Trimethylamine N-Oxide dysregulates the expression of tight junctions through Highly Upregulated Liver Carcinoma (HULC) in cellular model of colorectal cancer.

preprint OA: closed
Full text JSON View at publisher
Full text 92,640 characters · extracted from preprint-html · click to expand
Trimethylamine N-Oxide dysregulates the expression of tight junctions through Highly Upregulated Liver Carcinoma (HULC) in cellular model of colorectal cancer. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Trimethylamine N-Oxide dysregulates the expression of tight junctions through Highly Upregulated Liver Carcinoma (HULC) in cellular model of colorectal cancer. Sonya Najafpour, Mohammad Moradzad, Karim Rahimi, Zahra Alighardashi, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5855488/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Backgrounds and Aim: Colorectal cancer (CRC) pathogenesis is correlated with dysregulation of tight junction. This study aimed to investigate the molecular mechanism by which trimethylamine N-oxide (TMAO) alters the expression of tight junction proteins in a colorectal cancer (CRC) cell line. Material and Method: The study utilized the CRISPR/Cas13 system for targeted knock down of HULC in Caco-2 cells, followed by treatment with trimethylamine N-Oxide (TMAO). Tight junction components, including ZO-1, Claudin-1, and Occludin, were analyzed using real-time quantitative polymerase chain reaction (RT-qPCR). To investigate the role of the P38MAPK pathway, the specific inhibitor SB203580 was used in cells treated with TMAO to comprehensively assess tight junction regulation. Statistical analysis was performed using one-way ANOVA to compare the mean ± SD between different groups, followed by paired comparisons using the t-test. Results: Cells treated with TMAO showed a significant upregulation of the oncogenic long non-coding RNA (lncRNA) HULC (Highly Upregulated in Liver Cancer), , accompanied by increased expression of p38 MAPK. Interestingly, a significant downregulation of ZO-1 and Claudin-1 was observed as a result of TMAO treatment, which was modulated by the HULC/p38 MAPK axis. However, Occludin expression was also reduced by TMAO, but it remained unaffected by the HULC/p38 MAPK pathway. Conclusion: This study revealed a novel TMAO/HULC/p38 MAPK axis involved in the regulation of tight junctions in a colorectal cancer cell line model. TMAO treatment significantly reduced the expression of ZO-1, Claudin-1, and Occludin. Further in vivo research is strongly recommended to clarify the impact of TMAO on the integrity of colorectal cancer cells. Colorectal cancer tight junction proteins HULC TMAO P38MAPK Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Colorectal cancer, which includes both colon and rectal cancers, poses a major global health challenge and is one of the leading causes of cancer-related morbidity and mortality. Colon cancer specifically develops from the uncontrolled growth of cells in the colon, results in the formation of malignant tumors. Its etiology is multifactorial, involving genetic, environmental, and lifestyle influences. Despite advancements in diagnosis and treatment, the exact molecular mechanisms underlying colon cancer progression remain to be further investigated. The hallmark of colon cancer is the disruption of normal cellular processes, resulting in abnormal signaling pathways, genomic instability, and altered gene expression. Among the numerous molecules involved in the molecular landscape of colon cancer, long non-coding RNAs (lncRNAs) have emerged as key regulators. These non-coding transcripts, once considered to be transcriptional noise, are now recognized for their critical regulatory roles in diverse cellular processes, including proliferation, apoptosis, and metastasis. Additionally, Zhu et al. (1) demonstrated that lncRNAs not only influence CRC proliferation, invasion, metastasis, and drug resistance but also have the potential as circulating exosomal biomarkers, such as UCA1. lncRNAs are emphasized for their potential use in non-invasive CRC screening tests and as markers for evaluation of therapeutic efficacy, making them promising targets for the development of advanced diagnostic tools and treatments for colorectal cancer. One of the oncogenic lnc-RNAs is highly upregulated liver cancer (HULC) which is overexpressed in several cancers (2). While numerous studies have investigated the role of HULC in liver cancer, it has been shown that expression of HULC is associated with poor survival and metastasis in some cancers, including pancreatic cancer, osteosarcoma, gastric cancer, large B‐cell lymphoma, and cervical cancer(3,4). Yang et al observed an elevated HULC levels in human CRC tissues, correlating with poor prognosis. Moreover, they revealed that HULC knockdown hindered CRC cell proliferation, migration, and invasion, while promoting apoptosis in vitro and inhibiting tumorigenicity in vivo(5). Another clinical study indicated that serum level of HULC is increased in patients with CRC and the HULC rs7763881 is also associated with higher risk of CRC, making it a diagnostic marker (6). Trimethylamine N-Oxide (TMAO), a gut-liver metabolite has gained attention for its pro-inflammatory properties in CRC (7). TMAO is associated with the CRC progression via disparate mechanisms such as inflammation, oxidative stress, DNA damage, and protein misfolding (8). In addition, Yang et al demonstrated that TMAO increase angiogenesis and cell proliferation both in vitro and in vivo (9). The p38 mitogen-activated protein kinase (P38MAPK) pathway is a key signaling mechanism through which TMAO induces its effect (10, 11). The activation of P38MAPK regulate the expression of some transcription factors such as NF-κB, which promotes the expression of pro-inflammatory genes and leads to the production of inflammatory molecules such as TNF-α and IL-6(12). It has been shown that HULC gene is a prominent regulator of P38MAPK pathway (13, 14). Dysregulation of tight junction is highly correlated with CRC (15). Claudins are a family of tight junctions which are significantly dysregulated in CRC. While Claudin-1 (CLDN1) and -12 (CLDN12) are reported to be overexpressed in CRC, claudin-8 (CLDN8) is downregulated(16). Moreover, the role of claudin-2 (CLDN2) in colorectal cancer, particularly in patients undergoing chemotherapy for stage II/III colorectal cancer, has been investigated. They observed that elevated level of claudin-2 is correlated with poor outcomes, increased recurrence, and decreased sensitivity to chemotherapy. CLDN2 was found to promote self-renewal in colorectal cancer cells, inhibiting their differentiation and contributing to a stem-like phenotype(17). In colorectal cancer, the Zonula Occludens (ZO) family of proteins, including ZO-1, ZO-2, and ZO-3, play crucial regulatory roles in cell cycle progression and proliferative capacities (18). The expression of ZO-1 at the TJ, results in inhibition of ZONAB nuclear accumulation, and leads to cytoplasmic sequestration and regulates/stimulates the nuclear cdk-4 accumulation, thereby inhibits cell proliferation(19). Occludin, as an integral protein of the TJ, plays a significant role in colorectal cancer (CRC) by contributing to TJ structure and potential signaling pathways. With a larger size than typical claudins, occludin is a 65-kDa membrane protein featuring four transmembrane domains and a long cytoplasmic tail. Investigations have revealed its involvement in apoptotic machinery through mitogen-activated protein kinase and Akt signaling pathways(20, 21). Studies in human CRC tissues consistently demonstrate a down-regulation of occludincompared to normal controls, and this correlates with the grade of the tumor progression (22, 23). Immunohistochemical analysis consistently showed a reduced expression of occludin in CRC specimens, suggesting its potential role as a tumor suppressor gene in CRC development (23). The inverse association of occludin expression /with tumor grade underscores its importance in maintaining TJ integrity and highlights its potential as a biomarker for evaluation of colorectal cancer progression. Overall, tight junction dysregulation is highly associated with CRC metastasis, and this study has the potential to reveal new molecular mechanism of how selected tight junctions (ZO-1, Claudin-1, and Occludin) are affected under TMAO treatment. 