Concurrent contamination of Free-Living Amoebae and Legionella pneumophila in water resources of hospitals, A microscopic and molecular analysis

Concurrent contamination of Free-Living Amoebae and Legionella pneumophila in water resources of hospitals, A microscopic and molecular analysis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Concurrent contamination of Free-Living Amoebae and Legionella pneumophila in water resources of hospitals, A microscopic and molecular analysis Mohammad Naseri, Majid Zare-Bidaki, Sara Nemati, Rahmat Solgi, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6205801/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Free-living amoebae (FLAs) are widely prevalent protozoa found in various natural and man-made environments. In Iran, there have been few studies examining the contamination of hospital environments with FLAs and Legionella spp., and none have explored the coexistence of these two organisms. Thus, this study aims to investigate the contamination of FLAs and Legionella spp. in the water resources of hospitals in Birjand city. Water samples were collected from water sources in different hospital departments of Birjand city, were transferred to the laboratory. One litre of each sample passed through the nitrocellulose membrane filter. Samples were taken from the water taps of different departments and storage tanks positive samples were analyzed by morphological keys and Polymerase chain reaction (PCR) using 18S rDNA gene and ITS region to identify amoeba isolates. The possible contamination of the samples with Legionella spp. was examined through cultures and molecular tests. Overall, 80 out of 270 samples from hospital water sources were positive for contamination with FLAs by the culture method. Acanthamoeba was isolated in all 80 samples that were positive for Acanthamoeba . Among the 80 samples in which the Acanthamoeba parasite grown in the culture, 64 Acanthamoeba isolates were also positive with molecular tests. All sequenced samples of Acanthamoeba were reported as T4 genotype. Furthermore, 5/270 examined samples were positive for L. pneumophila contamination. All cases of L. pneumophila infection were reported in samples infected with Acantamoeba . A significant difference was observed between the concurrent contamination of Acantamoeba and L. pneumophila in Razi (P value =001) and Imam Reza hospitals (P value = 004) as well as surgical wards (P value = 0002) and water tanks (P value = 0.01) at Birjand hospitals. This study aimed to examine the co-occurrence of Legionella spp. and free-living amoebae (FLAs) as the most important water-related pathogens, in hospital water systems to better understand their interactions and the potential consequents for public health, which can lead to both outbreaks and sporadic cases. Acanthamoeba Legionella pneumophila Iran Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Contamination of water systems has emerged as a critical public health concern, particularly in healthcare settings (Guillot and Loret, 2009 ). Waterborne pathogens, including bacteria, viruses, and protozoa, can thrive in aquatic environments and pose serious risks to public health. Hospitals, with their numerous specialized water systems, are particularly vulnerable to contamination, which can lead to outbreaks of various infections and significantly impact patient safety (Ramírez-Castillo et al., 2015 ). Free-living amoebae (FLA) are highly abundant protozoa found in nature in a variety of environmental and man-made habitats, including freshwater, saltwater, seawater, soil, air-conditioning units, drinking water treatment plants, and even dental units (Balczun and Scheid, 2017 , Fan et al., 2024 , Mahmoudi et al., 2015 ). Free-living amoebae such as Hartmanella , Naegleria , and Acanthamoeba have also been reported from drinking water (Nacapunchai et al., 2001 , Hoffmann and Michel, 2001 ), swimming pools (De Jonckheere, 1979 ), and hospital water networks(Rohr et al., 1998 ). FLA accounts for an essential part of microbial communities. Acanthamoeba spp. are the causative agents of a sight-threatening corneal infection, called Acanthamoeba keratitis (AK), the incidence of which is on the rise worldwide as a severe sight-threatening disease (Lorenzo-Morales et al., 2015). FLA serve as significant environmental predators, feeding on various micro-organism populations, including bacteria, fungi, and algae (Shi et al., 2021 ) Shi et al indicated that, FLAs are ecologically significant for regulating bacterial population levels; however, the interactions between amoebae and their associated bacteria are unknown (Rodríguez-Zaragoza, 1994 ). The implications of these symbiotic amoeba-bacteria interactions for human health have garnered heightened attention, as certain pathogenic bacteria have developed survival mechanisms to evade amoebal digestion, thereby remaining shielded from adverse environmental conditions, particularly when they inhabit cysts that offer a protective barrier against disinfection techniques (Steinert et al., 1998 ). In particular, amoebae of the genus Acanthamoeba are suitable hosts due to their highly resistant cysts to environmental stresses, such as dryness and changes in pH, osmolarity, or temperature. They even survive chlorination and other disinfection methods (Wang et al., 2023 ). As a result, bacteria can not only be resistant to amoebae but can also proliferate in them and benefit from the advantages of coexistence with them, such as nutrient sources, greater protection from temperature, disinfectants, and UV radiation (Scheikl et al., 2014b ). The findings revealed that, FLAs are among the organisms that have been isolated from household water systems and hospital water mains (Lasjerdi et al., 2011 ). These amoebae commonly serve as hosts for Legionella spp., promoting their survival and proliferation in both natural habitats and man-made water systems. Studies indicate that Legionella spp. can evade environmental stressors by residing within amoebae (Valciņa et al., 2019 ). Legionella spp., is known to proliferate in warm water and biofilms, making hospital water systems ideal environments for its growth. As one of the leading causes of hospital-associated pneumonia, understanding the dynamics of waterborne pathogens is essential for effective infection control strategies. Legionella is a Gram-negative microorganism that can grow at temperatures between 25 and 42°C, particularly in collection systems. Legionella spp. can be found in natural and artificial aquatic environments such as spring waters, thermal waters, rivers, lakes, mud, pipes, fountains, and swimming pools. This organism can cause Legionnaires' disease (LD) and Pontiac fever (Bertolino et al., 2020b , Kanarek et al., 2022 ). Legionella pneumophila is the primary causative agent of legionellosis and is recognized as one of the 30 emerging infectious diseases (Van Kenhove et al., 2019 , Brunkard et al., 2011 ). Previous research has established that, aquatic biofilms facilitate the survival and multiplication of Legionella spp. (Abdel-Nour et al., 2013, Margot et al., 2024 ). Furthermore, protozoa can act as significant hosts for Legionella spp. in natural, hospital, and domestic environments; viable but non-culturable Legionella contained within amoebic cysts may contribute to water contamination in hospitals (Nisar et al., 2023 , Steinert et al., 1998 ). Earlier findings have revealed that, Legionella has also evolved mechanisms to avoid phagocytosis by FLAs. When residing within amoebae, Legionella spp. can acquire traits that enhance its pathogenicity, enabling the development of virulence factors essential for causing infections in humans (Chauhan and Shames, 2021 ). Moreover, both Legionella spp. and FLAs contribute to biofilm development in water distribution systems, which provides a protective habitat for Legionella , complicating disinfection efforts (Barbosa et al., 2024 ). This interaction is particularly concerning in healthcare settings, where immunocompromised patients are at a heightened risk for Legionella spp. infections, especially pneumonia. Accordingly, understanding the dynamics between Legionella spp. and free-living amoebae is crucial for formulating effective control measures to safeguard public health. The studies demonstrated that the factors contributing to the presence of Legionellaceae in a hospital water system were examined, along with the recontamination of Legionella pneumophila following a thermal disinfection procedure. Three months after the heat treatment at 70° C , Legionella strains regrew to their original cell numbers. The Potential host amoebae are reported to play a critical role in the amplification process of Legionella (Steinert et al., 1998 ). Targeted research in this area can lead to enhanced strategies for monitoring and managing water safety and quality. Furthermore, the considerable morbidity and mortality of diseases caused by these microorganisms indicate the need for further studies, particularly in hospital water resources as an important source of contamination.(6). There is a limited number of reports describing the endosymbiont bacteria of FLAs in water. Several reports have been published regarding the epidemiological surveillance of pathogenic bacteria in hospitals (Nisar et al., 2020 , Casini et al., 2018 ). In Iran, limited studies have been separately conducted on the contamination of hospital settings with FLAS and Legionella spp. , none of which have investigated the coexistence of FLAs and Legionella spp. (2). Only one study on Acanthamoeba has so far been conducted in Birjand City, indicating the contamination of a significant percentage of the city's surface water with this amoebae (Booton et al., 2002 ). Investigations conducted previously have illustrated that, Legionella species inhabit biofilms and interact with various microorganisms, including free-living amoebae (FLAs) (Barbosa et al., 2024 , Lau and Ashbolt, 2009a ). Therefore, investigating these microorganisms within hospital water systems is critically important for health risk prevention (Behravan et al., 2016 , Decker and Palmore, 2014 , Perkins et al., 2019 , Bertolino et al., 2020a ). Considering the transmission of infectious diseases through contaminated water, examining water systems is essential. The aims of the current study to explore the prevalence of water system contamination by potentially infectious microorganisms, the conditions that facilitate their growth, and the implications for infection prevention and control in hospital environments. Materials and Methods Sampling In the present cross-sectional (descriptive-analytical) study, the statistical population was the water resources of teaching hospitals (Emam Reza (AS) Hospital, Vali Asr (AS) Hospital, and Razi Hospital) in Birjand City. Water was sampled through direct collection in sterile containers. In total, 270 water samples were collected from different wards (ICU, operating room, surgical ward, and water storage tanks) of three teaching hospitals in Birjand City (South Khorasan province). In other words, the sample size from each hospital was 90 samples, which were divided equally between different wards. Samples were collected from water taps in different places, such as washbasin, toilet, bathroom, and from the tank in the case of storage tanks. Water was collected using 50 ml sterile falcons. The samples were then transferred to the Parasitology and Mycology Laboratory, Faculty of Medicine, Birjand University of Medical Sciences, for the tests detailed in the following steps. Filtration of samples The water samples collected, were shaken vigorously to mix the contents, then filtered through a cellulose nitrate membrane (Millipore). The samples were filtered using a vacuum pump and nitrocellulose paper filters with 0.45 micron pores and then passed through a nitrocellulose filter. Some of the samples were manually passed through a paper filter. Finally, the paper filters were placed on the culture medium, consisting of Non Nutrient Agar (NNA) with a layer of Escherichia coli to grow Acanthamoeba in this study (Karimi et al., 2023). A. Sub-cultivation and isolation of Acantamoeba Since fungi and bacteria can be present on the surface of the cultured plates, in addition to FLA, FLA must be cloned for a pure culture of a specific of. Fungi and bacteria must be eliminated as they are limiting in the PCR process. For this purpose, the FLA-containing plate was transferred under an inverted microscope, and a few cysts of the amoeba with fewer bacteria and fungi around it were taken using a sterile needle next to the flame and transferred to another culture medium. The plates were examined daily for amoeba growth. This was continued until a plate was obtained that was purer in terms of the amoeba of interest. Subculture was performed for all positive plates that exhibited growth of Acanthamoeba (Behniafar, 2016). Identification of FLAs using the monoxenic culture method For the morphological identification of FLAs, the filter was placed upside down on the NNA culture medium covered with E. coli . The media were incubated at 25-30 ° C . Due to the slow-growing nature of some Acanthamoeba strains, the plates were followed for 1 month. After a month, they were reported negative in the absence of FLAs (Booton et al., 2002). To purification of the cultured plates, FLAs must be cloned for a pure culture of a specific of Fungi and bacteria must be eliminated as they are limiting in the PCR process. For this purpose, the FLA-containing plate was transferred under an inverted microscope, and a few cysts of the amoeba with fewer bacteria and fungi around it were taken using a sterile needle next to the flame and transferred to another culture medium. The Acanthamoeba isolates were identified morphologically by their flattened trophozoites featuring slender acanthopodia and double-walled cysts with perforated star-shaped. Microscopic examination confirmed the diagnosis of Acanthamoeba spp (Fig) (Behniafar, 2016). DNA extraction and PCR To DNA from the trophozoite form was extracted using a kit (Chelex, Bio-Rad Co.). Acanthamoeba was cloned on a new culture medium, the plates were incubated at the appropriate temperature (28° C ), and monitored every day for 1-2 weeks. When the highest number of amoebae in the culture medium belonged to trophozoites and not cysts, the amoebae were collected from the surface of the culture medium, and their DNA was extracted using the mentioned kit. To extract DNA using the Chelex kit, 500 µl of trophozoites washed with distilled water were poured into a 1.5 ml microtube. Next, 200 µl of the kit reagent was added to a measured volume of the tested sample suspension, and the sample was heated in a water bath at 55° C for 15-30 min. After the required time, the sample was vortexed for 10 seconds and heated in a boiling water bath for 8 min. Then, the sample was vortexed vigorously for 10 seconds and then centrifuged at 3000 rpm for 3 min. At this stage, the supernatant of the sample was poured into a 0.5 ml microtube and stored together with the container containing the precipitate at -20 ° C for the PCR test. PCR reactions were completed in 25-μl volumes, containing 12.5 μl Ampliqon (Taq DNA Polymerase Master Mix RED, Denmark). A 500 bp region of the 18S rRNA gene was amplified using genus-specific primers JDP1 (5'-GGCCCAGATCGTTTACCGTGAA-3') and JDP2 (5'-TCTCACAAGCTGCTAGGGGAGTCA-3') from Takapozist, Iran (Behniafar, 2016, Booton et al., 2002). The PCR cycle profile was as follows: initial denaturation at 94° C for 1 minutes, followed by 35 cycles of denaturation at 94° C for 35 seconds, annealing at 56° C for 45 seconds, and extension at 72° C for 1 minute, concluding with a final extension at 72° C for 1 minutes. Distilled water was utilized as a negative control instead of DNA. Sequencing and phylogeny analysis The nucleotide of the samples was sequenced using the Genetic Analyzer 3130xl (Applied Biosystems, ABI, USA) available at the Gastroenterology and Liver Diseases Research Center, Shahid