Synthesis and Application of Encapsulated Bifidobacterium longum for Mitigation of Liver Fibrosis via Modulation of Oxidative Stress and Inflammation in a BDL Rat Model

Synthesis and Application of Encapsulated Bifidobacterium longum for Mitigation of Liver Fibrosis via Modulation of Oxidative Stress and Inflammation in a BDL Rat Model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Synthesis and Application of Encapsulated Bifidobacterium longum for Mitigation of Liver Fibrosis via Modulation of Oxidative Stress and Inflammation in a BDL Rat Model Siavash Amiri, Mitra Motallebi, Mohsen Hemmati-Dinarvand, Merat Karimi, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7773331/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Apr, 2026 Read the published version in World Journal of Microbiology and Biotechnology → Version 1 posted 8 You are reading this latest preprint version Abstract Liver fibrosis is a progressive disorder with limited therapeutic options. Probiotics, particularly Bifidobacterium longum ( B. longum ), represent a promising microbial biotechnology approach for hepatoprotection; however, their clinical efficacy is often compromised by low gastrointestinal survival. In this study, we evaluated the effects of B. longum encapsulated in a food-grade alginate–whey protein matrix with a chitosan coating to enhance microbial stability and delivery, and its impact on liver fibrosis in a bile duct ligation (BDL) rat model. Forty-eight male Wistar rats were assigned to six groups, including controls, BDL, and BDL treated with free or encapsulated probiotics. Encapsulation substantially improved probiotic viability under simulated gastric conditions (log 9.6 vs. 3.5) and effectively reduced serum markers of liver injury (ALT, AST, LDH). Encapsulated B. longum also modulated inflammatory mediators (downregulating IL-6, TNF-α, α-SMA; upregulating IL-10), enhanced antioxidant defenses, decreased oxidative stress markers, and attenuated histological liver damage. These findings highlight encapsulation as a microbial biotechnology strategy to optimize probiotic delivery and efficacy, supporting their therapeutic potential in liver fibrosis. Probiotic Bifidobacterium Longum Mircocapsule Liver Fibrosis Inflammation Oxidative Stress Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Liver disease represents a significant global health challenge, affecting approximately 1.5 billion individuals, leading to nearly 2 million deaths annually (Devarbhavi, Asrani et al. 2023 ). Liver disorders progress through four stages, beginning with inflammation. The inflammatory response in human initiates with the release of cytokines such as IL-6 and TGF-β, leading to induction of oxidative stress characterized by lipid peroxidation and production of H 2 O 2 . This changes leads to differentiation of hepatic stellate cells (HSCs) into myofibroblasts (Berumen, Baglieri et al. 2021 ). HSCs, localized in the perisinusoidal area of liver tissue and primarily responsible for storage of retinoids, undergo differentiation to myofibroblasts which results in production of excessive amounts of extracellular matrix, containing collagen type I and III, and matrix metalloproteinase-1 (MMP1) inhibitor that accumulates in liver tissue; this differentiation also induces expression of platelet-derived growth factor (PDGF) and alpha-smooth muscle actin (α-SMA) (Berumen, Baglieri et al. 2021 ) and vascular endothelial growth factor (VEGF) which promotes HSC proliferation (Kukla 2013 ). This accumulation leads to liver fibrosis, initiating the second stage of liver disease. While liver fibrosis can be reversible depending on its progression and the extent of fibrotic tissue, failure to implement appropriate treatments can lead to cirrhosis, the third stage of liver disease. Currently, few FDA-approved drugs exist for treatment of liver fibrosis, although several are under clinical trials (Tan, Sun et al. 2021 , Devarbhavi, Asrani et al. 2023 ). Liver and intestine are in closely related anatomically, via common bile duct and portal vein, and metabolically since foods and nutrition are transferred into liver after being digested in the intestine and subsequently in other organs. This relation is called the gut-liver axis that suggests alteration in gut environment can cause changes in liver (Albillos, de Gottardi et al. 2020 ). One of these alterations is changes in gut microbiome (Chen, Yang et al. 2011 ). Probiotics, defined as microorganisms that have health benefits if consumed at adequate amount, can balance disturbed gut microbiome (Amirreza, Reza et al. 2016 ). They also can produce and release several metabolites which may have antioxidant and anti-inflammatory effects, and they can also compete with pathogens for food and adhesive sites and induce gut and liver health (Wang, Wu et al. 2017 , Cristofori, Dargenio et al. 2021 , Zheng, Zhang et al. 2023 ). Bifidobacterium longum (B. longum) is a probiotic and a part of human gut microbiome (Quigley 2017 ). This rod shaped, gram-positive probiotic has antioxidant activity, immunomodulatory and anti-inflammatory effects that has been observed to be helpful in curing several intestine and metabolic disorders. B. longum can modulate gut-liver axis, restoring gut microbiome, producing metabolites such as short-chain fatty acids (SCFAs) such as butyrate, helping with maintaining gut integrity and modulating anti-inflammatory responses. This probiotic can also reduce oxidative stress, modulate inflammatory response through down-regulating inflammatory cytokines, and inhibit fibrosis pathways such as reducing collagen deposition by downregulating α-SMA (Lee, Shin et al. 2024 , Lu, Shataer et al. 2024 , Zhang, Xu et al. 2024 ).Therefore, may be beneficial in alleviating liver fibrosis and even reverse its progression (Dong, Ping et al. 2022 , Wang, Wang et al. 2023 ). Probiotics are often consumed orally which means passing through acidic and enzymatic environment of gastrointestinal tract (GIT) (Centurion, Basit et al. 2021 ). This environment reduces probiotics viability and may reduce their effectiveness. A method to enhance their viability of probiotics in GIT is microencapsulating them with several materials such as carbohydrates, proteins and oils (Gbassi and Vandamme 2012 ). Alginate and whey protein are two substances that can be used in microencapsulating of B. longum and is suggested that will induce their viability in GIT (de Araújo Etchepare, Nunes et al. 2020, Krunić and Rakin 2022 ). Microcapsules can further be coated by chitosan to increase protection furthermore. Alginate and chitosan are insoluble in the stomach's acidic environment, but soluble in alkaline conditions of intestine, meaning that they can keep their integrity in stomach and be digested in intestine; thus, keeping probiotics safe in gastric juice and release them in intestine so probiotics can exert their effects (Kowalska, Ziarno et al. 2022 , Wang, Gao et al. 2022 ). Also, alginate and chitosan can be used as prebiotics, meaning that they can be consumed and metabolized by the probiotics and gut microbiome which enhances their growth and activity and can help restore dysbiosis (Jantarathin, Borompichaichartkul et al. 2017 , Wang, Gao et al. 2022 ). In addition, whey protein is demonstrated to have anti-oxidant and anti-inflammatory properties which can help reduce or reverse hepatic fibrosis progression (Corrochano, Buckin et al. 2018 , Arranz, Corrochano et al. 2019 , Mohammed, Mubarak et al. 2024 ). several methods can be used in order to induce liver fibrosis such as chemical usage such as CCl 4 , and physical methods such as bile duct ligation (BDL). In BDL method as the common bile duct is sutured sideways and cut in the middle, creates a cholestatic state and the back push of biliary acids induces oxidants and inflammation and initiates fibrosis progression (Takahashi and Fukusato 2017 ). Since there is no evidence of the effects of encapsulated B. longum on experimental model of liver fibrosis, we hypothesize that oral supplementation with microencapsulated B. longum will attenuate liver fibrosis in a rat model of bile duct ligation (BDL) by reducing oxidative stress, inflammation, and collagen deposition and intestinal barrier function enhancement. In this experiment we aim to firstly determine the structure of microcapsules, their efficiency and protection against different GIT environment. We also measure liver enzymes activity such as ALT, AST, ALP and LDH, total and free bilirubin levels. We also aim to determine malondialdehyde (MDA), nitric oxide (NO), glutathione (GSH), total antioxidant capacity (TAC), total oxidant status (TOS), catalase (CAT), superoxide dismutase (SOD) and oxidative stress index to determine the oxidative/ anti-oxidative status. We also investigated the gene expression level of TNF-α, IL-10, IL-6 and α-SMA in liver to determine treatment efficiency and ZO-1 in ileum to evaluate gut barrier integrity. Histopathologic parameters in ileum and liver will also be studied in addition to biochemical assays in an experimental model of induced hepatic fibrosis by BDL in rat. Material and methods Ethics statement of the study This study was approved by Kashan University of Medical Sciences' Ethics Committee, Kashan, Iran under the code: IR.KAUMS.AEC.1402.013 . in order to minimize suffering in rats, all the procedures were performed under university's ethical guidelines. Probiotic strain preparation Fara Daru company, Tehran, Iran kindly provided us with B. longum in lyophilized powder form. Firstly 100 mg of the probiotic powder was dissolved in 1 ml of normal saline buffer. Then, serial dilution was performed and probiotics were cultured in bifidobacterium agar medium via pour plate method. Plates were incubated in an anaerobic jar (Don-Whitely jar gassing system) at 37 ºC for 72 hours. After that number of colonies were counted and the dosage of B. longum was determined \(\:{10}^{11}\) CFU/gr. B. longum microencapsulation Microencapsulation was carried out using extrusion method. Firstly, a mixture of alginate (2% w/v), whey protein concentrate (2% w/v) was prepared. Then 100 mg of probiotic powder was added to each 1 ml of the mixture and stirred until they were dissolved completely. Then the mixture was pushed through an insulin syringe (30G) into calcium chloride (5.5% w/v) to create microcapsules in spherical shape, and left there for 30 min to reach adequate hardening. Then the microcapsules were collected using Whatman 41 filter papers and washed with distilled water for 3 times. Next, they were added to chitosan solution (0.4% w/v) and softly shaken for 30 min for coating of microcapsules. At the end, microcapsules were collected using filter papers and washed once with distilled water. Microcapsule's structure analysis SEM imaging was done using electron microscope (VEGA\\TESCAN-XMU) in Razi Metallurgical Center, Tehran, Iran to investigate the size and shape of microcapsules. In order to determine the structure and chemical properties of the microcapsules, FTIR analysis was performed from 400 nm to 4000 nm wavelength via (name of the instrument) in Razi Metallurgical Center, Tehran, Iran. Encapsulation efficiency We used freshly prepared microcapsules to determine the efficiency of our encapsulation method, 1 ml of microcapsules was added to sodium citrate solution (10% w/v) and shaken until completely dissolved. Then we performed serial dilution and probiotic were cultivated via pour plate method. The encapsulation efficiency (%) was calculated via the following formula: $$\:\frac{N}{Nº}\:\times\:100$$ In this formula N is the log 10 of colony count of 1 ml of encapsulated probiotic and Nº is the log 10 of colony count of 100 mg of free probiotic. Measuring capsule's diameter In order to measure produced capsule's, 50 capsules were randomly selected and their diameter was measured using the Image J program. The data is measured and presented as mean ± SD based on millimeters. B. longum Viability in Stimulated Gastrointestinal Environment The viability of free and encapsulated B. longum formulations was assessed using a modified method described by Yasmin et al (Yasmin, Saeed et al. 2019 ). Simulated gastric juice (SGJ) was prepared by dissolving 3.0 g/L pepsin and 9.0 g/L sodium chloride in sterile solution, adjusting the pH to 2.0 with 12 mol/L HCl. Before use, SGJ was pre-warmed to 37°C. 100 milligrams of free probiotics and 1 mL of microcapsules were separately incubated in 9 mL of SGJ at 37°C with constant agitation. Probiotic survival was determined at 30, 60, 90, and 120 min. For free cells, the SGJ mixture was centrifuged at 3000 × g for 10 min. The pellet was washed once, resuspended in MRS broth, serially diluted, and plated on bifidobacterium agar for colony counting. For microcapsules, the samples were washed with sterile distilled water, dispersed in 10 mL of 10% (w/v) sodium citrate, serially diluted in MRS broth, and plated on bifidobacterium agar. Plates were incubated at 37°C for 72 hours. Stimulated intestinal fluid (SIF) was prepared by combining biliary acids (0.3% w/v), pancreatin (0.1% w/v), and sodium chloride (0.85% w/v), adjusting the pH to 8.0 with sodium hydroxide. Following a 120-min incubation in simulated gastric juice, both free and encapsulated probiotics were harvested, washed, and transferred to 9 mL of SIF. The mixture was then incubated for 30, 60, 90, and 120 min. At each time point, probiotics and microcapsules were collected, washed, serially diluted, and cultured. Colony counts were used to determine probiotic release and survival rates, expressed as log 10 CFU. Animals Forty-eight adult male Wistar rats (180–200 g) were obtained from the animal house of Kashan University of Medical Sciences. Animals were housed individually in stainless steel cages under controlled conditions (temperature: 23 ± 2°C, humidity: 55%, 12-hour light/dark cycle). Standard laboratory food and water were provided ad libitum , except for an overnight fast before surgery and euthanasia. All animal procedures adhered to the guidelines of the National Research Council Subcommittee on Laboratory Animals. Study Design A randomized experimental study was conducted to evaluate the effects of free and encapsulated probiotics on liver injury induced by bile duct ligation (BDL). Forty-eight male Wistar rats were randomly assigned to six groups (n = 8/group): Normal control (NC), sham-operated control (SHC), BDL control (BDL + vehicle), free B. longum probiotic (BDL + FP), free capsule (BDL + FC), and encapsulated B. longum probiotic (BDL + CP). Rats in group BDL + FP and BDL + CP orally received 3×10 9 CFU B. longum and the rats in group BDL + FC were fed the same amount of algiante-whey protein with chitosan coating microcapsules as the sixth group animals. 3×10 9 CFU of free and encapsulated B. longum were added to the rats’ daily food ration. Firstly, standard rat food was crushed and mixed with water to form a paste; then, the B. longum powder and free microcapsules and encapsulated B. longum was added to the paste. at last, the paste was formed to rod shape blocks and were put in refrigerator until the blocks have dried. Careful monitoring was performed to ensure that each animal consistently received the full dose throughout the duration of the study. They were treated daily 7 days before and 21 days after surgery. Animals in groups two to six received their respective treatments daily for one week before and three weeks after BDL surgery. The treatment regimen was prepared irrespective of the rats' weight, ensuring consistent dosage across the groups. Specifically, the fourth and sixth groups received \(\:3\times\:{10}^{9}\) CFU of either free or encapsulated B. longum cells. BDL surgery was performed under ketamine (75 mg/kg) and xylazine (10 mg/kg) anesthesia. After aseptic preparation, the common bile duct was doubly ligated and resected. Sham-operated animals underwent laparotomy without bile duct manipulation. Animals were euthanized by CO 2 inhalation followed by cardiac puncture for blood collection. Serum was separated from blood by centrifugation and stored at -80°C. Liver and ileum tissues were rapidly excised, with portions fixed in formalin for histopathology, and the remaining tissue snap-frozen in liquid nitrogen for biochemical and molecular analyses. Validation of Bile duct obstruction after surgery In order to validate success of our BDL surgery, we euthanized 2 rats after 3 days and 2 rats after 4 days from both sham and BDL control group (total of 8 rats) preceding the BDL surgery. Their blood serum and liver tissue were extracted and used for further testing; Liver function tests were studied to validate fibrosis initiation. Determination of treatment side effects In this study, the potential side effects associated with different treatments were evaluated by monitoring the study groups. Since liver fibrosis can cause nausea, diarrhea and constipation, the bile duct ligated rats were monitored for the mentioned side effects. These side effects included diarrhea, vomiting, and constipation, which are considered significant indicators of adverse reactions to treatment. To conduct this assessment, side effects were continuously monitored on a daily basis during one week prior to the initiation of treatment and for three weeks following surgery. This approach allowed us to closely observe changes and patterns in the occurrence of side effects, enabling us to analyze the impacts of the treatments on the rat involved in the study. Rat liver to rat body weight ratio Liver fibrosis involves the abnormal and excessive production of extracellular matrix in liver tissue, resulting in increased liver size and weight. The ratio of liver weight to mouse weight serves as an index for assessing the impact of surgical interventions and treatments on liver tissue. On the day of dissection, the weights of the rat were recorded, followed by the separation and weighing of the liver tissue. To calculate the percentage ratio of liver weight to total animal weight, the following formula was used: liver to rat weight ratio = Wl/Wt ×100 In this formula, Wl is the liver weight of the mouse, while Wt stands for total weight of an animal. Biochemical Parameter Determination Standard kits were used to measure aspartate aminotransferase (AST), alanine aminotransferase (ALT), lactate dehydrogenase (LDH), alkaline phosphatase (ALP), and total and direct bilirubin in liver homogenates using a Pars Azmoun Kit (Tehran, Iran) and a BT-3000 auto-analyzer (Biotecnica, Italy). Rat Liver Homogenate Preparation Liver samples (100 mg) were rinsed with ice-cold PBS and homogenized using liquid nitrogen. The homogenate was then resuspended in 1 mL of lysis buffer containing 10 mM (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 0.1% Triton X-100, and protease inhibitor cocktail (pH 7.9). This mixture was incubated for 15 min at 4°C, followed by centrifugation at 10,000 × g for 20 min at 4°C. Supernatants were used for subsequent analyses. Protein content in the liver homogenate was quantified using the Bradford method with bovine serum albumin as a standard. Measurement of Antioxidant Enzyme Activities and Oxidative Stress Parameters Antioxidant Enzyme Activities Superoxide dismutase (SOD) activity was measured using a commercially available SOD colorimetric assay kit (Kiazist Co., Iran) based on the nitro blue tetrazolium (NBT) method. Data are expressed as U/mg protein. Catalase activity was determined by its ability to decompose hydrogen peroxide (H₂O₂) into water (H₂O) and oxygen (O₂). Briefly, tissue homogenate was added to a 66 µM H₂O₂ solution in sodium-potassium phosphate buffer (pH 7.4). The resulting oxygen gas and water formation were quantified indirectly by measuring the absorbance of a yellow complex formed with ammonium molybdate at 374 nm after 3 min. Lipid Peroxidation Assessment Malondialdehyde (MDA) levels, a marker of lipid peroxidation, were determined using the thiobarbituric acid (TBA) method established by Ohkawa et al. (references 23, 24). Briefly, peroxidized lipids in liver tissue supernatants were reacted with TBA to form a colored complex, which was quantified by colorimetric assay at 632 nm wavelength. N-butanol was used as a blank, and tetraethoxypropane standards were used for calibration. Nitric Oxide Formation Assessment Nitric oxide (NO) levels in liver tissue homogenates were determined as the sum of nitrite and nitrate concentrations using the Griess reagent assay. The Griess reagent reacts with nitrite to form a deep purple azocompound, allowing for quantification through photometric analysis with sodium nitrate as the calibration standard. Thiol Groups Assay Thiol groups, essential antioxidants, were measured in liver homogenates using the Ellman method. This method utilizes the reaction between DTNB (5,5′-dithiobis-(2-nitrobenzoic acid)) and free thiol groups to produce a yellow complex. Absorbance was measured at 412 nm after incubation and centrifugation. Total Antioxidant Capacity Measurement The ferric reducing antioxidant power (FRAP) assay was employed to assess total antioxidant capacity. FRAP reagent, prepared with acetate buffer, TPTZ (2,4,6-tripyridyl-s-triazine), and FeCl₃, reduces Fe³⁺-TPTZ complex to Fe²⁺ at low pH, resulting in a blue color. Sample absorbance was measured at 593 nm after incubation with FRAP reagent (references 27–29). FeSO₄.7H₂O standards were used for calibration. Total oxidant status measurement The Total Oxidative Status (TOS) method was employed to assess the oxidation potential of the sample. Briefly, in an acidic environment, ferric ions (Fe³⁺) react with xylenol orange to form a colored complex. TOS measures were reported in micromoles of hydrogen peroxide (H₂O₂) concentration per liter, following calibration with H₂O₂. RNA Extraction and cDNA Synthesis Total RNA was extracted from 30 mg liver tissue using a column-based kit (DNAbiotech, Tehran, Iran) according to the manufacturer’s protocol. Briefly, 30 mg of liver tissue was homogenized and mixed with 800 µl of RNLy buffer. Then it was mixed with 150 µl of chloroform. Then the mixture was centrifuged at 12,000 × g for 12 min at 4 ºC. 450 µl of upper phase was moved to a new tube and mixed with 400 µl of ethanol 96%. The mixture was transferred to the spin column and the column was put in a collection tube and centrifuged for 1 min at 12,000 × g. Then the column was washed with 700 µl of RN wash buffer and centrifuged for 1 min. At last, the column was moved to a new tube and 50 µl of elution buffer was poured to the center of column and centrifuged for 1 min at 12,000 × g. RNA quality was verified through agarose gel electrophoresis, and quantification was performed using a NanoDrop 2000 spectrophotometer (NanoDrop Products, Wilmington, DE, USA). Subsequently, cDNA synthesis was carried out using a commercial kit (Parstous, Mashhad, Iran). Briefly, 1000 ng of total RNA was reverse transcribed into cDNA in a 20 µL reaction volume containing the supplied buffer and enzyme mix. The reaction was conducted through a temperature cycling protocol involving incubation at 25°C for 10 min, 47°C for 60 min, and 85°C for 5 min to terminate the reaction. Quantitative Reverse Transcription-Polymerase Chain Reaction (RT-qPCR) Gene expression levels of IL-6, IL-10, α-SMA, TNF-α, and ZO-1 were quantified using real-time PCR. β-actin served as the endogenous control for normalization. The reactions were performed on an iCycler IQ™ real-time PCR cycler (Bio-Rad Laboratories, CA, USA) using SYBR Green PCR Master Mix (Ampliqon, Denmark). Each 20 µL reaction mixture comprised 1 µL cDNA, 10 µL Maxima SYBR Green/ROX qPCR Master Mix 2X (Ampliqon, Bie & Berntsen, Herlev, Denmark), 8 µL nuclease-free water, and 0.5 µL of both forward and reverse primers specific to the target gene. Amplification was achieved through 40 cycles of denaturation at 96°C for 5 seconds, annealing at 49.6°C for 30 seconds, and extension at 72°C for 30 seconds, preceded by an initial polymerase activation step at 95°C for 30 min. Relative gene expression was calculated using the comparative Ct method. The ΔCt value, representing the difference in Ct values between the target gene and β-actin,Δ Ct = Ct (Target) − Ct ( β -actin), was determined for each sample. Subsequently, fold changes in gene expression were calculated using the \(\:{2}^{-\varDelta\:\varDelta\:ct}\) formula. The primer sequences and properties are shown in Table 1 . Table 1 sequences and properties of primers used in evaluating gene expression in this study Gene Forward Primer Reverse Primer Annealing TM Product size Β Actin CTGTGTGGATTGGTGGCTCT CAGCTCAGTAACAGTCCGCC 60.0 135 SMAα CAGCTATGTGGGGGACGAAG TCCGTTAGCAAGGTCGGATG 60.0 168 TNFα ATGGGCTCCCTCTCATCAGT GCTTGGTTTGCTACGAC 57.0 106 6IL- CTCTCCGCAAGAGACTTCCA TCTGTTGTGGGTGGTATCCT 56.0 120 10IL- GCAGGACTTTAAGGGTTACTTGG GGGGAGAAATCGATGACAGC 58.6 181 Histopathological Examinations Liver and terminal ileum tissues were subjected to histopathological analysis. Specimens were initially immersed in a 10% neutral formalin buffer, subsequently embedded in paraffin, and sectioned into 5-micrometer-thick slices. Hematoxylin and eosin (H&E) staining was employed to assess general histological features, while Masson's trichrome staining was utilized to quantify liver fibrosis through collagen deposition. An experienced pathologist determined the Metavir score and fibrosis stage based on H&E-stained sections. Histological characteristics, including necrosis, inflammation, ductal hyperplasia, and fibrosis, were graded using the H&E-stained slides. To establish a standardized scoring system, a mean score was calculated across ten randomly selected fields per section. Liver lesions were categorized according to the following criteria: fibrosis (absent, fibrous portal expansion, septal formation, marked bridging fibrosis, cirrhosis), necrosis (absent, focal necrosis affecting 50% of tissue, global hepatocyte necrosis), ductal hyperplasia (absent, hyperplasia involving 50% of each liver lobule, global hyperplasia), and inflammation (absent, focal inflammation affecting 50% of tissue, global inflammation). Histological modifications within the ileum were evaluated based on inflammatory infiltrate (absent, increased inflammatory cells, infiltration of submucosa, infiltration of muscle layer), goblet cell loss (healthy goblet cells, loss in 50% of tissue), and crypt density (healthy crypts, reduced crypts in 50% of tissue). Determination of rats' survival rate during treatment Following the surgical procedure for common bile duct obstruction and the induction of a liver fibrosis model, some rats died due to liver damage, underscoring the negative impact of surgery on their hepatic health. To evaluate the effects of various treatments on mouse survival, a study was conducted to compare survival rates across different groups. The survival rate was calculated by determining the ratio of surviving rat at the end of the study to those present at the beginning, expressed as a percentage using the formula (Nl/Nf) ×100 where Nl is the number of survivors on the last day and Nf is the number on day one. This investigation provides insights into treatment efficacy and potential side effects, which may inform future therapeutic strategies for liver diseases. Statistical analysis Data are presented as the mean ± standard deviation (mean ± SD) and were subjected to statistical analysis using one-way analysis of variance (ANOVA) followed by Dunnett’s post hoc test. Independent T-test was used for analysis between two groups. The significance threshold for all tests was set at P ≤ 0.05. Data management and analysis were conducted using SPSS version 27 and GraphPad Prism version 10. Results FTIR analysis of encapsulated B. longum The chitosan spectrum is identified by several peaks which are characteristic of the polymer. Importantly, there are strong absorption bands near 3400 cm − 1 owing to O-H and N-H stretching vibrations because they confirm that there are hydroxyl and amine groups present. Peaks around 2900 cm − 1 represent C-H stretching vibrations. There is also one peak near 1650 cm − 1 , which can be attributed to the amide I band that represents the C = O stretching of the amide group. The peak about 1550 cm − 1 corresponds to the amide II band, which relates to the N-H-bending and C-N-stretching vibrations. All the peaks in the region 1000–1200 cm − 1 can be said to arise from C-O stretching vibrations. The Free Capsule spectrum produced peaks that closely match those of Chitosan, although there are differences in intensity