2. Material and Methods 2.1. Cell Culture Caco-2, a human colon adenocarcinoma cell line was obtained from Pasteur Institute, Iran. The cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with fetal bovine serum (FBS) at 37°C in a humidified atmosphere containing 5% CO2. Cells were routinely passaged and maintained in culture to ensure exponential growth and viability. The culture medium was replenished every 2-3 days to provide optimal nutrient conditions. Cells were used for experiments at passage 5 to ensure consistent and reproducible results. All cell culture procedures were performed under sterile conditions in a certified biosafety cabinet. 2.2. MTT Assay Cell viability was assessed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Caco-2 cells were seeded in 96-well plates at a density of 5,000 cells per well and allowed to adhere overnight. Following adherence, the cells were treated with trimethylamine N-Oxide (TMAO) at a final concentration of 300 µM and the P38 mitogen-activated protein kinase (P38MAPK) inhibitor SB203580 at 50 µM both for 24 hours. After the treatment period, the culture medium was removed, and cells were incubated with MTT solution (MTT 0.5 mg/mL) for 4 hours at 37°C. Formazan crystals formed by viable cells were solubilized using dimethyl sulfoxide (DMSO), and the absorbance was measured at 570 nm using a Nanodrop spectrophotometer (Synergy HT; BioTek, USA). Untreated cells served as the control, and the percentage of cell viability was calculated by normalizing the absorbance of treated cells to the control. All experiments were performed in triplicate, and results are presented as the mean ± standard deviation. 2.3. LncRNA HULC Knockdown in HepG2 Cells using CRISPR/Cas13 System The CRISPR/Cas13 system was employed to knockdown lncRNA HULC in Caco2 cells. Guide RNAs (gRNAs) were designed using the Breaking-Cas online tool, and subsequently synthesized by Pishgam Company, Iran. The synthesized gRNAs (Table 1) were ligated into the CasRX pre-gRNA cloning backbone (Addgene 109054), which had been previously linearized using the BbsI restriction enzyme (Thermo Fisher Scientific). The inserted gRNAs were confirmed by PCR and Sanger sequencing (Figure 1). Following confirmation, plasmids containing the gRNAs were co-transfected into Caco-2 cells with the pcDNA3 plasmid harboring the Cas13 endonuclease (CasRx) using Lipofectamine LTX (Life Technologies). The success of the transfection process was validated by observing the expression of GFP protein from the pcDNA3 plasmid using a fluorescent microscope (Figure 2). A positive control gRNA targeting ANXA4 (Annexin A4), was employed to ensure the efficacy and specificity of the transfection, while a non-targeting control was included to evaluate transfection-related effects in the absence of specific experimental treatments. 2.4. RNA Extraction, cDNA Synthesis, and RT-qPCR Total RNA isolation from the cells was carried out using the RNA extraction kit (A101231, Parstous, Iran) following the manufacturer’s protocol. The quality and quantity of the obtained RNA were evaluated using a take3 PikoDrop spectrophotometer (Synergy HT; BioTek, USA). For cDNA synthesis, a cDNA synthesis kit (A101161, Parstous, Iran) was employed. In brief, 500 μg of the isolated RNA was combined with the reverse transcription master mix, encompassing a reverse transcriptase enzyme, random primers, and dNTPs. The mixture underwent incubation at 42-55°C for 1 hour. To assess gene expression levels, quantitative real-time polymerase chain reaction (RT-qPCR) was conducted utilizing the (Corrbet Rotor Gene 6000) system and specific primer sets (Table 2) designed for the target genes. 2.5. Statistical Analysis All experiments outlined in the Materials and Methods were performed in triplicate. The normality of data distribution was assessed using the Shapiro-Wilk test. Following this, one-way analysis of variance (ANOVA) was applied to examine overall differences among the experimental groups for each variable. Subsequent post hoc tests, specifically focusing on comparisons with the control group, were conducted. The Tukey's Honestly Significant Difference (HSD) test was selected as the post hoc analysis method. Data visualization was accomplished using GraphPad Prism software (Version 7.0.0). Statistical significance was defined at p < 0.05, and non-significant differences were indicated as "ns." Two-sided p value was considered for all statistical tests. 3. Results 3.1. MTT Assay The MTT assay was conducted to evaluate the impact of Trimethylamine N-Oxide (TMAO) and SB203580 on the viability of Caco-2 cells. No significant alterations in cell viability were observed for both TMAO (98.84±22.01) and SB203580 (110.52±9.06) compared to the control group. (Figure 1). The statistical analysis, utilizing one-way ANOVA followed by Tukey's HSD post hoc test, confirmed the absence of significant differences in cell viability among the experimental groups (p > 0.05). These findings indicate that neither TMAO nor SB203580 exerted a substantial impact on the overall viability of Caco-2 cells under the experimental conditions. 3.2. Verification of HULC Knockdown in Caco-2 Cells To confirm the successful knockdown of HULC in Caco-2 cells, a targeted CRISPR/Cas13 approach was employed. Control groups included a positive control with gRNA targeting Annexin A4 (ANXA4), a gene known for high baseline expression, and a non-targeting control with gRNA that does not target any specific genomic region. RT-qPCR was performed to assess the expression levels of HULC in the different experimental groups. The results demonstrated a significant downregulation of HULC expression in the group transfected with gRNA specifically targeting HULC compared to the control group. In contrast, the ANXA4 group and non-targeting control group exhibited no significant changes in HULC expression, confirming the specificity of the knockdown effect (Figure 2). Furthermore, to ensure the selectivity of the knockdown system, the expression of ANXA4 was evaluated across all experimental groups. Consistent with expectations, a significant downregulation of ANXA4 expression was observed exclusively in the group transfected with gRNA targeting ANXA4. The groups with gRNA for HULC and the non-targeting control demonstrated no significant alterations in ANXA4 expression compared to the control group (Figure 2). These results collectively validate the specificity and efficacy of the HULC knockdown model in Caco-2 cells, highlighting the successful modulation of HULC expression without affecting the expression of unrelated genes, as evidenced by the non-targeting control and ANXA4 group. 