Beheshti University of Medical Sciences. Thereafter, the nucleotide sequences of all positive samples were edited using the Chromas program and analyzed in the BLAST1 program of the PubMed site. A phylogenetic analysis was conducted to determine the evolutionary relationships among the isolated strains of FLAs obtained from hospital water systems. Phylogenetic trees were constructed based on 16S rRNA gene sequences using the Maximum Likelihood method implemented in MEGA version 6.0 software (http://www.megasoftware.net). Sequences were aligned using MUSCLE, and the best-fit model of evolution was selected using the Akaike Information Criterion (AIC). Bootstrap support was evaluated based on 1,000 replicates. B. Isolation and identification of Legionella spp . After sampling and passing the samples through nitrocellulose filters, the filters were cut into small pieces and placed in test tubes with 100 ml of the original water sample. The samples were placed at a temperature of 37 ° C for 24 h to separate the bacteria from the filter. Then, the samples were incubated in 50 ° C for 30 min to remove microbial agents other than Legionella bacteria. Finally, the samples were transferred to two 50 ml tubes and centrifuged at 2600 g for 30 min. The supernatant was discarded and 2-3 ml of the resulting precipitate from one tube was transferred to the culture medium for culture (Huang et al., 2011). DNA extraction , PCR and phylogeny analysis L. pneumophila was detected using a newly developed real-time TaqMan PCR assay with primers F (5′- GGCATAGATGTTTATCCGG -3′) and R (5′- GTGAAACCTGAAAACTTGCT -3′), which target the mip gene (Wilson et al., 2003). The amplification mixture for the detection of Legionella spp. consisted of 25 μl of iQ SYBR green supermix (Bio-Rad Laboratories B.V., Veenendaal, Netherlands), 0.4 mg ml −1 of bovine serum albumin (BSA; PCR grade; Roche Diagnostics, Almere, Netherlands), 0.2 μM each primer, and 10 μl of DNA template in a total reaction volume of 50 μl. Legionella -positive samples were proliferated using a specific primer pair that amplifies part of the MIP gene fragment of L. pneumophila . The negative control contained all the values required for the molecular reaction, except for the extracted genomic material. A phylogenetic tree was drawn using the genes obtained from the present study and the regions related to 12 reference sequences from serogroups 1-6 of L. pneumophila bacteria available in the GenBank database. Phylogenetic trees were constructed based on MIP gene sequences using the Maximum Likelihood method implemented in MEGA version 6.0 software (http://www.megasoftware.net) with 1000 bootstrap replicates. Statistical analysis Data were analyzed using SPSS version 21 software. Contamination rates based on wards and hospitals were compared using the Chi-square test at a statistical significance level of < 0.05. Results Isolation and identification of Acanthamoeba in water samples Detection of Acanthamoeba In this study, the Acanthamoeba were evaluated both morphologically and molecularly. After a few days of initial culture, FLA was identified in 80 (29.6%) plates according to the shape of trophozoites and cysts with two clearly defined walls. Acanthamoeba amoebae were identified in all 80 positive samples. Acanthamoeba cysts with various shapes were observed on the inner wall, such as spherical, star-shaped, and polyhedral (Fig 1). In this study, 80 water samples from diferent water resources were collected in Birjand city. Totally 270 samples of hospital water (Razi, Vali Asr, Emam Reza Hospital) were analysis. From 80 positive samples collected from different hospitals, 18 samples of ICU part, 15 samples of Surgery room, 27 samples of Surgical ward and 20 samples of Water storage tanks were analysis and represented as positive for Acantamoeba . The results of the number of positive samples by PCR summarized in Table 1 No significant difference was observed between the FLA contamination of water resources at hospitals and different wards of hospitals in Birjand city (P value = 0.1) (Table 1). All culture plates were examined daily for 30 days using a light microscope before disposal. Detection was based on the distinct morphological characteristics of Acanthamoeba trophozoites, as well as the trophozoites, flagellates, identified according to several documented reports (Figure 1). Table 1shown that, 80 plates of 270 samples were positive morphologically and moleculary in water samples from different districts of hospitals in Birjand City. Molecular analysis and Genotyping and sequencing of Acanthamoeba spp. In hospital water sources, 80 out of 270 samples were positive by the culture method, 64 isolates were ampilified positively with specific primers (JDP1,2). As shown in Fig 2, these primers could amplify a fragment of about 500 bp. Fifteen isolates were selected randomly and sent for sequencing analysis. The genus Acanthamoeba was genotyped based on the homology of the replicating fragment with the genes available in the GenBank. Homology analyses of the PCR products were conducted using BLAST (Basic Local Alignment Search Tool) software from the NCBI. In this study, after determining the sequencing, T4 genotype was presented as Acanthamoeba in all of the sequences. Phylogeny analysis of Acantamoeba spp. The phylogenetic analysis revealed three distinct clusters of FLA isolates, with Acanthamoeba species grouping closely together, Out of 15 randomly sequenced sequences, ten nucleotide sequences from FLAs were included in phylogeny analysis. The phylogenetic tree (Fig 3) illustrates the clustering patterns, with bootstrap values indicating robust support for the observed relationships. In this study, a phylogenetic tree was constructed to investigate the relationships of genotype T4. The results indicated that the T4 genotypes in this study were grouped separately in distinct branches compared to genotypes T2 and T3 from previous studies of hospital wastewater samples. Isolation and identification of Legionella spp. In this study, totally 270 samples of hospital water (Razi, Vali Asr, Emam Reza Hospital) were analysis. Out of 80 samples positive for Acanthamoeba collected from various hospitals, five samples were found positive for Legionella spp (6.25%). Specifically, there were two positive samples from Razi Hospital, two from Vali Asr Hospital, and one from Emam Reza Hospital. Additionally, five psitive samples were devided among different parts of the hospitals; two samples of Surgical ward and one sample of ICU, Surgery room and Water storage tanks respectively, were analysis and represented as positive for Legionella spp. After examining the plates of cultured hospital samples on the BCYE medium, initial identification was based on the specific shape of Legionella spp . colonies on the culture medium (Fig 4). Legionella spp. bacteria did not grow in the remaining plates that were negative for FLA. . The results of the number of positive samples by PCR summarized in Table 2. The results showed that, no significant difference was observed between the Legionella spp. contamination of water sources at the hospitals and different wards of hospitals in Birjand City (P value = 0.8). (Table 2). Molecular and phylogeny analysis of L. pneumophila Nucleotide sequence analysis of 5 genotyped samples confirmed the circulation of subtype 1 of L. pneumophila bacteria in South Khorasan Province (Fig 5). L. pneumophila sequences showed 99% identity with serogroup 1 sequences available in the GenBank database. The mentioned sequence was registered with the number PQ187603 in the GenBank. The phylogenetic tree (Fig 5) illustrated that, the isolated samples were all 100% similar to each other and were assigned to the same branch as serogroup 1. Concurrent contamination of FLA and L. pneumophila in hospitals The Concurrent contamination of FLAs and L. pneumophila . was evaluated in different water sources in Birjand hospitals. A significant difference was observed between the concurrent contamination of FLA and Legionella in Razi (P value =001) and Imam Reza hospitals (P value = 004) as well as surgical wards (P value = 0002) and water tanks (P value = 0.01) at Birjand hospitals (Table 3). As a result, all cases of L. pneumophila positivity were found in samples that tested positive for Acanthamoeba. Discussion Acanthamoeba has been isolated from a variety of habitats, including freshwater, saltwater, beach sand, sewage, and soil (Karimi et al., 2023 , Reyes-Batlle et al., 2021 , Latifi et al., 2020 ). Under unfavorable conditions, amoebae can form cysts to protect bacteria. Free-living amoebae can host pathogens, aiding their survival and complicating disinfection. They primarily consume bacteria, fungi, and algae through phagocytosis, digesting them in phagolysosomes (Malinowski et al., 2022 , Scheid, 2018 ). Some microorganisms resist amoebae by avoiding internalization or by surviving, proliferating, and exiting after being internalized (Scheid, 2018 ). Prior studies showed that, The concentration of FLAs inside biofilms formed is clinically important, particularly if they are present on equipment and devices in healthcare facilities. Barbeau et al. presented evidence that all water samples from dental units contained FLA, the concentrations of which in these samples were 300 times higher than in tap water. Hartmannella , Vanella , and Valcamphia amoebae were abundant in these samples, and Acanthamoeba and Naegleria amoebae were identified in 40% of the isolates. Therefore, biofilms formed inside some dental equipment can significantly increase the concentration of FLA. These results highlight the important role of biofilms in the maintenance and proliferation of pathogenic amoebae and bacteria (44). The microorganisms present in biofilms are an important food source for FLAs and contribute to their resistance to amoebicides (Norouzi et al., 2022 ). Therefore, biofilm sources in the hospital environment can be regarded as a serious health risk for patients (Norouzi et al., 2022 ). Recently, in vitro studies have proven that Pseudomonas can play a role in the pathogenesis of contact lens-associated amebic keratitis. In fact, Pseudomonas increases the resistance of Acanthamoeba to contact lens disinfectant solutions and increases the survival of Acanthamoeba by forming biofilms on the surface of contact lenses. Coinfection of Pseudomonas and Acanthamoeba has also been reported in patients with keratitis (Sharma et al., 2013 ). Previous research demonstrated that Acanthamoeba and Legionella spp. are common in drinking water in Birjand City, and water supply systems in the water system can be a potential source of Legionella infection. Multiple studies have documented the presence of Legionella spp. in water that is not linked to a specific outbreak, including research from Italy, Germany, Turkey [14], Georgia, Denmark, and Poland, among others (Baggiani et al., 2015 , Uzel et al., 2005 , Moore et al., 2006 , Stojek and Dutkiewicz, 2011 ). The prevalence of Legionella in drinking water ranged from 20.7% (49) to 32.7% (50) in Germany (Kruse et al., 2016 ), and different Legionella species were detected in 26% of hot water mains in residential buildings in Italy (Totaro et al., 2017 ). The co-occurrence of Legionella and FLA in water systems may suggest an increased health risk to individuals (Cervero-Aragó et al., 2015 ). In addition to protecting against Legionella , FLAS can also preserve viable but non-culturable (VBNC) strains and allow for long-term persistence and transmission of Legionella spp. (Denoncourt et al., 2014). There are limited reports on Acanthamoeba isolation from hospital water systems, suggesting that this amoebae is a host for the pathogenic Legionella spp. Our findings indicated that, all cases that tested positive for L. pneumophila were reported in samples that also tested positive for The presence of FLAs in water systems indicated a potential reservoir for L. pneumophila , highlighting the importance of monitoring both organisms in water quality assessments (Scheikl et al., 2014a ) The many studies revealed that elimination of L. pneumophila from hospital and potable water supplies is difficult when protozoan hosts are present (Breiman et al., 1990 , Steinert et al., 1998 ). H.Yet al revealed that, the survival microorganisms related to association with biofilms and the unique properties such as inherent tolerance of L.pneumophila to high temperature and chemical disinfectants (Lau and Ashbolt, 2009b ) Steinert et al (Steinert et al., 1998 ) demonstrated that, the temperature tolerance experiments revealed that the serogroup 1 strain of L. pneumophila shows higher tolerance to 60°C compared to serogroup 2. Additionally, potential host amoebae, such as Acanthamoeba spp. and Vahlkampfia spp., known to play a critical role in the amplification of L. pneumophila , were isolated from the plumbing system. In vitro studies demonstrated that both Legionella strains multiply at a similar rate within A. castellanii (Nisar et al., 2020 ). Our results showed contamination in surgical water sources (27/270, 10% ) with Acanthamoeba and L. pneumophila significantly was reported more than other parts of hospitals. Mohammady et al, Acanthamoeba genotypes isolated from the hospital environment and the thermal water of recreational baths in Markazi Province, central Iran. According to clinical units, the most positive cases were found in general wards (Hospital ward, laboratory, waiting room, radiology, and ICU-CCU wards) of the hospitals (20/38 or 52.6%) (Alireza et al., 2023 ). In addition, another study conducted in Brazil analyzed 135 samples from hospital wards and water storage tanks, of which 31 (23%) tested positive for Acanthamoeba genotypes T5, T3, and T4 (Taher et al., 2018 ). Costa et al. (2010) found Acanthamoeba amoeba in different samples collected from various hospital wards in Brazil. In this study, samples were obtained from the wards such as the general surgical unit, ICU, and operating room. In this study, Acanthamoeba isolation from different hospital wards facing heavy traffic of visitors indicates that Acanthamoeba cysts can be easily transmitted through dust carried by people from the outside environment into the hospital (Costa et al., 2010) On the other hand, Acanthamoeba isolation in ICUs, where people's movement is limited and hygiene procedures are observed more intensively, indicates that these strategies are not sufficient and appropriate to reduce or completely eliminate contamination (Costa et al., 2010). In current study, out of 270 water samples from different districts of hospitals in Birjand City., 80 positive samples for Acanthamoeba . The genus Acanthamoeba has reported as the most common FLA in the study (29.6%). Additionaly, in five (6.25%) of the 80 plates containing grown FLA, L. pneumophila was identified according to the shape of the well-defined colonies after a few days of initial culture. Our phylogeny analysis showed that, the T4 genotype was identified as the most abundant genotype (Maciver et al., 2013 ), indicating that this source could be a suitable habitat for the growth of pathogenic Acanthamoeba. Furthermore, the T4 genotypes in this study were grouped separately in distinct branches compared to T2 and T3 genotypes from previous studies of hospital wastewater samples. The prior research has stablished that, The genotypes T1, T2, T4, T5, T10, T11, and T12 belong to the factors of granulomatous amebic encephalitis, whereas T2, T4, T5, T16, and T18 may be the factors of Acanthamoeba pneumonia (Alsam et al., 2003 ). Several reports are available on the prevalence of the T4 genotype in cases of amoebic keratitis. However, a question still remains unanswered on the frequency of this genotype in the environment or whether isolates belonging to the T4 genotype are more pathogenic. The importance of this genotype was revealed when Yaslianifard et al. (2003) showed that isolates belonging to the T4 genotype had a greater binding power to host cells than genotypes T2, T3, and T11, consequently showing