and location of these peaks. The broad band around 3400 cm − 1 indicates the presence of O-H and N-H stretching vibrations. The peaks around 2900 cm − 1 are due to C-H stretching vibrations. Amides I and II can be seen around 1650 and 1550 cm − 1 , respectively. The peaks in the range of 1000–1200 cm − 1 are indicative of C-O stretching vibrations. The variances in peak intensity and position compared to Chitosan suggest interaction between the capsule and Chitosan. Distinct peaks represent the Functional groups present in Free Probiotic material. Broad peaks appear around 3400 cm − 1 due to O-H and N-H stretching vibrations. Similar peaks near 2900 cm − 1 indicate stretching vibrations of C-H. The amide I and amide II bands could be observed around 1650 cm − 1 and 1550 cm − 1 , respectively. The peaks between 1000 and 1200 cm − 1 are attributed to the stretching vibrations of C-O: pointing to these functional groups that characterize the probiotic material. In the Encapsulated Probiotic spectrum, peaks are seen to be characteristic of both the probiotic material and the encapsulating agents (alginate-whey protein with Chitosan coating). The broad peak near 3400 cm − 1 indicates the presence of O-H and N-H stretching vibrations. Peaks around 2900 cm − 1 show C-H stretching vibrations. The amide I and amide II bands are around 1650 cm − 1 and 1550 cm − 1 , respectively, while 1000–1200 cm − 1 regions show peaks indicating C-O stretching vibrations. Thus, these peaks indicated that encapsulation of probiotic material was done successfully using alginate-whey protein and Chitosan coating (Fig. 1 ). FTIR spectra provide meaningful information regarding functional groups in samples. The characteristic peaks present in the Chitosan spectrum indicate hydroxyl, amine and amide groups. In the Free Capsule spectra, similar peaks were obtained but varying in intensity and position. This is an indication of interactions between the capsule components and Chitosan. The Free Probiotic spectrum indicates distinct peaks that denote the probiotic material. The Encapsulated Probiotic peaks are characteristic of both the probiotic material and agents encapsulating them. This indicates successful encapsulation. This analysis gives insight into chemical interactions besides structural integrity of the encapsulated probiotic since this is relevant in developing good encapsulation techniques for B. longum with alginate-whey protein and Chitosan coating. Investigating morphology by SEM imaging of encapsulated B. longum Scanning electron imaging (SEM) showed rod-shaped B. longum probiotic at 10,000x magnification. SEM also showed spherical shaped microcapsules made from alginate-whey with chitosan coating with rough surface in 60x magnification and their size was determined to be almost 2000 µm in diameter. In 10,000x magnification the matrix of free capsules is visible and in encapsulated probiotics, the probiotics are seen embedded in capsule's matrix in the microcapsule's surface (Fig. 2 ). These pictures show that in encapsulated B. longum the probiotic cells are clearly visible on the surface of microcapsules, indicating that the probiotics are embedded in microcapsule's matrix. Alginate-whey protein with chitosan coating capsule's diameters were calculated to be 1.91 ± 0.19 (Mean ± SD) millimeters using the Image J program. After encapsulating \(\:3\times\:{10}^{9}\) CFU of B. longum , the capsules were resolved in sodium citrate (10% W/V) and cultivated. Then the cultivated colonies were counted and the efficiency of encapsulation was calculated to be 80% based on the formula on section 2.5. Free and encapsulated B. longum viability in stimulated gastrointestinal environment The survival rate of free and encapsulated B. longum after four 30-min intervals in SGJ is reported in Table 2 . Both free and encapsulated probiotic's dose was set to 10, based on log 10 , and after 120 min, free probiotic's viability reduced to 3.50 while encapsulated probiotics viability fell to 9.47 after 120 min. Table 2 survival rate of free and encapsulated B. lognum in 0, 30, 60, 90 and 120 mintues in stimulated gastric juice Time in SGJ Free B. longum Encapsulated B. longum 0 10 10 30 9.71 9.79 60 9.204 9.72 90 4.612 9.6 120 3.501 9.47 After 120 min in SGJ, free and encapsulated probiotics were extracted and moved to SIF and their determined survival and release after 30, 60, 90, and 120 min in SIF is reported in Table 3 . Free probiotic's survival rate fell from 3.50 to 2.47 in 60 min and to 0 in 90 min. During the 120 min in SIF the probiotic count was reduced from 9.47 to 1.1 in 90 min and to 0 in 120 min (Table 3 ). Table 3 survival rate of free and encapsulated B. lognum in 0, 30, 60, 90 and 120 mintues in stimulated intestinal fluid Time in SIF Free B. longum Encapsulated B. longum 0 3.501 9.47 30 2.69 6.58 60 2.47 2.3 90 0 1.1 120 0 0 Side effects of treating rats with our three treatments This study examined the effects of both free and microencapsulated B. longum , specifically within alginate-whey microcapsules coated with chitosan, in a rat model. The experimental timeline comprised one week of pre-treatment observation followed by three weeks of post-treatment monitoring. Over the four-week duration, no gastrointestinal adverse effects—including diarrhea, vomiting, constipation, or anorexia—were detected in any of the subjects. These results suggest that the administered probiotic formulations might exhibit a favorable safety profile, with no evidence of adverse effects in the treated groups. Also, no gastrointestinal side effects were detected in the bile duct ligated rats. However, more precise cytotoxicity assays are required to ensure the safety profile of this treatment. Validation of Bile duct obstruction after surgery The results demonstrated that the liver enzymes ALT, AST, ALP, and LDH, as well as total and direct bilirubin, were significantly elevated in the 3-day bile duct ligation (BDL) groups compared to their corresponding sham-operated groups (3-day Sham). This indicates the onset of liver injury following common bile duct obstruction surgery. The findings revealed the deposition of fibrous tissue in the liver and the initiation of fibrosis as early as the third day post-BDL surgery, confirming the progression of liver damage. The data are presented in Table 4 . Table 4 The effect of bile duct ligation after 3 days on rat liver function tests. Group 3-Day sham 3-day BDL AST 198.5 ± 67.15 1714.5 ± 89.8 *** ALT 79 ± 4.94 1972 ± 259.5 *** ALP 556 ± 161.22 6038 ± 994.19 ** LDH 1287 ± 626.49 25347 ± 957.42 **** Total bilirubin 0.07 ± 0.02 5.8 ± 0.84 *** Direct bilirubin 0.045 ± 0.007 4.21 ± 0.29 *** Data are presented as mean ± standard deviation. Abbreviations: BDL, bile duct-ligated mice; AST, aspartate aminotransferase; ALT, alanine aminotransferase; ALP, alkaline phosphatase; LDH, lactate dehydrogenase; FP, free probiotic; FC, empty capsule; CP, encapsulated probiotic. Asterisks indicate significant differences compared to the BDL control group (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, **** P ≤ 0.001). independent T-test was used for analysis between the two groups (number of rats per group = 8) Consequently, the treatment of mice was initiated on the third day after surgery, coinciding with the onset of hepatic fibrotic processes Rat liver to rat body weight ratio Results from this analysis are given in Fig. 3 . In addition, the percentage of liver weight over rats' weight for each group was calculated. As illustrated in the chart, the ratio (percentage) of liver weight to body weight was significantly different in the BDL + vehicle group compared to the Sham group, which present enlarged and heavier livers, with P ≤ 0.0001. Within the treatment groups, the probiotic-coated treatment group demonstrated a significant decrease in the liver-to-body weight ratio compared with the BDL + vehicle group at P ≤ 0.01, hence indicating that for this group liver weight was substantially lower when placed side by side with the nontreated lot. In the free probiotics-treated group, there is a reduction of liver-to-body weight ratio, but such was not statistically significant. There were also no significant differences among the various treatment groups, and between the two control groups, healthy and Sham. Effects of encapsulated B. longum on biochemical parameters Serum levels of liver enzymes, including alkaline phosphatase (ALP), aspartate aminotransferase (AST), alanine aminotransferase (ALT), and lactate dehydrogenase (LDH), as well as total and direct bilirubin, were significantly elevated in the bile duct ligation (BDL) group compared to sham or healthy controls (p ≤ 0.05 for ALP, AST, LDH; p ≤ 0.0001 for total and direct bilirubin). These findings indicate the successful induction of liver injury in the BDL model. Administration of encapsulated and free B. longum resulted in a significant reduction in serum levels of total and direct bilirubin (p ≤ 0.05), as well as ALP, AST, LDH, and ALT (p ≤ 0.01 for ALP, AST, LDH; p ≤ 0.001 for ALT) compared to the BDL + vehicle group. These results suggest that encapsulated probiotics may effectively mitigate liver injury induced by bile duct obstruction. Also, alginate-whey protein with chitosan coating capsules reduced ALP activity (p ≤ 0.001), and direct and total bilirubin levels significantly (p ≤ 0.05 and p ≤ 0.01 respectively) compared to the BDL + vehicle group. In the comparison among the treatment groups, no significant differences were observed in the reduction of the activities of the enzymes ALT, AST, and ALP, as well as in the serum levels of total and direct bilirubin among all three treatment groups. However, the reduction in LDH activity in the group treated with microencapsulated probiotics was significantly greater than that in the free probiotic group (P ≤ 0.05). Liver enzyme activity and bilirubin levels are illustrated in the charts in Fig. 4 . Effect of free and encapsulated B. longum on gene expression The expression of inflammatory cytokines, IL-6 and TNF- α was significantly increased (P ≤ 0.0001 and P ≤ 0.01 respectively) in BDL + vehicle compared to healthy control (HC). Treatment with free B. longum significantly reduced IL-6 and TNF-α expression levels compared to BDL + vehicle group (P ≤ 0.05 and P ≤ 0.001) and treatment with alginate-whey with chitosan coating reduced the gene expression of IL-6 and TNF-α significantly (P ≤ 0.05 and P ≤ 0.01). The expression of these genes was significantly downregulated in rats treated with encapsulated probiotics, P ≤ 0.0001 for IL-6 and P ≤ 0.001 for TNF-α when compared to BDL + vehicle group. Although the decrease of gene expression was greater in encapsulated probiotic treatment group compared to other treatments, this reduction was not significant between the treatment groups. IL-10, being an anti-inflammatory cytokine, decreased significantly in BDL + vehicle group compared to the healthy control (HC) group (P ≤ 0.001). Among the treatment groups, although the free probiotic treatment resulted in some increase in this gene's expression, this increase was not significant compared to the BDL + vehicle group. Additionally, no change in IL-10 gene expression was observed in the microcapsule treatment group compared to the BDL + vehicle group. The expression of this interleukin in the microencapsulated probiotic treatment group was significantly reduced (P ≤ 0.01) compared to the BDL + vehicle group. Alpha-smooth muscle actin (α-SMA) is a marker of the activation of stellate cells and their differentiation into myofibroblasts. In the BDL + vehicle group, the expression of this gene showed a significant increase (P ≤ 0.001) compared to the healthy control (HC) group. In the treatment groups, no significant change in the expression of this protein was observed in the microcapsule treatment group compared to the BDL + vehicle group; however, significant reductions were noted in the free probiotic and microencapsulated probiotic groups, with significance levels of P ≤ 0.01 and P ≤ 0.001, respectively. When comparing the treatment groups, a significant difference (P ≤ 0.05) was observed between the free probiotic and microencapsulated probiotic treatment groups. All data are illustrated in Fig. 5 . Effect of free and encapsulated B. longum on oxidative stress parameters Total antioxidant capacity (TAC) was significantly decreased in the BDL + vehicle group when compared with the Sham group (P ≤ 0.05). Both the free probiotic and microencapsulated probiotic groups showed a significant rise (P ≤ 0.01) compared with the BDL + vehicle group. The single microcapsule treatment group increased the total antioxidant index (P ≤ 0.05), which was less than the increase seen in the other two groups, and there is no significant difference between those two groups. Additionally, there were no significant differences among the free probiotic and microencapsulated probiotic treatment groups. The total oxidant status (TOS) showed a significant increase (P ≤ 0.01) in the BDL + vehicle group compared to the Sham group. In treatment with free probiotics and alginate-whey capsules with a chitosan coat, a significant reduction happened versus BDL + vehicle with significance defined by the values of P ≤ 0.01. The encapsulated B. longum showed a high, meaningful decline opposed to the BDL + Vehicle with P ≤ 0.001. There were no significant differences when comparing treatment groups to one another. The results of superoxide dismutase (SOD) activity assay indicated that the activity of this enzyme was significantly reduced (P ≤ 0.001) in the BDL + vehicle group compared to the Sham group. In the groups treated with free probiotics and free microcapule's an increase in enzyme activity was observed; however, this increase was not statistically significant compared to the BDL + vehicle group. Conversely, in the group treated with the encapsulated probiotic, an increase in enzyme activity was noted with a significance level of (P ≤ 0.05). When comparing the treatment groups, although the encapsulated probiotic group exhibited higher enzyme activity, this increase was not statistically significant when compared to the groups treated with free probiotics and alginate capsules. Nitric oxide (NO) is an oxidative marker that can be measured using the Griess method, and the results indicated a significant increase (P ≤ 0.05) in nitric oxide levels in the BDL + vehicle group compared to the Sham group. In the treatment groups, all three groups exhibited a decrease in nitric oxide levels; however, this difference was statistically significant (P ≤ 0.05) only in the groups treated with free probiotics and encapsulated probiotics compared to the BDL + vehicle group. In contrast, the group treated with alginate capsules did not show a significant reduction. No significant changes were observed among the three treatment groups when compared to each other. Malondialdehyde (MDA) is an indicator of lipid peroxidation and was quantified using the thiobarbituric acid (TBA) method. In the BDL + vehicle group, MDA levels exhibited a significant increase (P ≤ 0.01) compared to the Sham group. The treatment groups with free probiotics and free microcapsules demonstrated a significant reduction (P ≤ 0.01) in lipid peroxidation and MDA levels when compared to the BDL + vehicle group. Additionally, the group treated with the encapsulated probiotic also showed a significant decrease with a significance level of (P ≤ 0.001) relative to the BDL + vehicle group. No significant differences were observed among the three treatment groups when compared to one another. All data are illustrated in Fig. 6 . Effects of free and encapsulated B. longum on liver tissue Following the preparation and staining of liver tissue slides, the slides were examined by a pathologist. Histopathological indices—including biliary duct hyperplasia, necrosis, fibrosis, and inflammation—were scored based on the Metavir scoring system, ranging from 0 to 4. The histopathological results revealed a significant increase in inflammation, necrosis, biliary duct hyperplasia, and fibrosis in the BDL + vehicle group compared to the Sham group ( P ≤ 0.01, P ≤ 0.0001, P ≤ 0.01, and P ≤ 0.05, respectively), indicating substantial tissue damage induced by bile duct ligation (BDL) surgery. In the treatment groups, administration of the microcapsule alone led to a significant reduction in tissue necrosis ( P ≤ 0.01), while no significant changes were observed in the other indices. Treatment with free B. longum also resulted in a significant decrease in tissue necrosis ( P ≤ 0.001). Although reductions were noted in inflammation, biliary duct hyperplasia, and fibrosis, these changes were not statistically significant. Conversely, treatment with microencapsulated B. longum significantly reduced Metavir scores for inflammation, necrosis, and fibrosis ( P ≤ 0.0001, P ≤ 0.01, and P ≤ 0.05, respectively). While a decrease in biliary duct hyperplasia was also observed, this change did not reach statistical significance (Fig. 7 ). The pictures of liver tissue with H&E staining are shown in Fig. 8 with X100 and X400 magnification. Effects of free and encapsulated B. longum on ileum tissue Histopathological examination of ileal tissue assessed the effects of different treatments by evaluating inflammatory cell infiltration, submucosal inflammation, goblet cell depletion, crypt density and hyperplasia, muscle layer thickening, and the presence of ulcers and abscesses. The BDL + vehicle group showed significantly increased inflammatory cell infiltration (0.58 ± 0.33), crypt density (1.67 ± 0.58), and goblet cell depletion (0.58 ± 0.33) compared to the Sham group (all scores 0), while other indices remained unchanged. This group also exhibited reduced villi and crypt counts along with elongated villi, unlike other groups. In contrast, treatment with free B. longum , microencapsulated B. longum , and empty microcapsules resulted in normal ileal architecture, with all histopathological scores matching the Sham group (zero across all indices), indicating no pathological changes (Table 5 ). The pictures of ileum tissue are shown in Fig. 9 . Table 5 The histopathological effects of free B. longum probiotic, alginate-whey protein-chitosan encapsulated B. longum , and empty alginate-whey-chitosan capsules on illeum tissue histological parameters Groups NC SHC BDL + Vehicle BDL + FP BDL + FC BDL + CP Inflammatory cell infiltration 0 0 0.33 ± 0.58 0 0 0 submucosal inflammation 0 0 0 0 0 0 goblet cell depletion 0 0 0.33 ± 0.58 0 0 0 crypt density 0 0 1.67 ± 0.58 0 0 0 Crypt hyperplasia 0 0 0 0 0 0 muscle layer thickening 0 0 0 0 0 0 ulcers and abscesses Not seen Not seen Not seen 0 0 0 Description - - Loss of villi number and increase in their length were seen - - - Survival rate of rats during the study In this study, the survival rates of rats in the various control and treatment groups were calculated. It was found that all rat in the healthy control (HC) and sham control (SHC) groups exhibited the highest survival rates (100%), while the group subjected to bile duct ligation plus vehicle (BDL + vehicle) had the lowest survival rate at 30%, as they did not receive any treatment. Among the treatment groups, the highest survival rate was observed in the group treated with microencapsulated probiotics (70%). The groups treated with free probiotics and microcapsules demonstrated survival rates of 60% and 50%, respectively. Discussion Liver disease is a significant health burden worldwide, affecting approximately 1.5 billion people and causing almost 2 million deaths annually. The pathogenesis of liver diseases starts with inflammation, mediated by cytokines such as IL-6 and TGF-β, which induce oxidative stress and differentiation of HSCs into myofibroblasts. This leads to excessive extracellular matrix production, culminating in liver fibrosis. Untreated liver fibrosis can progress to cirrhosis, for which limited FDA-approved treatments are available. The close anatomical and metabolic relationship between the liver and intestine, also known as the gut-liver axis, suggests that disturbances in gut microbiota have a significant impact on the liver. Probiotics, such as B. longum , exert beneficial effects on the gut-liver axis by restoring the balance of the gut microbiome through antioxidant and anti-inflammatory mechanisms. Despite their potential, probiotics often face viability challenges in the gastrointestinal tract, which can be improved by microencapsulation techniques using materials such as alginate and whey protein. This study is based on the hypothesis that microencapsulated B. longum ameliorates liver fibrosis in a bile duct ligation rat model through reduction of oxidative stress and inflammation and enhancement of intestinal barrier function. SEM imaging showed that capsules were formed in spherical shapes with 2000 µm diameter which is favorable for adding to rat's standard food. SEM imaging also showed that B. longum was embedded into the surface of capsules matrix of alginate-whey protein indicating successful encapsulation of probiotics. This was further proved by FTIR analysis which demonstrated that probiotics were able to alter and form new chemical bonds with alginate and whey protein; indicating that B. longum successfully altered capsule's composition. These two tests indicated that probiotic cells were successfully entrapped inside the microcapsules. The efficiency of encapsulation was further evaluated and calculated to be 99%, which is higher than the results obtained from other studies that used the same material for encapsulation (Yasmin, Saeed et al. 2019 ); the higher efficiency and lowered probiotic cells loss may be due to several factors such as nozzle size, alginate-whey matrix concentration, and calcium chloride solution concentration, which can affect microcapsule's parameters such as shape, hardness and matrix formation. Also, the diameter of capsules (1.91 ± 0.19 millimeters) is considered to be in the micro scale (Singh, Hemant et al. 2010 ), meaning that our capsules can be considered as microcapsules. Our goal in encapsulating B. longum was not only to increase the resistance of this probiotic but also to assure its survival in the gastrointestinal transit and its active release in the intestine. To understand the protective effect of encapsulation, we tested the viability of the probiotics in SGJ. According to our result, free probiotic cells were sensitive to SGJ's acidic condition and pepsin activity, and their viability losses reached 3.5 log, as also represented in literature (Faisal Shahbaz Akram, Ashraf et al. 2017 ). By contrast, encapsulated probiotics showed higher viability, with a reduction of only 0.53 log after 120 min in SGJ, which reflected the protection given by the microcapsules. This increase in the viability of encapsulated B. longum agrees with the findings of Takahashi et al., who observed that B. longum encapsulated with alginate, whey and chitosan exhibited better resistance to SGJ compared to free cells (Takahashi, Xiao et al. 2004 ). In SIF probiotic cells' viability also reduced sharply from 3.50 to 0 in 90 min which is due to probiotic cells' sensitivity to bile acids and pancreatic enzymes (Ji, Wu et al. 2019 , Astó, Huedo et al. 2021 ). Alginate and chitosan dissolve under alkaline conditions, meaning that when microcapsules pass to the intestine from the stomach, they will be degrading, thereby facilitating the release of probiotics (Kalogeropoulou, Papailiou et al. 2023 ). Our result showed that encapsulated B. longum count also significantly reduced at intestine level due to the digestion of the microcapsule and B. longum was released from their matrix. The materials used in the treatment of rats (alginate, whey protein, chitosan and lyophilized B. longum ) are individually recognized as safe food additives based on their application (Turck, Castenmiller et al. 2019 , Buyukyoruk 2021 , Bampidis, Azimonti et al. 2022 ). However, few studies were conducted on their side effects and cytotoxicity on cell cultures when the materials are used in form of microcapsules alongside each other. Our study was limited by the lack of cytotoxicity assays on cell cultures, as we assumed, based on the available literature, that these materials do not have cytotoxic effects when used in the form of microcapsules. However, the rats were monitored for any adverse gastrointestinal effects during the treatment period on a daily basis. During this 4-week treatment no gastrointestinal side effects, such as diarrhea or vomiting, were observed; suggesting that encapsulated B. longum is a safe treatment for rats during a 4-week period. Due to the lack of cytotoxicity assays in our study, we suggest that in vitro studies be carried out to determine the adverse effects of our treatment on cellular level. In animal models of liver fibrosis, a change in the liver-to-body weight ratio can indicate the severity of fibrosis (Lai, Park et al. 2024 ). Therefore, based on our findings, it can be concluded that the significant increase of liver-to-body weight ratio in BDL + vehicle compared to sham control indicates liver fibrosis, which is in line with other studies (Sharawy, Abdel-Rahman et al. 2018 ). The liver-to-body weight ratio in encapsulated B. longum was significantly reduced compared to the BDL + vehicle group, which might indicate that our treatment was able to reduce fibrosis by a significant amount. Although there are several studies on the efficiency of B. longum on alleviating liver fibrosis, few evidence are available on its effect on liver-to-body weight ratio (Sharawy, Abdel-Rahman et al. 2018 , Hizo and Rampelotto 2024 , Lee, Shin et al. 2024 , Li, Chi et al. 2024 ). Our study suggests that even though free B. longum has reduced the liver-to-body weight ratio, the decrease was not significant. The higher efficiency of encapsulated B. longum treatment might be attributed to higher viability and delivery of probiotic cells during gastrointestinal transit. To determine and evaluate the efficiency of treatments, we further explored their effect on liver function, inflammatory and oxidative pathways. In the present study the liver function tests (LFTs) were assessed as a measure of liver damage and functionality. ALT and AST are measures of liver hepatocyte damage (Hall and Cash 2012 ); whereas ALP is an indicator of biliary dysfunction or damage such as biliary obstruction, like direct and total bilirubin levels (Levitt, Hapak et al. 2022 ). Our results demonstrated that all LFTs were elevated in BDL + vehicle group when compared to Sham control group; this indicates that bile duct ligation, initiated liver hepatocyte and biliary damage, further increasing total and direct bilirubin levels, leading to liver fibrosis as several studies show (Cho, Koo et al. 2020 , Kabiri-Arani, Motallebi et al. 2024 ). Our treatment with free B. longum reduced the liver enzymes activity and bilirubin levels significantly compared to BDL + vehicle group (Fig. 4 ) indicating that treatment with this probiotic is effective in mitigating liver damage. These changes, as many studies suggest, can be attributed to several mechanisms such as alleviating oxidative stress, reducing inflammation and improving gut barrier leading to reduced liver damage and reduced enzyme activity and bilirubin levels (Jang, Jeong et al. 2018 , Hizo and Rampelotto 2024 , Lu, Shataer et al. 2024 , Zhang, Xu et al. 2024 ). Treatment with alginate-whey with chitosan coating microcapsules' reduced ALP serum activity and total and direct bilirubin levels; however, this treatment reduced ALT, AST and LDH activity but insignificantly. These changes may be due to prebiotic effects of alginate, whey and chitosan; they can be digested and used as substrate for gut microbiome to produce several metabolites such as SCFAs and enhance gut microbiome. Therefore, affect the liver through gut-liver axis (Prokopidis, Mazidi et al. 2023 , Zhang, Wang et al. 2023 , Zhang, Xu et al. 2024 ). In some tests such as ALT, LDH and total bilirubin the decrease in encapsulated B. longum treatment was greater than in free B. longum treatment; however, the difference in LDH levels were significant between free and encapsulated probiotic treatment. This suggests that treating liver fibrosis with encapsulated B. longum can be beneficial in restoring liver function based on LFTs panel. To investigate the mechanisms by which free and microencapsulated B. longum —formulated in alginate-whey protein microcapsules with a chitosan coating—exerts hepatoprotective effects, key antioxidant