3.3. P38MAPK mRNA level is decreased upon HULC inhibition The expression of P38MAPK gene was assessed across eight experimental groups, and the average fold changes are presented (Figure ????). In the group treated with TMAO, a significant increase in P38MAPK expression was observed compared to the control group, indicating a stimulatory effect of TMAO on P38MAPK gene expression. Conversely, in all groups upon the knockdown of HULC, a significant downregulation of P38MAPK expression was observed. This suggests a potential regulatory role of HULC in maintaining normal P38MAPK expression levels. In the group treated with the P38MAPK inhibitor SB203580, a significant downregulation of P38MAPK expression was observed, validating the inhibitory effect of SB203580 on P38MAPK. However, in the combination group with SB203580 and TMAO, no significant change in P38MAPK expression was detected compared to the control. This suggests that the stimulatory effect of TMAO on P38MAPK may counteract the inhibitory impact of SB203580, resulting in a neutralized expression level. 3.4. Tight Junctions gene expression: 3.4.1. ZO-1 and Claudin-1 are regulated by HULC/P38MAPK axis Treatment with TMAO resulted in a marked reduction in ZO-1 expression compared to the control group, suggesting a suppressive effect of TMAO on ZO-1. Conversely, HULC knockdown significantly upregulated ZO-1 expression, indicating a potential regulatory role for HULC in negatively influencing ZO-1. Similarly, Claudin-1 exhibited a parallel expression pattern, with TMAO treatment leading to a significant reduction in Claudin-1 levels compared to the control group. Notably, HULC silencing across multiple groups resulted in significant upregulation of Claudin-1 expression, further emphasizing the regulatory impact of HULC on Claudin-1. Furthermore, the SB203580 induced a significant reduction in both ZO-1 and Claudin-1 expression levels. Intriguingly, the combined treatment group with SB203580 and TMAO exhibited no significant alteration in ZO-1 and Claudin-1 expression compared to the control. This suggests a potential counteractive interplay between TMAO and SB203580, neutralizing their individual effects on ZO-1 and Claudin-1 expression (Figure 4 A and B). Overall, these findings highlight the regulatory influence of the HULC/P38MAPK axis on ZO-1 and Claudin-1, suggesting potential therapeutic targets within the complex molecular landscape of colorectal cancer. The presented data are graphically represented in Figure 4. 3.4.2. Occludin is differentially regulated by TMAO Similar to the observed patterns in ZO-1 and Claudin-1, TMAO treatment reduced the expression of Occludin, except in cells treated with both TMAO and SB203580. Remarkably, HULC knockdown did not lead to significant alterations Occludin levels, contrasting with the distinct upregulation observed in ZO-1 and Claudin-1. Moreover, the administration of SB203580 alone did not significantly change the expression of Occludin (Figure 5). 4. Discussion The dysregulation of tight junction proteins plays a crucial role in the progression of CRC. (24). This study addresses the gap in understanding the role of TMAO in CRC by investigating its impact on tight junction expression, specifically ZO-1, Claudin-1, and Occludin. This study indicated upregulation of HULC, followed by P38MAPK under TMAO treatment. Regardless of regulatory role of HULC downstream targets, its own overexpression should be taken into account since it is highly associated with metastasis of CRC to the liver(25). Moreover, Ding et al showed that HULC importance in predicting CRC metastasis(4). Therefore, it seems that HULC overexpression is extremely associated with metastatic behavior since other studies also delineated its role in breast cancer metastasis by increasing Matrix Metalloproteinase 2 (MMP2) and Matrix Metalloproteinase 9 (MMP9) expression(26), and inhibiting miR-2052 expression in liver cancer(27). What is more, previous studies revealed that HULC overexpression spells increased proliferation and anti-apoptotic properties in CRC(28). Hence, we gave importance to TMAO potential to increase HULC expression which is extremely oncogenic in different cancers. Additionally, we demonstrated P38MAPK expression would be as a new downstream target for HULC. P38MAPK expression was significantly reduced in the HULC(KD) cells, suggesting inhibitory role of HULC on P38MAPK pathway, and this reduction was observed even with the combinate treatment of TMAO and SB203580. These results detonate that HULC has similar potential with SB203580 to inhibit P38MAPK. Moreover, identifying P38MAPK as downstream target of HULC is crucial because previous works demonstrated P38MAPK as a key pathway in CRC, especially in chemotherapy responses(29). Furthermore, other studies explicitly showed that upon P38MAPK overexpression CRC cells experienced elevated metastasis(30, 31), alongside with escalated proliferation(32). Collectively, our findings suggest that the effect of TMAO is induced via lnc-RNA (HULC) which can be followed by P38MAPK in CRC. In order to identify further molecular mechanisms, we pursued the impact of TMAO on downstream targets of HULC/P38MAPK axis. To achieve this end, we observed TMAO- treated cells significantly reduced the expression of ZO-1 and Claudin-1. This finding is consistent with previous studies linking TMAO to tight junction dysregulation(33). Interestingly, TMAO could not decrease ZO-1 and Claudin-1 at mRNA level in HULC(KD) cells, suggesting TMAO affects the expression of tight junctions through HULC. For further confirmation of this effect, P38MAPK inhibitor (SB203580) was used. ZO-1 and Claudin-1 expression was increased in response to treatment of cells with SB203580. This change was reversed when cells were simultaneously treated with both TMAO and SB203580. Hence, it seems that TMAO induces ZO-1 and Claudin-1 downregulation via HULC and P38MAPK overexpression. Downregulation of these tight junctions has been reported for cancer progression in several studies. Immunohistochemical staining depicted ZO-1 downregulation is related to liver metastasis(34). In addition, Ke et al showed that ZO-1 downregulation set off cell proliferation and migration in CRC(35). Furthermore, functional analysis conducted by Chen et al revealed that overexpression of ZO-1 inhibit colorectal cancer stem cells(36). Plus, B Resnick et al in a cohort of TNM stage II colon cancer using tissue microarray showed that lower expression of ZO-1 and Claudin-1 is associated with higher tumor grade, in particular, they found that Claudin-1 downregulation is strongly correlated with poor prognosis and survival in CRC patients(37). Totally, current study documented a downregulation of ZO-1 and Claudin-1in TMAO treated cells through HULC/P38MAPK axis. In contrast to ZO-1 and Claudin-1, the regulation of Occludin in CRC appears to follow distinct mechanisms. Treatment of Caco2 cells with TMAO reduced the expression level of Occludin, like what happen for ZO-1 and Claudin-1. However, HULC knockdown and SB203580 treatment did not apply significant changes in Occludin expression. This suggests that while TMAO affects Occludin similarly to other tight junction, its upstream regulation may be different. This result is consistent with previous work of Mattos et al that showed a significant reduction of Occludin in tissues of patients with CRC(38). Further details about the regulatory mechanism of Occludin in response to TMAO should be elucidated in the future. The previous finding of Voutsadakis et al confirm the presence of different regulatory mechanism for tight junctions in CRC (39). the comparative analysis of this research group revealed that tight junction’s regulation mechanisms are genetically different and also depends on CRC subgroups. Furthermore, unlike many other luminal tight junctions, Occludin structurally is a big transmembrane tight junction