greater cytotoxic effects (Alsam et al., 2003 ). Therefore, the prevalence of free-living amoebas with genotype 4 in water resources in hospitals can be a threat for public health (Alireza et al., 2023 ). Chan et al. (2010) isolated Acanthamoeba from dust in air conditioning systems in a Malaysian city, and the results showed that 98.22% were positive for Acanthamoeba , among which 90% of the isolates belonged to the T4 genotype (43). Their study corresponds to our result concerning the dominance of the T4 genotype According to researche that has been established, the co-occurrence of Acanthamoeba and Legionella spp. leads to the formation of a biofilm, creating a protected environment that allows Legionella spp. to survive within free-living amoebas. This situation contributes to the spread of this bacteri in hospital environments and among individuals at risk of disease. Also these bacteria back into water systems where they can continue to pose risks to individuals (Malinowski et al., 2022 ). In this study, the concurrent contamination of FLAs and L. pneumophila was evaluated in different water sources in Birjand hospitals. The data obtained in our study can help to focus on the widespread distribution of Acanthamoeba and Legionella spp. and their close interaction and long survival. Nevertheless, further studies may be required to identify whether FLAs management programs help reduce the Legionella -associated risk. Conclusion The prevalence of Legionella -associated FLAs indicates that traditional monitoring methods may be insufficient for Legionella spp. control. Our result revealed a contamination rate of 29.6 % and 6.25% for Acantamoeba , L. pneumophila respectively in hospital water samples. co-occurance contamination of Acanthamoeba and L. pneumophila was found in hospital water samples, which the highest rates were found in the Surgical ward of hospitals.In the present study, the contamination of hospital water resources indicates that more attention should be paid to the diagnosis of Legionnaires' disease in patients using accurate laboratory tests in addition to clinical symptoms. Co-occurrence of Acanthamoeba and L. pneumophila in hospital environment can be an important risk factor for patients. Declarations Ethical considerations The necessary approval was obtained from the ethics committee. The results of the study were made available to the research subjects and the authorities of the research areas. All material and intellectual rights of the university have been considered in presenting the results of the research project. Acknowledgments This study is the result of a Mohammad Naseri thesis from the Birjand University of Medical Sciences and Health Services, with the code of ethics IR.BUMS.REC.1402.014 The authors would like to acknowledge the esteemed Vice Chancellor for Research and Technology of Birjand University of Medical Sciences and the Faculty of Medicine as financial sponsors. Data availability All generated data from the current study are included in the article. Conflict of interest The authors declare that they have no conflict of interest. Informed consent Informed consent was obtained from all subjects and/or their legal guardian(s). All authors declared that they have seen and approved the submitted version of this manuscript. Funding Declaration This work was supported by Vice Chancellor for Research and Technology of Birjand University of Medical Sciences, Birjand, Iran (Grant number 456924). References ABDEL-NOUR, M., DUNCAN, C., LOW, D. E. & GUYARD, C. 2013. Biofilms: the stronghold of Legionella pneumophila. Int J Mol Sci, 14 , 21660-75. ALIREZA, M., ABDOLHOSSEIN, D., FATEMEH, G., MAJID, A. & MAJID, P. 2023. Genotyping of Acanthamoeba Isolated from Hospital Environments and Thermal Water of Recreational Baths in Markazi Province, Iran. Iranian Journal of Parasitology, 18. ALSAM, S., KIM, K. S., STINS, M., RIVAS, A. O., SISSONS, J. & KHAN, N. A. 2003. Acanthamoeba interactions with human brain microvascular endothelial cells. Microb Pathog, 35 , 235-41. BAGGIANI, A., CASINI, B., TOTARO, M., AQUINO, F., VALENTINI, P., BRUNI, B., PORRETTA, A., CASALINI, F., MICCOLI, M. & PRIVITERA, G. 2015. Colonization by Legionella spp. of water networks in residential buildings of the Province of Pisa, Italy. Ann Ig, 27 , 718-25. BALCZUN, C. & SCHEID, P. L. 2017. Free-Living Amoebae as Hosts for and Vectors of Intracellular Microorganisms with Public Health Significance. Viruses, 9. BARBOSA, A., AZEVEDO, N. F., GOERES, D. M. & CERQUEIRA, L. 2024. Ecology of Legionella pneumophila biofilms: The link between transcriptional activity and the biphasic cycle. Biofilm, 7 , 100196. BEHNIAFAR, H. 2016. Morphological and Molecular Identification of Acanthamoeba spp from Surface Waters in Birjand, Iran, During 2014-2015. Archives of Hygiene Sciences . BEHRAVAN, M., BEHNIAFAR, H., EINIPOUR, S., DORANI, N. & NAGHIZADEH, A. 2016. Morphological and Molecular Identification of Acanthamoeba Spp from Surface Waters in Birjand, Iran, During 2014-2015. Archives of Hygiene Sciences, 5 , 117-122. BERTOLINO, G., MARRAS, L., SANNA, C., CARRUCCIU, G., SCHINTU, M. & CORONEO, V. 2020a. Ten-Year Retrospective Analysis of Legionella Diffusion in Hospital Water Systems and Its Serogroup Seasonal Variation. In: DONELLI, G. (ed.) Advances in Microbiology, Infectious Diseases and Public Health: Volume 14. Cham: Springer International Publishing. BERTOLINO, G., MARRAS, L., SANNA, C., CARRUCCIU, G., SCHINTU, M. & CORONEO, V. 2020b. Ten-Year Retrospective Analysis of Legionella Diffusion in Hospital Water Systems and Its Serogroup Seasonal Variation. Adv Exp Med Biol, 1282 , 93-103. BOOTON, G. C., KELLY, D. J., CHU, Y. W., SEAL, D. V., HOUANG, E., LAM, D. S., BYERS, T. J. & FUERST, P. A. 2002. 18S ribosomal DNA typing and tracking of Acanthamoeba species isolates from corneal scrape specimens, contact lenses, lens cases, and home water supplies of Acanthamoeba keratitis patients in Hong Kong. J Clin Microbiol, 40 , 1621-5. BREIMAN, R. F., FIELDS, B. S., SANDEN, G. N., VOLMER, L., MEIER, A. & SPIKA, J. S. 1990. Association of shower use with Legionnaires' disease. Possible role of amoebae. Jama, 263 , 2924-6. BRUNKARD, J. M., AILES, E., ROBERTS, V. A., HILL, V., HILBORN, E. D., CRAUN, G. F., RAJASINGHAM, A., KAHLER, A., GARRISON, L., HICKS, L., CARPENTER, J., WADE, T. J., BEACH, M. J. & YODER MSW, J. S. 2011. Surveillance for waterborne disease outbreaks associated with drinking water---United States, 2007--2008. MMWR Surveill Summ, 60 , 38-68. CASINI, B., BAGGIANI, A., TOTARO, M., MANSI, A., COSTA, A. L., AQUINO, F., MICCOLI, M., VALENTINI, P., BRUSCHI, F., LOPALCO, P. L. & PRIVITERA, G. 2018. Detection of viable but non-culturable legionella in hospital water network following monochloramine disinfection. J Hosp Infect, 98 , 46-52. CERVERO-ARAGó, S., RODRíGUEZ-MARTíNEZ, S., PUERTAS-BENNASAR, A. & ARAUJO, R. M. 2015. Effect of Common Drinking Water Disinfectants, Chlorine and Heat, on Free Legionella and Amoebae-Associated Legionella. PLoS One, 10 , e0134726. CHAUHAN, D. & SHAMES, S. R. 2021. Pathogenicity and Virulence of Legionella: Intracellular replication and host response. Virulence, 12 , 1122-1144. COSTA, A. O., CASTRO, E. A., FERREIRA, G. A., FURST, C., CROZETA, M. A. & THOMAZ-SOCCOL, V. 2010. Characterization of acanthamoeba isolates from dust of a public hospital in Curitiba, Paraná, Brazil. J Eukaryot Microbiol, 57 , 70-5. DE JONCKHEERE, J. F. 1979. Pathogenic free-living amoebae in swimming pools: survey in Belgium. Ann Microbiol (Paris), 130b , 205-12. DECKER, B. K. & PALMORE, T. N. 2014. Hospital water and opportunities for infection prevention. Curr Infect Dis Rep, 16 , 432. DENONCOURT, A. M., PAQUET, V. E. & CHARETTE, S. J. 2014. Potential role of bacteria packaging by protozoa in the persistence and transmission of pathogenic bacteria. Front Microbiol, 5 , 240. FAN, S., SHEN, Y. & QIAN, L. 2024. Social life of free-living amoebae in aquatic environment— comprehensive insights into interactions of free-living amoebae with neighboring microorganisms. Frontiers in Microbiology, 15. GUILLOT, E. & LORET, J.-F. 2009. Waterborne Pathogens: Comprehensive Review for the Drinking Water Industry. IWA Publishing. HOFFMANN, R. & MICHEL, R. 2001. Distribution of free-living amoebae (FLA) during preparation and supply of drinking water. Int J Hyg Environ Health, 203 , 215-9. HUANG, S.-W., HSU, B.-M., CHEN, N.-H., HUANG, C.-C., HUANG, K.-H., CHEN, J.-S. & KAO, P.-M. 2011. Isolation and identification of Legionella and their host amoebae from weak alkaline carbonate spring water using a culture method combined with PCR. Parasitology Research, 109 , 1233-1241. KANAREK, P., BOGIEL, T. & BREZA-BORUTA, B. 2022. Legionellosis risk—an overview of Legionella spp. habitats in Europe. Environmental Science and Pollution Research, 29 , 76532-76542. KARIMI, A., KHEIRANDISH, F., JAVADI MAMAGHANI, A., TAGHIPOUR, N., MOUSAVI, S. F., AGHAJANI, A., ZEBARDAST, N., FARAJI, M. & FALLAHI, S. 2023. Identification and genotyping of Acanthamoeba spp. in the water resources of western Iran. Parasite Epidemiology and Control, 22 , e00308. KRUSE, E. B., WEHNER, A. & WISPLINGHOFF, H. 2016. Prevalence and distribution of Legionella spp in potable water systems in Germany, risk factors associated with contamination, and effectiveness of thermal disinfection. Am J Infect Control, 44 , 470-4. LASJERDI, Z., NIYYATI, M., HAGHIGHI, A., SHAHABI, S., BIDEROUNI, F. T., TAGHIPOUR, N., EFTEKHAR, M. & NAZEMALHOSSEINI MOJARAD, E. 2011. Potentially pathogenic free-living amoebae isolated from hospital wards with immunodeficient patients in Tehran, Iran. Parasitol Res, 109 , 575-80. LATIFI, A., SALAMI, M., KAZEMIRAD, E. & SOLEIMANI, M. 2020. Isolation and identification of free-living amoeba from the hot springs and beaches of the Caspian Sea. Parasite Epidemiology and Control, 10 , e00151. LAU, H. Y. & ASHBOLT, N. J. 2009a. The role of biofilms and protozoa in Legionella pathogenesis: implications for drinking water. Journal of Applied Microbiology, 107 , 368-378. LAU, H. Y. & ASHBOLT, N. J. 2009b. The role of biofilms and protozoa in Legionella pathogenesis: implications for drinking water. J Appl Microbiol, 107 , 368-78. LORENZO-MORALES, J., KHAN, N. A. & WALOCHNIK, J. 2015. An update on Acanthamoeba keratitis: diagnosis, pathogenesis and treatment. Parasite, 22 , 10. MACIVER, S. K., ASIF, M., SIMMEN, M. W. & LORENZO-MORALES, J. 2013. A systematic analysis of Acanthamoeba genotype frequency correlated with source and pathogenicity: T4 is confirmed as a pathogen-rich genotype. Eur J Protistol, 49 , 217-21. MAHMOUDI, M. R., RAHMATI, B., SEYEDPOUR, S. H. & KARANIS, P. 2015. Occurrence and molecular characterization of free-living amoeba species (Acanthamoeba, Hartmannella, and Saccamoeba limax) in various surface water resources of Iran. Parasitol Res, 114 , 4669-74. MALINOWSKI, N., DOMINGOS, S., WYLIE, J., MORGAN, M. J., METCALFE, S., WALSH, T., AHMED, W., KAKSONEN, A. H. & PUZON, G. J. 2022. Free-Living Amoeba and Associated Pathogenic Bacteria in Well-Chlorinated Drinking Water Storage Tanks. ACS ES&T Water, 2 , 1511-1520. MARGOT, C., RHOADS, W., GABRIELLI, M., OLIVE, M. & HAMMES, F. 2024. Dynamics of drinking water biofilm formation associated with Legionella spp. colonization. npj Biofilms and Microbiomes, 10 , 101. MOORE, M. R., PRYOR, M., FIELDS, B., LUCAS, C., PHELAN, M. & BESSER, R. E. 2006. Introduction of monochloramine into a municipal water system: impact on colonization of buildings by Legionella spp. Appl Environ Microbiol, 72 , 378-83. NACAPUNCHAI, D., KINO, H., RUANGSITTICHA, C., SRIWICHAI, P., ISHIH, A. & TERADA, M. 2001. A brief survey of free-living amebae in Thailand and Hamamatsu District, Japan. Southeast Asian J Trop Med Public Health, 32 Suppl 2 , 179-82. NISAR, M. A., ROS, K. E., BROWN, M. H., BENTHAM, R., BEST, G., XI, J., HINDS, J. & WHILEY, H. 2023. Stagnation arising through intermittent usage is associated with increased viable but non culturable Legionella and amoeba hosts in a hospital water system. Frontiers in Cellular and Infection Microbiology, 13. NISAR, M. A., ROSS, K. E., BROWN, M. H., BENTHAM, R. & WHILEY, H. 2020. Legionella pneumophila and Protozoan Hosts: Implications for the Control of Hospital and Potable Water Systems. Pathogens, 9. NOROUZI, M., NIYYATI, M. & BEHNIAFAR, H. 2022. Microbial Biofilms as a Risk Factor for Acantahmoeba keratitis. Novelty in Biomedicine, 10 , 37-42. PERKINS, K. M., REDDY, S. C., FAGAN, R., ARDUINO, M. J. & PERZ, J. F. 2019. Investigation of healthcare infection risks from water-related organisms: Summary of CDC consultations, 2014-2017. Infect Control Hosp Epidemiol, 40 , 621-626. RAMíREZ-CASTILLO, F. Y., LOERA-MURO, A., JACQUES, M., GARNEAU, P., AVELAR-GONZáLEZ, F. J., HAREL, J. & GUERRERO-BARRERA, A. L. 2015. Waterborne pathogens: detection methods and challenges. Pathogens, 4 , 307-34. REYES-BATLLE, M., DíAZ, F. J., SIFAOUI, I., RODRíGUEZ-EXPóSITO, R., RIZO-LIENDO, A., PIñERO, J. E. & LORENZO-MORALES, J. 2021. Free living amoebae isolation in irrigation waters and soils of an insular arid agroecosystem. Science of The Total Environment, 753 , 141833. RODRíGUEZ-ZARAGOZA, S. 1994. Ecology of free-living amoebae. Crit Rev Microbiol, 20 , 225-41. ROHR, U., WEBER, S., MICHEL, R., SELENKA, F. & WILHELM, M. 1998. Comparison of free-living amoebae in hot water systems of hospitals with isolates from moist sanitary areas by identifying genera and determining temperature tolerance. Appl Environ Microbiol, 64 , 1822-4. SCHEID, P. 2018. Free-Living Amoebae as Human Parasites and Hosts for Pathogenic Microorganisms. Proceedings [Online], 2. SCHEIKL, U., SOMMER, R., KIRSCHNER, A., RAMEDER, A., SCHRAMMEL, B., ZWEIMULLER, I., WESNER, W., HINKER, M. & WALOCHNIK, J. 2014a. Free-living amoebae (FLA) co-occurring with legionellae in industrial waters. Eur J Protistol, 50 , 422-9. SCHEIKL, U., SOMMER, R., KIRSCHNER, A., RAMEDER, A., SCHRAMMEL, B., ZWEIMULLER, I., WESNER, W., HINKER, M. & WALOCHNIK, J. 2014b. Free-living amoebae (FLA) co-occurring with legionellae in industrial waters. European Journal of Protistology, 50 , 422-429. SHARMA, R., JHANJI, V., SATPATHY, G., SHARMA, N., KHOKHAR, S. & AGARWAL, T. 2013. Coinfection with Acanthamoeba and Pseudomonas in contact lens-associated keratitis. Optom Vis Sci, 90 , e53-5. SHI, Y., QUELLER, D. C., TIAN, Y., ZHANG, S., YAN, Q., HE, Z., HE, Z., WU, C., WANG, C. & SHU, L. 2021. The Ecology and Evolution of Amoeba-Bacterium Interactions. Appl Environ Microbiol, 87. STEINERT, M., OCKERT, G., LUCK, C. & HACKER, J. 1998. Regrowth of Legionella pneumophila in a heat-disinfected plumbing system. Zentralblatt für Bakteriologie, 288 , 331-342. STOJEK, N. M. & DUTKIEWICZ, J. 2011. Co-existence of Legionella and other Gram-negative bacteria in potable water from various rural and urban sources. Ann Agric Environ Med, 18 , 330-4. TAHER, E. E., MEABED, E. M. H., ABDALLAH, I. & ABDEL WAHED, W. Y. 2018. Acanthamoeba keratitis in noncompliant soft contact lenses users: Genotyping and risk factors, a study from Cairo, Egypt. J Infect Public Health, 11 , 377-383. TOTARO, M., VALENTINI, P., COSTA, A. L., FRENDO, L., CAPPELLO, A., CASINI, B., MICCOLI, M., PRIVITERA, G. & BAGGIANI, A. 2017. Presence of Legionella spp. in Hot Water Networks of Different Italian Residential Buildings: A Three-Year Survey. Int J Environ Res Public Health, 14. UZEL, A., UCAR, F. & HAMEŞ-KOCABAŞ, E. E. 2005. Prevalence of Legionella pneumophila serogroup 1 in water distribution systems in Izmir province of Turkey. Apmis, 113 , 664-9. VALCIŅA, O., PŪLE, D., MALIŠEVS, A., TROFIMOVA, J., MAKAROVA, S., KONVISERS, G., BĒRZIŅŠ, A. & KRŪMIŅA, A. 2019. Co-Occurrence of Free-Living Amoeba and Legionella in Drinking Water Supply Systems. Medicina (Kaunas), 55. VAN KENHOVE, E., DINNE, K., JANSSENS, A. & LAVERGE, J. 2019. Overview and comparison of Legionella regulations worldwide. Am J Infect Control, 47 , 968-978. WANG, Y., JIANG, L., ZHAO, Y., JU, X., WANG, L., JIN, L., FINE, R. D. & LI, M. 2023. Biological characteristics and pathogenicity of Acanthamoeba. Front Microbiol, 14 , 1147077. WILSON, D. A., YEN-LIEBERMAN, B., REISCHL, U., GORDON, S. M. & PROCOP, G. W. 2003. Detection of Legionella pneumophila by real-time PCR for the mip gene. J Clin Microbiol, 41 , 3327-30. Tables Table 1. Prevalence of Acanthamoeba at the selected Sites Sources NO. of Positive plates Prevalence (%) of acanthamoeba P-value Hospitals* Hospital 1 32 35.5% 0.1 Hospital 2 21 23.3% Hospital 3 27 30% Total: 80 Hospital wards ICU 18 26.4% 0.1 Surgery room 15 21.4% Surgical ward 27 39.1% Water storage tanks 20 31.7% Total : 80 *Hospital : Razi, Hospital2: Vali Asr, Hospital3: Emam Reza Table 2. The frequency distribution of L. pneumophila -positive cases in water samples and different wards of hospitals Sources Positive plates Prevalence (%) of L. pneumophila P-value Hospitals* Hospital 1 2 2.2% 0.8 Hospital 2 2 2.2% Hospital 3 1 1.1% Total: 5 Hospital wards ICU 1 (1.4%) 0.8 Surgery room 1 (1.4%) Surgical ward 2 (2.8%) Water storage tanks 1 (1.4%) Total: 5 *Hospital: Razi, Hospital2: Vali Asr, Hospital3: Emam Reza Table 3. Investigation of concurrent contamination of FLA and L. pneumophila at the hospitals and different hospital wards Contamination area Contamination type Positive culture plates (%) of Acanthamoeba Positive plates of L. pneumophila with FLA P-value Hospitals* Hospital 1 Positive 32 (8.11%) 2 0.001 Negative 58 (5.21%) 30 Hospital 2 Positive 21 (8.7%) 2 0.1 Negative 69 (5.25%) 19 Hospital 3 Positive 27 (10%) 1 0.004 Negative 63 (3.23%) 26 Ward ICU Positive 18 (6.7%) 1 0.57 Negative 50 (18.5%) 17 Surgery room Positive 15 (5.5%) 1 0.18 Negative 55 (20.4%) 14 Surgical ward Positive 27 (10%) 2 0.002 Negative 42 (15.5%) 25 Water storage tanks Positive 20 (4.7%) 1 0.01 Negative 43 (15.9%) 19 Total : 270 Total : 10 *Hospital : Razi, Hospital2: Vali Asr, Hospital3: Emam Reza Additional Declarations No competing interests reported. Supplementary Files graphicalabstract.jpg Gel.