and oxidative parameters were evaluated.In groups treated with free B. longum , only the total antioxidant capacity (TAC) showed a significant increase, alongside a significant reduction in oxidative markers compared to the BDL + vehicle group. In contrast, treatment with microencapsulated B. longum resulted in a significant increase in all measured antioxidant indices and a marked decrease in oxidative parameters across all groups. B. longum directly scavenges free radicals through the production of intrinsic enzymes such as NADH oxidase and NADH peroxidase (Averina, Poluektova et al. 2021 ). Additionally, its secretion of exopolysaccharides (EPS) acts as free radical absorbers, preventing oxidative damage to cellular macromolecules. Furthermore, inhibition of inducible nitric oxide synthase (iNOS) activity reduces nitric oxide (NO) production, thereby suppressing the formation of destructive radicals like peroxynitrite (Sadeghi, Haghshenas et al. 2024 ). These findings confirm that B. longum not only functions as a direct antioxidant but also exerts protective effects by modulating nitrogen radical production pathways. Activation of sirtuin-dependent pathways, particularly Sir2, upregulates the expression of antioxidant enzymes such as superoxide dismutase (SOD) and catalase (CAT). Simultaneously, B. longum enhances cellular redox balance by regulating thioredoxin/glutaredoxin systems and replenishing glutathione (GSH) reserves through increased activity of key enzymes like gamma-glutamyl cysteine ligase (GCL). These coordinated mechanisms collectively elevate total antioxidant capacity (TAC) while mitigating the accumulation of oxidative byproducts such as malondialdehyde (MDA). One of the most critical hepatoprotective effects of B. longum is its production of short-chain fatty acids (SCFAs), including acetate and butyrate. These metabolites activate GPR41/GPR43 receptors, upregulating anti-inflammatory gene expression while inhibiting pro-inflammatory pathways such as NF-κB. Moreover, SCFAs restore gut microbiota balance by promoting the growth of beneficial bacteria (e.g., Bifidobacterium ) and suppressing endotoxin-producing species. Indirectly, these effects reduce intestinal permeability, limiting lipopolysaccharide (LPS) translocation into systemic circulation and thereby attenuating hepatic oxidative stress and systemic inflammation. B. longum further reinforces intestinal barrier integrity by upregulating tight junction proteins (occludin and claudin), preventing endotoxin leakage into the liver (Wang, Wu et al. 2017 , Dong, Ping et al. 2022 , Yoon, Yu et al. 2023 , Yu, Zhu et al. 2024 ). Combined with TLR4/NF-κB pathway suppression, this leads to decreased production of pro-inflammatory cytokines such as TNF-α and IL-6. Animal studies demonstrate that these mechanisms synergistically inhibit hepatic inflammation and ameliorate oxidative stress-induced damage. Although microencapsulated B. longum similarly enhances antioxidant indices and reduces oxidative markers, its effects are significantly more pronounced than those of free probiotics. This may be attributed to improved gastrointestinal survival of B. longum due to microencapsulation, or a synergistic interaction between the alginate-whey protein microcapsules and B. longum in modulating oxidative/antioxidant pathways. Further research is warranted to elucidate the precise mechanisms underlying this synergy. Since inflammation can be a contributing factor in liver fibrosis, the expression of cytokines responsible in inflammation (IL10, IL-6 and TNF- α) and fibrosis (α-SMA) was evaluated in order to determine if their expression can be affected by our treatments and help alleviate liver fibrosis. Regarding the alterations of gene expression, our results showed increased expression of inflammatory cytokines (IL-6 and TNF- α) and α-SMA gene which is a measure of activated HSCs, and reduced expression of anti-inflammatory cytokine (IL-6) in our bile duct ligated group, indicating that fibrosis and liver damage altered the expression of the aforementioned genes in favor of inflammation and HSCs activation, which is in line with other studies (Kabiri-Arani, Motallebi et al. 2024 ). Treatment with free and encapsulated B. longum significantly reduced IL-6 and TNF- α, and α-SMA expression, indicating that our treatment was able to alleviate cytokine-induced inflammation in rat liver tissue and reduced HSCs activation into myofibroblasts. Also, the treatment with encapsulated B. longum significantly increased IL-10 expression. These data are in line with In kim et al. and Dong et al. (In Kim, Kim et al. 2019 , Dong, Ping et al. 2022 ). These changes can be attributed to B. longum' s ability to alter immune system responses, gene expression regulation and metabolite production. B. longum can ferment several carbohydrates and dietary fibers into SCFAs such as acetate and butyrate. These SCFAs can modulate histone acetylation leading to increased transcription of anti-inflammatory genes such as IL-10 and suppress pro-inflammatory cytokines such as IL-6 and TNF-alpha due to their ability to activate G-protein coupled receptors (GPCRs) on immune cells. Also, other studies demonstrated that this probiotic can enhance regulatory T cells which is crucial for maintaining immune tolerance and preventing excessive inflammatory responses in the liver (Schell, Karmirantzou et al. 2002 , Gavzy, Kensiski et al. 2023 , Li, Yang et al. 2024 ). B. longum , as Álvarez-Mercado suggest, can upregulate Toll-like receptors (TLRs) which are responsible in immune responses related to inflammatory cytokines expression (Álvarez-Mercado, Plaza-Díaz et al. 2022 ); this may also be a contribute to B. longum's anti-inflammatory properties. The alterations of cytokines can be attributed to these changes in inflammatory responses caused by B. longum. Also, the mitigated inflammatory responses and inflammation results in reduced activation of HSCs, leading to downregulated expression of α-SMA (Jeng, Lu et al. 2020 ). In addition, the reason that encapsulated B. longum reduced expression of pro-inflammatory cytokines and α-SMA and also increased IL-10 expression more than free B. longum can be related to increased viability, bioavailability and functionality of encapsulated probiotic in GIT, resulting in increased enhanced effectiveness of the treatment with encapsulated B. longum. Our results demonstrated that alginate-whey with chitosan coating microcapsules reduced expression IL-6 and TNF-alpha. These alterations can be attributed to the ability of gut microbiome's ability to ferment alginate and chitosan to SCFAs and whey proteins to produce bioactive peptides that possess immunomodulatory properties; this, in addition to applying anti-inflammatory effects can enhance gut microbiome, which affects liver positively through gut-liver axis (Prokopidis, Mazidi et al. 2023 , Zhang, Wang et al. 2023 ). Therefore, our microcapsule's may have been able to reduce inflammation through these mechanisms. However, the insignificant reduction of α-SMA and increase of IL-10 with microcapsule's treatment could be related to low dosage and short treatment period. The BDL + vehicle group exhibited significantly elevated Metavir scores across all four hepatic indices (inflammation, fibrosis, necrosis, and bile duct hyperplasia) compared to Sham controls ( P < 0.05), confirming biliary obstruction-induced liver injury. This pathology likely stems from bile acid accumulation-induced oxidative stress and subsequent Kupffer/hepatic stellate cell activation, consistent with Kabiri et al.'s findings (Kabiri-Arani, Motallebi et al. 2024 ). While free probiotic and empty microcapsule treatments showed non-significant reductions in inflammation, hyperplasia, and fibrosis, only necrosis improved significantly. In contrast, microencapsulated B. longum demonstrated significant improvement in all histopathological parameters. This enhanced efficacy may reflect either superior probiotic viability due to enteric protection or synergistic effects with the alginate-whey protein matrix, though further studies are needed to elucidate this potential synergy. Comparative analysis with Ziółkowski et al.'s whey protein study reveals protocol-dependent efficacy variations, where higher doses (200mg/kg/8-weeks) in their fructose-induced model produced more pronounced effects (Yiğit Ziolkowski, Şenol et al. 2024 ), highlighting the influence of experimental parameters on therapeutic outcomes. The intestinal histopathology findings mirrored hepatic observations: BDL + vehicle rats showed marked villous atrophy, crypt loss (0.58 ± 0.33), and goblet cell depletion (0.58 ± 0.33) versus Sham controls, while all treatment groups maintained normal ileal architecture. This intestinal protection may derive from multiple mechanisms: (1) probiotic colonization enhancing gut-liver axis integrity, (2) alginate's mucoprotective properties, and (3) whey protein's dual antioxidant capacity - both direct free radical scavenging and Nrf2 pathway modulation. Although limited direct evidence exists for these interventions in cholestatic ileopathy, extant literature on NAFLD models and galactosamine-induced injury supports our observed protective effects, suggesting broader applicability of these therapeutic strategies across hepatointestinal pathologies. The differential efficacy between free and microencapsulated probiotics underscores the critical role of delivery systems in optimizing therapeutic outcomes, likely through enhanced gastric survival and targeted intestinal release (Wang, Lv et al. 2020 , Zhao, Gao et al. 2022 , Zhang, Xu et al. 2024 ) . As previously discussed, bile duct obstruction results in the entry of bile acids into the systemic circulation, thereby reaching the intestinal tissue and ileum, which subsequently induces oxidative stress and inflammation in the ileum (Angelis, Kostakis et al. 2023 ). Oxidative stress leads to intestinal tissue damage and histological changes such as decreased crypt density, infiltration of inflammatory cells, and loss of goblet cells, which were also observed in our study. Furthermore, it was noted that the number of intestinal villi decreased while their length increased. The reduction in villus number is a consequence of oxidative stress and intestinal injury, whereas the increase in villus length represents an adaptive mechanism to compensate for intestinal damage and the loss of ileal villi, as also reported in the study by al-Aaraji and colleagues (Al-Aaraji and Addi Ali 2022 ). In our study, it was observed that the ileal tissue of treated rats appeared normal and similar to that of the Sham group. This indicates that, despite the presence of bile duct obstruction, systemic oxidative stress, and inflammation, no damage was detected in the ileal tissue of the treated groups. This observation may be attributed to the colonization of B. longum in the ileum, which enhances intestinal barrier integrity and improves the gut-liver axis. Following bile duct obstruction and the accumulation of bile acids in the ileum, B. longum counteracts ileal damage and prevents tissue destruction (Wang, Lv et al. 2020 ). To date, no direct study has specifically evaluated the effect of B. longum on ileal injury in a bile duct ligation model. However, related evidence suggests that B. longum exerts protective effects on intestinal tissue under conditions of liver injury and gut inflammation, which may be relevant to the ileal injury caused by bile duct obstruction. This probiotic likely mediates its effects by reducing systemic inflammation and oxidative stress (Wang, Lv et al. 2020 ). Regarding the efficacy of alginate and whey protein microcapsules, their prebiotic properties are noteworthy. These compounds can promote the growth and proliferation of the gut microbiome, which in turn strengthens the intestinal barrier and the gut-liver axis. As a result, the intestine may become more resilient to the harmful effects of bile acid accumulation. The normal and undamaged appearance of ileal tissue in the group treated with free microcapsules can be explained by the prebiotic properties of alginate and whey protein. As previously described, alginate and whey protein can serve as substrates for the gut microbiome, supporting its growth and proliferation. Consequently, the protective intestinal barrier and gut-liver axis are reinforced, enabling the intestine to resist damage caused by bile duct obstruction. Additionally, whey protein possesses antioxidant properties that can directly scavenge free radicals and indirectly regulate oxidative and inflammatory pathways, thereby reducing oxidative damage to intestinal tissue and mitigating the harmful effects of bile duct obstruction (Williams, Iqbal et al. 2011 , Gotteland, Riveros et al. 2020 , Rackerby, Le et al. 2024 ). In their review, Ahmad and colleagues concluded that alginate forms a mucous layer that reduces inflammation and improves intestinal barrier function (Ahmad, Riaz et al. 2024 ). Moreover, in models of intestinal injury induced by inflammation—somewhat analogous to the damage caused by bile duct obstruction—alginate has been shown to prevent intestinal tissue damage. This is also true for whey protein; in a study by Boscaini on the effect of whey protein on intestinal injury induced by a high-fat diet, this compound was shown to prevent or ameliorate intestinal damage (Boscaini, Cabrera-Rubio et al. 2021 ). The results of these studies are consistent with our findings. Although no articles were found specifically addressing the effectiveness of alginate and whey protein in intestinal injury in the bile duct obstruction model, the available evidence supports the conclusion that free microcapsules can protect intestinal tissue and prevent intestinal damage. Finally, rats that undergo BDL surgery might die during the process of surgery and due to the reduced liver function and damage caused by the bile duct ligation (Kim, Han et al. 2015 ). We evaluated the survival rate of rats during the 3 weeks after undergoing BDL surgery. Our data showed that the highest mortality rate was pertinent with BDL + vehicle group which received no treatment and suffered the most adverse liver injury. The treatment increased survival rate to 60%, 50% and 70% in free probiotic, free capsule and encapsulated probiotic treatment groups, indicating that our treatment was able to reduce mortality related to liver injury. This research faced several limitations such as inability to use western blotting to evaluate the level of inflammatory cytokines and α-SMA production which could help better understand the correlation between inflammatory cytokines and α-SMA gene expression and protein production. Conclusion In summary the results obtained from this study suggests that treatment with free B. longum and alginate-whey protein with chitosan coating microcapsules can alleviate liver fibrosis and help towards reversing the progression of fibrosis. However, encapsulation of B. longum with alginate and whey with coating of chitosan can create an efficient probiotic delivery system, increasing probiotic cells' viability during gastrointestinal transit. Encapsulated B. longum can also increase treatment effectiveness, reducing oxidative injury and inflammation more effectively, leading to better alleviating of liver fibrosis. Declarations Acknowledgements The authors sincerely thank Ms. Mahsa Sarlak for her valuable assistance in conducting the biochemical assays. The authors also acknowledge the use of ChatGPT artificial intelligence during manuscript preparation for paraphrasing, grammar checking, and translation support. All content was carefully reviewed and revised by the authors, who take full responsibility for the final version of the article. Funding The research leading to these results received funding from Kashan University of Medical Sciences under Grant Agreement No 402099. Data Availability All the data are published in this article. Ethics approval This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Kashan University of Medical Sciences, Kashan, Iran ( Ethics code: IR.KAUMS.AEC.1402.013). Consent to participate Not applicable. Consent for publication Not applicable. Competing interest The authors declare no competing interests. References Ahmad A, Riaz S, Desta DT (2024) Alginate's ability to prevent metabolic illnesses, the degradation of the gut's protective layer, and alginate-based encapsulation methods. Food Sci Nutr 12(11):8692–8714 Al-Aaraji AS, Addi Ali B (2022) Effect of Pomegranate Peels Aqueous Extract on the Histological Structure of Small Intestine of Local Male Rabbits (Oryctolagus cuniculus). Arch Razi Inst 77(5):1935–1943 Albillos A, de Gottardi A, Rescigno M (2020) The gut-liver axis in liver disease: Pathophysiological basis for therapy. J Hepatol 72(3):558–577 Álvarez-Mercado AI, Plaza-Díaz J, de Almagro MC, Gil Á, Moreno-Muñoz JA, Fontana L (2022) Bifidobacterium longum subsp. infantis CECT 7210 Reduces Inflammatory Cytokine Secretion in Caco-2 Cells Cultured in the Presence of Escherichia coli CECT 515. Int J Mol Sci 23(18):10813 Amirreza K, Reza B, Shabnam K (2016) Probiotics: A Comprehensive Review of Their Classification, Mode of Action and Role in Human Nutrition. Probiotics and Prebiotics in Human Nutrition and Health. R. Venketeshwer and G. R. Leticia. Rijeka, IntechOpen: Ch. 2 Angelis A, Kostakis ID, Lilimpakis K, Kalaitzopoulou E, Papadea P, Skipitari M, Georgiou CD, Vagianos C (2023) Time-Related Evidence of Intestinal Oxidative Stress in Obstructive Jaundice-Induced Rats. Eur Surg Res : 1–11 Arranz E, Corrochano AR, Shanahan C, Villalva M, Jaime L, Santoyo S, Callanan MJ, Murphy E, Giblin L (2019) Antioxidant activity and characterization of whey protein-based beverages: Effect of shelf life and gastrointestinal transit on bioactivity. Innovative Food Sci Emerg Technol 57:102209 Astó E, Huedo P, Altadill T, Aguiló García M, Sticco M, Perez M, Espadaler-Mazo J (2021) Probiotic Properties of Bifidobacterium longum KABP042 and Pediococcus pentosaceus KABP041 Show Potential to Counteract Functional Gastrointestinal Disorders in an Observational Pilot Trial in Infants. Front Microbiol 12:741391 Averina OV, Poluektova EU, Marsova MV, Danilenko VN (2021) Biomarkers and Utility of the Antioxidant Potential of Probiotic Lactobacilli and Bifidobacteria as Representatives of the Human Gut. Microbiota Biomedicines 9(10) Bampidis V, Azimonti G, Bastos M, Christensen H, Dusemund B, Durjava M, Kouba M, López-Alonso M, López S, Marcon F, Mayo B, Pechova A, Petkova M, Ramos F, Sanz Y, Villa R, Woutersen R, Brozzi R, Galobart J, Innocenti M (2022) Safety and efficacy of a feed additive consisting of sodium alginate for all animal species (ALGAIA). EFSA Journal 20 Berumen J, Baglieri J, Kisseleva T, Mekeel K (2021) Liver fibrosis: Pathophysiology and clinical implications. WIREs Mech Dis 13(1):e1499 Boscaini S, Cabrera-Rubio R, Golubeva A, Nychyk O, Fülling C, Speakman JR, Cotter PD, Cryan JF, Nilaweera KN (2021) Depletion of the gut microbiota differentially affects the impact of whey protein on high-fat diet-induced obesity and intestinal permeability. Physiol Rep 9(11):e14867 Buyukyoruk S (2021) Chitosan for Using Food Protection. Chitin and Chitosan - Physicochemical Properties and Industrial Applications. M. Berrada. Rijeka, IntechOpen Centurion F, Basit AW, Liu J, Gaisford S, Rahim MA, Kalantar-Zadeh K (2021) Nanoencapsulation Probiotic Delivery ACS Nano 15(12):18653–18660 Chen Y, Yang F, Lu H, Wang B, Chen Y, Lei D, Wang Y, Zhu B, Li L (2011) Characterization of fecal microbial communities in patients with liver cirrhosis. Hepatology 54(2):562–572 Cho I, Koo BN, Kam EH, Lee SK, Oh H, Kim SY (2020) Bile duct ligation of C57BL/6 mice as a model of hepatic encephalopathy. Anesth Pain Med (Seoul) 15(1):19–27 Corrochano AR, Buckin V, Kelly PM, Giblin L (2018) Invited review: Whey proteins as antioxidants and promoters of cellular antioxidant pathways. J Dairy Sci 101(6):4747–4761 Cristofori F, Dargenio VN, Dargenio C, Miniello VL, Barone M, Francavilla R (2021) Anti-Inflammatory and Immunomodulatory Effects of Probiotics in Gut Inflammation: A Door to the Body. Front Immunol 12:578386 de Araújo Etchepare M, Nunes GL, Nicoloso BR, Barin JS, Moraes Flores EM, de Oliveira Mello R and C. Ragagnin de Menezes (2020) Improv viability encapsulated probiotics using whey proteins LWT 117: 108601 Devarbhavi H, Asrani SK, Arab JP, Nartey YA, Pose E, Kamath PS (2023) Global burden of liver disease: 2023 update. J Hepatol 79(2):516–537 Dong J, Ping L, Cao T, Sun L, Liu D, Wang S, Huo G, Li B (2022) Immunomodulatory effects of the Bifidobacterium longum BL-10 on lipopolysaccharide-induced intestinal mucosal immune injury. Front Immunol 13:947755 Dong J, Ping L, Meng Y, Zhang K, Tang H, Liu D, Li B, Huo G (2022) Bifidobacterium longum BL-10 with Antioxidant Capacity Ameliorates Lipopolysaccharide-Induced Acute Liver Injury in Mice by the Nuclear Factor-κB Pathway. J Agric Food Chem 70(28):8680–8692 Faisal Shahbaz Akram M, Ashraf M, Ali S, Kazmi SI (2017) Isolation of Gram-positive Bacteria from Different Sources and Evaluation of their Probiotic Properties. J Med Microbiol Infect Dis 5(1):12–16 Gavzy SJ, Kensiski A, Lee ZL, Mongodin EF, Ma B, Bromberg JS (2023) Bifidobacterium mechanisms of immune modulation and tolerance. Gut Microbes 15(2):2291164 Gbassi GK, Vandamme T (2012) Probiotic encapsulation technology: from microencapsulation to release into the gut. Pharmaceutics 4(1):149–163 Gotteland M, Riveros K, Gasaly N, Carcamo C, Magne F, Liabeuf G, Beattie A, Rosenfeld S (2020) The Pros and Cons of Using Algal Polysaccharides as Prebiotics. Front Nutr Volume 7–2020 Hall P, Cash J (2012) What is the real function of the liver 'function' tests? Ulster Med J 81(1):30–36 Hizo GH, Rampelotto PH (2024) The Impact of Probiotic Bifidobacterium on Liver Diseases and the Microbiota. Life 14(2):239 Hizo GH, Rampelotto PH (2024) The Impact of Probiotic Bifidobacterium on Liver Diseases and the Microbiota. Life 14. 10.3390/life14020239 Kim I, Kim HJK, Kim JY, Jang SE, Han MJ, Kim DH (2019) Lactobacillus plantarum LC27 and Bifidobacterium longum LC67 simultaneously alleviate high-fat diet-induced colitis, endotoxemia, liver steatosis, and obesity in mice. Nutr Res 67:78–89 Jang S-E, Jeong J-J, Kim J-K, Han MJ, Kim D-H (2018) Simultaneous Amelioratation of Colitis and Liver Injury in Mice by Bifidobacterium longum LC67 and Lactobacillus plantarum LC27. Sci Rep 8(1):7500 Jantarathin S, Borompichaichartkul C, Sanguandeekul R (2017) Microencapsulation of probiotic and prebiotic in alginate-chitosan capsules and its effect on viability under heat process in shrimp feeding. Materials Today: Proceedings 4(5, Part 2): 6166–6172 Jeng K-S, Lu S-J, Wang C-H, Chang C-F (2020) Liver Fibrosis and Inflammation under the Control of ERK2. Int J Mol Sci 21(11):3796 Ji R, Wu J, Zhang J, Wang T, Zhang X, Shao L, Chen D, Wang J (2019) Extending Viability of Bifidobacterium longum in Chitosan-Coated Alginate Microcapsules Using Emulsification and Internal Gelation Encapsulation Technology. Front Microbiol 10:1389 Kabiri-Arani S, Motallebi M, Taheri MA, Kheiripour N, Ardjmand A, Aghadavod E, Shahaboddin ME (2024) The Effect of Heat-Killed Lactobacillus plantarum on Oxidative Stress and Liver Damage in Rats with Bile Duct Ligation-Induced Hepatic Fibrosis. Probiotics Antimicrob Proteins 16(1):196–211 Kalogeropoulou F, Papailiou D, Protopapa C, Siamidi A, Tziveleka L-A, Pippa N, Vlachou M (2023) Design and Development of Low- and Medium-Viscosity Alginate Beads Loaded with Pluronic® F-127 Nanomicelles. Materials 16(13):4715 Kim H-G, Han J-M, Lee J-S, Lee JS, Son C-G (2015) Ethyl acetate fraction of Amomum xanthioides improves bile duct ligation-induced liver fibrosis of rat model via modulation of pro-fibrogenic cytokines. Sci Rep 5(1):14531 Kowalska E, Ziarno M, Ekielski A, Żelaziński T (2022) Mater Used Microencapsul Probiotic Bacteria Food Ind Molecules 27(10) Krunić T, Rakin MB (2022) Enriching alginate matrix used for probiotic encapsulation with whey protein concentrate or its trypsin-derived hydrolysate: Impact on antioxidant capacity and stability of fermented whey-based beverages. Food Chem 370:130931 Kukla M (2013) Angiogenesis: a phenomenon which aggravates chronic liver disease progression. Hepatol Int 7(1):4–12 Lai TL, Park SY, Nguyen G, Pham PTM, Kang SM, Hong J, Lee JH, Im SS, Choi DH, Cho EH (2024) Irisin Attenuates Hepatic Stellate Cell Activation and Liver Fibrosis in Bile Duct Ligation Mice Model and Improves Mitochondrial Dysfunction. Endocrinol Metab (Seoul) 39(6):908–920 Lee DY, Shin JW, Shin YJ, Han SW, Kim DH (2024) Lactobacillus plantarum and Bifidobacterium longum Alleviate Liver Injury and Fibrosis in Mice by Regulating NF-κB and AMPK Signaling. J Microbiol Biotechnol 34(1):149–156 Levitt MD, Hapak SM, Levitt DG (2022) Alkaline Phosphatase Pathophysiology with Emphasis on the Seldom-Discussed Role of Defective Elimination in Unexplained Elevations of Serum ALP - A Case Report and Literature Review. Clin Exp Gastroenterol 15:41–49 Li B, Chi X, Huang Y, Wang W, Liu Z (2024) Bifidobacterium longum-Derived Extracellular Vesicles Prevent Hepatocellular Carcinoma by Modulating the TGF-β1/Smad Signaling in Mice. FBL 29(7) Li X, Yang J, Shi S, Lan H, Zhao W, Hung W, He J, Wang R (2024) The Genome of Bifidobacterium longum subsp. infantis YLGB-1496 Provides Insights into Its Carbohydrate Utilization and Genetic Stability. Genes 15(4):466 Lu J, Shataer D, Yan H, Dong X, Zhang M, Qin Y, Cui J, Wang L (2024) Probiotics and Non-Alcoholic Fatty Liver Disease: Unveiling the Mechanisms of Lactobacillus plantarum and Bifidobacterium bifidum in Modulating Lipid Metabolism, Inflammation, and Intestinal Barrier Integrity. Foods 13(18):2992 Mohammed A-Z, Mubarak M, Aljarba N, Rudayni H, Yassen K, Alkahtani S, Nasr F, Al-Doaiss A, Al-eissa M (2024) Antioxidant Effects of Whey Protein as a Dietary Supplement to Alleviate Cadmium-Induced Oxidative Stress in Male Wistar Rats. Current Research in Nutrition and. Food Sci J 12:147–156 Prokopidis K, Mazidi M, Sankaranarayanan R, Tajik B, McArdle A, Isanejad M (2023) Effects of whey and soy protein supplementation on inflammatory cytokines in older adults: a systematic review and meta-analysis. Br J Nutr 129(5):759–770 Quigley EMM (2017) Chapter 16 - Bifidobacterium longum. The Microbiota in Gastrointestinal Pathophysiology. M. H. Floch, Y. Ringel and W. Allan Walker. Boston, Academic Press: 139–141 Rackerby B, Le HNM, Haymowicz A, Dallas DC, Park SH (2024) Potential Prebiotic Properties of Whey Protein and Glycomacropeptide in Gut Microbiome. Food Sci Anim Resour 44(2):299–308 Sadeghi M, Haghshenas B, Nami Y (2024) Bifidobacterium exopolysaccharides: new insights into engineering strategies, physicochemical functions, and immunomodulatory effects on host health. Front Microbiol 15:1396308 Schell MA, Karmirantzou M, Snel B, Vilanova D, Berger B, Pessi G, Zwahlen M-C, Desiere F, Bork P, Delley M, Pridmore RD, Arigoni F (2002) The genome sequence of Bifidobacterium longum reflects its adaptation to the human gastrointestinal tract. Proceedings of the National Academy of Sciences 99(22): 14422–14427 Sharawy MH, Abdel-Rahman N, Megahed N, El-Awady MS (2018) Paclitaxel alleviates liver fibrosis induced by bile duct ligation in rats: Role of TGF-β1, IL-10 and c-Myc. Life Sci 211:245–251 Singh MN, Hemant KS, Ram M, Shivakumar HG (2010) Microencapsulation: A promising technique for controlled drug delivery. Res Pharm Sci 5(2):65–77 Takahashi N, Xiao J-Z, Miyaji K, Yaeshiima T, Hiramatsu A, Iwatsuki K, Kokubo S, Hosono A (2004) Selection of acid tolerant Bifidobacteria and evidence for a low-pH-inducible acid tolerance response in Bifidobacterium longum. J Dairy Res 71:340–345 Takahashi Y, Fukusato T (2017) Chapter 13 - Animal Models of Liver Diseases. Animal Models for the Study of Human Disease (Second Edition). P. M. Conn, Academic Press: 313–339 Tan Z, Sun H, Xue T, Gan C, Liu H, Xie Y, Yao Y, Ye T (2021) Liver Fibrosis: Therapeutic Targets and Advances in Drug Therapy. Front Cell Dev Biol 9:730176 Turck D, Castenmiller J, de Henauw S, Hirsch-Ernst KI, Kearney J, Maciuk A, Mangelsdorf I, McArdle HJ, Naska A, Pelaez C, Pentieva K, Siani A, Thies F, Tsabouri S, Vinceti M, Cubadda F, Engel KH, Frenzel T, Heinonen M, Marchelli R, Neuhäuser-Berthold M, Pöting A, Poulsen M, Sanz Y, Schlatter JR, van Loveren H, Amundsen M, Knutsen HK (2019) Safety of whey basic protein isolate for extended uses in foods for special medical purposes and food supplements for infants pursuant to