that may have different regulatory mechanism rather than other tight junctions so remained unaffected by our studied HULC/P38MAPK axis. In conclusion, this study sheds light on the molecular mechanisms underlying the dysregulation of tight junction in colorectal cancer (CRC). The dysregulation of ZO-1, Claudin-1, and Occludin, as main components of tight junctions, plays a pivotal role in CRC progression, especially metastatic behavior of CRC cells. Our findings provided evidence a novel and mechanistic association between Trimethylamine N-Oxide (TMAO) and the long non-coding RNA HULC for regulation of tight junctions expression through the P38MAPK pathway. Declarations Funding information: The study was supported financially by vice chancellor in research of Kurdistan University of Medical Sciences [ IR.MUK.REC.1401.153]. Conflict of interests and disclosure: The authors declare that they have no competing financial interest and nothing to disclose. Authors Contributions: Sonya Najafpour carried out the sample collection, all laboratory works, and final report preparation. Mohammad Moradzad contributed to Crisper-Cas set up, statistical analyses and manuscript preparation, Karim Rahimi, provided us the vectors needed for this study, helped and advised in the design of cloning and CRISPR experiments. Zahra Alighardashi contributed to the experimental stages. Zakaria Vahabzadeh carried out the design, supervised the study, and prepared the final manuscript. The manuscript’s contents have been read and approved by all authors. Acknowledgement: This work as a Ph.D. thesis was financially supported by a grant received from voice chancellor in research of Kurdistan University of Medical Sciences (IR.MUK.REC.1401.153). The authors thank to cellular and molecular research labs of medicine school of the Kurdistan University of Medical Sciences Significant conclusion: TMAO-a gut-liver metabolite can leverage a highly oncogenic long non-coding RNA, called HULC to develop colorectal cancer. Ethical Statement: This study did not use human subject or animal; Therefore, there is not ethical consideration to be stated. Data sharing: All data generated or analyzed in this study are available upon reasonable request. References He Q, Long J, Yin Y, Li Y, Lei X, Li Z, Zhu W. Emerging roles of lncRNAs in the formation and progression of colorectal cancer. Frontiers in oncology. 2020;9:1542. Fan Y-H, Wu M-J, Jiang Y, Ye M, Lu S-G, Wu L, Zhu X-G. Long non-coding RNA HULC as a potential prognostic biomarker in human cancers: a meta-analysis. Oncotarget. 2017;8(13):21410. Yu X, Zheng H, Chan MT, Wu WKK. HULC: an oncogenic long non‐coding RNA in human cancer. Journal of cellular and molecular medicine. 2017;21(2):410-7. Ding Y, Sun C, Li J, Hu L, Li M, Liu J, et al. The significance of long non-coding RNA HULC in predicting prognosis and metastasis of cancers: a meta-analysis. Pathology & Oncology Research. 2019;25:311-8. Yang X-J, Huang C-Q, Peng C-W, Hou J-X, Liu J-Y. Long noncoding RNA HULC promotes colorectal carcinoma progression through epigenetically repressing NKD2 expression. Gene. 2016;592(1):172-8. Shaker OG, Senousy MA, Elbaz EM. Association of rs6983267 at 8q24, HULC rs7763881 polymorphisms and serum lncRNAs CCAT2 and HULC with colorectal cancer in Egyptian patients. Scientific Reports. 2017;7(1):16246. Xu R, Wang Q, Li L. A genome-wide systems analysis reveals strong link between colorectal cancer and trimethylamine N-oxide (TMAO), a gut microbial metabolite of dietary meat and fat. BMC genomics. 2015;16:1-9. Jalandra R, Dalal N, Yadav AK, Verma D, Sharma M, Singh R, et al. Emerging role of trimethylamine-N-oxide (TMAO) in colorectal cancer. Applied Microbiology and Biotechnology. 2021:1-10. Yang S, Dai H, Lu Y, Li R, Gao C, Pan S. Trimethylamine N-Oxide promotes cell proliferation and angiogenesis in colorectal cancer. Journal of Immunology Research. 2022;2022. Yang G, Lin C-C, Yang Y, Yuan L, Wang P, Wen X, et al. Nobiletin prevents trimethylamine oxide-induced vascular inflammation via inhibition of the NF-κB/MAPK pathways. Journal of agricultural and food chemistry. 2019;67(22):6169-76. Lai Y, Tang H, Zhang X, Zhou Z, Zhou M, Hu Z, et al. Trimethylamine-N-oxide aggravates kidney injury via activation of p38/MAPK signaling and upregulation of HuR. Kidney and Blood Pressure Research. 2022;47(1):61-71. Seldin MM, Meng Y, Qi H, Zhu W, Wang Z, Hazen SL, et al. Trimethylamine N‐oxide promotes vascular inflammation through signaling of mitogen‐activated protein kinase and nuclear factor‐κB. Journal of the American Heart Association. 2016;5(2):e002767. Shen X, Guo H, Xu J, Wang J. Inhibition of lncRNA HULC improves hepatic fibrosis and hepatocyte apoptosis by inhibiting the MAPK signaling pathway in rats with nonalcoholic fatty liver disease. Journal of cellular physiology. 2019;234(10):18169-79. Jiang X-R, Guo N, Li X-Q, Yang H-Y, Wang K, Zhang C-L, et al. Long non-coding RNA HULC promotes proliferation and osteogenic differentiation of bone mesenchymal stem cells via down-regulation of miR-195. European Review for Medical & Pharmacological Sciences. 2018;22(10). Wang X, Tully O, Ngo B, Zitin M, Mullin JM. Epithelial tight junctional changes in colorectal cancer tissues. TheScientificWorldJournal. 2011;11:826-41. Gröne J, Weber B, Staub E, Heinze M, Klaman I, Pilarsky C, et al. Differential expression of genes encoding tight junction proteins in colorectal cancer: frequent dysregulation of claudin-1,-8 and-12. International journal of colorectal disease. 2007;22:651-9. Paquet-Fifield S, Koh SL, Cheng L, Beyit LM, Shembrey C, Mølck C, et al. Tight junction protein claudin-2 promotes self-renewal of human colorectal cancer stem-like cells. Cancer research. 2018;78(11):2925-38. Anderson JM, Van Itallie CM. Physiology and function of the tight junction. Cold Spring Harbor perspectives in biology. 2009;1(2):a002584. Balda MS, Garrett MD, Matter K. The ZO-1–associated Y-box factor ZONAB regulates epithelial cell proliferation and cell density. The Journal of cell biology. 2003;160(3):423-32. Li D, Mrsny RJ. Oncogenic Raf-1 disrupts epithelial tight junctions via downregulation of occludin. The Journal of cell biology. 2000;148(4):791-800. Wang Z, Mandell KJ, Parkos CA, Mrsny RJ, Nusrat A. The second loop of occludin is required for suppression of Raf1-induced tumor growth. Oncogene. 2005;24(27):4412-20. HAHN‐STRÖMBERG V, Edvardsson H, Bodin L, FRANZEÉN L. Tumor volume of colon carcinoma is related to the invasive pattern but not to the expression of cell adhesion proteins. Apmis. 2009;117(3):205-11. Kimura Y, Shiozaki H, Hirao M, Maeno Y, Doki Y, Inoue M, et al. Expression of occludin, tight-junction-associated protein, in human digestive tract. The American journal of pathology. 1997;151(1):45. Lopez-Escalera S, Wellejus A. Evaluation of Caco-2 and human intestinal epithelial cells as in vitro models of colonic and small intestinal integrity. Biochem Biophys Rep. 2022;31:101314. Matouk IJ, Abbasi I, Hochberg A, Galun E, Dweik H, Akkawi M. Highly upregulated in liver cancer noncoding RNA is overexpressed in hepatic colorectal metastasis. European journal of gastroenterology & hepatology. 2009;21(6):688-92. Shi F, Xiao F, Ding P, Qin H, Huang R. Long noncoding RNA highly up-regulated in liver cancer predicts unfavorable outcome and regulates metastasis by MMPs in triple-negative breast cancer. Archives of Medical Research. 2016;47(6):446-53. Zhang H, Liao Z, Liu F, Su C, Zhu H, Li Y, et al. Long noncoding RNA HULC promotes hepatocellular carcinoma progression. Aging (Albany NY). 2019;11(20):9111. Ghafouri‐Fard S, Esmaeili M, Taheri M, Samsami M. Highly upregulated in liver cancer (HULC): An update on its role in carcinogenesis. Journal of Cellular Physiology. 