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6205801","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":434212358,"identity":"61948b3e-b660-4a88-84a2-c643f00b9e51","order_by":0,"name":"Mohammad Naseri","email":"","orcid":"","institution":"Birjand University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Naseri","suffix":""},{"id":434212359,"identity":"cd2b643a-23a8-4b00-98c6-f495df25836a","order_by":1,"name":"Majid Zare-Bidaki","email":"","orcid":"","institution":"Birjand University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Majid","middleName":"","lastName":"Zare-Bidaki","suffix":""},{"id":434212360,"identity":"5df9ad74-00e1-49aa-a237-09ba3c5aefc6","order_by":2,"name":"Sara Nemati","email":"","orcid":"","institution":"Shahid Beheshti University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Sara","middleName":"","lastName":"Nemati","suffix":""},{"id":434212361,"identity":"ed6c5d20-6452-4e45-a528-29581cf9ce92","order_by":3,"name":"Rahmat Solgi","email":"","orcid":"","institution":"Birjand University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Rahmat","middleName":"","lastName":"Solgi","suffix":""},{"id":434212363,"identity":"e4447f36-8fea-45c4-9185-6f39f5baa508","order_by":4,"name":"Mahmoodreza Behravan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHElEQVRIiWNgGAWjYFACHhDBzAAlD0AEPzAwJJCmhXEGyVqYefBo0W0/e3TDhwrrfH7+ww+YCyru5PPPSH722LbNLo+fvYHxw8ccDC1mZ/LSbs44k245s+GYAfOMM88sZ9xIMzfObUsuluw5wCw5cxumlgM5Zrd52w4bGBxsMGAGMRjOHDCTzm1jTtxwI4GNmReLlvNvIFrsD7N/YOb9d9hA/szxb9KWbfW4tdyA2cLGA7SlAcg43mMmzdh2GI+WN2YgvxhInOEpODzj2GEDw+M9ZZI9544nzuw52IzVL+dzzG4AQ8yAv//4xscFNYcN5A6zb5P4UVad2M/efPDDR0wtKOAAnMXIBiYb8KtHBX9IUTwKRsEoGAXDHAAAdnp0DvGZbwsAAAAASUVORK5CYII=","orcid":"","institution":"Birjand University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Mahmoodreza","middleName":"","lastName":"Behravan","suffix":""}],"badges":[],"createdAt":"2025-03-11 18:08:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6205801/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6205801/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":79750900,"identity":"6fb09643-1cf7-4908-b9d6-dedcabb258d1","added_by":"auto","created_at":"2025-04-02 09:21:28","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":241968,"visible":true,"origin":"","legend":"\u003cp\u003eStar-shaped cysts of \u003cem\u003eAcanthamoeba\u003c/em\u003e isolated from Culture media in the non-nutrient agar medium from different sources and stained with iodine (100X magnification)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6205801/v1/21cfbb4f1b4ec22436225212.png"},{"id":79751874,"identity":"ad3b96b0-9ec0-4085-8111-d75c1531404c","added_by":"auto","created_at":"2025-04-02 09:29:28","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":362114,"visible":true,"origin":"","legend":"\u003cp\u003eElectrophoresis of the PCR product using specific primers for \u003cem\u003eAcanthamoeba\u003c/em\u003e using the \u003cem\u003emip\u003c/em\u003egene sequence isolated from hospital water sources in Birjand city.\u003c/p\u003e\n\u003cp\u003e(M: JDP1,2 Marker, Line 1-12: positive samples, Line13: PC positive control, and Line14: NC negative control)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6205801/v1/b7bdd023dd4cf47ca47bff22.png"},{"id":79750906,"identity":"d0c9a628-8b74-4cba-91a3-573a8aacac09","added_by":"auto","created_at":"2025-04-02 09:21:28","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":186464,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of the \u003cem\u003eL. pneumophila\u003c/em\u003e genus. A maximum-likelihood tree of sequenced \u003cem\u003eL. pneumophila\u003c/em\u003e species\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6205801/v1/701e865fdb58b740a896da4f.png"},{"id":79751876,"identity":"ff48b346-1995-43fa-a8b0-52580a6152fa","added_by":"auto","created_at":"2025-04-02 09:29:28","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":517308,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eLegionella\u003c/em\u003e spp. culture on the BCYE medium\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6205801/v1/9b504b5909840ea45a68ad6f.png"},{"id":79750923,"identity":"de0dbf7b-527b-464a-b8f3-bdc8cad10524","added_by":"auto","created_at":"2025-04-02 09:21:29","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":101167,"visible":true,"origin":"","legend":"\u003cp\u003e18SrRNA based phylogenetic tree of isolated \u003cem\u003eAcanthamoeba\u003c/em\u003e spp. with nearest validated species with high bootstrapping value. The those marked with a black circle belong to the samples studied in the present study.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6205801/v1/9f701ca5f65b68e10f59f72d.png"},{"id":81016513,"identity":"631c9bb1-3e80-4e17-badd-8638a11ba830","added_by":"auto","created_at":"2025-04-21 09:01:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2968315,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6205801/v1/2a641163-d201-40f1-aef1-3085e0ab607e.pdf"},{"id":79750909,"identity":"d896cff3-a723-46bd-b70a-eafa7d9f695a","added_by":"auto","created_at":"2025-04-02 09:21:28","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3277042,"visible":true,"origin":"","legend":"","description":"","filename":"graphicalabstract.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6205801/v1/166956167cb1e65b3a5b71d6.jpg"},{"id":79750907,"identity":"6766bdbb-fa5b-46bf-8174-077a7f913874","added_by":"auto","created_at":"2025-04-02 09:21:28","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":163392,"visible":true,"origin":"","legend":"","description":"","filename":"Gel.docx","url":"https://assets-eu.researchsquare.com/files/rs-6205801/v1/dbcf2a5fcfda8e917b70203c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Concurrent contamination of Free-Living Amoebae and Legionella pneumophila in water resources of hospitals, A microscopic and molecular analysis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eContamination of water systems has emerged as a critical public health concern, particularly in healthcare settings (Guillot and Loret, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Waterborne pathogens, including bacteria, viruses, and protozoa, can thrive in aquatic environments and pose serious risks to public health. Hospitals, with their numerous specialized water systems, are particularly vulnerable to contamination, which can lead to outbreaks of various infections and significantly impact patient safety (Ram\u0026iacute;rez-Castillo et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFree-living amoebae (FLA) are highly abundant protozoa found in nature in a variety of environmental and man-made habitats, including freshwater, saltwater, seawater, soil, air-conditioning units, drinking water treatment plants, and even dental units (Balczun and Scheid, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Fan et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2024\u003c/span\u003e, Mahmoudi et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Free-living amoebae such as \u003cem\u003eHartmanella\u003c/em\u003e, \u003cem\u003eNaegleria\u003c/em\u003e, and \u003cem\u003eAcanthamoeba\u003c/em\u003e have also been reported from drinking water (Nacapunchai et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2001\u003c/span\u003e, Hoffmann and Michel, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2001\u003c/span\u003e), swimming pools (De Jonckheere, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1979\u003c/span\u003e), and hospital water networks(Rohr et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). FLA accounts for an essential part of microbial communities. \u003cem\u003eAcanthamoeba\u003c/em\u003e spp. are the causative agents of a sight-threatening corneal infection, called \u003cem\u003eAcanthamoeba\u003c/em\u003e keratitis (AK), the incidence of which is on the rise worldwide as a severe sight-threatening disease (Lorenzo-Morales et al., 2015). FLA serve as significant environmental predators, feeding on various micro-organism populations, including bacteria, fungi, and algae (Shi et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) Shi et al indicated that, FLAs are ecologically significant for regulating bacterial population levels; however, the interactions between amoebae and their associated bacteria are unknown (Rodr\u0026iacute;guez-Zaragoza, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). The implications of these symbiotic amoeba-bacteria interactions for human health have garnered heightened attention, as certain pathogenic bacteria have developed survival mechanisms to evade amoebal digestion, thereby remaining shielded from adverse environmental conditions, particularly when they inhabit cysts that offer a protective barrier against disinfection techniques (Steinert et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). In particular, amoebae of the genus \u003cem\u003eAcanthamoeba\u003c/em\u003e are suitable hosts due to their highly resistant cysts to environmental stresses, such as dryness and changes in pH, osmolarity, or temperature. They even survive chlorination and other disinfection methods (Wang et al., \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). As a result, bacteria can not only be resistant to amoebae but can also proliferate in them and benefit from the advantages of coexistence with them, such as nutrient sources, greater protection from temperature, disinfectants, and UV radiation (Scheikl et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2014b\u003c/span\u003e). The findings revealed that, FLAs are among the organisms that have been isolated from household water systems and hospital water mains (Lasjerdi et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). These amoebae commonly serve as hosts for \u003cem\u003eLegionella\u003c/em\u003e spp., promoting their survival and proliferation in both natural habitats and man-made water systems. Studies indicate that \u003cem\u003eLegionella\u003c/em\u003e spp. can evade environmental stressors by residing within amoebae (Valciņa et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). \u003cem\u003eLegionella\u003c/em\u003e spp., is known to proliferate in warm water and biofilms, making hospital water systems ideal environments for its growth. As one of the leading causes of hospital-associated pneumonia, understanding the dynamics of waterborne pathogens is essential for effective infection control strategies. \u003cem\u003eLegionella\u003c/em\u003e is a Gram-negative microorganism that can grow at temperatures between 25 and 42\u0026deg;C, particularly in collection systems. \u003cem\u003eLegionella\u003c/em\u003e spp. can be found in natural and artificial aquatic environments such as spring waters, thermal waters, rivers, lakes, mud, pipes, fountains, and swimming pools. This organism can cause Legionnaires' disease (LD) and Pontiac fever (Bertolino et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020b\u003c/span\u003e, Kanarek et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). \u003cem\u003eLegionella pneumophila\u003c/em\u003e is the primary causative agent of legionellosis and is recognized as one of the 30 emerging infectious diseases (Van Kenhove et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Brunkard et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Previous research has established that, aquatic biofilms facilitate the survival and multiplication of \u003cem\u003eLegionella\u003c/em\u003e spp. (Abdel-Nour et al., 2013, Margot et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Furthermore, protozoa can act as significant hosts for \u003cem\u003eLegionella\u003c/em\u003e spp. in natural, hospital, and domestic environments; viable but non-culturable \u003cem\u003eLegionella\u003c/em\u003e contained within amoebic cysts may contribute to water contamination in hospitals (Nisar et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Steinert et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Earlier findings have revealed that, \u003cem\u003eLegionella\u003c/em\u003e has also evolved mechanisms to avoid phagocytosis by FLAs. When residing within amoebae, \u003cem\u003eLegionella\u003c/em\u003e spp. can acquire traits that enhance its pathogenicity, enabling the development of virulence factors essential for causing infections in humans (Chauhan and Shames, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Moreover, both \u003cem\u003eLegionella\u003c/em\u003e spp. and FLAs contribute to biofilm development in water distribution systems, which provides a protective habitat for \u003cem\u003eLegionella\u003c/em\u003e, complicating disinfection efforts (Barbosa et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). This interaction is particularly concerning in healthcare settings, where immunocompromised patients are at a heightened risk for \u003cem\u003eLegionella\u003c/em\u003e spp. infections, especially pneumonia. Accordingly, understanding the dynamics between \u003cem\u003eLegionella\u003c/em\u003e spp. and free-living amoebae is crucial for formulating effective control measures to safeguard public health. The studies demonstrated that the factors contributing to the presence of Legionellaceae in a hospital water system were examined, along with the recontamination of \u003cem\u003eLegionella pneumophila\u003c/em\u003e following a thermal disinfection procedure. Three months after the heat treatment at 70\u0026deg;\u003csup\u003eC\u003c/sup\u003e, \u003cem\u003eLegionella\u003c/em\u003e strains regrew to their original cell numbers. The Potential host amoebae are reported to play a critical role in the amplification process of \u003cem\u003eLegionella\u003c/em\u003e (Steinert et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Targeted research in this area can lead to enhanced strategies for monitoring and managing water safety and quality. Furthermore, the considerable morbidity and mortality of diseases caused by these microorganisms indicate the need for further studies, particularly in hospital water resources as an important source of contamination.(6).