Regulation (EU) 2015/2283. Efsa j 17(4): e05659 Wang K, Lv L, Yan R, Wang Q, Jiang H, Wu W, Li Y, Ye J, Wu J, Yang L, Bian X, Jiang X, Lu Y, Xie J, Wang Q, Shen J, Li L (2020) Bifidobacterium longum R0175 Protects Rats against d-Galactosamine-Induced Acute Liver Failure. mSphere 5(1) Wang X, Gao S, Yun S, Zhang M, Peng L, Li Y, Zhou Y (2022) Microencapsulating Alginate-Based Polymers for Probiotics Delivery Systems and Their Application. Pharmaceuticals (Basel) 15(5) Wang Y, Wang J, Li H, Lao J, Jia D, Liu J, Wang J, Luo J, Guan G, Yin H, Li Y (2023) Antioxidant effects of Bifidobacterium longum T37a in mice weight loss and aging model induced by D-galactose. BMC Microbiol 23(1):103 Wang Y, Wu Y, Wang Y, Xu H, Mei X, Yu D, Wang Y, Li W (2017) Antioxid Prop Probiotic Bacteria Nutrients 9(5) Williams I, Iqbal T, Webber M, Tselepis C (2011) A mechanism for the effect of alginate on the gut microflora. Gut 60(Suppl 1):A76 Yasmin I, Saeed M, Pasha I, Zia MA (2019) Development of Whey Protein Concentrate-Pectin-Alginate Based Delivery System to Improve Survival of B. longum BL-05 in Simulated Gastrointestinal Conditions. Probiotics Antimicrob Proteins 11(2):413–426 Yiğit Ziolkowski A, Şenol N, Aslankoç R, Samur G (2024) Whey protein supplementation reduced the liver damage scores of rats fed with a high fat-high fructose diet. PLoS ONE 19(4):e0301012 Yoon SJ, Yu JS, Min BH, Gupta H, Won S-M, Park HJ, Han SH, Kim B-Y, Kim KH, Kim BK, Joung HC, Park T-S, Ham YL, Lee DY, Suk KT (2023) Bifidobacterium-derived short-chain fatty acids and indole compounds attenuate nonalcoholic fatty liver disease by modulating gut-liver axis. Front Microbiol Volume 14–2023 Yu J, Zhu P, Shi L, Gao N, Li Y, Shu C, Xu Y, Yu Y, He J, Guo D, Zhang X, Wang X, Shao S, Dong W, Wang Y, Zhang W, Zhang W, Chen WH, Chen X, Liu Z, Yang X, Zhang B (2024) Bifidobacterium longum promotes postoperative liver function recovery in patients with hepatocellular carcinoma. Cell Host Microbe 32(1):131–144e136 Zhang X, Xu J, Dong X, Tang J, Xie Y, Yang J, Zou L, Wu L, Fan J (2024) Bifidobacterium longum BL-19 inhibits oxidative stress and inflammatory damage in the liver of mice with NAFLD by regulating the production of butyrate in the intestine. Food Sci Nutr 12(9):6442–6460 Zhang X, Xu J, Dong X, Tang J, Xie Y, Yang J, Zou L, Wu L, Fan J (2024) Bifidobacterium longumBL-19 inhibits oxidative stress and inflammatory damage in the liver of mice with NAFLD by regulating the production of butyrate in the intestine. Food Sci Nutr 12(9):6442–6460 Zhang Z, Wang X, Li F (2023) An exploration of alginate oligosaccharides modulating intestinal inflammatory networks via gut microbiota. Front Microbiol 14 Zhao H, Gao X, Liu Z, Zhang L, Fang X, Sun J, Zhang Z, Sun Y (2022) Sodium Alginate Prevents Non-Alcoholic Fatty Liver Disease by Modulating the Gut-Liver Axis in High-Fat Diet-Fed Rats. Nutrients 14(22) Zheng Y, Zhang L, Bonfili L, de Vivo L, Eleuteri AM, Bellesi M (2023) Probiotics Supplementation Attenuates Inflammation and Oxidative Stress Induced by Chronic Sleep Restriction. Nutrients 15(6) Additional Declarations No competing interests reported. Supplementary Files tables8.docx graphicalabstract.jpg Cite Share Download PDF Status: Published Journal Publication published 28 Apr, 2026 Read the published version in World Journal of Microbiology and Biotechnology → Version 1 posted Editorial decision: Revision requested 22 Jan, 2026 Reviews received at journal 22 Jan, 2026 Reviewers agreed at journal 23 Dec, 2025 Reviewers agreed at journal 02 Nov, 2025 Reviewers invited by journal 06 Oct, 2025 Editor assigned by journal 04 Oct, 2025 Submission checks completed at journal 04 Oct, 2025 First submitted to journal 03 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7773331","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":530527067,"identity":"a206ef4b-a715-44d2-ad26-e9109c9cd18e","order_by":0,"name":"Siavash Amiri","email":"","orcid":"","institution":"Kashan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Siavash","middleName":"","lastName":"Amiri","suffix":""},{"id":530527068,"identity":"0d167540-8976-4b3c-a19a-4f202d971429","order_by":1,"name":"Mitra Motallebi","email":"","orcid":"","institution":"Kashan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mitra","middleName":"","lastName":"Motallebi","suffix":""},{"id":530527070,"identity":"dd975a89-7dbd-46d5-be7c-aa6a47a16b18","order_by":2,"name":"Mohsen Hemmati-Dinarvand","email":"","orcid":"","institution":"Kashan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohsen","middleName":"","lastName":"Hemmati-Dinarvand","suffix":""},{"id":530527073,"identity":"b324af38-952d-4621-9c73-34581b2aa656","order_by":3,"name":"Merat Karimi","email":"","orcid":"","institution":"University of Kashan","correspondingAuthor":false,"prefix":"","firstName":"Merat","middleName":"","lastName":"Karimi","suffix":""},{"id":530527076,"identity":"5ab8bbef-af57-4ee5-8be4-987997f77fdf","order_by":4,"name":"Maryam Akhavan Taheri","email":"","orcid":"","institution":"Kashan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Maryam","middleName":"Akhavan","lastName":"Taheri","suffix":""},{"id":530527077,"identity":"12e4c449-a1da-44ee-96da-e3e14aca1e93","order_by":5,"name":"Sahar Ahmadi Asouri","email":"","orcid":"","institution":"Kashan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Sahar","middleName":"Ahmadi","lastName":"Asouri","suffix":""},{"id":530527078,"identity":"4add904c-0bbb-4769-93eb-5f7181de94ec","order_by":6,"name":"Mohammad Esmaeil Shahaboddin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6UlEQVRIiWNgGAWjYDACCQY2BsYGIDrMwPiwAS5sQJwWZkMStRxgYJNswKMQDuRnNz978HOHjWzfcd5jlTNqDkfLNzA//MBQcA+nFoM7x8wNe8+kGc88zJd2c8Oxw7kbDrAZSzAYFOPWIpFgJsHbdjhxw2Ees5sP2IBaGBjMgOIJuB02I/2b5F+olsIH/w7nzm9g/4ZXC8ONHDNpmC2MG9sO5zYc4MFvi8GNnDJpWbBfeIwlZ/al5wL1Fksk4HfYNsm3oBA7f8bwY88369z57e0bP3z4g8dhmIAZiEnSMApGwSgYBaMAAwAA6Qxav2YVJsMAAAAASUVORK5CYII=","orcid":"","institution":"Kashan University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Mohammad","middleName":"Esmaeil","lastName":"Shahaboddin","suffix":""}],"badges":[],"createdAt":"2025-10-03 12:08:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7773331/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7773331/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11274-026-04838-9","type":"published","date":"2026-04-28T15:58:35+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":93941679,"identity":"62a75e87-0dc1-474a-a6ef-5eef8379ad2e","added_by":"auto","created_at":"2025-10-20 13:40:49","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":155174,"visible":true,"origin":"","legend":"","description":"","filename":"AmiriArticle2Copy.docx","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/16353b718ee91004cb2f5dd0.docx"},{"id":93940364,"identity":"77a07c9d-cbe9-4eec-b708-fb606f8402fc","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":470837,"visible":true,"origin":"","legend":"","description":"","filename":"Figure15.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/d77793946e7cd12ea8b24d5e.jpg"},{"id":93942463,"identity":"ca399376-fb5b-4390-95ef-cf9a671aa2f3","added_by":"auto","created_at":"2025-10-20 13:48:49","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22067,"visible":true,"origin":"","legend":"","description":"","filename":"tables8.docx","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/65b96e494ac81173ed7a6691.docx"},{"id":93941681,"identity":"0e4beeec-0bf7-4a28-915e-726510a33c5a","added_by":"auto","created_at":"2025-10-20 13:40:49","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":391802,"visible":true,"origin":"","legend":"","description":"","filename":"Figure27.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/a3acacb810903bc61d0af648.jpg"},{"id":93941680,"identity":"4110aaee-ee31-4d67-a050-9d746f30a5fd","added_by":"auto","created_at":"2025-10-20 13:40:49","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":60075,"visible":true,"origin":"","legend":"","description":"","filename":"Figure34.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/3c94346e8f9f204b3830b7d5.png"},{"id":93943659,"identity":"0a846d5e-7d80-4309-a4d6-764218079a73","added_by":"auto","created_at":"2025-10-20 13:56:49","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":441181,"visible":true,"origin":"","legend":"","description":"","filename":"Figure42.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/2079f33017b7bc6a23c7dee1.png"},{"id":93941689,"identity":"1793449c-7dc1-4eb6-beac-2458cc6f219b","added_by":"auto","created_at":"2025-10-20 13:40:49","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":149877,"visible":true,"origin":"","legend":"","description":"","filename":"Figure56.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/98aab629a307289e432a15ad.png"},{"id":93941686,"identity":"2f00343d-9245-40c5-912d-f03e049502c3","added_by":"auto","created_at":"2025-10-20 13:40:49","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":197588,"visible":true,"origin":"","legend":"","description":"","filename":"Figure65.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/75e67f52bb05d11dfc1b94ef.png"},{"id":93940375,"identity":"faa58d53-27c6-4d40-af73-c241ba9494e9","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":107150,"visible":true,"origin":"","legend":"","description":"","filename":"Figure73.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/cf98f96a147381c9f82e868e.png"},{"id":93940377,"identity":"bef1e5b7-c034-474c-a7d2-520cb1e2ad03","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4355863,"visible":true,"origin":"","legend":"","description":"","filename":"Figure81.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/ca392ade75273b61501ceb1a.png"},{"id":93940370,"identity":"8d9ddc3f-5dc7-4bc7-8e99-f38da9d40d6e","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"jpg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":360086,"visible":true,"origin":"","legend":"","description":"","filename":"graphicalabstract.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/02e4610affcff7aa9535377f.jpg"},{"id":93940387,"identity":"982752d5-2eb7-478f-82c4-ab6614926cef","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"json","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8427,"visible":true,"origin":"","legend":"","description":"","filename":"5051a6f17ec24411a4bcd2415ca86951.json","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/34741e0faafdcf5c8ac72230.json"},{"id":93940371,"identity":"05111726-30e2-4a8b-ab12-74dadf5db0a6","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"xml","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":225476,"visible":true,"origin":"","legend":"","description":"","filename":"5051a6f17ec24411a4bcd2415ca869511enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/95fa757c40ec0a7aae7a5b5f.xml"},{"id":93940381,"identity":"7e431f46-b7eb-48b6-93b2-6f1df6555cbd","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"jpg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":470837,"visible":true,"origin":"","legend":"","description":"","filename":"Figure15.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/505ffea1066720ec25b1983f.jpg"},{"id":93940383,"identity":"fdf69a6e-c6ff-4e07-a59b-3e61bdcf5893","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"jpg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":391802,"visible":true,"origin":"","legend":"","description":"","filename":"Figure27.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/2834e63a44da762f755d2a52.jpg"},{"id":93940380,"identity":"8c2b656b-cbdd-4293-8310-9394dc9bd44c","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":60075,"visible":true,"origin":"","legend":"","description":"","filename":"Figure34.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/8e7cd2ff6d79d7a69b401173.png"},{"id":93942466,"identity":"ecba138c-e8eb-45fd-afeb-8e818658933a","added_by":"auto","created_at":"2025-10-20 13:48:49","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":441181,"visible":true,"origin":"","legend":"","description":"","filename":"Figure42.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/cbcd54f3b929d17ce992c39d.png"},{"id":93941691,"identity":"5eb77620-99a5-444a-9ec6-04f5f0b0ce18","added_by":"auto","created_at":"2025-10-20 13:40:50","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":149877,"visible":true,"origin":"","legend":"","description":"","filename":"Figure56.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/594e4dfe70b836ef3b8d0cc2.png"},{"id":93940388,"identity":"a2728c2c-ec5c-42a0-89be-1961908956a0","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":197588,"visible":true,"origin":"","legend":"","description":"","filename":"Figure65.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/e24d021660b6ef8d8055f05c.png"},{"id":93940390,"identity":"68ef0f56-9858-4325-9ebf-71c459421555","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":107150,"visible":true,"origin":"","legend":"","description":"","filename":"Figure73.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/d60d8bd40c5bff98d873cd09.png"},{"id":93940386,"identity":"dd479cc6-9a20-4ff1-b7d5-e2268fccbbd0","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4355863,"visible":true,"origin":"","legend":"","description":"","filename":"Figure81.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/d376604af15b48864f6036c2.png"},{"id":93940391,"identity":"2c9d1412-cb1c-459d-b61d-d21b6d2fa688","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65348,"visible":true,"origin":"","legend":"","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/a87d506afeab1f0062f2e8d9.png"},{"id":93941693,"identity":"5e69afa0-0d30-4e67-baa9-dade7332e7ae","added_by":"auto","created_at":"2025-10-20 13:40:50","extension":"jpg","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":360086,"visible":true,"origin":"","legend":"","description":"","filename":"graphicalabstract.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/5f1bd049d31d863cc3bc4319.jpg"},{"id":93940398,"identity":"af1cc1d5-8e0a-4cf7-9f33-3327c7912bb1","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":147696,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure15.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/0ed353cc91261f60e8457c00.png"},{"id":93940382,"identity":"b37e70e7-1945-4ff7-af76-fd6234bea633","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":214401,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure27.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/9fe0333a4c4b867138d06262.png"},{"id":93940379,"identity":"4a943747-058b-4741-92ff-535c735428db","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11415,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure34.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/2e5ff54022bbc4e881d193dc.png"},{"id":93941692,"identity":"871b29a4-021b-4162-b399-35d4a9973720","added_by":"auto","created_at":"2025-10-20 13:40:50","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":43121,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure42.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/1030c55d3447f24ee4ff8015.png"},{"id":93940392,"identity":"ca24cbcc-57a3-4963-a633-523460af8180","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":28448,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure56.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/19d1e261326ad05f8adc827c.png"},{"id":93942468,"identity":"3195d00f-03a8-46ab-9139-4ed2c71f306c","added_by":"auto","created_at":"2025-10-20 13:48:50","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":42097,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure65.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/d9b20806cf812bbf590e9800.png"},{"id":93940384,"identity":"973c54e9-4301-4d28-a88e-7ad9210efb75","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22802,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure73.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/33a06c642f3ac512c8e5127d.png"},{"id":93940397,"identity":"70857f0f-0f62-4720-8e38-452aad3c25e0","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":707138,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure81.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/c2dafc163493d63b43cf7c02.png"},{"id":93940396,"identity":"07f2f1cb-cb6b-4a3a-b38b-2ec4b3d9d41c","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":654766,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegraphicalabstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/90a10bf49f4cedacf14d021f.png"},{"id":93940385,"identity":"175324c5-0283-4f76-aacc-21a0de174f4a","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"xml","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":227114,"visible":true,"origin":"","legend":"","description":"","filename":"5051a6f17ec24411a4bcd2415ca869511structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/4fe6bb16993a6b92c6102594.xml"},{"id":93940395,"identity":"901591a8-a7c3-41f0-8201-3c649a549635","added_by":"auto","created_at":"2025-10-20 13:32:50","extension":"html","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":237186,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/f8504f42222078f778d114b5.html"},{"id":93940355,"identity":"04315085-07c4-42d8-9741-baf513f80fa7","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":470837,"visible":true,"origin":"","legend":"\u003cp\u003eThe FTIR spectra include: the chitosan powder (yellow line), \u003cem\u003eB. longum\u003c/em\u003eprobiotic (orange line), alginate-whey protein microcapsules with chitosan coating (gray line), and microencapsulated \u003cem\u003eB. longum \u003c/em\u003ewith alginate-whey protein and chitosan coating (blue line).\u003c/p\u003e","description":"","filename":"Figure15.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/f5d48980c6d854bb4a1f51e4.jpg"},{"id":93940358,"identity":"9b6ad76c-9f05-4df5-8d13-a08f614866d5","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":391802,"visible":true,"origin":"","legend":"\u003cp\u003eSEM images: (A) Probiotic-loaded sodium alginate microcapsule morphology (X10,000); (B) Microcapsule surface (X50); (C) \u003cem\u003eB. longum\u003c/em\u003e cells (X10,000); (D) Microcapsule cross-section (X10,000).\u003c/p\u003e","description":"","filename":"Figure27.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/88039cfaa9e12af91a251d95.jpg"},{"id":93942464,"identity":"b9461a9f-cda5-4b77-92df-32f66893022d","added_by":"auto","created_at":"2025-10-20 13:48:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":60075,"visible":true,"origin":"","legend":"\u003cp\u003eRat liver-to-body weight ratio (%). BDL + vehicle rats showed a significant increase in liver-to-body weight ratio compared with the Sham group (****P ≤ 0.0001). Encapsulated probiotics (BDL + CP) significantly reduced the ratio compared with the BDL + vehicle group (**P ≤ 0.01), while free probiotics (BDL + FP) and fermented control (BDL + FC) showed non-significant reductions. No differences were observed between NC and SHC groups. Data are mean ± SEM.\u003c/p\u003e","description":"","filename":"Figure34.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/e714e6d8ee59d49c1c14015e.png"},{"id":93940360,"identity":"caa3f023-e7f8-4122-b7b7-3a68dccec56e","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":441181,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of free and microencapsulated \u003cem\u003eB. longum\u003c/em\u003e (alginate-whey/chitosan) and free capsules on hepatic enzymes (AST, ALT, ALP, LDH) and serum bilirubin in BDL rats. (Data: mean ± SD. ٭P≤0.05, ٭٭P≤0.01, ٭٭٭P≤0.0001 vs. BDL control)\u003c/p\u003e","description":"","filename":"Figure42.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/ae01e4d9e51aac5d9aad6fd8.png"},{"id":93940366,"identity":"9fc0405d-3030-4e60-acf2-ce3577f561aa","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":149877,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of free and microencapsulated \u003cem\u003eB. longum\u003c/em\u003e (alginate-whey/chitosan) and free capsules inflammatory gene expression (IL-6, IL-10 and TNF-α) and fibrosis related genes (α-SMA) based in accordance with β-actin expression in BDL rats. (Data: mean ± SD. ٭P≤0.05, ٭٭P≤0.01, ٭٭٭P≤0.0001 vs. BDL control)\u003c/p\u003e","description":"","filename":"Figure56.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/dcb4c84a0953ec868475e75b.png"},{"id":93941683,"identity":"0ffdf8e0-85b4-46f0-8a5e-62fc861f88de","added_by":"auto","created_at":"2025-10-20 13:40:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":197588,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of free and microencapsulated \u003cem\u003eB. longum\u003c/em\u003e (alginate-whey/chitosan) and free capsules on oxidative and anti-oxidative parameters in BDL rats. (Data: mean ± SD. ٭P≤0.05, ٭٭P≤0.01, ٭٭٭P≤0.0001 vs. BDL control)\u003c/p\u003e","description":"","filename":"Figure65.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/26754b01b11687c074e702e8.png"},{"id":93940369,"identity":"6366216d-6627-4fb6-9bcf-babbeff377d4","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":107150,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of free and microencapsulated \u003cem\u003eB. longum\u003c/em\u003e (alginate-whey/chitosan) and free capsules on histological parameters of liver tissue in BDL rats. (Data: mean ± SD. ٭P≤0.05, ٭٭P≤0.01, ٭٭٭P≤0.0001 vs. BDL control)\u003c/p\u003e","description":"","filename":"Figure73.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/54c9e9764467331fbde802d0.png"},{"id":93940378,"identity":"8982c012-c065-49dc-a9bd-4d7d85867823","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":4355863,"visible":true,"origin":"","legend":"\u003cp\u003eThe histopathological effects of free \u003cem\u003eB. longum\u003c/em\u003eprobiotic, alginate-whey protein-chitosan encapsulated probiotic, and empty alginate-whey-chitosan capsules on illuem tissue are shown in H\u0026amp;E-stained sections (100X), where arrows indicate fibrosis and arrowheads mark bile duct hyperplasia in: (A) Normal control, (B) Sham, (C) BDL control, (D) BDL+Free Probiotic, (E) BDL+Free Capsule, and (F) BDL+Encapsulated Probiotic groups.\u003c/p\u003e","description":"","filename":"Figure81.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/fad4e3597b6fa364f9a00e54.png"},{"id":93940368,"identity":"7fb2266d-9e40-43d5-962c-2ae0f5b462ab","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":5713,"visible":true,"origin":"","legend":"\u003cp\u003eThe histopathological effects of free \u003cem\u003eB. longum\u003c/em\u003eprobiotic, alginate-whey protein-chitosan encapsulated probiotic, and empty alginate-whey-chitosan capsules on illuem tissue are shown in H\u0026amp;E-stained sections (100X), where arrows indicate fibrosis and arrowheads mark bile duct hyperplasia in: (A) Normal control, (B) Sham, (C) BDL control, (D) BDL+Free Probiotic, (E) BDL+Free Capsule, and (F) BDL+Encapsulated Probiotic groups.\u003c/p\u003e","description":"","filename":"placeholderimage.png","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/a683c8cefb45c1835bbecf90.png"},{"id":108438962,"identity":"6a8af8c5-b423-4b4a-9b2e-08cf4d9debb0","added_by":"auto","created_at":"2026-05-04 16:12:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7557339,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/dad4ebd3-61de-4c91-804a-6c6c2a7a6ff8.pdf"},{"id":93940356,"identity":"644f2f8a-d0a2-4b5f-859e-da8e5af89a65","added_by":"auto","created_at":"2025-10-20 13:32:49","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":22067,"visible":true,"origin":"","legend":"","description":"","filename":"tables8.docx","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/3776b8bfd2984ea413305bbf.docx"},{"id":93943658,"identity":"8652a546-20af-48ec-b0e0-7dd14d58a3d3","added_by":"auto","created_at":"2025-10-20 13:56:49","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":360086,"visible":true,"origin":"","legend":"","description":"","filename":"graphicalabstract.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7773331/v1/a32fe1c0cbe406c312bc08d7.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Synthesis and Application of Encapsulated Bifidobacterium longum for Mitigation of Liver Fibrosis via Modulation of Oxidative Stress and Inflammation in a BDL Rat Model","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLiver disease represents a significant global health challenge, affecting approximately 1.5\u0026nbsp;billion individuals, leading to nearly 2\u0026nbsp;million deaths annually (Devarbhavi, Asrani et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eLiver disorders progress through four stages, beginning with inflammation. The inflammatory response in human initiates with the release of cytokines such as IL-6 and TGF-β, leading to induction of oxidative stress characterized by lipid peroxidation and production of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. This changes leads to differentiation of hepatic stellate cells (HSCs) into myofibroblasts (Berumen, Baglieri et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). HSCs, localized in the perisinusoidal area of liver tissue and primarily responsible for storage of retinoids, undergo differentiation to myofibroblasts which results in production of excessive amounts of extracellular matrix, containing collagen type I and III, and matrix metalloproteinase-1 (MMP1) inhibitor that accumulates in liver tissue; this differentiation also induces expression of platelet-derived growth factor (PDGF) and alpha-smooth muscle actin (α-SMA) (Berumen, Baglieri et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and vascular endothelial growth factor (VEGF) which promotes HSC proliferation (Kukla \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). This accumulation leads to liver fibrosis, initiating the second stage of liver disease. While liver fibrosis can be reversible depending on its progression and the extent of fibrotic tissue, failure to implement appropriate treatments can lead to cirrhosis, the third stage of liver disease. Currently, few FDA-approved drugs exist for treatment of liver fibrosis, although several are under clinical trials (Tan, Sun et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Devarbhavi, Asrani et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eLiver and intestine are in closely related anatomically, via common bile duct and portal vein, and metabolically since foods and nutrition are transferred into liver after being digested in the intestine and subsequently in other organs. This relation is called the gut-liver axis that suggests alteration in gut environment can cause changes in liver (Albillos, de Gottardi et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). One of these alterations is changes in gut microbiome (Chen, Yang et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Probiotics, defined as microorganisms that have health benefits if consumed at adequate amount, can balance disturbed gut microbiome (Amirreza, Reza et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). They also can produce and release several metabolites which may have antioxidant and anti-inflammatory effects, and they can also compete with pathogens for food and adhesive sites and induce gut and liver health (Wang, Wu et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Cristofori, Dargenio et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Zheng, Zhang et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). \u003cem\u003eBifidobacterium longum (B. longum)\u003c/em\u003e is a probiotic and a part of human gut microbiome (Quigley \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). This rod shaped, gram-positive probiotic has antioxidant activity, immunomodulatory and anti-inflammatory effects that has been observed to be helpful in curing several intestine and metabolic disorders. \u003cem\u003eB. longum\u003c/em\u003e can modulate gut-liver axis, restoring gut microbiome, producing metabolites such as short-chain fatty acids (SCFAs) such as butyrate, helping with maintaining gut integrity and modulating anti-inflammatory responses. This probiotic can also reduce oxidative stress, modulate inflammatory response through down-regulating inflammatory cytokines, and inhibit fibrosis pathways such as reducing collagen deposition by downregulating α-SMA (Lee, Shin et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2024\u003c/span\u003e, Lu, Shataer et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2024\u003c/span\u003e, Zhang, Xu et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).Therefore, may be beneficial in alleviating liver fibrosis and even reverse its progression (Dong, Ping et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Wang, Wang et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eProbiotics are often consumed orally which means passing through acidic and enzymatic environment of gastrointestinal tract (GIT) (Centurion, Basit et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This environment reduces probiotics viability and may reduce their effectiveness. A method to enhance their viability of probiotics in GIT is microencapsulating them with several materials such as carbohydrates, proteins and oils (Gbassi and Vandamme \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Alginate and whey protein are two substances that can be used in microencapsulating of \u003cem\u003eB. longum\u003c/em\u003e and is suggested that will induce their viability in GIT (de Ara\u0026uacute;jo Etchepare, Nunes et al. 2020, Krunić and Rakin \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Microcapsules can further be coated by chitosan to increase protection furthermore. Alginate and chitosan are insoluble in the stomach's acidic environment, but soluble in alkaline conditions of intestine, meaning that they can keep their integrity in stomach and be digested in intestine; thus, keeping probiotics safe in gastric juice and release them in intestine so probiotics can exert their effects (Kowalska, Ziarno et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Wang, Gao et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Also, alginate and chitosan can be used as prebiotics, meaning that they can be consumed and metabolized by the probiotics and gut microbiome which enhances their growth and activity and can help restore dysbiosis (Jantarathin, Borompichaichartkul et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Wang, Gao et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In addition, whey protein is demonstrated to have anti-oxidant and anti-inflammatory properties which can help reduce or reverse hepatic fibrosis progression (Corrochano, Buckin et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Arranz, Corrochano et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Mohammed, Mubarak et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eseveral methods can be used in order to induce liver fibrosis such as chemical usage such as CCl\u003csub\u003e4\u003c/sub\u003e, and physical methods such as bile duct ligation (BDL). In BDL method as the common bile duct is sutured sideways and cut in the middle, creates a cholestatic state and the back push of biliary acids induces oxidants and inflammation and initiates fibrosis progression (Takahashi and Fukusato \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSince there is no evidence of the effects of encapsulated \u003cem\u003eB. longum\u003c/em\u003e on experimental model of liver fibrosis, we hypothesize that oral supplementation with microencapsulated \u003cem\u003eB. longum\u003c/em\u003e will attenuate liver fibrosis in a rat model of bile duct ligation (BDL) by reducing oxidative stress, inflammation, and collagen deposition and intestinal barrier function enhancement.