2020;235(12):9071-9. Pranteda A, Piastra V, Stramucci L, Fratantonio D, Bossi G. The p38 MAPK signaling activation in colorectal cancer upon therapeutic treatments. International Journal of Molecular Sciences. 2020;21(8):2773. Xiang T, Fei R, Wang Z, Shen Z, Qian J, Chen W. Nicotine enhances invasion and metastasis of human colorectal cancer cells through the nicotinic acetylcholine receptor downstream p38 MAPK signaling pathway. Oncology reports. 2016;35(1):205-10. Zhang Y, Liao Y, Chen C, Sun W, Sun X, Liu Y, et al. p38‐regulated FOXC1 stability is required for colorectal cancer metastasis. The Journal of Pathology. 2020;250(2):217-30. Ou S, Liao Y, Shi J, Tang J, Ye Y, Wu F, et al. S100A16 suppresses the proliferation, migration and invasion of colorectal cancer cells in part via the JNK/p38 MAPK pathway. Molecular Medicine Reports. 2021;23(2):1-. Hernandez L, Ward LJ, Arefin S, Ebert T, Laucyte-Cibulskiene A, 1 G-FCPLNCMRVK-WAHMTKK, et al. Blood–brain barrier and gut barrier dysfunction in chronic kidney disease with a focus on circulating biomarkers and tight junction proteins. Scientific reports. 2022;12(1):4414. Kaihara T, Kusaka T, Nishi M, Kawamata H, Imura J, Kitajima K, et al. Dedifferentiation and decreased expression of adhesion molecules, E-cadherin and ZO-1, in colorectal cancer are closely related to liver metastasis. Journal of experimental & clinical cancer research: CR. 2003;22(1):117-23. Ke J, Shao W, Jiang Y, Xu J, Li F, Qin J. MicroRNA‑103 regulates tumorigenesis in colorectal cancer by targeting ZO‑1. Molecular Medicine Reports. 2018;17(1):783-8. Chen Y, Tang L, Ye X, Chen Y, Shan E, Han H, Zhong C. Regulation of ZO-1 on β-catenin mediates sulforaphane suppressed colorectal cancer stem cell properties in colorectal cancer. Food & Function. 2022;13(23):12363-70. Resnick MB, Konkin T, Routhier J, Sabo E, Pricolo VE. Claudin-1 is a strong prognostic indicator in stage II colonic cancer: a tissue microarray study. Modern pathology. 2005;18(4):511-8. de Mattos RLM, Kanno DT, Campos FG, Pacciulli Pereira G, Magami Yoshitani M, de Godoy Delben A, et al. Tissue Content and Pattern of Expression of Claudin-3 and Occludin in Normal and Neoplastic Tissues in Patients with Colorectal Cancer. Journal of Gastrointestinal Surgery. 2022;26(11):2351-3. Voutsadakis IA. Tight Junction Claudins and Occludin Are Differentially Regulated and Expressed in Genomically Defined Subsets of Colon Cancer. Current Issues in Molecular Biology. 2023;45(11):8670-86. Tables Table 1 . Specific gRNAs to target HULC, ANXA4 and for Non targeting Control Targets Names Sequence HULC gRNA1+ 5’ AAACAAAGAATATTCCGGCCTTTACTTCAGAGTT 3’ gRNA1- 5’ CTTGAACTCTGAAGTAAAGGCCGGAATATTCTTT 3’ ANXA4 gRNA1+ 5’ AACAATTAGGCAGCCCTCATCAGTGCCGGCTCC3’ gRNA1- 5’ CTTGGGAGCCGGCACTGATGAGGGCTGCCTAATT3’ Non targeting Control gRNA1+ 5’ AAACTCACCAGAAGCGTACCATACTCACGAACAG3’ gRNA1- 5’ CTTGCTGTTCGTGAGTATGGTACGCTTCTGGTGA3’ Table 2. Specific Primers in this Study Gene of interest Sequence Product Size HULC Forward: 5′‐ATCTGCAAGCCAGGAAGAGTC-3′ 184bp Reverse: 5′‐ CTTGCTTGATGCTTTGGTCTGT-3′ P38MAPK Forward:5′‐TGTTGGACGTTTTTACACCTGC-3′ 193bp Reverse: 5′‐AACATGGTCATCTGTAAGCTTCTG-3′ ZO-1 Forward:5′‐AAGGCTTAGAGGAAGGTGATCA -3′ 135bp Reverse: 5′‐GCGACGATAAACATCCTTCTTC-3′ Claudin-1 Forward:5′‐CGGGTTGCTTGCAATGTGC -3′ 240bp Reverse: 5′‐ CCGGCGACAACATCGTGAC-3′ Occludin Forward:5′‐ TGTGATGAGCTGGAGGAGGACT-3′ 120bp Reverse: 5′‐CAGCAGCAGCCATGTACTCTTC -3′ β-Actin Forward:5′‐ AGATCATTGCTCCTCCTGAG -3′ 161bp Reverse: 5′‐ CTAAGTCATAGTCCGCCTAG-3′ Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5855488","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":406224382,"identity":"beee69e4-a673-4a8a-ae7f-d9be03d88d99","order_by":0,"name":"Sonya Najafpour","email":"","orcid":"","institution":"Kurdistan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Sonya","middleName":"","lastName":"Najafpour","suffix":""},{"id":406224383,"identity":"28935a97-35c3-4431-b7ad-f4c2f05cb014","order_by":1,"name":"Mohammad Moradzad","email":"","orcid":"","institution":"Kurdistan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Moradzad","suffix":""},{"id":406224384,"identity":"4e9652a9-2292-4897-a8b8-57458f0eb9ca","order_by":2,"name":"Karim Rahimi","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Karim","middleName":"","lastName":"Rahimi","suffix":""},{"id":406224385,"identity":"fbd32b94-daa4-4389-9a64-370a5259e9cc","order_by":3,"name":"Zahra Alighardashi","email":"","orcid":"","institution":"Kurdistan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Zahra","middleName":"","lastName":"Alighardashi","suffix":""},{"id":406224386,"identity":"3a2cb5f5-e1c1-472d-80ca-6adec6e633f5","order_by":4,"name":"Zakaria Vahabzadeh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0UlEQVRIiWNgGAWjYFACNiA2YGDgB7ETCkjRItkA0mJAtBaQrgMMEL0EgXz7scTPFQV2iZvPr0788MCAQZ5f7AB+LYw9aYclzxgkJ2678XazBNBhhjNnJ+DXwsyQ3iDZYMBsbHbj7AaQlgSD2wS0sPE/b/7ZYFBvbDzj7OYfRGnhkUg7BrTlsJwBf+824myRkHiWZtlgcFxO4gbvNosEAwnCfpHvTzO+2fCnmoe//+zmmz8qbOT5pQloQbIPrFKCWOUgwH+AFNWjYBSMglEwkgAAtPZAXBWAw/UAAAAASUVORK5CYII=","orcid":"","institution":"Kurdistan University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Zakaria","middleName":"","lastName":"Vahabzadeh","suffix":""}],"badges":[],"createdAt":"2025-01-18 13:53:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5855488/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5855488/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":74894886,"identity":"a25d0828-ef95-438f-bac2-a2b3bcdfc0de","added_by":"auto","created_at":"2025-01-28 06:04:44","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":17893,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eMTT Assay result showed no significate changes in treated cell with TMAO and SB203580 compared to control group.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5855488/v1/6c0522f99bee9891c635e1c5.jpg"},{"id":74894885,"identity":"153e4567-c27d-46b3-8c29-67818f9a0e1e","added_by":"auto","created_at":"2025-01-28 06:04:42","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":42126,"visible":true,"origin":"","legend":"\u003cp\u003eGene expression of HULC and ANXA4 was assessed across the group to ensure successful knockdown. HULC and ANXA4 were downregulated in the HULC knockdown (KD) group and ANXA4 knockdown (KD) group respectively Significancy level was considered \u0026lt;0.05 = * and ns = not significant.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5855488/v1/c90abeed6551151e2b4a238a.jpg"},{"id":74894895,"identity":"01cdba30-7895-4afd-a2e3-a9729a7f4d69","added_by":"auto","created_at":"2025-01-28 06:04:51","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":35260,"visible":true,"origin":"","legend":"\u003cp\u003eRelative expression of P38MAPK across all groups. Significance levels were indicated as follows: p \u0026lt; 0.05 = *, p \u0026lt; 0.01 = **, and \"ns\" for not significant. TMAO treatment increased P38MAPK expression, while P38MAPK expression was downregulated in the four groups where HULC was knocked down, regardless of TMAO treatment. Abbreviations: HULC(KD), HULC knockdown; PI, P38MAPK inhibitor (SB203580); CTRL, Control group.