\u003c/p\u003e \u003cp\u003eThere is a limited number of reports describing the endosymbiont bacteria of FLAs in water. Several reports have been published regarding the epidemiological surveillance of pathogenic bacteria in hospitals (Nisar et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Casini et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In Iran, limited studies have been separately conducted on the contamination of hospital settings with FLAS and \u003cem\u003eLegionella spp.\u003c/em\u003e, none of which have investigated the coexistence of FLAs and \u003cem\u003eLegionella\u003c/em\u003e spp. (2). Only one study on \u003cem\u003eAcanthamoeba\u003c/em\u003e has so far been conducted in Birjand City, indicating the contamination of a significant percentage of the city's surface water with this amoebae (Booton et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Investigations conducted previously have illustrated that, \u003cem\u003eLegionella\u003c/em\u003e species inhabit biofilms and interact with various microorganisms, including free-living amoebae (FLAs) (Barbosa et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2024\u003c/span\u003e, Lau and Ashbolt, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2009a\u003c/span\u003e). Therefore, investigating these microorganisms within hospital water systems is critically important for health risk prevention (Behravan et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, Decker and Palmore, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, Perkins et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Bertolino et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020a\u003c/span\u003e). Considering the transmission of infectious diseases through contaminated water, examining water systems is essential. The aims of the current study to explore the prevalence of water system contamination by potentially infectious microorganisms, the conditions that facilitate their growth, and the implications for infection prevention and control in hospital environments.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eSampling\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the present cross-sectional (descriptive-analytical) study, the statistical population was the water resources of teaching hospitals (Emam Reza (AS) Hospital, Vali Asr (AS) Hospital, and Razi Hospital) in Birjand City. Water was sampled through direct collection in sterile containers. In total, 270 water samples were collected from different wards (ICU, operating room, surgical ward, and water storage tanks) of three teaching hospitals in Birjand City (South Khorasan province). In other words, the sample size from each hospital was 90 samples, which were divided equally between different wards. Samples were collected from water taps in different places, such as washbasin, toilet, bathroom, and from the tank in the case of storage tanks. Water was collected using 50 ml sterile falcons. The samples were then transferred to the Parasitology and Mycology Laboratory, Faculty of Medicine, Birjand University of Medical Sciences, for the tests detailed in the following steps.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFiltration of samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe water samples collected, were shaken vigorously to mix the contents, then filtered through a cellulose nitrate membrane (Millipore). The samples were filtered using a vacuum pump and nitrocellulose paper filters with 0.45 micron pores and then passed through a nitrocellulose filter. Some of the samples were manually passed through a paper filter. Finally, the paper filters were placed on the culture medium, consisting of Non Nutrient Agar (NNA) with a layer of \u003cem\u003eEscherichia coli\u003c/em\u003e to grow \u003cem\u003eAcanthamoeba\u003c/em\u003e in this study (Karimi et al., 2023).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA. Sub-cultivation and isolation of \u003cem\u003eAcantamoeba\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSince fungi and bacteria can be present on the surface of the cultured plates, in addition to FLA, FLA must be cloned for a pure culture of a specific of. Fungi and bacteria must be eliminated as they are limiting in the PCR process. For this purpose, the FLA-containing plate was transferred under an inverted microscope, and a few cysts of the amoeba with fewer bacteria and fungi around it were taken using a sterile needle next to the flame and transferred to another culture medium. The plates were examined daily for amoeba growth. This was continued until a plate was obtained that was purer in terms of the amoeba of interest. Subculture was performed for all positive plates that exhibited growth of Acanthamoeba (Behniafar, 2016).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIdentification of FLAs using the monoxenic culture method\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the morphological identification of FLAs, the filter was placed upside down on the NNA culture medium covered with \u003cem\u003eE. coli\u003c/em\u003e. The media were incubated at 25-30 \u0026deg;\u003csup\u003eC\u003c/sup\u003e. Due to the slow-growing nature of some \u003cem\u003eAcanthamoeba\u003c/em\u003e strains, the plates were followed for 1 month. After a month, they were reported negative in the absence of FLAs (Booton et al., 2002).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo purification of the cultured plates, FLAs must be cloned for a pure culture of a specific of Fungi and bacteria must be eliminated as they are limiting in the PCR process. For this purpose, the FLA-containing plate was transferred under an inverted microscope, and a few cysts of the amoeba with fewer bacteria and fungi around it were taken using a sterile needle next to the flame and transferred to another culture medium. The \u003cem\u003eAcanthamoeba\u003c/em\u003e isolates were identified morphologically by their flattened trophozoites featuring slender acanthopodia and double-walled cysts with perforated star-shaped. Microscopic examination confirmed the diagnosis of \u003cem\u003eAcanthamoeba\u003c/em\u003e spp (Fig) (Behniafar, 2016).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA extraction and PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo DNA from the trophozoite form was extracted using a kit (Chelex, Bio-Rad Co.). \u003cem\u003eAcanthamoeba\u003c/em\u003e was cloned on a new culture medium, the plates were incubated at the appropriate temperature (28\u0026deg;\u003csup\u003eC\u003c/sup\u003e), and monitored every day for 1-2 weeks. When the highest number of amoebae in the culture medium belonged to trophozoites and not cysts, the amoebae were collected from the surface of the culture medium, and their DNA was extracted using the mentioned kit. To extract DNA using the Chelex kit, 500 \u0026micro;l of trophozoites washed with distilled water were poured into a 1.5 ml microtube. Next, 200 \u0026micro;l of the kit reagent was added to a measured volume of the tested sample suspension, and the sample was heated in a water bath at 55\u0026deg;\u003csup\u003eC\u003c/sup\u003e for 15-30 min. After the required time, the sample was vortexed for 10 seconds and heated in a boiling water bath for 8 min. Then, the sample was vortexed vigorously for 10 seconds and then centrifuged at 3000 rpm for 3 min. At this stage, the supernatant of the sample was poured into a 0.5 ml microtube and stored together with the container containing the precipitate at -20 \u0026deg;\u003csup\u003eC\u003c/sup\u003e for the PCR test. PCR reactions were completed in 25-\u0026mu;l volumes, containing 12.5 \u0026mu;l Ampliqon (Taq DNA Polymerase Master Mix RED, Denmark). A 500 bp region of the 18S rRNA gene was amplified using genus-specific primers JDP1 (5\u0026apos;-GGCCCAGATCGTTTACCGTGAA-3\u0026apos;) and JDP2 (5\u0026apos;-TCTCACAAGCTGCTAGGGGAGTCA-3\u0026apos;) from Takapozist, Iran (Behniafar, 2016, Booton et al., 2002). The PCR cycle profile was as follows: initial denaturation at 94\u0026deg;\u003csup\u003eC\u003c/sup\u003e for 1 minutes, followed by 35 cycles of denaturation at 94\u0026deg;\u003csup\u003eC\u003c/sup\u003e for 35 seconds, annealing at 56\u0026deg;\u003csup\u003eC\u003c/sup\u003e for 45 seconds, and extension at 72\u0026deg;\u003csup\u003eC\u003c/sup\u003e for 1 minute, concluding with a final extension at 72\u0026deg;\u003csup\u003eC\u003c/sup\u003e for 1 minutes. Distilled water was utilized as a negative control instead of DNA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSequencing and phylogeny analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe nucleotide of the samples was sequenced using the Genetic Analyzer 3130xl (Applied Biosystems, ABI, USA) available at the Gastroenterology and Liver Diseases Research Center, Shahid Beheshti University of Medical Sciences. Thereafter, the nucleotide sequences of all positive samples were edited using the Chromas program and analyzed in the BLAST1 program of the PubMed site. A phylogenetic analysis was conducted to determine the evolutionary relationships among the isolated strains of FLAs obtained from hospital water systems. Phylogenetic trees were constructed based on 16S rRNA gene sequences using the Maximum Likelihood method implemented in MEGA version 6.0 software (http://www.megasoftware.net). Sequences were aligned using MUSCLE, and the best-fit model of evolution was selected using the Akaike Information Criterion (AIC). Bootstrap support was evaluated based on 1,000 replicates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB.\u003c/strong\u003e \u003cstrong\u003eIsolation and identification of \u003cem\u003eLegionella\u0026nbsp;\u003c/em\u003espp\u003cem\u003e.\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter sampling and passing the samples through nitrocellulose filters, the filters were cut into small pieces and placed in test tubes with 100 ml of the original water sample. The samples were placed at a temperature of 37 \u0026deg;\u003csup\u003eC\u003c/sup\u003e for 24 h to separate the bacteria from the filter. Then, the samples were incubated in 50 \u0026deg;\u003csup\u003eC\u003c/sup\u003e for 30 min to remove microbial agents other than \u003cem\u003eLegionella\u003c/em\u003e bacteria. Finally, the samples were transferred to two 50 ml tubes and centrifuged at 2600 g for 30 min. The supernatant was discarded and 2-3 ml of the resulting precipitate from one tube was transferred to the culture medium for culture (Huang et al., 2011).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA extraction , PCR and phylogeny analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eL. pneumophila\u003c/em\u003e was detected using a newly developed real-time TaqMan PCR assay with primers F (5\u0026prime;- GGCATAGATGTTTATCCGG -3\u0026prime;) and R (5\u0026prime;- GTGAAACCTGAAAACTTGCT -3\u0026prime;), which target the \u003cem\u003emip\u003c/em\u003e gene (Wilson et al., 2003). The amplification mixture for the detection of \u003cem\u003eLegionella\u003c/em\u003e spp. consisted of 25 \u0026mu;l of iQ SYBR green supermix (Bio-Rad Laboratories B.V., Veenendaal, Netherlands), 0.4 mg ml\u003csup\u003e\u0026minus;1\u003c/sup\u003e of bovine serum albumin (BSA; PCR grade; Roche Diagnostics, Almere, Netherlands), 0.2 \u0026mu;M each primer, and 10 \u0026mu;l of DNA template in a total reaction volume of 50 \u0026mu;l. \u003cem\u003eLegionella\u003c/em\u003e-positive samples were proliferated using a specific primer pair that amplifies part of the \u003cem\u003eMIP\u003c/em\u003e gene fragment of \u0026nbsp; \u003cem\u003eL. pneumophila\u003c/em\u003e. The negative control contained all the values required for the molecular reaction, except for the extracted genomic material. A phylogenetic tree was drawn using the genes obtained from the present study and the regions related to 12 reference sequences from serogroups 1-6 of \u003cem\u003eL. pneumophila\u0026nbsp;\u003c/em\u003ebacteria available in the GenBank database. Phylogenetic trees were constructed based on \u003cem\u003eMIP\u003c/em\u003e gene sequences using the Maximum Likelihood method implemented in MEGA version 6.0 software (http://www.megasoftware.net) with 1000 bootstrap replicates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were analyzed using SPSS version 21 software. Contamination rates based on wards and hospitals were compared using the Chi-square test at a statistical significance level of \u0026lt; 0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eIsolation and identification of \u003cem\u003eAcanthamoeba\u003c/em\u003e in water samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of \u003cem\u003eAcanthamoeba\u003c/em\u003e\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, the \u003cem\u003eAcanthamoeba\u0026nbsp;\u003c/em\u003ewere evaluated both morphologically and molecularly.\u0026nbsp;After a few days of initial culture, FLA was identified in 80 (29.6%) plates according to the shape of trophozoites and cysts with two clearly defined walls. \u003cem\u003eAcanthamoeba\u003c/em\u003e amoebae were identified in all 80 positive samples. \u003cem\u003eAcanthamoeba\u003c/em\u003e cysts with various shapes were observed on the inner wall, such as spherical, star-shaped, and polyhedral (Fig 1). In this study, 80 water samples from diferent water resources were collected in Birjand city. Totally 270 samples of hospital water (Razi, Vali Asr, Emam Reza Hospital) were analysis. \u0026nbsp;From 80 positive samples collected \u0026nbsp;from different hospitals, 18 samples of\u0026nbsp;ICU part, 15 samples of Surgery room, 27 samples of Surgical ward and 20 samples of Water storage tanks were analysis and represented as positive for \u003cem\u003eAcantamoeba\u003c/em\u003e. The results of the number of positive samples by PCR summarized in Table\u0026nbsp;1\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;No significant difference was observed between the FLA contamination of water resources at hospitals and different wards of hospitals in Birjand city (P \u003csub\u003evalue\u003c/sub\u003e= 0.1) (Table 1).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll culture plates were examined daily for 30 days using a light microscope before disposal. Detection was based on the distinct morphological characteristics of \u003cem\u003eAcanthamoeba\u003c/em\u003e trophozoites, as well as the trophozoites, flagellates, identified according to several documented reports (Figure 1).\u0026nbsp;Table 1shown that, 80 plates of 270 samples were positive morphologically and moleculary in water samples from different districts of hospitals in Birjand City.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular analysis and Genotyping and sequencing of \u003cem\u003eAcanthamoeba\u003c/em\u003e spp.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn hospital water sources, 80 out of 270 samples were positive by the culture method, 64 isolates were ampilified positively with specific primers (JDP1,2). As shown in Fig 2, these primers could amplify a fragment of about 500 bp. Fifteen isolates were selected randomly and sent for sequencing analysis. The genus \u003cem\u003eAcanthamoeba\u003c/em\u003e was genotyped based on the homology of the replicating fragment with the genes available in the GenBank. Homology analyses of the PCR products were conducted using BLAST (Basic Local Alignment Search Tool) software from the NCBI. In this study, after determining the sequencing, T4 genotype was presented as \u003cem\u003eAcanthamoeba\u003c/em\u003e in all of the sequences.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhylogeny analysis of \u003cem\u003eAcantamoeba\u0026nbsp;\u003c/em\u003espp.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe phylogenetic analysis revealed three distinct clusters of FLA isolates, with \u003cem\u003eAcanthamoeba\u003c/em\u003e species grouping closely together, Out\u0026nbsp;of 15 randomly sequenced sequences, ten nucleotide sequences from FLAs were included in phylogeny analysis.\u003c/p\u003e\n\u003cp\u003eThe phylogenetic tree (Fig 3) illustrates the clustering patterns, with bootstrap values indicating robust support for the observed relationships.