\u003c/p\u003e\u003cp\u003eIn this experiment we aim to firstly determine the structure of microcapsules, their efficiency and protection against different GIT environment. We also measure liver enzymes activity such as ALT, AST, ALP and LDH, total and free bilirubin levels. We also aim to determine malondialdehyde (MDA), nitric oxide (NO), glutathione (GSH), total antioxidant capacity (TAC), total oxidant status (TOS), catalase (CAT), superoxide dismutase (SOD) and oxidative stress index to determine the oxidative/ anti-oxidative status. We also investigated the gene expression level of TNF-α, IL-10, IL-6 and α-SMA in liver to determine treatment efficiency and ZO-1 in ileum to evaluate gut barrier integrity. Histopathologic parameters in ileum and liver will also be studied in addition to biochemical assays in an experimental model of induced hepatic fibrosis by BDL in rat.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eEthics statement of the study\u003c/h2\u003e\u003cp\u003eThis study was approved by Kashan University of Medical Sciences' Ethics Committee, Kashan, Iran under the code: \u003cb\u003eIR.KAUMS.AEC.1402.013\u003c/b\u003e. in order to minimize suffering in rats, all the procedures were performed under university's ethical guidelines.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eProbiotic strain preparation\u003c/h3\u003e\n\u003cp\u003eFara Daru company, Tehran, Iran kindly provided us with \u003cem\u003eB. longum\u003c/em\u003e in lyophilized powder form. Firstly 100 mg of the probiotic powder was dissolved in 1 ml of normal saline buffer. Then, serial dilution was performed and probiotics were cultured in bifidobacterium agar medium via pour plate method. Plates were incubated in an anaerobic jar (Don-Whitely jar gassing system) at 37 \u0026ordm;C for 72 hours. After that number of colonies were counted and the dosage of \u003cem\u003eB. longum\u003c/em\u003e was determined \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:{10}^{11}\\)\u003c/span\u003e\u003c/span\u003e CFU/gr.\u003c/p\u003e\u003cp\u003e\u003cb\u003eB. longum\u003c/b\u003e \u003cb\u003emicroencapsulation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eMicroencapsulation was carried out using extrusion method. Firstly, a mixture of alginate (2% w/v), whey protein concentrate (2% w/v) was prepared. Then 100 mg of probiotic powder was added to each 1 ml of the mixture and stirred until they were dissolved completely. Then the mixture was pushed through an insulin syringe (30G) into calcium chloride (5.5% w/v) to create microcapsules in spherical shape, and left there for 30 min to reach adequate hardening. Then the microcapsules were collected using Whatman 41 filter papers and washed with distilled water for 3 times. Next, they were added to chitosan solution (0.4% w/v) and softly shaken for 30 min for coating of microcapsules. At the end, microcapsules were collected using filter papers and washed once with distilled water.\u003c/p\u003e\n\u003ch3\u003eMicrocapsule's structure analysis\u003c/h3\u003e\n\u003cp\u003eSEM imaging was done using electron microscope (VEGA\\\\TESCAN-XMU) in Razi Metallurgical Center, Tehran, Iran to investigate the size and shape of microcapsules. In order to determine the structure and chemical properties of the microcapsules, FTIR analysis was performed from 400 nm to 4000 nm wavelength via (name of the instrument) in Razi Metallurgical Center, Tehran, Iran.\u003c/p\u003e\n\u003ch3\u003eEncapsulation efficiency\u003c/h3\u003e\n\u003cp\u003eWe used freshly prepared microcapsules to determine the efficiency of our encapsulation method, 1 ml of microcapsules was added to sodium citrate solution (10% w/v) and shaken until completely dissolved. Then we performed serial dilution and probiotic were cultivated via pour plate method.\u003c/p\u003e\u003cp\u003eThe encapsulation efficiency (%) was calculated via the following formula:\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\:\\frac{N}{N\u0026ordm;}\\:\\times\\:100$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eIn this formula \u003cem\u003eN\u003c/em\u003e is the log\u003csub\u003e10\u003c/sub\u003e of colony count of 1 ml of encapsulated probiotic and \u003cem\u003eN\u0026ordm;\u003c/em\u003e is the log\u003csub\u003e10\u003c/sub\u003e of colony count of 100 mg of free probiotic.\u003c/p\u003e\n\u003ch3\u003eMeasuring capsule's diameter\u003c/h3\u003e\n\u003cp\u003eIn order to measure produced capsule's, 50 capsules were randomly selected and their diameter was measured using the Image J program. The data is measured and presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD based on millimeters.\u003c/p\u003e\u003cp\u003e\u003cb\u003eB. longum\u003c/b\u003e \u003cb\u003eViability in Stimulated Gastrointestinal Environment\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe viability of free and encapsulated \u003cem\u003eB. longum\u003c/em\u003e formulations was assessed using a modified method described by Yasmin et al (Yasmin, Saeed et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Simulated gastric juice (SGJ) was prepared by dissolving 3.0 g/L pepsin and 9.0 g/L sodium chloride in sterile solution, adjusting the pH to 2.0 with 12 mol/L HCl. Before use, SGJ was pre-warmed to 37\u0026deg;C. 100 milligrams of free probiotics and 1 mL of microcapsules were separately incubated in 9 mL of SGJ at 37\u0026deg;C with constant agitation. Probiotic survival was determined at 30, 60, 90, and 120 min. For free cells, the SGJ mixture was centrifuged at 3000 \u0026times; g for 10 min. The pellet was washed once, resuspended in MRS broth, serially diluted, and plated on bifidobacterium agar for colony counting. For microcapsules, the samples were washed with sterile distilled water, dispersed in 10 mL of 10% (w/v) sodium citrate, serially diluted in MRS broth, and plated on bifidobacterium agar. Plates were incubated at 37\u0026deg;C for 72 hours.\u003c/p\u003e\u003cp\u003eStimulated intestinal fluid (SIF) was prepared by combining biliary acids (0.3% w/v), pancreatin (0.1% w/v), and sodium chloride (0.85% w/v), adjusting the pH to 8.0 with sodium hydroxide.\u003c/p\u003e\u003cp\u003eFollowing a 120-min incubation in simulated gastric juice, both free and encapsulated probiotics were harvested, washed, and transferred to 9 mL of SIF. The mixture was then incubated for 30, 60, 90, and 120 min. At each time point, probiotics and microcapsules were collected, washed, serially diluted, and cultured. Colony counts were used to determine probiotic release and survival rates, expressed as log\u003csub\u003e10\u003c/sub\u003e CFU.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eAnimals\u003c/h2\u003e\u003cp\u003eForty-eight adult male Wistar rats (180\u0026ndash;200 g) were obtained from the animal house of Kashan University of Medical Sciences. Animals were housed individually in stainless steel cages under controlled conditions (temperature: 23\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, humidity: 55%, 12-hour light/dark cycle). Standard laboratory food and water were provided \u003cem\u003ead libitum\u003c/em\u003e, except for an overnight fast before surgery and euthanasia. All animal procedures adhered to the guidelines of the National Research Council Subcommittee on Laboratory Animals.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eStudy Design\u003c/h3\u003e\n\u003cp\u003eA randomized experimental study was conducted to evaluate the effects of free and encapsulated probiotics on liver injury induced by bile duct ligation (BDL). Forty-eight male Wistar rats were randomly assigned to six groups (n\u0026thinsp;=\u0026thinsp;8/group): Normal control (NC), sham-operated control (SHC), BDL control (BDL\u0026thinsp;+\u0026thinsp;vehicle), free \u003cem\u003eB. longum\u003c/em\u003e probiotic (BDL\u0026thinsp;+\u0026thinsp;FP), free capsule (BDL\u0026thinsp;+\u0026thinsp;FC), and encapsulated \u003cem\u003eB. longum\u003c/em\u003e probiotic (BDL\u0026thinsp;+\u0026thinsp;CP).\u003c/p\u003e\u003cp\u003eRats in group BDL\u0026thinsp;+\u0026thinsp;FP and BDL\u0026thinsp;+\u0026thinsp;CP orally received 3\u0026times;10\u003csup\u003e9\u003c/sup\u003e CFU \u003cem\u003eB. longum\u003c/em\u003e and the rats in group BDL\u0026thinsp;+\u0026thinsp;FC were fed the same amount of algiante-whey protein with chitosan coating microcapsules as the sixth group animals. 3\u0026times;10\u003csup\u003e9\u003c/sup\u003e CFU of free and encapsulated \u003cem\u003eB. longum\u003c/em\u003e were added to the rats\u0026rsquo; daily food ration. Firstly, standard rat food was crushed and mixed with water to form a paste; then, the \u003cem\u003eB. longum\u003c/em\u003e powder and free microcapsules and encapsulated \u003cem\u003eB. longum\u003c/em\u003e was added to the paste. at last, the paste was formed to rod shape blocks and were put in refrigerator until the blocks have dried. Careful monitoring was performed to ensure that each animal consistently received the full dose throughout the duration of the study. They were treated daily 7 days before and 21 days after surgery. Animals in groups two to six received their respective treatments daily for one week before and three weeks after BDL surgery. The treatment regimen was prepared irrespective of the rats' weight, ensuring consistent dosage across the groups. Specifically, the fourth and sixth groups received \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:3\\times\\:{10}^{9}\\)\u003c/span\u003e\u003c/span\u003e CFU of either free or encapsulated \u003cem\u003eB. longum\u003c/em\u003e cells.\u003c/p\u003e\u003cp\u003eBDL surgery was performed under ketamine (75 mg/kg) and xylazine (10 mg/kg) anesthesia. After aseptic preparation, the common bile duct was doubly ligated and resected. Sham-operated animals underwent laparotomy without bile duct manipulation.\u003c/p\u003e\u003cp\u003eAnimals were euthanized by CO\u003csub\u003e2\u003c/sub\u003e inhalation followed by cardiac puncture for blood collection. Serum was separated from blood by centrifugation and stored at -80\u0026deg;C. Liver and ileum tissues were rapidly excised, with portions fixed in formalin for histopathology, and the remaining tissue snap-frozen in liquid nitrogen for biochemical and molecular analyses.\u003c/p\u003e\n\u003ch3\u003eValidation of Bile duct obstruction after surgery\u003c/h3\u003e\n\u003cp\u003eIn order to validate success of our BDL surgery, we euthanized 2 rats after 3 days and 2 rats after 4 days from both sham and BDL control group (total of 8 rats) preceding the BDL surgery. Their blood serum and liver tissue were extracted and used for further testing; Liver function tests were studied to validate fibrosis initiation.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eDetermination of treatment side effects\u003c/h2\u003e\u003cp\u003eIn this study, the potential side effects associated with different treatments were evaluated by monitoring the study groups. Since liver fibrosis can cause nausea, diarrhea and constipation, the bile duct ligated rats were monitored for the mentioned side effects. These side effects included diarrhea, vomiting, and constipation, which are considered significant indicators of adverse reactions to treatment. To conduct this assessment, side effects were continuously monitored on a daily basis during one week prior to the initiation of treatment and for three weeks following surgery. This approach allowed us to closely observe changes and patterns in the occurrence of side effects, enabling us to analyze the impacts of the treatments on the rat involved in the study.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eRat liver to rat body weight ratio\u003c/h2\u003e\u003cp\u003eLiver fibrosis involves the abnormal and excessive production of extracellular matrix in liver tissue, resulting in increased liver size and weight. The ratio of liver weight to mouse weight serves as an index for assessing the impact of surgical interventions and treatments on liver tissue.\u003c/p\u003e\u003cp\u003eOn the day of dissection, the weights of the rat were recorded, followed by the separation and weighing of the liver tissue. To calculate the percentage ratio of liver weight to total animal weight, the following formula was used:\u003c/p\u003e\u003cp\u003eliver to rat weight ratio\u0026thinsp;=\u0026thinsp;Wl/Wt \u0026times;100\u003c/p\u003e\u003cp\u003eIn this formula, Wl is the liver weight of the mouse, while Wt stands for total weight of an animal.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eBiochemical Parameter Determination\u003c/h2\u003e\u003cp\u003eStandard kits were used to measure aspartate aminotransferase (AST), alanine aminotransferase (ALT), lactate dehydrogenase (LDH), alkaline phosphatase (ALP), and total and direct bilirubin in liver homogenates using a Pars Azmoun Kit (Tehran, Iran) and a BT-3000 auto-analyzer (Biotecnica, Italy).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eRat Liver Homogenate Preparation\u003c/h2\u003e\u003cp\u003eLiver samples (100 mg) were rinsed with ice-cold PBS and homogenized using liquid nitrogen. The homogenate was then resuspended in 1 mL of lysis buffer containing 10 mM (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 0.1% Triton X-100, and protease inhibitor cocktail (pH 7.9). This mixture was incubated for 15 min at 4\u0026deg;C, followed by centrifugation at 10,000 \u0026times; g for 20 min at 4\u0026deg;C. Supernatants were used for subsequent analyses.\u003c/p\u003e\u003cp\u003eProtein content in the liver homogenate was quantified using the Bradford method with bovine serum albumin as a standard.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eMeasurement of Antioxidant Enzyme Activities and Oxidative Stress Parameters\u003c/h2\u003e\u003cdiv id=\"Sec16\" class=\"Section3\"\u003e\u003ch2\u003eAntioxidant Enzyme Activities\u003c/h2\u003e\u003cp\u003eSuperoxide dismutase (SOD) activity was measured using a commercially available SOD colorimetric assay kit (Kiazist Co., Iran) based on the nitro blue tetrazolium (NBT) method. Data are expressed as U/mg protein.\u003c/p\u003e\u003cp\u003eCatalase activity was determined by its ability to decompose hydrogen peroxide (H₂O₂) into water (H₂O) and oxygen (O₂). Briefly, tissue homogenate was added to a 66 \u0026micro;M H₂O₂ solution in sodium-potassium phosphate buffer (pH 7.4). The resulting oxygen gas and water formation were quantified indirectly by measuring the absorbance of a yellow complex formed with ammonium molybdate at 374 nm after 3 min.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eLipid Peroxidation Assessment\u003c/h2\u003e\u003cp\u003eMalondialdehyde (MDA) levels, a marker of lipid peroxidation, were determined using the thiobarbituric acid (TBA) method established by Ohkawa et al. (references 23, 24). Briefly, peroxidized lipids in liver tissue supernatants were reacted with TBA to form a colored complex, which was quantified by colorimetric assay at 632 nm wavelength. N-butanol was used as a blank, and tetraethoxypropane standards were used for calibration.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eNitric Oxide Formation Assessment\u003c/h2\u003e\u003cp\u003eNitric oxide (NO) levels in liver tissue homogenates were determined as the sum of nitrite and nitrate concentrations using the Griess reagent assay. The Griess reagent reacts with nitrite to form a deep purple azocompound, allowing for quantification through photometric analysis with sodium nitrate as the calibration standard.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eThiol Groups Assay\u003c/h2\u003e\u003cp\u003eThiol groups, essential antioxidants, were measured in liver homogenates using the Ellman method. This method utilizes the reaction between DTNB (5,5\u0026prime;-dithiobis-(2-nitrobenzoic acid)) and free thiol groups to produce a yellow complex. Absorbance was measured at 412 nm after incubation and centrifugation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eTotal Antioxidant Capacity Measurement\u003c/h2\u003e\u003cp\u003eThe ferric reducing antioxidant power (FRAP) assay was employed to assess total antioxidant capacity. FRAP reagent, prepared with acetate buffer, TPTZ (2,4,6-tripyridyl-s-triazine), and FeCl₃, reduces Fe\u0026sup3;⁺-TPTZ complex to Fe\u0026sup2;⁺ at low pH, resulting in a blue color. Sample absorbance was measured at 593 nm after incubation with FRAP reagent (references 27\u0026ndash;29). FeSO₄.7H₂O standards were used for calibration.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eTotal oxidant status measurement\u003c/h2\u003e\u003cp\u003eThe Total Oxidative Status (TOS) method was employed to assess the oxidation potential of the sample. Briefly, in an acidic environment, ferric ions (Fe\u0026sup3;⁺) react with xylenol orange to form a colored complex. TOS measures were reported in micromoles of hydrogen peroxide (H₂O₂) concentration per liter, following calibration with H₂O₂.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eRNA Extraction and cDNA Synthesis\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from 30 mg liver tissue using a column-based kit (DNAbiotech, Tehran, Iran) according to the manufacturer\u0026rsquo;s protocol. Briefly, 30 mg of liver tissue was homogenized and mixed with 800 \u0026micro;l of RNLy buffer. Then it was mixed with 150 \u0026micro;l of chloroform. Then the mixture was centrifuged at 12,000 \u0026times; g for 12 min at 4 \u0026ordm;C. 450 \u0026micro;l of upper phase was moved to a new tube and mixed with 400 \u0026micro;l of ethanol 96%. The mixture was transferred to the spin column and the column was put in a collection tube and centrifuged for 1 min at 12,000 \u0026times; g. Then the column was washed with 700 \u0026micro;l of RN wash buffer and centrifuged for 1 min. At last, the column was moved to a new tube and 50 \u0026micro;l of elution buffer was poured to the center of column and centrifuged for 1 min at 12,000 \u0026times; g. RNA quality was verified through agarose gel electrophoresis, and quantification was performed using a NanoDrop 2000 spectrophotometer (NanoDrop Products, Wilmington, DE, USA).\u003c/p\u003e\u003cp\u003eSubsequently, cDNA synthesis was carried out using a commercial kit (Parstous, Mashhad, Iran). Briefly, 1000 ng of total RNA was reverse transcribed into cDNA in a 20 \u0026micro;L reaction volume containing the supplied buffer and enzyme mix. The reaction was conducted through a temperature cycling protocol involving incubation at 25\u0026deg;C for 10 min, 47\u0026deg;C for 60 min, and 85\u0026deg;C for 5 min to terminate the reaction.\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eQuantitative Reverse Transcription-Polymerase Chain Reaction (RT-qPCR)\u003c/h2\u003e\u003cp\u003eGene expression levels of IL-6, IL-10, α-SMA, TNF-α, and ZO-1 were quantified using real-time PCR. β-actin served as the endogenous control for normalization. The reactions were performed on an iCycler IQ\u0026trade; real-time PCR cycler (Bio-Rad Laboratories, CA, USA) using SYBR Green PCR Master Mix (Ampliqon, Denmark). Each 20 \u0026micro;L reaction mixture comprised 1 \u0026micro;L cDNA, 10 \u0026micro;L Maxima SYBR Green/ROX qPCR Master Mix 2X (Ampliqon, Bie \u0026amp; Berntsen, Herlev, Denmark), 8 \u0026micro;L nuclease-free water, and 0.5 \u0026micro;L of both forward and reverse primers specific to the target gene. Amplification was achieved through 40 cycles of denaturation at 96\u0026deg;C for 5 seconds, annealing at 49.6\u0026deg;C for 30 seconds, and extension at 72\u0026deg;C for 30 seconds, preceded by an initial polymerase activation step at 95\u0026deg;C for 30 min. Relative gene expression was calculated using the comparative Ct method. The ΔCt value, representing the difference in Ct values between the target gene and β-actin,Δ\u003cem\u003eCt\u003c/em\u003e\u0026thinsp;=\u0026thinsp;\u003cem\u003eCt\u003c/em\u003e (Target)\u0026thinsp;\u0026minus;\u0026thinsp;\u003cem\u003eCt\u003c/em\u003e (\u003cem\u003eβ\u003c/em\u003e-actin), was determined for each sample. Subsequently, fold changes in gene expression were calculated using the \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:{2}^{-\\varDelta\\:\\varDelta\\:ct}\\)\u003c/span\u003e\u003c/span\u003e formula. The primer sequences and properties are shown in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003esequences and properties of primers used in evaluating gene expression in this study\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse Primer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAnnealing TM\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eProduct size\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eΒ Actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTGTGTGGATTGGTGGCTCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGCTCAGTAACAGTCCGCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60.0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e135\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSMAα\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGCTATGTGGGGGACGAAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCGTTAGCAAGGTCGGATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e60.0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e168\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTNFα\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eATGGGCTCCCTCTCATCAGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCTTGGTTTGCTACGAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e57.0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e106\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e6IL-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTCTCCGCAAGAGACTTCCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCTGTTGTGGGTGGTATCCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e56.0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e120\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e10IL-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCAGGACTTTAAGGGTTACTTGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGGGAGAAATCGATGACAGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e58.6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e181\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eHistopathological Examinations\u003c/h2\u003e\u003cp\u003eLiver and terminal ileum tissues were subjected to histopathological analysis. Specimens were initially immersed in a 10% neutral formalin buffer, subsequently embedded in paraffin, and sectioned into 5-micrometer-thick slices. Hematoxylin and eosin (H\u0026amp;E) staining was employed to assess general histological features, while Masson's trichrome staining was utilized to quantify liver fibrosis through collagen deposition. An experienced pathologist determined the Metavir score and fibrosis stage based on H\u0026amp;E-stained sections. Histological characteristics, including necrosis, inflammation, ductal hyperplasia, and fibrosis, were graded using the H\u0026amp;E-stained slides.\u003c/p\u003e\u003cp\u003eTo establish a standardized scoring system, a mean score was calculated across ten randomly selected fields per section. Liver lesions were categorized according to the following criteria: fibrosis (absent, fibrous portal expansion, septal formation, marked bridging fibrosis, cirrhosis), necrosis (absent, focal necrosis affecting\u0026thinsp;\u0026lt;\u0026thinsp;25%, 25\u0026ndash;50%, or \u0026gt;\u0026thinsp;50% of tissue, global hepatocyte necrosis), ductal hyperplasia (absent, hyperplasia involving\u0026thinsp;\u0026lt;\u0026thinsp;25%, 25\u0026ndash;50%, or \u0026gt;\u0026thinsp;50% of each liver lobule, global hyperplasia), and inflammation (absent, focal inflammation affecting\u0026thinsp;\u0026lt;\u0026thinsp;25%, 25\u0026ndash;50%, or \u0026gt;\u0026thinsp;50% of tissue, global inflammation).\u003c/p\u003e\u003cp\u003eHistological modifications within the ileum were evaluated based on inflammatory infiltrate (absent, increased inflammatory cells, infiltration of submucosa, infiltration of muscle layer), goblet cell loss (healthy goblet cells, loss in \u0026lt;\u0026thinsp;10%, 10\u0026ndash;50%, or \u0026gt;\u0026thinsp;50% of tissue), and crypt density (healthy crypts, reduced crypts in \u0026lt;\u0026thinsp;10%, 10\u0026ndash;50%, or \u0026gt;\u0026thinsp;50% of tissue).\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\u003ch2\u003eDetermination of rats' survival rate during treatment\u003c/h2\u003e\u003cp\u003eFollowing the surgical procedure for common bile duct obstruction and the induction of a liver fibrosis model, some rats died due to liver damage, underscoring the negative impact of surgery on their hepatic health. To evaluate the effects of various treatments on mouse survival, a study was conducted to compare survival rates across different groups. The survival rate was calculated by determining the ratio of surviving rat at the end of the study to those present at the beginning, expressed as a percentage using the formula (Nl/Nf) \u0026times;100 where Nl is the number of survivors on the last day and Nf is the number on day one.\u003c/p\u003e\u003cp\u003eThis investigation provides insights into treatment efficacy and potential side effects, which may inform future therapeutic strategies for liver diseases.