Song, W., Wang, Z.L., He, J.B., Shi, X.M., Cui, Q.H., Qiao, X., Ye, M., 2019. Diversity of O-glycosyltransferases contributes to the biosynthesis of flavonoid and triterpenoid glycosides in Glycyrrhiza uralensis . ACS Synth. Biol. 8, 1858-1866.Gupta, S., Roy, A., 2021. Deciphering the role of phytoanticipins, phytoalexins, and polyphenols in plant-insect defense. Plant-Pest Interactions: From Molecular Mechanisms to Chemical Ecology: Chemical Ecology, 305-335.Huang, L., Xiao, W.J., Wang, S., Liu, T., Wu, Z.G., Guo, L.P., 2016. The application of Rowan and its suspension cells in the study of plant stress resistance. China. Mod. Chin. Med. 18(10), 1359-1363.Hüttner, C., Beuerle, T., Scharnhop, H., Ernst, L., Beerhues, L., 2010. Differential effect of elicitors on biphenyl and dibenzofuran formation in Sorbus aucuparia cell cultures. J. Agric. Food. Chem. 58, 11977-11984.Isah, T., 2019. Stress and defense responses in plant secondary metabolites production. Biol. Res. 52.Jain, Z.J., Gide, P.S., Kankate, R.S., 2017. Biphenyls and their derivatives as synthetically and pharmacologically important aromatic structural moieties. Arab. J. Chem. 10, S2051-S2066.Jeandet, P. 2015. Phytoalexins: current progress and future prospects. Molecules 20(2), 2770-2774.Le Roy, J., Huss, B., Creach, A., Hawkins, S., Neutelings, G., 2016. Glycosylation is a major regulator of phenylpropanoid availability and biological activity in plants. Front. Plant. Sci. 7, 735.Li, J.X., Li, H.L., Zhou, L.Y., Huang, L., Yang, J., Zhang, W.D., Guo, L.P., 2019a. Chemical constituents and antibacterial activity of yeast-induced Rowan suspension cells. Nat. Prod. Res.Dev. 31(12), 2071-2076.Li, J.X., Mo, G., Zhou, L.Y., Liu, Y.H., Jiang, J.Y., Tan, Y.P., et al., 2019b. Full-length cloning and expression analysis of a glycosyltransferase gene from Rowan europaea. Chin. J. Exp. Tradit. Med. Formulae. (5), 6.Liao, A., Li, L., Wang, T., Lu, A., Wang, Z., Wang, Q., 2022. Discovery of phytoalexin camalexin and its derivatives as novel antiviral and antiphytopathogenic-fungus agents. J. Agric. Food. Chem. 70, 2554-2563.Liu, X., Lin, C., Ma, X., Tan, Y., Wang, J., Zeng, M., 2018. Functional characterization of a flavonoid glycosyltransferase in sweet orange ( Citrus sinensis ). Front. Plant. Sci. 9, 166.Majeed, H.N., Shaheen, S., Kashif, M., 2024. Glycosyltransferases: Unraveling Molecular Insights and Biotechnological Implications. Sci. Rev. Bio. 3, 16.Mo, G., Huang, L., Kang, L.P., Hua, G.D., Guo, L.P., 2014. Effects of different types of elicitors on the secondary metabolism of Rowan Rowan suspension cells. Chin. Mater. Med. (6), 927-931Morant, A.V., Jørgensen, K., Jørgensen, C., Paquette, S.M., Sánchez-Pérez, R., Møller, B.L., Bak, S., 2008. β-Glucosidases as detonators of plant chemical defense. Phytochemistry 69, 1795-1813.Parasecolo, L., Monsalvo, I.M., Kovinich, N., Ifa, D., 2024. Development of a Matrix-assisted laser desorption ionization high resolution mass spectrometry for the quantification of Camalexin and Scopoletin in Arabidospis thaliana . Rapid. Commun. Mass. Sp. 39(6), e9973.Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic. Acid. Res. 29, e45-e45.Rehman, H.M., Nawaz, M.A., Shah, Z.H., Ludwig-Müller, J., Chung, G., Ahmad, M.Q., Yang, S.H., Lee, S.I., 2018. Comparative genomic and transcriptomic analyses of Family-1 UDP glycosyltransferase in three Brassica species and Arabidopsis indicates stress-responsive regulation. Sci. Rep-UK. 8, 1-18.Shah, A., Smith, D.L., 2020. Flavonoids in agriculture: Chemistry and roles in, biotic and abiotic stress responses, and microbial associations. Agron. 10, 1209.Shahrajabian, M.H., Kuang, Y., Cui, H., Fu, L., Sun, W., 2023. Metabolic changes of active components of important medicinal plants on the basis of traditional Chinese medicine under different environmental stresses. Curr. Org. Chem. 27, 782-806.Shukla, P.K., Mishra, P., Mishra, N., 2019. A prospective study on emerging roles of phytoalexins in plant protection. Int. J. Pharma. Bio. Sci. 10, 186-198.Song, N., Wu, J., 2024. Synergistic induction of phytoalexins in Nicotiana attenuata by jasmonate and ethylene signaling mediated by NaWRKY70. J. Exp. Bot. 75, 1063-1080.Speeckaert, N., El Jaziri, M., Baucher, M., Behr, M., 2022. UGT72, a major glycosyltransferase family for flavonoid and monolignol homeostasis in plants. Biol. 11, 441.Yang, L., Wen, K.S., Ruan, X., Zhao, Y.X., Wei, F., Wang, Q., 2018. Response of plant secondary metabolites to environmental factors. Molecules 23, 762.Yang, Y., Liang, Y., Cui, F., Wang, Y., Sun, L., Zan, X., Sun, W., 2023. UDP-glycosyltransferases in edible fungi: function, structure, and catalytic mechanism. Fermentation 9, 164.Yuan, J., Wang, S., Liu, Y.H., Li, J.X., Zhou, L.Y., Li, Y., Zhou, L., Zhang, W.J., Guo, L.P., Huang, L.Q., 2021. A preliminary study on the memory function of European Rowan suspension cells against biological stress. China. J. Trad. Chin. Med. 46(10), 2467-2473.Zhang, R.T., Fu, Q.S., Zhang, L., Li, S.T., Guo, Y.D., Zhang, H., Li, L.Z., Li, H.P., Wang, H.S., 2017. Cloning and expression analysis of CmGnT gene in muskmelon under abiotic stress. J. Hortic. 44(7), 1379-1387.Zhang, W., Wang, S., Yang, J., Kang, C., Huang, L., Guo, L., 2022. Glycosylation of plant secondary metabolites: Regulating from chaos to harmony. Environ. Exp. Bot. 194, 104703.Zhou, L., Yang, J., Yang, G., Kang, C., Xiao, W., Lv, C., Wang, S., Tang, J., Guo, L., 2016. Biphenyl phytoalexin in Sorbus pohuashanensis suspension cell induced by yeast extract. Molecules 21, 1180.Zhou, L.Y., Li, J.X., Yang, J., Wang, S., Lv, C.G., Guo, L.P., 2021. Cloning and identification of the rhamnose synthase gene SaRHMs from Rowan europaea. Acta. Pharmacol. Sin. 56(1), 328-335. Figure legends Fig. 1 Growth of SASCs (A) YE induction at 0 h; (B) YE induction at 24 h; (C) Change in biomass of SASCs under YE induction (n=3, * significantly different under YE induction compared to 0 h, p<0.05; # significantly different under uninduced conditions compared to 0 h, p<0.05). Fig. 2 Changes in soluble protein content in SASCs at different time points of YE induction (n=3, *significantly different under YE-induced conditions compared to 0 h, p<0.05; # significantly different under uninduced conditions compared to 0 h, p<0.05). Fig. 3 (A) YE induction of relative levels of SASC differential phytoalexins at different time points; (B) Chemical structures of biphenyl phytoalexins and their glycosides identified by UPLC-Q-TOF-MS/MS. Fig. 4 The relative expression of SaUGT5 and SaUGT7 genes following