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eIn this study, a phylogenetic tree was constructed to investigate the relationships of genotype T4. The results indicated that the T4 genotypes in this study were grouped separately in distinct branches compared to genotypes T2 and T3 from previous studies of hospital wastewater samples.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation and identification of \u003cem\u003eLegionella\u003c/em\u003e spp.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, totally 270 samples of hospital water (Razi, Vali Asr, Emam Reza Hospital) were analysis. \u0026nbsp;Out of 80 samples positive for \u003cem\u003eAcanthamoeba\u003c/em\u003e collected from various hospitals, five samples were found positive for \u003cem\u003eLegionella\u003c/em\u003e spp (6.25%). Specifically, there were two positive samples from Razi Hospital, two from Vali Asr Hospital, and one from Emam Reza Hospital.\u0026nbsp;Additionally, five psitive samples were devided among different parts of the hospitals; two samples of\u0026nbsp;Surgical ward\u0026nbsp;and one sample of ICU, Surgery room\u0026nbsp;and Water storage tanks respectively, were analysis and represented as positive for \u003cem\u003eLegionella\u0026nbsp;\u003c/em\u003espp.\u0026nbsp;After examining the plates of cultured hospital samples on the BCYE medium, initial identification was based on the specific shape of \u003cem\u003eLegionella\u0026nbsp;\u003c/em\u003espp\u003cem\u003e.\u003c/em\u003e colonies on the culture medium (Fig 4). \u003cem\u003eLegionella\u0026nbsp;\u003c/em\u003espp. bacteria did not grow in the remaining plates that were negative for FLA.\u003cem\u003e.\u003c/em\u003e The results of the number of positive samples by PCR summarized in Table 2. The results showed that, \u0026nbsp;no significant difference was observed between the \u003cem\u003eLegionella\u003c/em\u003e spp. contamination of water sources at the hospitals and different wards of hospitals in Birjand City (P \u003csub\u003evalue\u003c/sub\u003e= 0.8). (Table 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular and phylogeny analysis of \u003cem\u003eL. pneumophila\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNucleotide sequence analysis of 5 genotyped samples confirmed the circulation of subtype 1 of \u003cem\u003eL. pneumophila\u003c/em\u003e bacteria in South Khorasan Province (Fig 5). \u003cem\u003eL. pneumophila\u0026nbsp;\u003c/em\u003esequences showed 99% identity with serogroup 1 sequences available in the GenBank database. The mentioned sequence was registered with the number PQ187603 in the GenBank. The phylogenetic tree (Fig 5) illustrated that, the isolated samples were all 100% similar to each other and were assigned to the same branch as serogroup 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConcurrent contamination of FLA and \u003cem\u003eL. pneumophila\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cstrong\u003ein hospitals\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Concurrent\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003econtamination of FLAs and \u003cem\u003eL. pneumophila\u003c/em\u003e. was evaluated in different water sources in Birjand hospitals. A significant difference was observed between the concurrent\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003econtamination of FLA and \u003cem\u003eLegionella\u003c/em\u003e in Razi (P \u003csub\u003evalue\u003c/sub\u003e=001) and Imam Reza hospitals \u0026nbsp; \u0026nbsp;(P \u003csub\u003evalue\u003c/sub\u003e= 004) \u0026nbsp; as well as surgical wards (P \u003csub\u003evalue\u003c/sub\u003e= 0002) and water tanks (P \u003csub\u003evalue\u003c/sub\u003e= 0.01) at Birjand hospitals \u0026nbsp;(Table 3). As a result, all cases of \u003cem\u003eL. pneumophila\u0026nbsp;\u003c/em\u003epositivity were found in samples that tested positive for \u003cem\u003eAcanthamoeba.\u003c/em\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cem\u003eAcanthamoeba\u003c/em\u003e has been isolated from a variety of habitats, including freshwater, saltwater, beach sand, sewage, and soil (Karimi et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Reyes-Batlle et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Latifi et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Under unfavorable conditions, amoebae can form cysts to protect bacteria. Free-living amoebae can host pathogens, aiding their survival and complicating disinfection. They primarily consume bacteria, fungi, and algae through phagocytosis, digesting them in phagolysosomes (Malinowski et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Scheid, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Some microorganisms resist amoebae by avoiding internalization or by surviving, proliferating, and exiting after being internalized (Scheid, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrior studies showed that, The concentration of FLAs inside biofilms formed is clinically important, particularly if they are present on equipment and devices in healthcare facilities. Barbeau et al. presented evidence that all water samples from dental units contained FLA, the concentrations of which in these samples were 300 times higher than in tap water. \u003cem\u003eHartmannella\u003c/em\u003e, \u003cem\u003eVanella\u003c/em\u003e, and \u003cem\u003eValcamphia\u003c/em\u003e amoebae were abundant in these samples, and \u003cem\u003eAcanthamoeba\u003c/em\u003e and \u003cem\u003eNaegleria\u003c/em\u003e amoebae were identified in 40% of the isolates. Therefore, biofilms formed inside some dental equipment can significantly increase the concentration of FLA. These results highlight the important role of biofilms in the maintenance and proliferation of pathogenic amoebae and bacteria (44). The microorganisms present in biofilms are an important food source for FLAs and contribute to their resistance to amoebicides (Norouzi et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Therefore, biofilm sources in the hospital environment can be regarded as a serious health risk for patients (Norouzi et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Recently, \u003cem\u003ein vitro\u003c/em\u003e studies have proven that \u003cem\u003ePseudomonas\u003c/em\u003e can play a role in the pathogenesis of contact lens-associated amebic keratitis. In fact, \u003cem\u003ePseudomonas\u003c/em\u003e increases the resistance of \u003cem\u003eAcanthamoeba\u003c/em\u003e to contact lens disinfectant solutions and increases the survival of \u003cem\u003eAcanthamoeba\u003c/em\u003e by forming biofilms on the surface of contact lenses. Coinfection of \u003cem\u003ePseudomonas\u003c/em\u003e and \u003cem\u003eAcanthamoeba\u003c/em\u003e has also been reported in patients with keratitis (Sharma et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrevious research demonstrated that \u003cem\u003eAcanthamoeba\u003c/em\u003e and \u003cem\u003eLegionella\u003c/em\u003e spp. are common in drinking water in Birjand City, and water supply systems in the water system can be a potential source of \u003cem\u003eLegionella\u003c/em\u003e infection. Multiple studies have documented the presence of \u003cem\u003eLegionella\u003c/em\u003e spp. in water that is not linked to a specific outbreak, including research from Italy, Germany, Turkey [14], Georgia, Denmark, and Poland, among others (Baggiani et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e, Uzel et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2005\u003c/span\u003e, Moore et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2006\u003c/span\u003e, Stojek and Dutkiewicz, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe prevalence of \u003cem\u003eLegionella\u003c/em\u003e in drinking water ranged from 20.7% (49) to 32.7% (50) in Germany (Kruse et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), and different \u003cem\u003eLegionella\u003c/em\u003e species were detected in 26% of hot water mains in residential buildings in Italy (Totaro et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The co-occurrence of \u003cem\u003eLegionella\u003c/em\u003e and FLA in water systems may suggest an increased health risk to individuals (Cervero-Arag\u0026oacute; et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In addition to protecting against \u003cem\u003eLegionella\u003c/em\u003e, FLAS can also preserve viable but non-culturable (VBNC) strains and allow for long-term persistence and transmission of \u003cem\u003eLegionella\u003c/em\u003e spp. (Denoncourt et al., 2014). There are limited reports on \u003cem\u003eAcanthamoeba\u003c/em\u003e isolation from hospital water systems, suggesting that this amoebae is a host for the pathogenic \u003cem\u003eLegionella\u003c/em\u003e spp.\u003c/p\u003e \u003cp\u003eOur findings indicated that, all cases that tested positive for \u003cem\u003eL. pneumophila\u003c/em\u003e were reported in samples that also tested positive for The presence of FLAs in water systems indicated a potential reservoir for \u003cem\u003eL. pneumophila\u003c/em\u003e, highlighting the importance of monitoring both organisms in water quality assessments (Scheikl et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2014a\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eThe many studies revealed that elimination of \u003cem\u003eL. pneumophila\u003c/em\u003e from hospital and potable water supplies is difficult when protozoan hosts are present (Breiman et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1990\u003c/span\u003e, Steinert et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). H.Yet al revealed that,\u003c/p\u003e \u003cp\u003ethe survival microorganisms related to association with biofilms and the unique properties such as inherent tolerance of \u003cem\u003eL.pneumophila\u003c/em\u003e to high temperature and chemical disinfectants (Lau and Ashbolt, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2009b\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eSteinert et al (Steinert et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1998\u003c/span\u003e) demonstrated that, the temperature tolerance experiments revealed that the serogroup 1 strain of \u003cem\u003eL. pneumophila\u003c/em\u003e shows higher tolerance to 60\u0026deg;C compared to serogroup 2. Additionally, potential host amoebae, such as \u003cem\u003eAcanthamoeba\u003c/em\u003e spp. and \u003cem\u003eVahlkampfia\u003c/em\u003e spp., known to play a critical role in the amplification of \u003cem\u003eL. pneumophila\u003c/em\u003e, were isolated from the plumbing system. In vitro studies demonstrated that both \u003cem\u003eLegionella\u003c/em\u003e strains multiply at a similar rate within \u003cem\u003eA. castellanii\u003c/em\u003e (Nisar et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOur results showed contamination in surgical water sources (27/270, 10% ) with \u003cem\u003eAcanthamoeba\u003c/em\u003e and \u003cem\u003eL. pneumophila\u003c/em\u003e significantly was reported more than other parts of hospitals. Mohammady et al, \u003cem\u003eAcanthamoeba\u003c/em\u003e genotypes isolated from the hospital environment and the thermal water of recreational baths in Markazi Province, central Iran. According to clinical units, the most positive cases were found in general wards (Hospital ward, laboratory, waiting room, radiology, and ICU-CCU wards) of the hospitals (20/38 or 52.6%) (Alireza et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In addition, another study conducted in Brazil analyzed 135 samples from hospital wards and water storage tanks, of which 31 (23%) tested positive for \u003cem\u003eAcanthamoeba\u003c/em\u003e genotypes T5, T3, and T4 (Taher et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Costa et al. (2010) found \u003cem\u003eAcanthamoeba\u003c/em\u003e amoeba in different samples collected from various hospital wards in Brazil. In this study, samples were obtained from the wards such as the general surgical unit, ICU, and operating room. In this study, \u003cem\u003eAcanthamoeba\u003c/em\u003e isolation from different hospital wards facing heavy traffic of visitors indicates that \u003cem\u003eAcanthamoeba\u003c/em\u003e cysts can be easily transmitted through dust carried by people from the outside environment into the hospital (Costa et al., 2010) On the other hand, \u003cem\u003eAcanthamoeba\u003c/em\u003e isolation in ICUs, where people's movement is limited and hygiene procedures are observed more intensively, indicates that these strategies are not sufficient and appropriate to reduce or completely eliminate contamination (Costa et al., 2010).\u003c/p\u003e \u003cp\u003eIn current study, out of 270 water samples from different districts of hospitals in Birjand City., 80 positive samples for \u003cem\u003eAcanthamoeba\u003c/em\u003e. The genus \u003cem\u003eAcanthamoeba\u003c/em\u003e has reported as the most common FLA in the study (29.6%). Additionaly, in five (6.25%) of the 80 plates containing grown FLA, \u003cem\u003eL. pneumophila\u003c/em\u003e was identified according to the shape of the well-defined colonies after a few days of initial culture.\u003c/p\u003e \u003cp\u003eOur phylogeny analysis showed that, the T4 genotype was identified as the most abundant genotype (Maciver et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), indicating that this source could be a suitable habitat for the growth of pathogenic \u003cem\u003eAcanthamoeba.\u003c/em\u003e Furthermore, the T4 genotypes in this study were grouped separately in distinct branches compared to T2 and T3 genotypes from previous studies of hospital wastewater samples. The prior research has stablished that, The genotypes T1, T2, T4, T5, T10, T11, and T12 belong to the factors of granulomatous amebic encephalitis, whereas T2, T4, T5, T16, and T18 may be the factors of \u003cem\u003eAcanthamoeba\u003c/em\u003e pneumonia (Alsam et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2003\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSeveral reports are available on the prevalence of the T4 genotype in cases of amoebic keratitis. However, a question still remains unanswered on the frequency of this genotype in the environment or whether isolates belonging to the T4 genotype are more pathogenic. The importance of this genotype was revealed when Yaslianifard et al. (2003) showed that isolates belonging to the T4 genotype had a greater binding power to host cells than genotypes T2, T3, and T11, consequently showing greater cytotoxic effects (Alsam et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Therefore, the prevalence of free-living amoebas with genotype 4 in water resources in hospitals can be a threat for public health (Alireza et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Chan et al. (2010) isolated \u003cem\u003eAcanthamoeba\u003c/em\u003e from dust in air conditioning systems in a Malaysian city, and the results showed that 98.22% were positive for \u003cem\u003eAcanthamoeba\u003c/em\u003e, among which 90% of the isolates belonged to the T4 genotype (43). Their study corresponds to our result concerning the dominance of the T4 genotype\u003c/p\u003e \u003cp\u003eAccording to researche that has been established, the co-occurrence of \u003cem\u003eAcanthamoeba\u003c/em\u003e and \u003cem\u003eLegionella\u003c/em\u003e spp. leads to the formation of a biofilm, creating a protected environment that allows \u003cem\u003eLegionella\u003c/em\u003e spp. to survive within free-living amoebas. This situation contributes to the spread of this bacteri in hospital environments and among individuals at risk of disease. Also these bacteria back into water systems where they can continue to pose risks to individuals (Malinowski et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In this study, the concurrent contamination of FLAs and \u003cem\u003eL. pneumophila\u003c/em\u003e was evaluated in different water sources in Birjand hospitals. The data obtained in our study can help to focus on the widespread distribution of \u003cem\u003eAcanthamoeba\u003c/em\u003e and \u003cem\u003eLegionella\u003c/em\u003e spp. and their close interaction and long survival. Nevertheless, further studies may be required to identify whether FLAs management programs help reduce the \u003cem\u003eLegionella\u003c/em\u003e-associated risk.