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5855488/v1/e23ace62b22d3797b50381ff.jpg"},{"id":74894893,"identity":"ad08d8bf-f80e-4db3-8c67-e5c53e2be1d3","added_by":"auto","created_at":"2025-01-28 06:04:49","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":68477,"visible":true,"origin":"","legend":"\u003cp\u003e(A): The expression levels of ZO-1 were assessed across various experimental groups, including Trimethylamine N-Oxide (TMAO) treatment, HULC) knockdown, and P38MAPK inhibition with SB203580. Notably, TMAO led to significant reduction in ZO-1 expression, while HULC knockdown consistently upregulated the ZO-1 levels. Additionally, inhibition of P38MAPK inhibition using SB203580 resulted in significant decrease in ZO-1 expression. (B): The expression patterns of Claudin-1 were investigated across various experimental conditions, encompassing TMAO treatment, HULC knockdown, and P38MAPK inhibition with SB203580. TMAO treatment led to a distinct reduction in Claudin-1 expression, contrasting with the consistent upregulation observed in the context of HULC knockdown. Furthermore, P38MAPK inhibition resulted in a significant decrease in Claudin-1 levels. The combined treatment group with SB203580 and TMAO exhibited no significant alteration in Claudin-1 expression compared to the control. Significance levels are represented as follows: p \u0026lt;0.05 = * and p \u0026lt;0.01 = **.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5855488/v1/62665062b7e2cafeedc29dbd.jpg"},{"id":74894882,"identity":"cb006a66-01fd-4e28-9761-1473a99f87f1","added_by":"auto","created_at":"2025-01-28 06:04:40","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":36283,"visible":true,"origin":"","legend":"\u003cp\u003eExpression levels of Occludin were assessed across diverse experimental conditions: Notably, TMAO treatment induced a reduction in Occludin expression in the majority of groups, except for the intriguing exception observed in the SB203580 50µM + TMAO 300µM group. Significance level was considered p \u0026lt;0.05 = *, ns = not significant\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5855488/v1/b34b1d5260306441df593d32.jpg"},{"id":76916678,"identity":"21555449-1649-4789-8ae5-3f9c4c747255","added_by":"auto","created_at":"2025-02-22 09:31:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":853283,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5855488/v1/002cd88c-84b2-4978-adf4-e9839ed147f1.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eTrimethylamine N-Oxide dysregulates the expression of tight junctions through Highly Upregulated Liver Carcinoma (HULC) in cellular model of colorectal cancer.\u003c/p\u003e","fulltext":[{"header":"1.\tIntroduction","content":"\u003cp\u003eColorectal cancer, which includes both colon and rectal cancers, poses a major global health challenge and is one of the leading causes of cancer-related morbidity and mortality. Colon cancer specifically develops from the uncontrolled growth of cells in the colon, results in the formation of malignant tumors. Its etiology is multifactorial, involving genetic, environmental, and lifestyle influences. Despite advancements in diagnosis and treatment, the exact molecular mechanisms underlying colon cancer progression remain to be further investigated.\u003c/p\u003e\n\u003cp\u003eThe hallmark of colon cancer is the disruption of normal cellular processes, resulting in abnormal signaling pathways, genomic instability, and altered gene expression. Among the numerous molecules involved in the molecular landscape of colon cancer, long non-coding RNAs (lncRNAs) have emerged as key regulators. These non-coding transcripts, once considered to be transcriptional noise, are now recognized for their critical regulatory roles in diverse cellular processes, including proliferation, apoptosis, and metastasis. Additionally, \u0026nbsp;Zhu et al. (1) demonstrated that lncRNAs not only influence CRC proliferation, invasion, metastasis, and drug resistance but also have the potential as circulating exosomal biomarkers, such as UCA1. lncRNAs are emphasized for their potential use in non-invasive CRC screening tests and as markers for evaluation of therapeutic efficacy, making them promising targets for the development of advanced diagnostic tools and treatments for colorectal cancer.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOne of the oncogenic lnc-RNAs is highly upregulated liver cancer (HULC) which is overexpressed \u0026nbsp;in several cancers (2). While numerous studies have investigated the \u0026nbsp;role of HULC in liver cancer, it has been shown that expression of HULC is associated with poor survival and metastasis in some cancers, including pancreatic cancer, osteosarcoma, gastric cancer, large B‐cell lymphoma, and cervical cancer(3,4). Yang et al observed an elevated HULC levels in human CRC tissues, correlating with poor prognosis. Moreover, they revealed that HULC knockdown hindered CRC cell proliferation, migration, and invasion, while promoting apoptosis in vitro and inhibiting tumorigenicity in vivo(5). Another clinical study indicated that serum level of HULC is increased in patients with CRC and the HULC rs7763881 is also associated with higher risk of CRC, making it a diagnostic marker (6).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTrimethylamine N-Oxide (TMAO), a gut-liver metabolite has gained attention for its pro-inflammatory properties in CRC (7). TMAO is associated with the CRC progression via disparate mechanisms such as inflammation, oxidative stress, DNA damage, and protein misfolding (8). In addition, Yang et al demonstrated that TMAO increase angiogenesis and cell proliferation both in vitro and in vivo (9). The p38 mitogen-activated protein kinase (P38MAPK) pathway is a key signaling mechanism through which TMAO induces its effect (10, 11). The activation of P38MAPK regulate the expression of some transcription factors such as NF-\u0026kappa;B, which promotes the expression of pro-inflammatory genes and leads to the production of inflammatory molecules such as TNF-\u0026alpha; and IL-6(12). It has been shown that HULC gene is a prominent regulator of P38MAPK pathway (13, 14).\u003c/p\u003e\n\u003cp\u003eDysregulation of tight junction is highly correlated with CRC (15). Claudins are a family of tight junctions which are significantly dysregulated in CRC. While Claudin-1 (CLDN1) and -12 (CLDN12) are reported to be overexpressed in CRC, claudin-8 (CLDN8) is downregulated(16). Moreover, the role of claudin-2 (CLDN2) in colorectal cancer, particularly in patients undergoing chemotherapy for stage II/III colorectal cancer, has been investigated. They observed that elevated level of claudin-2 is correlated with poor outcomes, increased recurrence, and decreased sensitivity to chemotherapy. CLDN2 was found to promote self-renewal in colorectal cancer cells, inhibiting their differentiation and contributing to a stem-like phenotype(17). In colorectal cancer, the Zonula Occludens (ZO) family of proteins, including ZO-1, ZO-2, and ZO-3, play crucial regulatory roles in cell cycle progression and proliferative capacities (18). The expression of ZO-1 at the TJ, results in inhibition of ZONAB nuclear accumulation, and leads to cytoplasmic sequestration and regulates/stimulates the nuclear cdk-4 accumulation, thereby inhibits cell proliferation(19). Occludin, as an integral protein of the TJ, plays a significant role in colorectal cancer (CRC) by contributing to TJ structure and potential signaling pathways. With a larger size than typical claudins, occludin is a 65-kDa membrane protein featuring four transmembrane domains and a long cytoplasmic tail. Investigations have revealed its involvement in apoptotic machinery through mitogen-activated protein kinase and Akt signaling pathways(20, 21). Studies in human CRC tissues consistently demonstrate a down-regulation of occludincompared to normal controls, and this correlates with the grade of the tumor progression (22, 23). Immunohistochemical analysis consistently showed a reduced expression of occludin in CRC specimens, suggesting its potential role as a tumor suppressor gene in CRC development (23). The inverse association of occludin expression /with tumor grade underscores its importance in maintaining TJ integrity and highlights its potential as a biomarker for evaluation of colorectal cancer progression.