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eData are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) and were subjected to statistical analysis using one-way analysis of variance (ANOVA) followed by Dunnett\u0026rsquo;s post hoc test. Independent T-test was used for analysis between two groups. The significance threshold for all tests was set at P\u0026thinsp;\u0026le;\u0026thinsp;0.05. Data management and analysis were conducted using SPSS version 27 and GraphPad Prism version 10.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eFTIR analysis of encapsulated\u003c/b\u003e \u003cb\u003eB. longum\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe chitosan spectrum is identified by several peaks which are characteristic of the polymer. Importantly, there are strong absorption bands near 3400 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e owing to O-H and N-H stretching vibrations because they confirm that there are hydroxyl and amine groups present. Peaks around 2900 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e represent C-H stretching vibrations. There is also one peak near 1650 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, which can be attributed to the amide I band that represents the C\u0026thinsp;=\u0026thinsp;O stretching of the amide group. The peak about 1550 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e corresponds to the amide II band, which relates to the N-H-bending and C-N-stretching vibrations. All the peaks in the region 1000\u0026ndash;1200 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e can be said to arise from C-O stretching vibrations. The Free Capsule spectrum produced peaks that closely match those of Chitosan, although there are differences in intensity and location of these peaks. The broad band around 3400 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e indicates the presence of O-H and N-H stretching vibrations. The peaks around 2900 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e are due to C-H stretching vibrations. Amides I and II can be seen around 1650 and 1550 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, respectively. The peaks in the range of 1000\u0026ndash;1200 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e are indicative of C-O stretching vibrations. The variances in peak intensity and position compared to Chitosan suggest interaction between the capsule and Chitosan. Distinct peaks represent the Functional groups present in Free Probiotic material. Broad peaks appear around 3400 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e due to O-H and N-H stretching vibrations. Similar peaks near 2900 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e indicate stretching vibrations of C-H. The amide I and amide II bands could be observed around 1650 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 1550 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, respectively. The peaks between 1000 and 1200 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e are attributed to the stretching vibrations of C-O: pointing to these functional groups that characterize the probiotic material. In the Encapsulated Probiotic spectrum, peaks are seen to be characteristic of both the probiotic material and the encapsulating agents (alginate-whey protein with Chitosan coating). The broad peak near 3400 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e indicates the presence of O-H and N-H stretching vibrations. Peaks around 2900 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e show C-H stretching vibrations. The amide I and amide II bands are around 1650 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 1550 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, respectively, while 1000\u0026ndash;1200 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e regions show peaks indicating C-O stretching vibrations. Thus, these peaks indicated that encapsulation of probiotic material was done successfully using alginate-whey protein and Chitosan coating (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFTIR spectra provide meaningful information regarding functional groups in samples. The characteristic peaks present in the Chitosan spectrum indicate hydroxyl, amine and amide groups. In the Free Capsule spectra, similar peaks were obtained but varying in intensity and position. This is an indication of interactions between the capsule components and Chitosan. The Free Probiotic spectrum indicates distinct peaks that denote the probiotic material. The Encapsulated Probiotic peaks are characteristic of both the probiotic material and agents encapsulating them. This indicates successful encapsulation. This analysis gives insight into chemical interactions besides structural integrity of the encapsulated probiotic since this is relevant in developing good encapsulation techniques for \u003cem\u003eB. longum\u003c/em\u003e with alginate-whey protein and Chitosan coating.\u003c/p\u003e\u003cp\u003e\u003cb\u003eInvestigating morphology by SEM imaging of encapsulated\u003c/b\u003e \u003cb\u003eB. longum\u003c/b\u003e\u003c/p\u003e\u003cp\u003eScanning electron imaging (SEM) showed rod-shaped \u003cem\u003eB. longum\u003c/em\u003e probiotic at 10,000x magnification. SEM also showed spherical shaped microcapsules made from alginate-whey with chitosan coating with rough surface in 60x magnification and their size was determined to be almost 2000 \u0026micro;m in diameter. In 10,000x magnification the matrix of free capsules is visible and in encapsulated probiotics, the probiotics are seen embedded in capsule's matrix in the microcapsule's surface (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThese pictures show that in encapsulated \u003cem\u003eB. longum\u003c/em\u003e the probiotic cells are clearly visible on the surface of microcapsules, indicating that the probiotics are embedded in microcapsule's matrix.\u003c/p\u003e\u003cp\u003eAlginate-whey protein with chitosan coating capsule's diameters were calculated to be 1.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19 (Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) millimeters using the Image J program.\u003c/p\u003e\u003cp\u003eAfter encapsulating \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:3\\times\\:{10}^{9}\\)\u003c/span\u003e\u003c/span\u003e CFU of \u003cem\u003eB. longum\u003c/em\u003e, the capsules were resolved in sodium citrate (10% W/V) and cultivated. Then the cultivated colonies were counted and the efficiency of encapsulation was calculated to be 80% based on the formula on section 2.5.\u003c/p\u003e\u003cp\u003e\u003cb\u003eFree and encapsulated\u003c/b\u003e \u003cb\u003eB. longum\u003c/b\u003e \u003cb\u003eviability in stimulated gastrointestinal environment\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe survival rate of free and encapsulated \u003cem\u003eB. longum\u003c/em\u003e after four 30-min intervals in SGJ is reported in Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Both free and encapsulated probiotic's dose was set to 10, based on log\u003csub\u003e10\u003c/sub\u003e, and after 120 min, free probiotic's viability reduced to 3.50 while encapsulated probiotics viability fell to 9.47 after 120 min.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003esurvival rate of free and encapsulated \u003cem\u003eB. lognum\u003c/em\u003e in 0, 30, 60, 90 and 120 mintues in stimulated gastric juice\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTime in SGJ\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFree \u003cem\u003eB. longum\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eEncapsulated \u003cem\u003eB. longum\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e9.71\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9.79\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e9.204\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9.72\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e4.612\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9.6\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e120\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3.501\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9.47\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eAfter 120 min in SGJ, free and encapsulated probiotics were extracted and moved to SIF and their determined survival and release after 30, 60, 90, and 120 min in SIF is reported in Table \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Free probiotic's survival rate fell from 3.50 to 2.47 in 60 min and to 0 in 90 min. During the 120 min in SIF the probiotic count was reduced from 9.47 to 1.1 in 90 min and to 0 in 120 min (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003esurvival rate of free and encapsulated \u003cem\u003eB. lognum\u003c/em\u003e in 0, 30, 60, 90 and 120 mintues in stimulated intestinal fluid\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTime in SIF\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFree \u003cem\u003eB. longum\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eEncapsulated \u003cem\u003eB. longum\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3.501\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9.47\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e2.69\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e6.58\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e2.47\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e2.3\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1.1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e120\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\u003ch2\u003eSide effects of treating rats with our three treatments\u003c/h2\u003e\u003cp\u003eThis study examined the effects of both free and microencapsulated \u003cem\u003eB. longum\u003c/em\u003e, specifically within alginate-whey microcapsules coated with chitosan, in a rat model. The experimental timeline comprised one week of pre-treatment observation followed by three weeks of post-treatment monitoring. Over the four-week duration, no gastrointestinal adverse effects\u0026mdash;including diarrhea, vomiting, constipation, or anorexia\u0026mdash;were detected in any of the subjects. These results suggest that the administered probiotic formulations might exhibit a favorable safety profile, with no evidence of adverse effects in the treated groups. Also, no gastrointestinal side effects were detected in the bile duct ligated rats. However, more precise cytotoxicity assays are required to ensure the safety profile of this treatment.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec29\" class=\"Section2\"\u003e\u003ch2\u003eValidation of Bile duct obstruction after surgery\u003c/h2\u003e\u003cp\u003eThe results demonstrated that the liver enzymes ALT, AST, ALP, and LDH, as well as total and direct bilirubin, were significantly elevated in the 3-day bile duct ligation (BDL) groups compared to their corresponding sham-operated groups (3-day Sham). This indicates the onset of liver injury following common bile duct obstruction surgery. The findings revealed the deposition of fibrous tissue in the liver and the initiation of fibrosis as early as the third day post-BDL surgery, confirming the progression of liver damage. The data are presented in Table \u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe effect of bile duct ligation after 3 days on rat liver function tests.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGroup\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003e3-Day sham\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3-day BDL\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAST\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e198.5\u0026thinsp;\u0026plusmn;\u0026thinsp;67.15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1714.5\u0026thinsp;\u0026plusmn;\u0026thinsp;89.8\u003c/p\u003e\u003cp\u003e***\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eALT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e79\u0026thinsp;\u0026plusmn;\u0026thinsp;4.94\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1972\u0026thinsp;\u0026plusmn;\u0026thinsp;259.5\u003c/p\u003e\u003cp\u003e***\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eALP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e556\u0026thinsp;\u0026plusmn;\u0026thinsp;161.22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e6038\u0026thinsp;\u0026plusmn;\u0026thinsp;994.19\u003c/p\u003e\u003cp\u003e**\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e1287\u0026thinsp;\u0026plusmn;\u0026thinsp;626.49\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e25347\u0026thinsp;\u0026plusmn;\u0026thinsp;957.42\u003c/p\u003e\u003cp\u003e****\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTotal bilirubin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e0.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e5.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.84\u003c/p\u003e\u003cp\u003e***\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDirect bilirubin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e0.045\u0026thinsp;\u0026plusmn;\u0026thinsp;0.007\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003c/p\u003e\u003cp\u003e***\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"3\"\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Abbreviations: BDL, bile duct-ligated mice; AST, aspartate aminotransferase; ALT, alanine aminotransferase; ALP, alkaline phosphatase; LDH, lactate dehydrogenase; FP, free probiotic; FC, empty capsule; CP, encapsulated probiotic. Asterisks indicate significant differences compared to the BDL control group (*P\u0026thinsp;\u0026le;\u0026thinsp;0.05, **P\u0026thinsp;\u0026le;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026le;\u0026thinsp;0.001, **** P\u0026thinsp;\u0026le;\u0026thinsp;0.001). independent T-test was used for analysis between the two groups (number of rats per group\u0026thinsp;=\u0026thinsp;8)\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eConsequently, the treatment of mice was initiated on the third day after surgery, coinciding with the onset of hepatic fibrotic processes\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eRat liver to rat body weight ratio\u003c/h3\u003e\n\u003cp\u003eResults from this analysis are given in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. In addition, the percentage of liver weight over rats' weight for each group was calculated. As illustrated in the chart, the ratio (percentage) of liver weight to body weight was significantly different in the BDL\u0026thinsp;+\u0026thinsp;vehicle group compared to the Sham group, which present enlarged and heavier livers, with P\u0026thinsp;\u0026le;\u0026thinsp;0.0001. Within the treatment groups, the probiotic-coated treatment group demonstrated a significant decrease in the liver-to-body weight ratio compared with the BDL\u0026thinsp;+\u0026thinsp;vehicle group at P\u0026thinsp;\u0026le;\u0026thinsp;0.01, hence indicating that for this group liver weight was substantially lower when placed side by side with the nontreated lot. In the free probiotics-treated group, there is a reduction of liver-to-body weight ratio, but such was not statistically significant. There were also no significant differences among the various treatment groups, and between the two control groups, healthy and Sham.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEffects of encapsulated\u003c/b\u003e \u003cb\u003eB. longum\u003c/b\u003e \u003cb\u003eon biochemical parameters\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSerum levels of liver enzymes, including alkaline phosphatase (ALP), aspartate aminotransferase (AST), alanine aminotransferase (ALT), and lactate dehydrogenase (LDH), as well as total and direct bilirubin, were significantly elevated in the bile duct ligation (BDL) group compared to sham or healthy controls (p\u0026thinsp;\u0026le;\u0026thinsp;0.05 for ALP, AST, LDH; p\u0026thinsp;\u0026le;\u0026thinsp;0.0001 for total and direct bilirubin). These findings indicate the successful induction of liver injury in the BDL model. Administration of encapsulated and free \u003cem\u003eB. longum\u003c/em\u003e resulted in a significant reduction in serum levels of total and direct bilirubin (p\u0026thinsp;\u0026le;\u0026thinsp;0.05), as well as ALP, AST, LDH, and ALT (p\u0026thinsp;\u0026le;\u0026thinsp;0.01 for ALP, AST, LDH; p\u0026thinsp;\u0026le;\u0026thinsp;0.001 for ALT) compared to the BDL\u0026thinsp;+\u0026thinsp;vehicle group. These results suggest that encapsulated probiotics may effectively mitigate liver injury induced by bile duct obstruction. Also, alginate-whey protein with chitosan coating capsules reduced ALP activity (p\u0026thinsp;\u0026le;\u0026thinsp;0.001), and direct and total bilirubin levels significantly (p\u0026thinsp;\u0026le;\u0026thinsp;0.05 and p\u0026thinsp;\u0026le;\u0026thinsp;0.01 respectively) compared to the BDL\u0026thinsp;+\u0026thinsp;vehicle group.\u003c/p\u003e\u003cp\u003eIn the comparison among the treatment groups, no significant differences were observed in the reduction of the activities of the enzymes ALT, AST, and ALP, as well as in the serum levels of total and direct bilirubin among all three treatment groups. However, the reduction in LDH activity in the group treated with microencapsulated probiotics was significantly greater than that in the free probiotic group (P\u0026thinsp;\u0026le;\u0026thinsp;0.05). Liver enzyme activity and bilirubin levels are illustrated in the charts in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEffect of free and encapsulated\u003c/b\u003e \u003cb\u003eB. longum\u003c/b\u003e \u003cb\u003eon gene expression\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe expression of inflammatory cytokines, IL-6 and TNF- α was significantly increased (P\u0026thinsp;\u0026le;\u0026thinsp;0.0001 and P\u0026thinsp;\u0026le;\u0026thinsp;0.01 respectively) in BDL\u0026thinsp;+\u0026thinsp;vehicle compared to healthy control (HC). Treatment with free \u003cem\u003eB. longum\u003c/em\u003e significantly reduced IL-6 and TNF-α expression levels compared to BDL\u0026thinsp;+\u0026thinsp;vehicle group (P\u0026thinsp;\u0026le;\u0026thinsp;0.05 and P\u0026thinsp;\u0026le;\u0026thinsp;0.001) and treatment with alginate-whey with chitosan coating reduced the gene expression of IL-6 and TNF-α significantly (P\u0026thinsp;\u0026le;\u0026thinsp;0.05 and P\u0026thinsp;\u0026le;\u0026thinsp;0.01). The expression of these genes was significantly downregulated in rats treated with encapsulated probiotics, P\u0026thinsp;\u0026le;\u0026thinsp;0.0001 for IL-6 and P\u0026thinsp;\u0026le;\u0026thinsp;0.001 for TNF-α when compared to BDL\u0026thinsp;+\u0026thinsp;vehicle group. Although the decrease of gene expression was greater in encapsulated probiotic treatment group compared to other treatments, this reduction was not significant between the treatment groups.\u003c/p\u003e\u003cp\u003eIL-10, being an anti-inflammatory cytokine, decreased significantly in BDL\u0026thinsp;+\u0026thinsp;vehicle group compared to the healthy control (HC) group (P\u0026thinsp;\u0026le;\u0026thinsp;0.001). Among the treatment groups, although the free probiotic treatment resulted in some increase in this gene's expression, this increase was not significant compared to the BDL\u0026thinsp;+\u0026thinsp;vehicle group. Additionally, no change in IL-10 gene expression was observed in the microcapsule treatment group compared to the BDL\u0026thinsp;+\u0026thinsp;vehicle group. The expression of this interleukin in the microencapsulated probiotic treatment group was significantly reduced (P\u0026thinsp;\u0026le;\u0026thinsp;0.01) compared to the BDL\u0026thinsp;+\u0026thinsp;vehicle group.\u003c/p\u003e\u003cp\u003eAlpha-smooth muscle actin (α-SMA) is a marker of the activation of stellate cells and their differentiation into myofibroblasts. In the BDL\u0026thinsp;+\u0026thinsp;vehicle group, the expression of this gene showed a significant increase (P\u0026thinsp;\u0026le;\u0026thinsp;0.001) compared to the healthy control (HC) group. In the treatment groups, no significant change in the expression of this protein was observed in the microcapsule treatment group compared to the BDL\u0026thinsp;+\u0026thinsp;vehicle group; however, significant reductions were noted in the free probiotic and microencapsulated probiotic groups, with significance levels of P\u0026thinsp;\u0026le;\u0026thinsp;0.01 and P\u0026thinsp;\u0026le;\u0026thinsp;0.001, respectively. When comparing the treatment groups, a significant difference (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) was observed between the free probiotic and microencapsulated probiotic treatment groups. All data are illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEffect of free and encapsulated\u003c/b\u003e \u003cb\u003eB. longum\u003c/b\u003e \u003cb\u003eon oxidative stress parameters\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTotal antioxidant capacity (TAC) was significantly decreased in the BDL\u0026thinsp;+\u0026thinsp;vehicle group when compared with the Sham group (P\u0026thinsp;\u0026le;\u0026thinsp;0.05). Both the free probiotic and microencapsulated probiotic groups showed a significant rise (P\u0026thinsp;\u0026le;\u0026thinsp;0.01) compared with the BDL\u0026thinsp;+\u0026thinsp;vehicle group. The single microcapsule treatment group increased the total antioxidant index (P\u0026thinsp;\u0026le;\u0026thinsp;0.05), which was less than the increase seen in the other two groups, and there is no significant difference between those two groups. Additionally, there were no significant differences among the free probiotic and microencapsulated probiotic treatment groups.\u003c/p\u003e\u003cp\u003eThe total oxidant status (TOS) showed a significant increase (P\u0026thinsp;\u0026le;\u0026thinsp;0.01) in the BDL\u0026thinsp;+\u0026thinsp;vehicle group compared to the Sham group. In treatment with free probiotics and alginate-whey capsules with a chitosan coat, a significant reduction happened versus BDL\u0026thinsp;+\u0026thinsp;vehicle with significance defined by the values of P\u0026thinsp;\u0026le;\u0026thinsp;0.01. The encapsulated \u003cem\u003eB. longum\u003c/em\u003e showed a high, meaningful decline opposed to the BDL\u0026thinsp;+\u0026thinsp;Vehicle with P\u0026thinsp;\u0026le;\u0026thinsp;0.001. There were no significant differences when comparing treatment groups to one another.\u003c/p\u003e\u003cp\u003eThe results of superoxide dismutase (SOD) activity assay indicated that the activity of this enzyme was significantly reduced (P\u0026thinsp;\u0026le;\u0026thinsp;0.001) in the BDL\u0026thinsp;+\u0026thinsp;vehicle group compared to the Sham group. In the groups treated with free probiotics and free microcapule's an increase in enzyme activity was observed; however, this increase was not statistically significant compared to the BDL\u0026thinsp;+\u0026thinsp;vehicle group. Conversely, in the group treated with the encapsulated probiotic, an increase in enzyme activity was noted with a significance level of (P\u0026thinsp;\u0026le;\u0026thinsp;0.05). When comparing the treatment groups, although the encapsulated probiotic group exhibited higher enzyme activity, this increase was not statistically significant when compared to the groups treated with free probiotics and alginate capsules.\u003c/p\u003e\u003cp\u003eNitric oxide (NO) is an oxidative marker that can be measured using the Griess method, and the results indicated a significant increase (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) in nitric oxide levels in the BDL\u0026thinsp;+\u0026thinsp;vehicle group compared to the Sham group. In the treatment groups, all three groups exhibited a decrease in nitric oxide levels; however, this difference was statistically significant (P\u0026thinsp;\u0026le;\u0026thinsp;0.05) only in the groups treated with free probiotics and encapsulated probiotics compared to the BDL\u0026thinsp;+\u0026thinsp;vehicle group. In contrast, the group treated with alginate capsules did not show a significant reduction. No significant changes were observed among the three treatment groups when compared to each other.\u003c/p\u003e\u003cp\u003eMalondialdehyde (MDA) is an indicator of lipid peroxidation and was quantified using the thiobarbituric acid (TBA) method. In the BDL\u0026thinsp;+\u0026thinsp;vehicle group, MDA levels exhibited a significant increase (P\u0026thinsp;\u0026le;\u0026thinsp;0.01) compared to the Sham group. The treatment groups with free probiotics and free microcapsules demonstrated a significant reduction (P\u0026thinsp;\u0026le;\u0026thinsp;0.01) in lipid peroxidation and MDA levels when compared to the BDL\u0026thinsp;+\u0026thinsp;vehicle group. Additionally, the group treated with the encapsulated probiotic also showed a significant decrease with a significance level of (P\u0026thinsp;\u0026le;\u0026thinsp;0.001) relative to the BDL\u0026thinsp;+\u0026thinsp;vehicle group. No significant differences were observed among the three treatment groups when compared to one another. All data are illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEffects of free and encapsulated\u003c/b\u003e \u003cb\u003eB. longum\u003c/b\u003e \u003cb\u003eon liver tissue\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFollowing the preparation and staining of liver tissue slides, the slides were examined by a pathologist. Histopathological indices\u0026mdash;including biliary duct hyperplasia, necrosis, fibrosis, and inflammation\u0026mdash;were scored based on the Metavir scoring system, ranging from 0 to 4. The histopathological results revealed a significant increase in inflammation, necrosis, biliary duct hyperplasia, and fibrosis in the BDL\u0026thinsp;+\u0026thinsp;vehicle group compared to the Sham group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.01, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.0001, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.01, and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05, respectively), indicating substantial tissue damage induced by bile duct ligation (BDL) surgery. In the treatment groups, administration of the microcapsule alone led to a significant reduction in tissue necrosis (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.01), while no significant changes were observed in the other indices. Treatment with free \u003cem\u003eB. longum\u003c/em\u003e also resulted in a significant decrease in tissue necrosis (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.001). Although reductions were noted in inflammation, biliary duct hyperplasia, and fibrosis, these changes were not statistically significant. Conversely, treatment with microencapsulated \u003cem\u003eB. longum\u003c/em\u003e significantly reduced Metavir scores for inflammation, necrosis, and fibrosis (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.0001, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.01, and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05, respectively). While a decrease in biliary duct hyperplasia was also observed, this change did not reach statistical significance (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The pictures of liver tissue with H\u0026amp;E staining are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e with X100 and X400 magnification.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEffects of free and encapsulated\u003c/b\u003e \u003cb\u003eB. longum\u003c/b\u003e \u003cb\u003eon ileum tissue\u003c/b\u003e\u003c/p\u003e\u003cp\u003eHistopathological examination of ileal tissue assessed the effects of different treatments by evaluating inflammatory cell infiltration, submucosal inflammation, goblet cell depletion, crypt density and hyperplasia, muscle layer thickening, and the presence of ulcers and abscesses. The BDL\u0026thinsp;+\u0026thinsp;vehicle group showed significantly increased inflammatory cell infiltration (0.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33), crypt density (1.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58), and goblet cell depletion (0.