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe prevalence of \u003cem\u003eLegionella\u003c/em\u003e-associated FLAs indicates that traditional monitoring methods may be insufficient for \u003cem\u003eLegionella\u003c/em\u003e spp. control. Our result revealed a contamination rate of 29.6 % \u0026nbsp;and 6.25% for \u003cem\u003eAcantamoeba\u003c/em\u003e,\u003cem\u003e\u0026nbsp;L. pneumophila\u0026nbsp;\u003c/em\u003erespectively in hospital water samples. co-occurance contamination of \u003cem\u003eAcanthamoeba\u003c/em\u003e and \u003cem\u003eL. pneumophila\u003c/em\u003e was found in hospital water samples, which the highest rates were found in the Surgical ward of hospitals.In the present study, the contamination of hospital water resources indicates that more attention should be paid to the diagnosis of Legionnaires\u0026apos; disease in patients using accurate laboratory tests in addition to clinical symptoms. Co-occurrence of\u003cem\u003e\u0026nbsp;Acanthamoeba\u003c/em\u003e and \u003cem\u003eL. pneumophila\u003c/em\u003e in hospital environment\u003cem\u003e\u0026nbsp;\u003c/em\u003e can be an important risk factor for patients.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical considerations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe necessary approval was obtained from the ethics committee. The results of the study were made available to the research subjects and the authorities of the research areas. All material and intellectual rights of the university have been considered in presenting the results of the research project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study is the result of a Mohammad Naseri thesis from the Birjand University of Medical Sciences and Health Services, with the code of ethics IR.BUMS.REC.1402.014 The authors would like to acknowledge\u0026nbsp;the esteemed Vice Chancellor for Research and Technology of Birjand University of Medical Sciences and the Faculty of Medicine as financial sponsors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll generated data from the current study are included in the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed consent\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInformed consent was obtained from all subjects and/or their legal guardian(s). All authors declared that they have seen and approved the submitted version of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Vice Chancellor for Research and Technology of Birjand University of Medical Sciences, Birjand, Iran (Grant number 456924).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eABDEL-NOUR, M., DUNCAN, C., LOW, D. E. \u0026amp; GUYARD, C. 2013. Biofilms: the stronghold of Legionella pneumophila. \u003cem\u003eInt J Mol Sci,\u003c/em\u003e 14\u003cstrong\u003e,\u003c/strong\u003e 21660-75.\u003c/li\u003e\n \u003cli\u003eALIREZA, M., ABDOLHOSSEIN, D., FATEMEH, G., MAJID, A. \u0026amp; MAJID, P. 2023. Genotyping of Acanthamoeba Isolated from Hospital Environments and Thermal Water of Recreational Baths in Markazi Province, Iran. \u003cem\u003eIranian Journal of Parasitology,\u003c/em\u003e 18.\u003c/li\u003e\n \u003cli\u003eALSAM, S., KIM, K. S., STINS, M., RIVAS, A. O., SISSONS, J. \u0026amp; KHAN, N. A. 2003. Acanthamoeba interactions with human brain microvascular endothelial cells. \u003cem\u003eMicrob Pathog,\u003c/em\u003e 35\u003cstrong\u003e,\u003c/strong\u003e 235-41.\u003c/li\u003e\n \u003cli\u003eBAGGIANI, A., CASINI, B., TOTARO, M., AQUINO, F., VALENTINI, P., BRUNI, B., PORRETTA, A., CASALINI, F., MICCOLI, M. \u0026amp; PRIVITERA, G. 2015. Colonization by Legionella spp. of water networks in residential buildings of the Province of Pisa, Italy. \u003cem\u003eAnn Ig,\u003c/em\u003e 27\u003cstrong\u003e,\u003c/strong\u003e 718-25.\u003c/li\u003e\n \u003cli\u003eBALCZUN, C. \u0026amp; SCHEID, P. L. 2017. Free-Living Amoebae as Hosts for and Vectors of Intracellular Microorganisms with Public Health Significance. \u003cem\u003eViruses,\u003c/em\u003e 9.\u003c/li\u003e\n \u003cli\u003eBARBOSA, A., AZEVEDO, N. F., GOERES, D. M. \u0026amp; CERQUEIRA, L. 2024. Ecology of Legionella pneumophila biofilms: The link between transcriptional activity and the biphasic cycle. \u003cem\u003eBiofilm,\u003c/em\u003e 7\u003cstrong\u003e,\u003c/strong\u003e 100196.\u003c/li\u003e\n \u003cli\u003eBEHNIAFAR, H. 2016. Morphological and Molecular Identification of Acanthamoeba spp from Surface Waters in Birjand, Iran, During 2014-2015. \u003cem\u003eArchives of Hygiene Sciences\u003c/em\u003e.\u003c/li\u003e\n \u003cli\u003eBEHRAVAN, M., BEHNIAFAR, H., EINIPOUR, S., DORANI, N. \u0026amp; NAGHIZADEH, A. 2016. Morphological and Molecular Identification of Acanthamoeba Spp from Surface Waters in Birjand, Iran, During 2014-2015. \u003cem\u003eArchives of Hygiene Sciences,\u003c/em\u003e 5\u003cstrong\u003e,\u003c/strong\u003e 117-122.\u003c/li\u003e\n \u003cli\u003eBERTOLINO, G., MARRAS, L., SANNA, C., CARRUCCIU, G., SCHINTU, M. \u0026amp; CORONEO, V. 2020a. Ten-Year Retrospective Analysis of Legionella Diffusion in Hospital Water Systems and Its Serogroup Seasonal Variation. \u003cem\u003eIn:\u003c/em\u003e DONELLI, G. (ed.) \u003cem\u003eAdvances in Microbiology, Infectious Diseases and Public Health: Volume 14.\u003c/em\u003e Cham: Springer International Publishing.\u003c/li\u003e\n \u003cli\u003eBERTOLINO, G., MARRAS, L., SANNA, C., CARRUCCIU, G., SCHINTU, M. \u0026amp; CORONEO, V. 2020b. Ten-Year Retrospective Analysis of Legionella Diffusion in Hospital Water Systems and Its Serogroup Seasonal Variation. \u003cem\u003eAdv Exp Med Biol,\u003c/em\u003e 1282\u003cstrong\u003e,\u003c/strong\u003e 93-103.\u003c/li\u003e\n \u003cli\u003eBOOTON, G. C., KELLY, D. J., CHU, Y. W., SEAL, D. V., HOUANG, E., LAM, D. S., BYERS, T. J. \u0026amp; FUERST, P. A. 2002. 18S ribosomal DNA typing and tracking of Acanthamoeba species isolates from corneal scrape specimens, contact lenses, lens cases, and home water supplies of Acanthamoeba keratitis patients in Hong Kong. \u003cem\u003eJ Clin Microbiol,\u003c/em\u003e 40\u003cstrong\u003e,\u003c/strong\u003e 1621-5.\u003c/li\u003e\n \u003cli\u003eBREIMAN, R. F., FIELDS, B. S., SANDEN, G. N., VOLMER, L., MEIER, A. \u0026amp; SPIKA, J. S. 1990. Association of shower use with Legionnaires\u0026apos; disease. Possible role of amoebae. \u003cem\u003eJama,\u003c/em\u003e 263\u003cstrong\u003e,\u003c/strong\u003e 2924-6.\u003c/li\u003e\n \u003cli\u003eBRUNKARD, J. M., AILES, E., ROBERTS, V. A., HILL, V., HILBORN, E. D., CRAUN, G. F., RAJASINGHAM, A., KAHLER, A., GARRISON, L., HICKS, L., CARPENTER, J., WADE, T. J., BEACH, M. J. \u0026amp; YODER MSW, J. S. 2011. Surveillance for waterborne disease outbreaks associated with drinking water---United States, 2007--2008. \u003cem\u003eMMWR Surveill Summ,\u003c/em\u003e 60\u003cstrong\u003e,\u003c/strong\u003e 38-68.\u003c/li\u003e\n \u003cli\u003eCASINI, B., BAGGIANI, A., TOTARO, M., MANSI, A., COSTA, A. L., AQUINO, F., MICCOLI, M., VALENTINI, P., BRUSCHI, F., LOPALCO, P. L. \u0026amp; PRIVITERA, G. 2018. Detection of viable but non-culturable legionella in hospital water network following monochloramine disinfection. \u003cem\u003eJ Hosp Infect,\u003c/em\u003e 98\u003cstrong\u003e,\u003c/strong\u003e 46-52.\u003c/li\u003e\n \u003cli\u003eCERVERO-ARAG\u0026oacute;, S., RODR\u0026iacute;GUEZ-MART\u0026iacute;NEZ, S., PUERTAS-BENNASAR, A. \u0026amp; ARAUJO, R. M. 2015. Effect of Common Drinking Water Disinfectants, Chlorine and Heat, on Free Legionella and Amoebae-Associated Legionella. \u003cem\u003ePLoS One,\u003c/em\u003e 10\u003cstrong\u003e,\u003c/strong\u003e e0134726.\u003c/li\u003e\n \u003cli\u003eCHAUHAN, D. \u0026amp; SHAMES, S. R. 2021. Pathogenicity and Virulence of Legionella: Intracellular replication and host response. \u003cem\u003eVirulence,\u003c/em\u003e 12\u003cstrong\u003e,\u003c/strong\u003e 1122-1144.\u003c/li\u003e\n \u003cli\u003eCOSTA, A. O., CASTRO, E. A., FERREIRA, G. A., FURST, C., CROZETA, M. A. \u0026amp; THOMAZ-SOCCOL, V. 2010. Characterization of acanthamoeba isolates from dust of a public hospital in Curitiba, Paran\u0026aacute;, Brazil. \u003cem\u003eJ Eukaryot Microbiol,\u003c/em\u003e 57\u003cstrong\u003e,\u003c/strong\u003e 70-5.\u003c/li\u003e\n \u003cli\u003eDE JONCKHEERE, J. F. 1979. Pathogenic free-living amoebae in swimming pools: survey in Belgium. \u003cem\u003eAnn Microbiol (Paris),\u003c/em\u003e 130b\u003cstrong\u003e,\u003c/strong\u003e 205-12.\u003c/li\u003e\n \u003cli\u003eDECKER, B. K. \u0026amp; PALMORE, T. N. 2014. Hospital water and opportunities for infection prevention. \u003cem\u003eCurr Infect Dis Rep,\u003c/em\u003e 16\u003cstrong\u003e,\u003c/strong\u003e 432.\u003c/li\u003e\n \u003cli\u003eDENONCOURT, A. M., PAQUET, V. E. \u0026amp; CHARETTE, S. J. 2014. Potential role of bacteria packaging by protozoa in the persistence and transmission of pathogenic bacteria. \u003cem\u003eFront Microbiol,\u003c/em\u003e 5\u003cstrong\u003e,\u003c/strong\u003e 240.\u003c/li\u003e\n \u003cli\u003eFAN, S., SHEN, Y. \u0026amp; QIAN, L. 2024. Social life of free-living amoebae in aquatic environment\u0026mdash; comprehensive insights into interactions of free-living amoebae with neighboring microorganisms. \u003cem\u003eFrontiers in Microbiology,\u003c/em\u003e 15.\u003c/li\u003e\n \u003cli\u003eGUILLOT, E. \u0026amp; LORET, J.-F. 2009. Waterborne Pathogens: Comprehensive Review for the Drinking Water Industry. IWA Publishing.\u003c/li\u003e\n \u003cli\u003eHOFFMANN, R. \u0026amp; MICHEL, R. 2001. Distribution of free-living amoebae (FLA) during preparation and supply of drinking water. \u003cem\u003eInt J Hyg Environ Health,\u003c/em\u003e 203\u003cstrong\u003e,\u003c/strong\u003e 215-9.\u003c/li\u003e\n \u003cli\u003eHUANG, S.-W., HSU, B.-M., CHEN, N.-H., HUANG, C.-C., HUANG, K.-H., CHEN, J.-S. \u0026amp; KAO, P.-M. 2011. Isolation and identification of Legionella and their host amoebae from weak alkaline carbonate spring water using a culture method combined with PCR. \u003cem\u003eParasitology Research,\u003c/em\u003e 109\u003cstrong\u003e,\u003c/strong\u003e 1233-1241.\u003c/li\u003e\n \u003cli\u003eKANAREK, P., BOGIEL, T. \u0026amp; BREZA-BORUTA, B. 2022. Legionellosis risk\u0026mdash;an overview of Legionella spp. habitats in Europe. \u003cem\u003eEnvironmental Science and Pollution Research,\u003c/em\u003e 29\u003cstrong\u003e,\u003c/strong\u003e 76532-76542.\u003c/li\u003e\n \u003cli\u003eKARIMI, A., KHEIRANDISH, F., JAVADI MAMAGHANI, A., TAGHIPOUR, N., MOUSAVI, S. F., AGHAJANI, A., ZEBARDAST, N., FARAJI, M. \u0026amp; FALLAHI, S. 2023. Identification and genotyping of Acanthamoeba spp. in the water resources of western Iran. \u003cem\u003eParasite Epidemiology and Control,\u003c/em\u003e 22\u003cstrong\u003e,\u003c/strong\u003e e00308.\u003c/li\u003e\n \u003cli\u003eKRUSE, E. B., WEHNER, A. \u0026amp; WISPLINGHOFF, H. 2016. Prevalence and distribution of Legionella spp in potable water systems in Germany, risk factors associated with contamination, and effectiveness of thermal disinfection. \u003cem\u003eAm J Infect Control,\u003c/em\u003e 44\u003cstrong\u003e,\u003c/strong\u003e 470-4.\u003c/li\u003e\n \u003cli\u003eLASJERDI, Z., NIYYATI, M., HAGHIGHI, A., SHAHABI, S., BIDEROUNI, F. T., TAGHIPOUR, N., EFTEKHAR, M. \u0026amp; NAZEMALHOSSEINI MOJARAD, E. 2011. Potentially pathogenic free-living amoebae isolated from hospital wards with immunodeficient patients in Tehran, Iran. \u003cem\u003eParasitol Res,\u003c/em\u003e 109\u003cstrong\u003e,\u003c/strong\u003e 575-80.\u003c/li\u003e\n \u003cli\u003eLATIFI, A., SALAMI, M., KAZEMIRAD, E. \u0026amp; SOLEIMANI, M. 2020. Isolation and identification of free-living amoeba from the hot springs and beaches of the Caspian Sea. \u003cem\u003eParasite Epidemiology and Control,\u003c/em\u003e 10\u003cstrong\u003e,\u003c/strong\u003e e00151.\u003c/li\u003e\n \u003cli\u003eLAU, H. Y. \u0026amp; ASHBOLT, N. J. 2009a. The role of biofilms and protozoa in Legionella pathogenesis: implications for drinking water. \u003cem\u003eJournal of Applied Microbiology,\u003c/em\u003e 107\u003cstrong\u003e,\u003c/strong\u003e 368-378.\u003c/li\u003e\n \u003cli\u003eLAU, H. Y. \u0026amp; ASHBOLT, N. J. 2009b. The role of biofilms and protozoa in Legionella pathogenesis: implications for drinking water. \u003cem\u003eJ Appl Microbiol,\u003c/em\u003e 107\u003cstrong\u003e,\u003c/strong\u003e 368-78.\u003c/li\u003e\n \u003cli\u003eLORENZO-MORALES, J., KHAN, N. A. \u0026amp; WALOCHNIK, J. 2015. An update on Acanthamoeba keratitis: diagnosis, pathogenesis and treatment. \u003cem\u003eParasite,\u003c/em\u003e 22\u003cstrong\u003e,\u003c/strong\u003e 10.\u003c/li\u003e\n \u003cli\u003eMACIVER, S. K., ASIF, M., SIMMEN, M. W. \u0026amp; LORENZO-MORALES, J. 2013. A systematic analysis of Acanthamoeba genotype frequency correlated with source and pathogenicity: T4 is confirmed as a pathogen-rich genotype. \u003cem\u003eEur J Protistol,\u003c/em\u003e 49\u003cstrong\u003e,\u003c/strong\u003e 217-21.\u003c/li\u003e\n \u003cli\u003eMAHMOUDI, M. R., RAHMATI, B., SEYEDPOUR, S. H. \u0026amp; KARANIS, P. 2015. Occurrence and molecular characterization of free-living amoeba species (Acanthamoeba, Hartmannella, and Saccamoeba limax) in various surface water resources of Iran. \u003cem\u003eParasitol Res,\u003c/em\u003e 114\u003cstrong\u003e,\u003c/strong\u003e 4669-74.\u003c/li\u003e\n \u003cli\u003eMALINOWSKI, N., DOMINGOS, S., WYLIE, J., MORGAN, M. J., METCALFE, S., WALSH, T., AHMED, W., KAKSONEN, A. H. \u0026amp; PUZON, G. J. 2022. Free-Living Amoeba and Associated Pathogenic Bacteria in Well-Chlorinated Drinking Water Storage Tanks. \u003cem\u003eACS ES\u0026amp;T Water,\u003c/em\u003e 2\u003cstrong\u003e,\u003c/strong\u003e 1511-1520.\u003c/li\u003e\n \u003cli\u003eMARGOT, C., RHOADS, W., GABRIELLI, M., OLIVE, M. \u0026amp; HAMMES, F. 2024. Dynamics of drinking water biofilm formation associated with Legionella spp. colonization. \u003cem\u003enpj Biofilms and Microbiomes,\u003c/em\u003e 10\u003cstrong\u003e,\u003c/strong\u003e 101.\u003c/li\u003e\n \u003cli\u003eMOORE, M. R., PRYOR, M., FIELDS, B., LUCAS, C., PHELAN, M. \u0026amp; BESSER, R. E. 2006. Introduction of monochloramine into a municipal water system: impact on colonization of buildings by Legionella spp. \u003cem\u003eAppl Environ Microbiol,\u003c/em\u003e 72\u003cstrong\u003e,\u003c/strong\u003e 378-83.\u003c/li\u003e\n \u003cli\u003eNACAPUNCHAI, D., KINO, H., RUANGSITTICHA, C., SRIWICHAI, P., ISHIH, A. \u0026amp; TERADA, M. 2001. A brief survey of free-living amebae in Thailand and Hamamatsu District, Japan. \u003cem\u003eSoutheast Asian J Trop Med Public Health,\u003c/em\u003e 32 Suppl 2\u003cstrong\u003e,\u003c/strong\u003e 179-82.\u003c/li\u003e\n \u003cli\u003eNISAR, M. A., ROS, K. E., BROWN, M. H., BENTHAM, R., BEST, G., XI, J., HINDS, J. \u0026amp; WHILEY, H. 2023. Stagnation arising through intermittent usage is associated with increased viable but non culturable Legionella and amoeba hosts in a hospital water system. \u003cem\u003eFrontiers in Cellular and Infection Microbiology,\u003c/em\u003e 13.\u003c/li\u003e\n \u003cli\u003eNISAR, M. A., ROSS, K. E., BROWN, M. H., BENTHAM, R. \u0026amp; WHILEY, H. 2020. Legionella pneumophila and Protozoan Hosts: Implications for the Control of Hospital and Potable Water Systems. \u003cem\u003ePathogens,\u003c/em\u003e 9.\u003c/li\u003e\n \u003cli\u003eNOROUZI, M., NIYYATI, M. \u0026amp; BEHNIAFAR, H. 2022. Microbial Biofilms as a Risk Factor for Acantahmoeba keratitis. \u003cem\u003eNovelty in Biomedicine,\u003c/em\u003e 10\u003cstrong\u003e,\u003c/strong\u003e 37-42.\u003c/li\u003e\n \u003cli\u003ePERKINS, K. M., REDDY, S. C., FAGAN, R., ARDUINO, M. J. \u0026amp; PERZ, J. F. 2019. Investigation of healthcare infection risks from water-related organisms: Summary of CDC consultations, 2014-2017. \u003cem\u003eInfect Control Hosp Epidemiol,\u003c/em\u003e 40\u003cstrong\u003e,\u003c/strong\u003e 621-626.