treatment with YE at different times. Data were means ± SD of three biological replicates. Fig. 5 Correlation analysis of SaUGT5 and SaUGT7 gene expression with biphenyl phytoalexins content, biomass and soluble protein content. Fig. 6 (A) Chemical structures of glycosyl acceptors and donors; (B) In vitro glycosylation activity of soluble proteins; (C) Biphenyl and dibenzofuran phycocyanin biosynthetic pathway (Note: the dotted line represents the pathway is speculative and has not been confirmed). Fig. S1 (A) BPI total ion current map of SASC metabolites under different treatment; OPLS-DA analysis of control (0 h after treatment) and samples 24 h after treatment. (B) OPLS-DA score; (C) model validation; (D) Coefficients vs. VIP; (E) S-plot. Table 1 Actin, SaUGT5, SaUGT7 RT-PCR primers Primer name Sequence (5’-3’) Actin-F AGCCTTCACCATTCCAGTTC Actin-R GTCTTCGTTCGTCTTCGTCTT SaUGT5-F AATAGCGATTGCGGTTGA SaUGT5-R CCTCACTCTCCTCTCCAA SaUGT7-F TATCTTGAGGTGGCTTGA SaUGT7-R CATAGTCGCTTGGCATAG Table 2 UPLC-Q-TOF-MS/MS identification results of differential biphenyl phytoalexins under different treatments (*Labeled compounds have not been reported in the literature). No. TR (min) m/z [M-H] - Error (mDa) Formula MS/MS (-) Identification 1* 2.001 361.0724 -3.0 C 14 H 18 O 11 203.0815; 163.0418; 103.9179 aucuparin 4-O-β-D-Xyl 2 3.578 391.1021 -0.9 C 19 H 20 O 9 229.0473; 206.0795; 125.0231 noreriobofuran 5-O-β-D-Glc 3 4.47 407.1329 -1.6 C 20 H 24 O 9 317.1947; 245.0780; 230.0543; 185.0571 2’-glucosyloxy-aucuparin 4 5.019 377.1217 -0.3 C 19 H 22 O 8 327.2137; 215.0678; 171.0996 noraucuparin 5-O-β-D-Glc 5 5.418 229.0478 -3.1 C 13 H 10 O 4 214.8742; 211.1310; 181.0592 noreriobofuran 6 6.293 215.0678 -2.9 C 13 H 12 O 3 200.0446; 199.0346; 166.9901; 121.0270 noraucuparin Supplementary Material File (image6.tiff) Download 3.40 MB File (image7.tiff) Download 4.86 MB Information & Authors Information Version history V1 Version 1 17 March 2025 Peer review timeline Published BMC Plant Biology Version of Record 24 Jul 2025 Published Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords biotic stress biphenyl glycosyltransferases metabalome phytoalexins secondary metabolism Authors Affiliations wenjin zhang 0000-0002-3541-7282 [email protected] Ningxia Medical University View all articles by this author Xiaojia Zhang Ningxia Medical University View all articles by this author Le Liang Ningxia Medical University View all articles by this author Jian Yang China Academy of Chinese Medical Sciences National Resource Center for Chinese Materia Medica View all articles by this author Lanping Guo China Academy of Chinese Medical Sciences National Resource Center for Chinese Materia Medica View all articles by this author Metrics & Citations Metrics Article Usage 159 views 172 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation wenjin zhang, Xiaojia Zhang, Le Liang, et al. SaUGTs regulate YE-induced phytoalexins homeostasis in Sorbus aucuparia suspension cells. Authorea . 17 March 2025. DOI: https://doi.org/10.22541/au.174219347.79432929/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.174219347.79432929/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9fe6baa5fe5c1b23',t:'MTc3OTIzMTc0NA=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();