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33) compared to the Sham group (all scores 0), while other indices remained unchanged. This group also exhibited reduced villi and crypt counts along with elongated villi, unlike other groups. In contrast, treatment with free \u003cem\u003eB. longum\u003c/em\u003e, microencapsulated \u003cem\u003eB. longum\u003c/em\u003e, and empty microcapsules resulted in normal ileal architecture, with all histopathological scores matching the Sham group (zero across all indices), indicating no pathological changes (Table \u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The pictures of ileum tissue are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe histopathological effects of free \u003cem\u003eB. longum\u003c/em\u003e probiotic, alginate-whey protein-chitosan encapsulated \u003cem\u003eB. longum\u003c/em\u003e, and empty alginate-whey-chitosan capsules on illeum tissue histological parameters\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGroups\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNC\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSHC\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eBDL\u0026thinsp;+\u0026thinsp;Vehicle\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eBDL\u0026thinsp;+\u0026thinsp;FP\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eBDL\u0026thinsp;+\u0026thinsp;FC\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eBDL\u0026thinsp;+\u0026thinsp;CP\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eInflammatory cell infiltration\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esubmucosal inflammation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003egoblet cell depletion\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecrypt density\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.58\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCrypt hyperplasia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emuscle layer thickening\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eulcers and abscesses\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNot seen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNot seen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNot seen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDescription\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLoss of villi number and increase in their length were seen\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec31\" class=\"Section2\"\u003e\u003ch2\u003eSurvival rate of rats during the study\u003c/h2\u003e\u003cp\u003eIn this study, the survival rates of rats in the various control and treatment groups were calculated. It was found that all rat in the healthy control (HC) and sham control (SHC) groups exhibited the highest survival rates (100%), while the group subjected to bile duct ligation plus vehicle (BDL\u0026thinsp;+\u0026thinsp;vehicle) had the lowest survival rate at 30%, as they did not receive any treatment. Among the treatment groups, the highest survival rate was observed in the group treated with microencapsulated probiotics (70%). The groups treated with free probiotics and microcapsules demonstrated survival rates of 60% and 50%, respectively.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eLiver disease is a significant health burden worldwide, affecting approximately 1.5\u0026nbsp;billion people and causing almost 2\u0026nbsp;million deaths annually. The pathogenesis of liver diseases starts with inflammation, mediated by cytokines such as IL-6 and TGF-β, which induce oxidative stress and differentiation of HSCs into myofibroblasts. This leads to excessive extracellular matrix production, culminating in liver fibrosis. Untreated liver fibrosis can progress to cirrhosis, for which limited FDA-approved treatments are available. The close anatomical and metabolic relationship between the liver and intestine, also known as the gut-liver axis, suggests that disturbances in gut microbiota have a significant impact on the liver. Probiotics, such as \u003cem\u003eB. longum\u003c/em\u003e, exert beneficial effects on the gut-liver axis by restoring the balance of the gut microbiome through antioxidant and anti-inflammatory mechanisms. Despite their potential, probiotics often face viability challenges in the gastrointestinal tract, which can be improved by microencapsulation techniques using materials such as alginate and whey protein. This study is based on the hypothesis that microencapsulated \u003cem\u003eB. longum\u003c/em\u003e ameliorates liver fibrosis in a bile duct ligation rat model through reduction of oxidative stress and inflammation and enhancement of intestinal barrier function.\u003c/p\u003e\u003cp\u003eSEM imaging showed that capsules were formed in spherical shapes with 2000 \u0026micro;m diameter which is favorable for adding to rat's standard food. SEM imaging also showed that \u003cem\u003eB. longum\u003c/em\u003e was embedded into the surface of capsules matrix of alginate-whey protein indicating successful encapsulation of probiotics. This was further proved by FTIR analysis which demonstrated that probiotics were able to alter and form new chemical bonds with alginate and whey protein; indicating that \u003cem\u003eB. longum\u003c/em\u003e successfully altered capsule's composition. These two tests indicated that probiotic cells were successfully entrapped inside the microcapsules. The efficiency of encapsulation was further evaluated and calculated to be 99%, which is higher than the results obtained from other studies that used the same material for encapsulation (Yasmin, Saeed et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2019\u003c/span\u003e); the higher efficiency and lowered probiotic cells loss may be due to several factors such as nozzle size, alginate-whey matrix concentration, and calcium chloride solution concentration, which can affect microcapsule's parameters such as shape, hardness and matrix formation. Also, the diameter of capsules (1.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19 millimeters) is considered to be in the micro scale (Singh, Hemant et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), meaning that our capsules can be considered as microcapsules.\u003c/p\u003e\u003cp\u003eOur goal in encapsulating \u003cem\u003eB. longum\u003c/em\u003e was not only to increase the resistance of this probiotic but also to assure its survival in the gastrointestinal transit and its active release in the intestine. To understand the protective effect of encapsulation, we tested the viability of the probiotics in SGJ. According to our result, free probiotic cells were sensitive to SGJ's acidic condition and pepsin activity, and their viability losses reached 3.5 log, as also represented in literature (Faisal Shahbaz Akram, Ashraf et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). By contrast, encapsulated probiotics showed higher viability, with a reduction of only 0.53 log after 120 min in SGJ, which reflected the protection given by the microcapsules. This increase in the viability of encapsulated \u003cem\u003eB. longum\u003c/em\u003e agrees with the findings of Takahashi et al., who observed that \u003cem\u003eB. longum\u003c/em\u003e encapsulated with alginate, whey and chitosan exhibited better resistance to SGJ compared to free cells (Takahashi, Xiao et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). In SIF probiotic cells' viability also reduced sharply from 3.50 to 0 in 90 min which is due to probiotic cells' sensitivity to bile acids and pancreatic enzymes (Ji, Wu et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Ast\u0026oacute;, Huedo et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Alginate and chitosan dissolve under alkaline conditions, meaning that when microcapsules pass to the intestine from the stomach, they will be degrading, thereby facilitating the release of probiotics (Kalogeropoulou, Papailiou et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Our result showed that encapsulated \u003cem\u003eB. longum\u003c/em\u003e count also significantly reduced at intestine level due to the digestion of the microcapsule and \u003cem\u003eB. longum\u003c/em\u003e was released from their matrix.\u003c/p\u003e\u003cp\u003eThe materials used in the treatment of rats (alginate, whey protein, chitosan and lyophilized \u003cem\u003eB. longum\u003c/em\u003e) are individually recognized as safe food additives based on their application (Turck, Castenmiller et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Buyukyoruk \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Bampidis, Azimonti et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, few studies were conducted on their side effects and cytotoxicity on cell cultures when the materials are used in form of microcapsules alongside each other. Our study was limited by the lack of cytotoxicity assays on cell cultures, as we assumed, based on the available literature, that these materials do not have cytotoxic effects when used in the form of microcapsules. However, the rats were monitored for any adverse gastrointestinal effects during the treatment period on a daily basis. During this 4-week treatment no gastrointestinal side effects, such as diarrhea or vomiting, were observed; suggesting that encapsulated \u003cem\u003eB. longum\u003c/em\u003e is a safe treatment for rats during a 4-week period. Due to the lack of cytotoxicity assays in our study, we suggest that \u003cem\u003ein vitro\u003c/em\u003e studies be carried out to determine the adverse effects of our treatment on cellular level.\u003c/p\u003e\u003cp\u003eIn animal models of liver fibrosis, a change in the liver-to-body weight ratio can indicate the severity of fibrosis (Lai, Park et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Therefore, based on our findings, it can be concluded that the significant increase of liver-to-body weight ratio in BDL\u0026thinsp;+\u0026thinsp;vehicle compared to sham control indicates liver fibrosis, which is in line with other studies (Sharawy, Abdel-Rahman et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The liver-to-body weight ratio in encapsulated \u003cem\u003eB. longum\u003c/em\u003e was significantly reduced compared to the BDL\u0026thinsp;+\u0026thinsp;vehicle group, which might indicate that our treatment was able to reduce fibrosis by a significant amount. Although there are several studies on the efficiency of \u003cem\u003eB. longum\u003c/em\u003e on alleviating liver fibrosis, few evidence are available on its effect on liver-to-body weight ratio (Sharawy, Abdel-Rahman et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Hizo and Rampelotto \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2024\u003c/span\u003e, Lee, Shin et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2024\u003c/span\u003e, Li, Chi et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Our study suggests that even though free \u003cem\u003eB. longum\u003c/em\u003e has reduced the liver-to-body weight ratio, the decrease was not significant. The higher efficiency of encapsulated \u003cem\u003eB. longum\u003c/em\u003e treatment might be attributed to higher viability and delivery of probiotic cells during gastrointestinal transit. To determine and evaluate the efficiency of treatments, we further explored their effect on liver function, inflammatory and oxidative pathways.\u003c/p\u003e\u003cp\u003eIn the present study the liver function tests (LFTs) were assessed as a measure of liver damage and functionality. ALT and AST are measures of liver hepatocyte damage (Hall and Cash \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2012\u003c/span\u003e); whereas ALP is an indicator of biliary dysfunction or damage such as biliary obstruction, like direct and total bilirubin levels (Levitt, Hapak et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Our results demonstrated that all LFTs were elevated in BDL\u0026thinsp;+\u0026thinsp;vehicle group when compared to Sham control group; this indicates that bile duct ligation, initiated liver hepatocyte and biliary damage, further increasing total and direct bilirubin levels, leading to liver fibrosis as several studies show (Cho, Koo et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Kabiri-Arani, Motallebi et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Our treatment with free \u003cem\u003eB. longum\u003c/em\u003e reduced the liver enzymes activity and bilirubin levels significantly compared to BDL\u0026thinsp;+\u0026thinsp;vehicle group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) indicating that treatment with this probiotic is effective in mitigating liver damage. These changes, as many studies suggest, can be attributed to several mechanisms such as alleviating oxidative stress, reducing inflammation and improving gut barrier leading to reduced liver damage and reduced enzyme activity and bilirubin levels (Jang, Jeong et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Hizo and Rampelotto \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2024\u003c/span\u003e, Lu, Shataer et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2024\u003c/span\u003e, Zhang, Xu et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Treatment with alginate-whey with chitosan coating microcapsules' reduced ALP serum activity and total and direct bilirubin levels; however, this treatment reduced ALT, AST and LDH activity but insignificantly. These changes may be due to prebiotic effects of alginate, whey and chitosan; they can be digested and used as substrate for gut microbiome to produce several metabolites such as SCFAs and enhance gut microbiome. Therefore, affect the liver through gut-liver axis (Prokopidis, Mazidi et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Zhang, Wang et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Zhang, Xu et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In some tests such as ALT, LDH and total bilirubin the decrease in encapsulated \u003cem\u003eB. longum\u003c/em\u003e treatment was greater than in free \u003cem\u003eB. longum\u003c/em\u003e treatment; however, the difference in LDH levels were significant between free and encapsulated probiotic treatment. This suggests that treating liver fibrosis with encapsulated \u003cem\u003eB. longum\u003c/em\u003e can be beneficial in restoring liver function based on LFTs panel.\u003c/p\u003e\u003cp\u003eTo investigate the mechanisms by which free and microencapsulated \u003cem\u003eB. longum\u003c/em\u003e \u0026mdash;formulated in alginate-whey protein microcapsules with a chitosan coating\u0026mdash;exerts hepatoprotective effects, key antioxidant and oxidative parameters were evaluated.In groups treated with free \u003cem\u003eB. longum\u003c/em\u003e, only the total antioxidant capacity (TAC) showed a significant increase, alongside a significant reduction in oxidative markers compared to the BDL\u0026thinsp;+\u0026thinsp;vehicle group. In contrast, treatment with microencapsulated \u003cem\u003eB. longum\u003c/em\u003e resulted in a significant increase in all measured antioxidant indices and a marked decrease in oxidative parameters across all groups. \u003cem\u003eB. longum\u003c/em\u003e directly scavenges free radicals through the production of intrinsic enzymes such as NADH oxidase and NADH peroxidase (Averina, Poluektova et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Additionally, its secretion of exopolysaccharides (EPS) acts as free radical absorbers, preventing oxidative damage to cellular macromolecules. Furthermore, inhibition of inducible nitric oxide synthase (iNOS) activity reduces nitric oxide (NO) production, thereby suppressing the formation of destructive radicals like peroxynitrite (Sadeghi, Haghshenas et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). These findings confirm that \u003cem\u003eB. longum\u003c/em\u003e not only functions as a direct antioxidant but also exerts protective effects by modulating nitrogen radical production pathways. Activation of sirtuin-dependent pathways, particularly Sir2, upregulates the expression of antioxidant enzymes such as superoxide dismutase (SOD) and catalase (CAT). Simultaneously, \u003cem\u003eB. longum\u003c/em\u003e enhances cellular redox balance by regulating thioredoxin/glutaredoxin systems and replenishing glutathione (GSH) reserves through increased activity of key enzymes like gamma-glutamyl cysteine ligase (GCL). These coordinated mechanisms collectively elevate total antioxidant capacity (TAC) while mitigating the accumulation of oxidative byproducts such as malondialdehyde (MDA). One of the most critical hepatoprotective effects of \u003cem\u003eB. longum\u003c/em\u003e is its production of short-chain fatty acids (SCFAs), including acetate and butyrate. These metabolites activate GPR41/GPR43 receptors, upregulating anti-inflammatory gene expression while inhibiting pro-inflammatory pathways such as NF-κB. Moreover, SCFAs restore gut microbiota balance by promoting the growth of beneficial bacteria (e.g., \u003cem\u003eBifidobacterium\u003c/em\u003e) and suppressing endotoxin-producing species. Indirectly, these effects reduce intestinal permeability, limiting lipopolysaccharide (LPS) translocation into systemic circulation and thereby attenuating hepatic oxidative stress and systemic inflammation. \u003cem\u003eB. longum\u003c/em\u003e further reinforces intestinal barrier integrity by upregulating tight junction proteins (occludin and claudin), preventing endotoxin leakage into the liver (Wang, Wu et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Dong, Ping et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Yoon, Yu et al. \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Yu, Zhu et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Combined with TLR4/NF-κB pathway suppression, this leads to decreased production of pro-inflammatory cytokines such as TNF-α and IL-6. Animal studies demonstrate that these mechanisms synergistically inhibit hepatic inflammation and ameliorate oxidative stress-induced damage. Although microencapsulated \u003cem\u003eB. longum\u003c/em\u003e similarly enhances antioxidant indices and reduces oxidative markers, its effects are significantly more pronounced than those of free probiotics. This may be attributed to improved gastrointestinal survival of \u003cem\u003eB. longum\u003c/em\u003e due to microencapsulation, or a synergistic interaction between the alginate-whey protein microcapsules and \u003cem\u003eB. longum\u003c/em\u003e in modulating oxidative/antioxidant pathways. Further research is warranted to elucidate the precise mechanisms underlying this synergy.\u003c/p\u003e\u003cp\u003eSince inflammation can be a contributing factor in liver fibrosis, the expression of cytokines responsible in inflammation (IL10, IL-6 and TNF- α) and fibrosis (α-SMA) was evaluated in order to determine if their expression can be affected by our treatments and help alleviate liver fibrosis. Regarding the alterations of gene expression, our results showed increased expression of inflammatory cytokines (IL-6 and TNF- α) and α-SMA gene which is a measure of activated HSCs, and reduced expression of anti-inflammatory cytokine (IL-6) in our bile duct ligated group, indicating that fibrosis and liver damage altered the expression of the aforementioned genes in favor of inflammation and HSCs activation, which is in line with other studies (Kabiri-Arani, Motallebi et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Treatment with free and encapsulated \u003cem\u003eB. longum\u003c/em\u003e significantly reduced IL-6 and TNF- α, and α-SMA expression, indicating that our treatment was able to alleviate cytokine-induced inflammation in rat liver tissue and reduced HSCs activation into myofibroblasts. Also, the treatment with encapsulated \u003cem\u003eB. longum\u003c/em\u003e significantly increased IL-10 expression. These data are in line with In kim et al. and Dong et al. (In Kim, Kim et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Dong, Ping et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). These changes can be attributed to \u003cem\u003eB. longum'\u003c/em\u003es ability to alter immune system responses, gene expression regulation and metabolite production. \u003cem\u003eB. longum\u003c/em\u003e can ferment several carbohydrates and dietary fibers into SCFAs such as acetate and butyrate. These SCFAs can modulate histone acetylation leading to increased transcription of anti-inflammatory genes such as IL-10 and suppress pro-inflammatory cytokines such as IL-6 and TNF-alpha due to their ability to activate G-protein coupled receptors (GPCRs) on immune cells. Also, other studies demonstrated that this probiotic can enhance regulatory T cells which is crucial for maintaining immune tolerance and preventing excessive inflammatory responses in the liver (Schell, Karmirantzou et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2002\u003c/span\u003e, Gavzy, Kensiski et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Li, Yang et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). \u003cem\u003eB. longum\u003c/em\u003e, as \u0026Aacute;lvarez-Mercado suggest, can upregulate Toll-like receptors (TLRs) which are responsible in immune responses related to inflammatory cytokines expression (\u0026Aacute;lvarez-Mercado, Plaza-D\u0026iacute;az et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e); this may also be a contribute to \u003cem\u003eB. longum's\u003c/em\u003e anti-inflammatory properties. The alterations of cytokines can be attributed to these changes in inflammatory responses caused by \u003cem\u003eB. longum.\u003c/em\u003e Also, the mitigated inflammatory responses and inflammation results in reduced activation of HSCs, leading to downregulated expression of α-SMA (Jeng, Lu et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In addition, the reason that encapsulated \u003cem\u003eB. longum\u003c/em\u003e reduced expression of pro-inflammatory cytokines and α-SMA and also increased IL-10 expression more than free \u003cem\u003eB. longum\u003c/em\u003e can be related to increased viability, bioavailability and functionality of encapsulated probiotic in GIT, resulting in increased enhanced effectiveness of the treatment with encapsulated \u003cem\u003eB. longum.\u003c/em\u003e Our results demonstrated that alginate-whey with chitosan coating microcapsules reduced expression IL-6 and TNF-alpha. These alterations can be attributed to the ability of gut microbiome's ability to ferment alginate and chitosan to SCFAs and whey proteins to produce bioactive peptides that possess immunomodulatory properties; this, in addition to applying anti-inflammatory effects can enhance gut microbiome, which affects liver positively through gut-liver axis (Prokopidis, Mazidi et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Zhang, Wang et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Therefore, our microcapsule's may have been able to reduce inflammation through these mechanisms. However, the insignificant reduction of α-SMA and increase of IL-10 with microcapsule's treatment could be related to low dosage and short treatment period.\u003c/p\u003e\u003cp\u003eThe BDL\u0026thinsp;+\u0026thinsp;vehicle group exhibited significantly elevated Metavir scores across all four hepatic indices (inflammation, fibrosis, necrosis, and bile duct hyperplasia) compared to Sham controls (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), confirming biliary obstruction-induced liver injury. This pathology likely stems from bile acid accumulation-induced oxidative stress and subsequent Kupffer/hepatic stellate cell activation, consistent with Kabiri et al.'s findings (Kabiri-Arani, Motallebi et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). While free probiotic and empty microcapsule treatments showed non-significant reductions in inflammation, hyperplasia, and fibrosis, only necrosis improved significantly. In contrast, microencapsulated \u003cem\u003eB. longum\u003c/em\u003e demonstrated significant improvement in all histopathological parameters. This enhanced efficacy may reflect either superior probiotic viability due to enteric protection or synergistic effects with the alginate-whey protein matrix, though further studies are needed to elucidate this potential synergy. Comparative analysis with Zi\u0026oacute;łkowski et al.'s whey protein study reveals protocol-dependent efficacy variations, where higher doses (200mg/kg/8-weeks) in their fructose-induced model produced more pronounced effects (Yiğit Ziolkowski, Şenol et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), highlighting the influence of experimental parameters on therapeutic outcomes. The intestinal histopathology findings mirrored hepatic observations: BDL\u0026thinsp;+\u0026thinsp;vehicle rats showed marked villous atrophy, crypt loss (0.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33), and goblet cell depletion (0.58\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33) versus Sham controls, while all treatment groups maintained normal ileal architecture. This intestinal protection may derive from multiple mechanisms: (1) probiotic colonization enhancing gut-liver axis integrity, (2) alginate's mucoprotective properties, and (3) whey protein's dual antioxidant capacity - both direct free radical scavenging and Nrf2 pathway modulation. Although limited direct evidence exists for these interventions in cholestatic ileopathy, extant literature on NAFLD models and galactosamine-induced injury supports our observed protective effects, suggesting broader applicability of these therapeutic strategies across hepatointestinal pathologies. The differential efficacy between free and microencapsulated probiotics underscores the critical role of delivery systems in optimizing therapeutic outcomes, likely through enhanced gastric survival and targeted intestinal release (Wang, Lv et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Zhao, Gao et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Zhang, Xu et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) .\u003c/p\u003e\u003cp\u003eAs previously discussed, bile duct obstruction results in the entry of bile acids into the systemic circulation, thereby reaching the intestinal tissue and ileum, which subsequently induces oxidative stress and inflammation in the ileum (Angelis, Kostakis et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Oxidative stress leads to intestinal tissue damage and histological changes such as decreased crypt density, infiltration of inflammatory cells, and loss of goblet cells, which were also observed in our study. Furthermore, it was noted that the number of intestinal villi decreased while their length increased. The reduction in villus number is a consequence of oxidative stress and intestinal injury, whereas the increase in villus length represents an adaptive mechanism to compensate for intestinal damage and the loss of ileal villi, as also reported in the study by al-Aaraji and colleagues (Al-Aaraji and Addi Ali \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In our study, it was observed that the ileal tissue of treated rats appeared normal and similar to that of the Sham group. This indicates that, despite the presence of bile duct obstruction, systemic oxidative stress, and inflammation, no damage was detected in the ileal tissue of the treated groups. This observation may be attributed to the colonization of \u003cem\u003eB. longum\u003c/em\u003e in the ileum, which enhances intestinal barrier integrity and improves the gut-liver axis. Following bile duct obstruction and the accumulation of bile acids in the ileum, \u003cem\u003eB. longum\u003c/em\u003e counteracts ileal damage and prevents tissue destruction (Wang, Lv et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eTo date, no direct study has specifically evaluated the effect of \u003cem\u003eB. longum\u003c/em\u003e on ileal injury in a bile duct ligation model. However, related evidence suggests that \u003cem\u003eB. longum\u003c/em\u003e exerts protective effects on intestinal tissue under conditions of liver injury and gut inflammation, which may be relevant to the ileal injury caused by bile duct obstruction. This probiotic likely mediates its effects by reducing systemic inflammation and oxidative stress (Wang, Lv et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Regarding the efficacy of alginate and whey protein microcapsules, their prebiotic properties are noteworthy. These compounds can promote the growth and proliferation of the gut microbiome, which in turn strengthens the intestinal barrier and the gut-liver axis. As a result, the intestine may become more resilient to the harmful effects of bile acid accumulation. The normal and undamaged appearance of ileal tissue in the group treated with free microcapsules can be explained by the prebiotic properties of alginate and whey protein. As previously described, alginate and whey protein can serve as substrates for the gut microbiome, supporting its growth and proliferation. Consequently, the protective intestinal barrier and gut-liver axis are reinforced, enabling the intestine to resist damage caused by bile duct obstruction. Additionally, whey protein possesses antioxidant properties that can directly scavenge free radicals and indirectly regulate oxidative and inflammatory pathways, thereby reducing oxidative damage to intestinal tissue and mitigating the harmful effects of bile duct obstruction (Williams, Iqbal et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Gotteland, Riveros et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Rackerby, Le et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In their review, Ahmad and colleagues concluded that alginate forms a mucous layer that reduces inflammation and improves intestinal barrier function (Ahmad, Riaz et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Moreover, in models of intestinal injury induced by inflammation\u0026mdash;somewhat analogous to the damage caused by bile duct obstruction\u0026mdash;alginate has been shown to prevent intestinal tissue damage. This is also true for whey protein; in a study by Boscaini on the effect of whey protein on intestinal injury induced by a high-fat diet, this compound was shown to prevent or ameliorate intestinal damage (Boscaini, Cabrera-Rubio et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The results of these studies are consistent with our findings. Although no articles were found specifically addressing the effectiveness of alginate and whey protein in intestinal injury in the bile duct obstruction model, the available evidence supports the conclusion that free microcapsules can protect intestinal tissue and prevent intestinal damage.