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Overall, tight junction dysregulation is highly associated with CRC metastasis, and this study has the potential to reveal new molecular mechanism of how selected tight junctions (ZO-1, Claudin-1, and Occludin) are affected under TMAO treatment.\u0026nbsp;\u003c/p\u003e"},{"header":"2.\tMaterial and Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Cell Culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCaco-2, a human colon adenocarcinoma cell line was obtained from Pasteur Institute, Iran. The cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with fetal bovine serum (FBS) at 37°C in a humidified atmosphere containing 5% CO2. Cells were routinely passaged and maintained in culture to ensure exponential growth and viability. The culture medium was replenished every 2-3 days to provide optimal nutrient conditions. Cells were used for experiments at passage 5 to ensure consistent and reproducible results. All cell culture procedures were performed under sterile conditions in a certified biosafety cabinet.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;MTT Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell viability was assessed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Caco-2 cells were seeded in 96-well plates at a density of 5,000 cells per well and allowed to adhere overnight. Following adherence, the cells were treated with trimethylamine N-Oxide (TMAO) at a final concentration of 300 µM and the P38 mitogen-activated protein kinase (P38MAPK) inhibitor SB203580 at 50 µM both for 24 hours. After the treatment period, the culture medium was removed, and cells were incubated with MTT solution (MTT 0.5 mg/mL) for 4 hours at 37°C. Formazan crystals formed by viable cells were solubilized using dimethyl sulfoxide (DMSO), and the absorbance was measured at 570 nm using a Nanodrop spectrophotometer (Synergy HT; BioTek, USA). Untreated cells served as the control, and the percentage of cell viability was calculated by normalizing the absorbance of treated cells to the control. All experiments were performed in triplicate, and results are presented as the mean ± standard deviation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;LncRNA HULC Knockdown in HepG2 Cells using CRISPR/Cas13 System\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe CRISPR/Cas13 system was employed to knockdown lncRNA HULC in Caco2 cells. Guide RNAs (gRNAs) were designed using the Breaking-Cas online tool, and subsequently synthesized by Pishgam Company, Iran. The synthesized gRNAs (Table 1) were ligated into the CasRX pre-gRNA cloning backbone (Addgene 109054), which had been previously linearized using the BbsI restriction enzyme (Thermo Fisher Scientific). The inserted gRNAs were confirmed by PCR and Sanger sequencing (Figure 1). \u0026nbsp;Following confirmation, plasmids containing the gRNAs were co-transfected into Caco-2 cells with the pcDNA3 plasmid harboring the Cas13 endonuclease (CasRx) using Lipofectamine LTX (Life Technologies). The success of the transfection process was validated by observing the expression of GFP protein from the pcDNA3 plasmid using a fluorescent microscope (Figure 2). A positive control gRNA targeting ANXA4 (Annexin A4), was employed to ensure the efficacy and specificity of the transfection, while a non-targeting control was included to evaluate transfection-related effects in the absence of specific experimental treatments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;RNA Extraction, cDNA Synthesis, and RT-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA isolation from the cells was carried out using the RNA extraction kit (A101231, Parstous, Iran) following the manufacturer’s protocol. The quality and quantity of the obtained RNA were evaluated using a take3 PikoDrop spectrophotometer (Synergy HT; BioTek, USA). For cDNA synthesis, a cDNA synthesis kit (A101161, Parstous, Iran) was employed. In brief, 500 μg of the isolated RNA was combined with the reverse transcription master mix, encompassing a reverse transcriptase enzyme, random primers, and dNTPs. The mixture underwent incubation at 42-55°C for 1 hour. To assess gene expression levels, quantitative real-time polymerase chain reaction (RT-qPCR) was conducted utilizing the (Corrbet Rotor Gene 6000) system and specific primer sets (Table 2) designed for the target genes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Statistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments outlined in the Materials and Methods were performed in triplicate. The normality of data distribution was assessed using the Shapiro-Wilk test. Following this, one-way analysis of variance (ANOVA) was applied to examine overall differences among the experimental groups for each variable. Subsequent post hoc tests, specifically focusing on comparisons with the control group, were conducted. The Tukey's Honestly Significant Difference (HSD) test was selected as the post hoc analysis method. Data visualization was accomplished using GraphPad Prism software (Version 7.0.0). Statistical significance was defined at p \u0026lt; 0.05, and non-significant differences were indicated as \"ns.\" Two-sided p value was considered for all statistical tests. \u0026nbsp;\u003c/p\u003e"},{"header":"3.\tResults","content":"\u003cp\u003e\u003cstrong\u003e3.1.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;MTT Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe MTT assay was conducted to evaluate the impact of Trimethylamine N-Oxide (TMAO) and SB203580 on the viability of Caco-2 cells. No significant alterations in cell viability were observed for both TMAO (98.84±22.01) and SB203580 (110.52±9.06) compared to the control group. (Figure 1). The statistical analysis, utilizing one-way ANOVA followed by Tukey's HSD post hoc test, confirmed the absence of significant differences in cell viability among the experimental groups (p \u0026gt; 0.05). These findings indicate that neither TMAO nor SB203580 exerted a substantial impact on the overall viability of Caco-2 cells under the experimental conditions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Verification of HULC Knockdown in Caco-2 Cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo confirm the successful knockdown of HULC in Caco-2 cells, a targeted CRISPR/Cas13 approach was employed. Control groups included a positive control with gRNA targeting Annexin A4 (ANXA4), a gene known for high baseline expression, and a non-targeting control with gRNA that does not target any specific genomic region. RT-qPCR was performed to assess the expression levels of HULC in the different experimental groups. The results demonstrated a significant downregulation of HULC expression in the group transfected with gRNA specifically targeting HULC compared to the control group. In contrast, the ANXA4 group and non-targeting control group exhibited no significant changes in HULC expression, confirming the specificity of the knockdown effect (Figure 2). Furthermore, to ensure the selectivity of the knockdown system, the expression of ANXA4 was evaluated across all experimental groups. Consistent with expectations, a significant downregulation of ANXA4 expression was observed exclusively in the group transfected with gRNA targeting ANXA4. The groups with gRNA for HULC and the non-targeting control demonstrated no significant alterations in ANXA4 expression compared to the control group (Figure 2). These results collectively validate the specificity and efficacy of the HULC knockdown model in Caco-2 cells, highlighting the successful modulation of HULC expression without affecting the expression of unrelated genes, as evidenced by the non-targeting control and ANXA4 group.