\u003c/li\u003e\n \u003cli\u003eRAM\u0026iacute;REZ-CASTILLO, F. Y., LOERA-MURO, A., JACQUES, M., GARNEAU, P., AVELAR-GONZ\u0026aacute;LEZ, F. J., HAREL, J. \u0026amp; GUERRERO-BARRERA, A. L. 2015. Waterborne pathogens: detection methods and challenges. \u003cem\u003ePathogens,\u003c/em\u003e 4\u003cstrong\u003e,\u003c/strong\u003e 307-34.\u003c/li\u003e\n \u003cli\u003eREYES-BATLLE, M., D\u0026iacute;AZ, F. J., SIFAOUI, I., RODR\u0026iacute;GUEZ-EXP\u0026oacute;SITO, R., RIZO-LIENDO, A., PI\u0026ntilde;ERO, J. E. \u0026amp; LORENZO-MORALES, J. 2021. Free living amoebae isolation in irrigation waters and soils of an insular arid agroecosystem. \u003cem\u003eScience of The Total Environment,\u003c/em\u003e 753\u003cstrong\u003e,\u003c/strong\u003e 141833.\u003c/li\u003e\n \u003cli\u003eRODR\u0026iacute;GUEZ-ZARAGOZA, S. 1994. Ecology of free-living amoebae. \u003cem\u003eCrit Rev Microbiol,\u003c/em\u003e 20\u003cstrong\u003e,\u003c/strong\u003e 225-41.\u003c/li\u003e\n \u003cli\u003eROHR, U., WEBER, S., MICHEL, R., SELENKA, F. \u0026amp; WILHELM, M. 1998. Comparison of free-living amoebae in hot water systems of hospitals with isolates from moist sanitary areas by identifying genera and determining temperature tolerance. \u003cem\u003eAppl Environ Microbiol,\u003c/em\u003e 64\u003cstrong\u003e,\u003c/strong\u003e 1822-4.\u003c/li\u003e\n \u003cli\u003eSCHEID, P. 2018. Free-Living Amoebae as Human Parasites and Hosts for Pathogenic Microorganisms. \u003cem\u003eProceedings\u0026nbsp;\u003c/em\u003e[Online], 2.\u003c/li\u003e\n \u003cli\u003eSCHEIKL, U., SOMMER, R., KIRSCHNER, A., RAMEDER, A., SCHRAMMEL, B., ZWEIMULLER, I., WESNER, W., HINKER, M. \u0026amp; WALOCHNIK, J. 2014a. Free-living amoebae (FLA) co-occurring with legionellae in industrial waters. \u003cem\u003eEur J Protistol,\u003c/em\u003e 50\u003cstrong\u003e,\u003c/strong\u003e 422-9.\u003c/li\u003e\n \u003cli\u003eSCHEIKL, U., SOMMER, R., KIRSCHNER, A., RAMEDER, A., SCHRAMMEL, B., ZWEIMULLER, I., WESNER, W., HINKER, M. \u0026amp; WALOCHNIK, J. 2014b. Free-living amoebae (FLA) co-occurring with legionellae in industrial waters. \u003cem\u003eEuropean Journal of Protistology,\u003c/em\u003e 50\u003cstrong\u003e,\u003c/strong\u003e 422-429.\u003c/li\u003e\n \u003cli\u003eSHARMA, R., JHANJI, V., SATPATHY, G., SHARMA, N., KHOKHAR, S. \u0026amp; AGARWAL, T. 2013. Coinfection with Acanthamoeba and Pseudomonas in contact lens-associated keratitis. \u003cem\u003eOptom Vis Sci,\u003c/em\u003e 90\u003cstrong\u003e,\u003c/strong\u003e e53-5.\u003c/li\u003e\n \u003cli\u003eSHI, Y., QUELLER, D. C., TIAN, Y., ZHANG, S., YAN, Q., HE, Z., HE, Z., WU, C., WANG, C. \u0026amp; SHU, L. 2021. The Ecology and Evolution of Amoeba-Bacterium Interactions. \u003cem\u003eAppl Environ Microbiol,\u003c/em\u003e 87.\u003c/li\u003e\n \u003cli\u003eSTEINERT, M., OCKERT, G., LUCK, C. \u0026amp; HACKER, J. 1998. Regrowth of Legionella pneumophila in a heat-disinfected plumbing system. \u003cem\u003eZentralblatt f\u0026uuml;r Bakteriologie,\u003c/em\u003e 288\u003cstrong\u003e,\u003c/strong\u003e 331-342.\u003c/li\u003e\n \u003cli\u003eSTOJEK, N. M. \u0026amp; DUTKIEWICZ, J. 2011. Co-existence of Legionella and other Gram-negative bacteria in potable water from various rural and urban sources. \u003cem\u003eAnn Agric Environ Med,\u003c/em\u003e 18\u003cstrong\u003e,\u003c/strong\u003e 330-4.\u003c/li\u003e\n \u003cli\u003eTAHER, E. E., MEABED, E. M. H., ABDALLAH, I. \u0026amp; ABDEL WAHED, W. Y. 2018. Acanthamoeba keratitis in noncompliant soft contact lenses users: Genotyping and risk factors, a study from Cairo, Egypt. \u003cem\u003eJ Infect Public Health,\u003c/em\u003e 11\u003cstrong\u003e,\u003c/strong\u003e 377-383.\u003c/li\u003e\n \u003cli\u003eTOTARO, M., VALENTINI, P., COSTA, A. L., FRENDO, L., CAPPELLO, A., CASINI, B., MICCOLI, M., PRIVITERA, G. \u0026amp; BAGGIANI, A. 2017. Presence of Legionella spp. in Hot Water Networks of Different Italian Residential Buildings: A Three-Year Survey. \u003cem\u003eInt J Environ Res Public Health,\u003c/em\u003e 14.\u003c/li\u003e\n \u003cli\u003eUZEL, A., UCAR, F. \u0026amp; HAMEŞ-KOCABAŞ, E. E. 2005. Prevalence of Legionella pneumophila serogroup 1 in water distribution systems in Izmir province of Turkey. \u003cem\u003eApmis,\u003c/em\u003e 113\u003cstrong\u003e,\u003c/strong\u003e 664-9.\u003c/li\u003e\n \u003cli\u003eVALCIŅA, O., PŪLE, D., MALI\u0026Scaron;EVS, A., TROFIMOVA, J., MAKAROVA, S., KONVISERS, G., BĒRZIŅ\u0026Scaron;, A. \u0026amp; KRŪMIŅA, A. 2019. Co-Occurrence of Free-Living Amoeba and Legionella in Drinking Water Supply Systems. \u003cem\u003eMedicina (Kaunas),\u003c/em\u003e 55.\u003c/li\u003e\n \u003cli\u003eVAN KENHOVE, E., DINNE, K., JANSSENS, A. \u0026amp; LAVERGE, J. 2019. Overview and comparison of Legionella regulations worldwide. \u003cem\u003eAm J Infect Control,\u003c/em\u003e 47\u003cstrong\u003e,\u003c/strong\u003e 968-978.\u003c/li\u003e\n \u003cli\u003eWANG, Y., JIANG, L., ZHAO, Y., JU, X., WANG, L., JIN, L., FINE, R. D. \u0026amp; LI, M. 2023. Biological characteristics and pathogenicity of Acanthamoeba. \u003cem\u003eFront Microbiol,\u003c/em\u003e 14\u003cstrong\u003e,\u003c/strong\u003e 1147077.\u003c/li\u003e\n \u003cli\u003eWILSON, D. A., YEN-LIEBERMAN, B., REISCHL, U., GORDON, S. M. \u0026amp; PROCOP, G. W. 2003. Detection of Legionella pneumophila by real-time PCR for the mip gene. \u003cem\u003eJ Clin Microbiol,\u003c/em\u003e 41\u003cstrong\u003e,\u003c/strong\u003e 3327-30.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ePrevalence of \u003cem\u003eAcanthamoeba\u003c/em\u003e at the selected Sites\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"618\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSources\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNO. of Positive\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;plates\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrevalence (%)\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof acanthamoeba\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" valign=\"top\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eHospitals*\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHospital 1\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e35.5%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\" valign=\"top\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e0.1\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHospital 2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e23.3%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHospital 3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e30%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal: 80\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"4\" valign=\"top\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eHospital wards\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eICU\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e26.4%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" valign=\"top\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e0.1\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eSurgery room\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e21.4%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eSurgical ward\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e39.1%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eWater storage tanks\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e31.7%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp dir=\"RTL\"\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e: 80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e*Hospital\u003c/strong\u003e: Razi, Hospital2: Vali Asr, Hospital3: Emam Reza\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. The frequency distribution of \u003cem\u003eL. pneumophila\u003c/em\u003e -positive cases in water samples and different wards of hospitals\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"636\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSources\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive plates\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrevalence (%)\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eL. pneumophila\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eHospitals*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHospital 1\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.2%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHospital 2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.2%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHospital 3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.1%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Total: 5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eHospital wards\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eICU\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e(1.4%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSurgery room\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e(1.4%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSurgical ward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e(2.8%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eWater storage tanks\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e(1.4%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal: 5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e*Hospital:\u003c/strong\u003e Razi, Hospital2: Vali Asr, Hospital3: Emam Reza\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3. Investigation of concurrent contamination of FLA and \u003cem\u003eL. pneumophila\u003c/em\u003e at the hospitals and different hospital wards\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eContamination area\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eContamination type\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePositive culture plates (%)\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof \u003cem\u003eAcanthamoeba\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003ePositive plates of \u003cem\u003eL. pneumophila\u003c/em\u003e with FLA\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"6\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eHospitals*\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHospital 1\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e32 (8.11%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.001\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e58 (5.21%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHospital 2\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e21 (8.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e69 (5.25%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eHospital 3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e27 (10%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.004\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e63 (3.23%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"8\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eWard\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eICU\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e18 (6.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.57\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e50 (18.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSurgery room\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15 (5.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.18\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55 (20.4%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSurgical ward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e27 (10%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.002\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e42 (15.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eWater storage tanks\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePositive\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e20 (4.7%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNegative\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e43 (15.9%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e: 270\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e: 10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e*Hospital\u003c/strong\u003e: Razi, Hospital2: Vali Asr, Hospital3: Emam Reza\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Acanthamoeba, Legionella pneumophila, Iran","lastPublishedDoi":"10.21203/rs.3.rs-6205801/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6205801/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eFree-living amoebae (FLAs) are widely prevalent protozoa found in various natural and man-made environments. In Iran, there have been few studies examining the contamination of hospital environments with FLAs and \u003cem\u003eLegionella\u003c/em\u003e spp., and none have explored the coexistence of these two organisms. Thus, this study aims to investigate the contamination of FLAs and \u003cem\u003eLegionella\u003c/em\u003e spp. in the water resources of hospitals in Birjand city. Water samples were collected from water sources in different hospital departments of Birjand city, were transferred to the laboratory. One litre of each sample passed through the nitrocellulose membrane filter. Samples were taken from the water taps of different departments and storage tanks positive samples were analyzed by morphological keys and Polymerase chain reaction (PCR) using 18S rDNA gene and ITS region to identify \u003cem\u003eamoeba\u003c/em\u003e isolates. The possible contamination of the samples with \u003cem\u003eLegionella\u003c/em\u003e spp. was examined through cultures and molecular tests. Overall, 80 out of 270 samples from hospital water sources were positive for contamination with FLAs by the culture method. \u003cem\u003eAcanthamoeba\u003c/em\u003e was isolated in all 80 samples that were positive for \u003cem\u003eAcanthamoeba\u003c/em\u003e. Among the 80 samples in which the \u003cem\u003eAcanthamoeba\u003c/em\u003e parasite grown in the culture, 64 \u003cem\u003eAcanthamoeba\u003c/em\u003e isolates were also positive with molecular tests. All sequenced samples of \u003cem\u003eAcanthamoeba\u003c/em\u003e were reported as T4 genotype. Furthermore, 5/270 examined samples were positive for \u003cem\u003eL. pneumophila\u003c/em\u003e contamination. All cases of \u003cem\u003eL. pneumophila\u003c/em\u003e infection were reported in samples infected with \u003cem\u003eAcantamoeba\u003c/em\u003e. A significant difference was observed between the concurrent contamination of \u003cem\u003eAcantamoeba\u003c/em\u003e and \u003cem\u003eL. pneumophila\u003c/em\u003e in Razi (P\u003csub\u003evalue\u003c/sub\u003e=001) and Imam Reza hospitals (P\u003csub\u003evalue\u003c/sub\u003e= 004) as well as surgical wards (P\u003csub\u003evalue\u003c/sub\u003e= 0002) and water tanks (P\u003csub\u003evalue\u003c/sub\u003e= 0.01) at Birjand hospitals. This study aimed to examine the co-occurrence of \u003cem\u003eLegionella\u003c/em\u003e spp. and free-living amoebae (FLAs) as the most important water-related pathogens, in hospital water systems to better understand their interactions and the potential consequents for public health, which can lead to both outbreaks and sporadic cases.\u003c/p\u003e","manuscriptTitle":"Concurrent contamination of Free-Living Amoebae and Legionella pneumophila in water resources of hospitals, A microscopic and molecular analysis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-02 09:21:23","doi":"10.21203/rs.3.rs-6205801/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"492ca331-e52c-45a3-8507-57684e83d160","owner":[],"postedDate":"April 2nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-04-21T08:53:36+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-02 09:21:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6205801","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6205801","identity":"rs-6205801","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}