\u003c/p\u003e\u003cp\u003eFinally, rats that undergo BDL surgery might die during the process of surgery and due to the reduced liver function and damage caused by the bile duct ligation (Kim, Han et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). We evaluated the survival rate of rats during the 3 weeks after undergoing BDL surgery. Our data showed that the highest mortality rate was pertinent with BDL\u0026thinsp;+\u0026thinsp;vehicle group which received no treatment and suffered the most adverse liver injury. The treatment increased survival rate to 60%, 50% and 70% in free probiotic, free capsule and encapsulated probiotic treatment groups, indicating that our treatment was able to reduce mortality related to liver injury.\u003c/p\u003e\u003cp\u003eThis research faced several limitations such as inability to use western blotting to evaluate the level of inflammatory cytokines and α-SMA production which could help better understand the correlation between inflammatory cytokines and α-SMA gene expression and protein production.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary the results obtained from this study suggests that treatment with free \u003cem\u003eB. longum\u003c/em\u003e and alginate-whey protein with chitosan coating microcapsules can alleviate liver fibrosis and help towards reversing the progression of fibrosis. However, encapsulation of \u003cem\u003eB. longum\u003c/em\u003e with alginate and whey with coating of chitosan can create an efficient probiotic delivery system, increasing probiotic cells' viability during gastrointestinal transit. Encapsulated \u003cem\u003eB. longum\u003c/em\u003e can also increase treatment effectiveness, reducing oxidative injury and inflammation more effectively, leading to better alleviating of liver fibrosis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors sincerely thank Ms. Mahsa Sarlak for her valuable assistance in conducting the biochemical assays. The authors also acknowledge the use of ChatGPT artificial intelligence during manuscript preparation for paraphrasing, grammar checking, and translation support. All content was carefully reviewed and revised by the authors, who take full responsibility for the final version of the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research leading to these results received funding from Kashan University of Medical Sciences under Grant Agreement No 402099.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the data are published in this article.\u003c/p\u003e\n\u003cp\u003eEthics approval This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Kashan University of Medical Sciences, Kashan, Iran \u003cstrong\u003e(\u003c/strong\u003eEthics code: \u003cstrong\u003eIR.KAUMS.AEC.1402.013).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Competing interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAhmad A, Riaz S, Desta DT (2024) Alginate's ability to prevent metabolic illnesses, the degradation of the gut's protective layer, and alginate-based encapsulation methods. Food Sci Nutr 12(11):8692\u0026ndash;8714\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAl-Aaraji AS, Addi Ali B (2022) Effect of Pomegranate Peels Aqueous Extract on the Histological Structure of Small Intestine of Local Male Rabbits (Oryctolagus cuniculus). Arch Razi Inst 77(5):1935\u0026ndash;1943\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlbillos A, de Gottardi A, Rescigno M (2020) The gut-liver axis in liver disease: Pathophysiological basis for therapy. J Hepatol 72(3):558\u0026ndash;577\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e\u0026Aacute;lvarez-Mercado AI, Plaza-D\u0026iacute;az J, de Almagro MC, Gil \u0026Aacute;, Moreno-Mu\u0026ntilde;oz JA, Fontana L (2022) Bifidobacterium longum subsp. infantis CECT 7210 Reduces Inflammatory Cytokine Secretion in Caco-2 Cells Cultured in the Presence of Escherichia coli CECT 515. Int J Mol Sci 23(18):10813\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAmirreza K, Reza B, Shabnam K (2016) Probiotics: A Comprehensive Review of Their Classification, Mode of Action and Role in Human Nutrition. Probiotics and Prebiotics in Human Nutrition and Health. R. Venketeshwer and G. R. Leticia. Rijeka, IntechOpen: Ch. 2\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAngelis A, Kostakis ID, Lilimpakis K, Kalaitzopoulou E, Papadea P, Skipitari M, Georgiou CD, Vagianos C (2023) Time-Related Evidence of Intestinal Oxidative Stress in Obstructive Jaundice-Induced Rats. Eur Surg Res : 1\u0026ndash;11\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArranz E, Corrochano AR, Shanahan C, Villalva M, Jaime L, Santoyo S, Callanan MJ, Murphy E, Giblin L (2019) Antioxidant activity and characterization of whey protein-based beverages: Effect of shelf life and gastrointestinal transit on bioactivity. Innovative Food Sci Emerg Technol 57:102209\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAst\u0026oacute; E, Huedo P, Altadill T, Aguil\u0026oacute; Garc\u0026iacute;a M, Sticco M, Perez M, Espadaler-Mazo J (2021) Probiotic Properties of Bifidobacterium longum KABP042 and Pediococcus pentosaceus KABP041 Show Potential to Counteract Functional Gastrointestinal Disorders in an Observational Pilot Trial in Infants. Front Microbiol 12:741391\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAverina OV, Poluektova EU, Marsova MV, Danilenko VN (2021) Biomarkers and Utility of the Antioxidant Potential of Probiotic Lactobacilli and Bifidobacteria as Representatives of the Human Gut. Microbiota Biomedicines 9(10)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBampidis V, Azimonti G, Bastos M, Christensen H, Dusemund B, Durjava M, Kouba M, L\u0026oacute;pez-Alonso M, L\u0026oacute;pez S, Marcon F, Mayo B, Pechova A, Petkova M, Ramos F, Sanz Y, Villa R, Woutersen R, Brozzi R, Galobart J, Innocenti M (2022) Safety and efficacy of a feed additive consisting of sodium alginate for all animal species (ALGAIA). EFSA Journal 20\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBerumen J, Baglieri J, Kisseleva T, Mekeel K (2021) Liver fibrosis: Pathophysiology and clinical implications. WIREs Mech Dis 13(1):e1499\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBoscaini S, Cabrera-Rubio R, Golubeva A, Nychyk O, F\u0026uuml;lling C, Speakman JR, Cotter PD, Cryan JF, Nilaweera KN (2021) Depletion of the gut microbiota differentially affects the impact of whey protein on high-fat diet-induced obesity and intestinal permeability. Physiol Rep 9(11):e14867\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBuyukyoruk S (2021) Chitosan for Using Food Protection. Chitin and Chitosan - Physicochemical Properties and Industrial Applications. M. Berrada. Rijeka, IntechOpen\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCenturion F, Basit AW, Liu J, Gaisford S, Rahim MA, Kalantar-Zadeh K (2021) Nanoencapsulation Probiotic Delivery ACS Nano 15(12):18653\u0026ndash;18660\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen Y, Yang F, Lu H, Wang B, Chen Y, Lei D, Wang Y, Zhu B, Li L (2011) Characterization of fecal microbial communities in patients with liver cirrhosis. Hepatology 54(2):562\u0026ndash;572\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCho I, Koo BN, Kam EH, Lee SK, Oh H, Kim SY (2020) Bile duct ligation of C57BL/6 mice as a model of hepatic encephalopathy. Anesth Pain Med (Seoul) 15(1):19\u0026ndash;27\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCorrochano AR, Buckin V, Kelly PM, Giblin L (2018) Invited review: Whey proteins as antioxidants and promoters of cellular antioxidant pathways. J Dairy Sci 101(6):4747\u0026ndash;4761\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCristofori F, Dargenio VN, Dargenio C, Miniello VL, Barone M, Francavilla R (2021) Anti-Inflammatory and Immunomodulatory Effects of Probiotics in Gut Inflammation: A Door to the Body. Front Immunol 12:578386\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ede Ara\u0026uacute;jo Etchepare M, Nunes GL, Nicoloso BR, Barin JS, Moraes Flores EM, de Oliveira Mello R and C. Ragagnin de Menezes (2020) Improv viability encapsulated probiotics using whey proteins LWT 117: 108601\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDevarbhavi H, Asrani SK, Arab JP, Nartey YA, Pose E, Kamath PS (2023) Global burden of liver disease: 2023 update. J Hepatol 79(2):516\u0026ndash;537\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDong J, Ping L, Cao T, Sun L, Liu D, Wang S, Huo G, Li B (2022) Immunomodulatory effects of the Bifidobacterium longum BL-10 on lipopolysaccharide-induced intestinal mucosal immune injury. Front Immunol 13:947755\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDong J, Ping L, Meng Y, Zhang K, Tang H, Liu D, Li B, Huo G (2022) Bifidobacterium longum BL-10 with Antioxidant Capacity Ameliorates Lipopolysaccharide-Induced Acute Liver Injury in Mice by the Nuclear Factor-κB Pathway. J Agric Food Chem 70(28):8680\u0026ndash;8692\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFaisal Shahbaz Akram M, Ashraf M, Ali S, Kazmi SI (2017) Isolation of Gram-positive Bacteria from Different Sources and Evaluation of their Probiotic Properties. J Med Microbiol Infect Dis 5(1):12\u0026ndash;16\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGavzy SJ, Kensiski A, Lee ZL, Mongodin EF, Ma B, Bromberg JS (2023) Bifidobacterium mechanisms of immune modulation and tolerance. Gut Microbes 15(2):2291164\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGbassi GK, Vandamme T (2012) Probiotic encapsulation technology: from microencapsulation to release into the gut. Pharmaceutics 4(1):149\u0026ndash;163\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGotteland M, Riveros K, Gasaly N, Carcamo C, Magne F, Liabeuf G, Beattie A, Rosenfeld S (2020) The Pros and Cons of Using Algal Polysaccharides as Prebiotics. Front Nutr Volume 7\u0026ndash;2020\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHall P, Cash J (2012) What is the real function of the liver 'function' tests? Ulster Med J 81(1):30\u0026ndash;36\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHizo GH, Rampelotto PH (2024) The Impact of Probiotic Bifidobacterium on Liver Diseases and the Microbiota. Life 14(2):239\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHizo GH, Rampelotto PH (2024) The Impact of Probiotic Bifidobacterium on Liver Diseases and the Microbiota. Life 14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/life14020239\u003c/span\u003e\u003cspan address=\"10.3390/life14020239\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim I, Kim HJK, Kim JY, Jang SE, Han MJ, Kim DH (2019) Lactobacillus plantarum LC27 and Bifidobacterium longum LC67 simultaneously alleviate high-fat diet-induced colitis, endotoxemia, liver steatosis, and obesity in mice. Nutr Res 67:78\u0026ndash;89\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJang S-E, Jeong J-J, Kim J-K, Han MJ, Kim D-H (2018) Simultaneous Amelioratation of Colitis and Liver Injury in Mice by Bifidobacterium longum LC67 and Lactobacillus plantarum LC27. Sci Rep 8(1):7500\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJantarathin S, Borompichaichartkul C, Sanguandeekul R (2017) Microencapsulation of probiotic and prebiotic in alginate-chitosan capsules and its effect on viability under heat process in shrimp feeding. Materials Today: Proceedings 4(5, Part 2): 6166\u0026ndash;6172\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJeng K-S, Lu S-J, Wang C-H, Chang C-F (2020) Liver Fibrosis and Inflammation under the Control of ERK2. Int J Mol Sci 21(11):3796\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJi R, Wu J, Zhang J, Wang T, Zhang X, Shao L, Chen D, Wang J (2019) Extending Viability of Bifidobacterium longum in Chitosan-Coated Alginate Microcapsules Using Emulsification and Internal Gelation Encapsulation Technology. Front Microbiol 10:1389\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKabiri-Arani S, Motallebi M, Taheri MA, Kheiripour N, Ardjmand A, Aghadavod E, Shahaboddin ME (2024) The Effect of Heat-Killed Lactobacillus plantarum on Oxidative Stress and Liver Damage in Rats with Bile Duct Ligation-Induced Hepatic Fibrosis. Probiotics Antimicrob Proteins 16(1):196\u0026ndash;211\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKalogeropoulou F, Papailiou D, Protopapa C, Siamidi A, Tziveleka L-A, Pippa N, Vlachou M (2023) Design and Development of Low- and Medium-Viscosity Alginate Beads Loaded with Pluronic\u0026reg; F-127 Nanomicelles. Materials 16(13):4715\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim H-G, Han J-M, Lee J-S, Lee JS, Son C-G (2015) Ethyl acetate fraction of Amomum xanthioides improves bile duct ligation-induced liver fibrosis of rat model via modulation of pro-fibrogenic cytokines. Sci Rep 5(1):14531\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKowalska E, Ziarno M, Ekielski A, Żelaziński T (2022) Mater Used Microencapsul Probiotic Bacteria Food Ind Molecules 27(10)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKrunić T, Rakin MB (2022) Enriching alginate matrix used for probiotic encapsulation with whey protein concentrate or its trypsin-derived hydrolysate: Impact on antioxidant capacity and stability of fermented whey-based beverages. Food Chem 370:130931\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKukla M (2013) Angiogenesis: a phenomenon which aggravates chronic liver disease progression. Hepatol Int 7(1):4\u0026ndash;12\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLai TL, Park SY, Nguyen G, Pham PTM, Kang SM, Hong J, Lee JH, Im SS, Choi DH, Cho EH (2024) Irisin Attenuates Hepatic Stellate Cell Activation and Liver Fibrosis in Bile Duct Ligation Mice Model and Improves Mitochondrial Dysfunction. Endocrinol Metab (Seoul) 39(6):908\u0026ndash;920\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee DY, Shin JW, Shin YJ, Han SW, Kim DH (2024) Lactobacillus plantarum and Bifidobacterium longum Alleviate Liver Injury and Fibrosis in Mice by Regulating NF-κB and AMPK Signaling. J Microbiol Biotechnol 34(1):149\u0026ndash;156\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLevitt MD, Hapak SM, Levitt DG (2022) Alkaline Phosphatase Pathophysiology with Emphasis on the Seldom-Discussed Role of Defective Elimination in Unexplained Elevations of Serum ALP - A Case Report and Literature Review. Clin Exp Gastroenterol 15:41\u0026ndash;49\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi B, Chi X, Huang Y, Wang W, Liu Z (2024) Bifidobacterium longum-Derived Extracellular Vesicles Prevent Hepatocellular Carcinoma by Modulating the TGF-β1/Smad Signaling in Mice. FBL 29(7)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi X, Yang J, Shi S, Lan H, Zhao W, Hung W, He J, Wang R (2024) The Genome of Bifidobacterium longum subsp. infantis YLGB-1496 Provides Insights into Its Carbohydrate Utilization and Genetic Stability. Genes 15(4):466\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu J, Shataer D, Yan H, Dong X, Zhang M, Qin Y, Cui J, Wang L (2024) Probiotics and Non-Alcoholic Fatty Liver Disease: Unveiling the Mechanisms of Lactobacillus plantarum and Bifidobacterium bifidum in Modulating Lipid Metabolism, Inflammation, and Intestinal Barrier Integrity. Foods 13(18):2992\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMohammed A-Z, Mubarak M, Aljarba N, Rudayni H, Yassen K, Alkahtani S, Nasr F, Al-Doaiss A, Al-eissa M (2024) Antioxidant Effects of Whey Protein as a Dietary Supplement to Alleviate Cadmium-Induced Oxidative Stress in Male Wistar Rats. Current Research in Nutrition and. Food Sci J 12:147\u0026ndash;156\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eProkopidis K, Mazidi M, Sankaranarayanan R, Tajik B, McArdle A, Isanejad M (2023) Effects of whey and soy protein supplementation on inflammatory cytokines in older adults: a systematic review and meta-analysis. Br J Nutr 129(5):759\u0026ndash;770\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQuigley EMM (2017) Chapter 16 - Bifidobacterium longum. The Microbiota in Gastrointestinal Pathophysiology. M. H. Floch, Y. Ringel and W. Allan Walker. Boston, Academic Press: 139\u0026ndash;141\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRackerby B, Le HNM, Haymowicz A, Dallas DC, Park SH (2024) Potential Prebiotic Properties of Whey Protein and Glycomacropeptide in Gut Microbiome. Food Sci Anim Resour 44(2):299\u0026ndash;308\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSadeghi M, Haghshenas B, Nami Y (2024) Bifidobacterium exopolysaccharides: new insights into engineering strategies, physicochemical functions, and immunomodulatory effects on host health. Front Microbiol 15:1396308\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchell MA, Karmirantzou M, Snel B, Vilanova D, Berger B, Pessi G, Zwahlen M-C, Desiere F, Bork P, Delley M, Pridmore RD, Arigoni F (2002) The genome sequence of \u0026lt;\u0026thinsp;i\u0026thinsp;\u0026gt;\u0026thinsp;Bifidobacterium longum\u0026thinsp;reflects its adaptation to the human gastrointestinal tract. Proceedings of the National Academy of Sciences 99(22): 14422\u0026ndash;14427\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSharawy MH, Abdel-Rahman N, Megahed N, El-Awady MS (2018) Paclitaxel alleviates liver fibrosis induced by bile duct ligation in rats: Role of TGF-β1, IL-10 and c-Myc. Life Sci 211:245\u0026ndash;251\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSingh MN, Hemant KS, Ram M, Shivakumar HG (2010) Microencapsulation: A promising technique for controlled drug delivery. Res Pharm Sci 5(2):65\u0026ndash;77\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTakahashi N, Xiao J-Z, Miyaji K, Yaeshiima T, Hiramatsu A, Iwatsuki K, Kokubo S, Hosono A (2004) Selection of acid tolerant Bifidobacteria and evidence for a low-pH-inducible acid tolerance response in Bifidobacterium longum. J Dairy Res 71:340\u0026ndash;345\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTakahashi Y, Fukusato T (2017) Chapter 13 - Animal Models of Liver Diseases. Animal Models for the Study of Human Disease (Second Edition). P. M. Conn, Academic Press: 313\u0026ndash;339\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTan Z, Sun H, Xue T, Gan C, Liu H, Xie Y, Yao Y, Ye T (2021) Liver Fibrosis: Therapeutic Targets and Advances in Drug Therapy. Front Cell Dev Biol 9:730176\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTurck D, Castenmiller J, de Henauw S, Hirsch-Ernst KI, Kearney J, Maciuk A, Mangelsdorf I, McArdle HJ, Naska A, Pelaez C, Pentieva K, Siani A, Thies F, Tsabouri S, Vinceti M, Cubadda F, Engel KH, Frenzel T, Heinonen M, Marchelli R, Neuh\u0026auml;user-Berthold M, P\u0026ouml;ting A, Poulsen M, Sanz Y, Schlatter JR, van Loveren H, Amundsen M, Knutsen HK (2019) Safety of whey basic protein isolate for extended uses in foods for special medical purposes and food supplements for infants pursuant to Regulation (EU) 2015/2283. Efsa j 17(4): e05659\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang K, Lv L, Yan R, Wang Q, Jiang H, Wu W, Li Y, Ye J, Wu J, Yang L, Bian X, Jiang X, Lu Y, Xie J, Wang Q, Shen J, Li L (2020) Bifidobacterium longum R0175 Protects Rats against d-Galactosamine-Induced Acute Liver Failure. mSphere 5(1)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang X, Gao S, Yun S, Zhang M, Peng L, Li Y, Zhou Y (2022) Microencapsulating Alginate-Based Polymers for Probiotics Delivery Systems and Their Application. Pharmaceuticals (Basel) 15(5)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Y, Wang J, Li H, Lao J, Jia D, Liu J, Wang J, Luo J, Guan G, Yin H, Li Y (2023) Antioxidant effects of Bifidobacterium longum T37a in mice weight loss and aging model induced by D-galactose. BMC Microbiol 23(1):103\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Y, Wu Y, Wang Y, Xu H, Mei X, Yu D, Wang Y, Li W (2017) Antioxid Prop Probiotic Bacteria Nutrients 9(5)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWilliams I, Iqbal T, Webber M, Tselepis C (2011) A mechanism for the effect of alginate on the gut microflora. Gut 60(Suppl 1):A76\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYasmin I, Saeed M, Pasha I, Zia MA (2019) Development of Whey Protein Concentrate-Pectin-Alginate Based Delivery System to Improve Survival of B. longum BL-05 in Simulated Gastrointestinal Conditions. Probiotics Antimicrob Proteins 11(2):413\u0026ndash;426\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYiğit Ziolkowski A, Şenol N, Aslanko\u0026ccedil; R, Samur G (2024) Whey protein supplementation reduced the liver damage scores of rats fed with a high fat-high fructose diet. PLoS ONE 19(4):e0301012\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYoon SJ, Yu JS, Min BH, Gupta H, Won S-M, Park HJ, Han SH, Kim B-Y, Kim KH, Kim BK, Joung HC, Park T-S, Ham YL, Lee DY, Suk KT (2023) Bifidobacterium-derived short-chain fatty acids and indole compounds attenuate nonalcoholic fatty liver disease by modulating gut-liver axis. Front Microbiol Volume 14\u0026ndash;2023\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYu J, Zhu P, Shi L, Gao N, Li Y, Shu C, Xu Y, Yu Y, He J, Guo D, Zhang X, Wang X, Shao S, Dong W, Wang Y, Zhang W, Zhang W, Chen WH, Chen X, Liu Z, Yang X, Zhang B (2024) Bifidobacterium longum promotes postoperative liver function recovery in patients with hepatocellular carcinoma. Cell Host Microbe 32(1):131\u0026ndash;144e136\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang X, Xu J, Dong X, Tang J, Xie Y, Yang J, Zou L, Wu L, Fan J (2024) Bifidobacterium longum BL-19 inhibits oxidative stress and inflammatory damage in the liver of mice with NAFLD by regulating the production of butyrate in the intestine. Food Sci Nutr 12(9):6442\u0026ndash;6460\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang X, Xu J, Dong X, Tang J, Xie Y, Yang J, Zou L, Wu L, Fan J (2024) Bifidobacterium longumBL-19 inhibits oxidative stress and inflammatory damage in the liver of mice with NAFLD by regulating the production of butyrate in the intestine. Food Sci Nutr 12(9):6442\u0026ndash;6460\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Z, Wang X, Li F (2023) An exploration of alginate oligosaccharides modulating intestinal inflammatory networks via gut microbiota. Front Microbiol 14\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao H, Gao X, Liu Z, Zhang L, Fang X, Sun J, Zhang Z, Sun Y (2022) Sodium Alginate Prevents Non-Alcoholic Fatty Liver Disease by Modulating the Gut-Liver Axis in High-Fat Diet-Fed Rats. Nutrients 14(22)\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZheng Y, Zhang L, Bonfili L, de Vivo L, Eleuteri AM, Bellesi M (2023) Probiotics Supplementation Attenuates Inflammation and Oxidative Stress Induced by Chronic Sleep Restriction. Nutrients 15(6)\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"world-journal-of-microbiology-and-biotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"wibi","sideBox":"Learn more about [World Journal of Microbiology and Biotechnology](https://www.springer.com/journal/11274)","snPcode":"11274","submissionUrl":"https://submission.nature.com/new-submission/11274/3","title":"World Journal of Microbiology and Biotechnology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Probiotic, Bifidobacterium Longum, Mircocapsule, Liver Fibrosis, Inflammation, Oxidative Stress","lastPublishedDoi":"10.21203/rs.3.rs-7773331/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7773331/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLiver fibrosis is a progressive disorder with limited therapeutic options. Probiotics, particularly \u003cem\u003eBifidobacterium longum\u003c/em\u003e (\u003cem\u003eB. longum\u003c/em\u003e), represent a promising microbial biotechnology approach for hepatoprotection; however, their clinical efficacy is often compromised by low gastrointestinal survival. In this study, we evaluated the effects of \u003cem\u003eB. longum\u003c/em\u003e encapsulated in a food-grade alginate\u0026ndash;whey protein matrix with a chitosan coating to enhance microbial stability and delivery, and its impact on liver fibrosis in a bile duct ligation (BDL) rat model. Forty-eight male Wistar rats were assigned to six groups, including controls, BDL, and BDL treated with free or encapsulated probiotics. Encapsulation substantially improved probiotic viability under simulated gastric conditions (log 9.6 vs. 3.5) and effectively reduced serum markers of liver injury (ALT, AST, LDH). Encapsulated B. longum also modulated inflammatory mediators (downregulating IL-6, TNF-α, α-SMA; upregulating IL-10), enhanced antioxidant defenses, decreased oxidative stress markers, and attenuated histological liver damage. These findings highlight encapsulation as a microbial biotechnology strategy to optimize probiotic delivery and efficacy, supporting their therapeutic potential in liver fibrosis.\u003c/p\u003e","manuscriptTitle":"Synthesis and Application of Encapsulated Bifidobacterium longum for Mitigation of Liver Fibrosis via Modulation of Oxidative Stress and Inflammation in a BDL Rat Model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-20 13:32:44","doi":"10.21203/rs.3.rs-7773331/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-22T11:00:08+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-22T10:33:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"338601665819037151279122236628301659845","date":"2025-12-23T09:46:58+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"50300277839884958716548702220396102653","date":"2025-11-03T04:46:42+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-06T09:16:36+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-04T20:48:14+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-04T06:04:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"World Journal of Microbiology and Biotechnology","date":"2025-10-03T11:54:28+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"world-journal-of-microbiology-and-biotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"wibi","sideBox":"Learn more about [World Journal of Microbiology and Biotechnology](https://www.springer.com/journal/11274)","snPcode":"11274","submissionUrl":"https://submission.nature.com/new-submission/11274/3","title":"World Journal of Microbiology and Biotechnology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6549e564-e5f8-4f0c-8309-862c36a0e875","owner":[],"postedDate":"October 20th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-05-04T16:12:10+00:00","versionOfRecord":{"articleIdentity":"rs-7773331","link":"https://doi.org/10.1007/s11274-026-04838-9","journal":{"identity":"world-journal-of-microbiology-and-biotechnology","isVorOnly":false,"title":"World Journal of Microbiology and Biotechnology"},"publishedOn":"2026-04-28 15:58:35","publishedOnDateReadable":"April 28th, 2026"},"versionCreatedAt":"2025-10-20 13:32:44","video":"","vorDoi":"10.1007/s11274-026-04838-9","vorDoiUrl":"https://doi.org/10.1007/s11274-026-04838-9","workflowStages":[]},"version":"v1","identity":"rs-7773331","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7773331","identity":"rs-7773331","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}