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;P38MAPK mRNA level is decreased upon HULC inhibition\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression of P38MAPK gene was assessed across eight experimental groups, and the average fold changes are presented (Figure ????). In the group treated with TMAO, a significant increase in P38MAPK expression was observed compared to the control group, indicating a stimulatory effect of TMAO on P38MAPK gene expression. Conversely, in all groups upon the knockdown of HULC, a significant downregulation of P38MAPK expression was observed. This suggests a potential regulatory role of HULC in maintaining normal P38MAPK expression levels. In the group treated with the P38MAPK inhibitor SB203580, a significant downregulation of P38MAPK expression was observed, validating the inhibitory effect of SB203580 on P38MAPK. However, in the combination group with SB203580 and TMAO, no significant change in P38MAPK expression was detected compared to the control. This suggests that the stimulatory effect of TMAO on P38MAPK may counteract the inhibitory impact of SB203580, resulting in a neutralized expression level.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4.\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Tight Junctions gene expression:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4.1.\u0026nbsp; \u0026nbsp;ZO-1 and Claudin-1 are regulated by HULC/P38MAPK axis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTreatment with TMAO resulted in a marked reduction in ZO-1 expression compared to the control group, suggesting a suppressive effect of TMAO on ZO-1. Conversely, HULC knockdown significantly upregulated ZO-1 expression, indicating a potential regulatory role for HULC in negatively influencing ZO-1. Similarly, Claudin-1 exhibited a parallel expression pattern, with TMAO treatment leading to a significant reduction in Claudin-1 levels compared to the control group. Notably, HULC silencing across multiple groups resulted in significant upregulation of Claudin-1 expression, further emphasizing the regulatory impact of HULC on Claudin-1. Furthermore, the SB203580 induced a significant reduction in both ZO-1 and Claudin-1 expression levels. Intriguingly, the combined treatment group with SB203580 and TMAO exhibited no significant alteration in ZO-1 and Claudin-1 expression compared to the control. This suggests a potential counteractive interplay between TMAO and SB203580, neutralizing their individual effects on ZO-1 and Claudin-1 expression (Figure 4 A and B). Overall, these findings highlight the regulatory influence of the HULC/P38MAPK axis on ZO-1 and Claudin-1, suggesting potential therapeutic targets within the complex molecular landscape of colorectal cancer. The presented data are graphically represented in Figure 4.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4.2.\u0026nbsp; \u0026nbsp;Occludin is differentially regulated by TMAO\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSimilar to the observed patterns in ZO-1 and Claudin-1, TMAO treatment reduced the expression of Occludin, except in cells treated with both TMAO and SB203580. Remarkably, HULC knockdown did not lead to significant alterations Occludin levels, contrasting with the distinct upregulation observed in ZO-1 and Claudin-1. Moreover, the administration of SB203580 alone did not significantly change the expression of Occludin (Figure 5).\u003c/p\u003e"},{"header":"4.\tDiscussion","content":"\u003cp\u003eThe dysregulation of tight junction proteins plays a crucial role in the progression of CRC. (24). This study addresses the gap in understanding the role of TMAO in CRC by investigating its impact on tight junction expression, specifically ZO-1, Claudin-1, and Occludin. This study indicated upregulation of HULC, followed by P38MAPK under TMAO treatment. Regardless of regulatory role of HULC downstream targets, its own overexpression should be taken into account since it is highly associated with metastasis of CRC to the liver(25). \u0026nbsp; Moreover, Ding et al showed that HULC importance in predicting CRC metastasis(4). Therefore, it seems that HULC overexpression is extremely associated with metastatic behavior since other studies also delineated its role in breast cancer metastasis by increasing Matrix Metalloproteinase 2 (MMP2) and Matrix Metalloproteinase 9 (MMP9) expression(26), and inhibiting miR-2052 expression in liver cancer(27). What is more, previous studies revealed that HULC overexpression spells increased proliferation and anti-apoptotic properties in CRC(28). \u0026nbsp; Hence, we gave importance to TMAO potential to increase HULC expression which is extremely oncogenic in different cancers.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAdditionally, we demonstrated P38MAPK expression would be as a new downstream target for HULC. P38MAPK expression was significantly reduced in the HULC(KD) cells, suggesting inhibitory role of HULC on P38MAPK pathway, and this reduction was observed even with the combinate treatment of TMAO and SB203580. These results detonate that HULC has similar potential with SB203580 to inhibit P38MAPK. Moreover, identifying P38MAPK as downstream target of HULC is crucial because previous works demonstrated P38MAPK as a key pathway in CRC, especially in chemotherapy responses(29). Furthermore, other studies explicitly showed that upon P38MAPK overexpression CRC cells experienced elevated metastasis(30, 31), alongside with escalated proliferation(32). Collectively, our findings suggest that the effect of TMAO is induced via lnc-RNA (HULC) which can be followed by P38MAPK in CRC.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn order to identify further molecular mechanisms, we pursued the impact of TMAO on downstream targets of HULC/P38MAPK axis. To achieve this end, we observed TMAO- treated cells significantly reduced the expression of ZO-1 and Claudin-1. This finding is consistent with previous studies linking TMAO to tight junction dysregulation(33). Interestingly, TMAO could not decrease ZO-1 and Claudin-1 at mRNA level in HULC(KD) cells, suggesting TMAO affects the expression of tight junctions through HULC. For further confirmation of this effect, P38MAPK inhibitor (SB203580) was used. ZO-1 and Claudin-1 expression was increased in response to treatment of cells with SB203580. This change was reversed when cells were simultaneously treated with both TMAO and SB203580. Hence, it seems that TMAO induces ZO-1 and Claudin-1 downregulation via HULC and P38MAPK overexpression. Downregulation of these tight junctions has been reported for cancer progression in several studies. Immunohistochemical staining depicted ZO-1 downregulation is related to liver metastasis(34). In addition, Ke et al showed that ZO-1 downregulation set off cell proliferation and migration in CRC(35). Furthermore, functional analysis conducted by Chen et al revealed that overexpression of ZO-1 inhibit colorectal cancer stem cells(36). Plus, B Resnick et al in a cohort of TNM stage II colon cancer using tissue microarray showed that lower expression of ZO-1 and Claudin-1 is associated with higher tumor grade, in particular, they found that Claudin-1 downregulation is strongly correlated with poor prognosis and survival in CRC patients(37). \u0026nbsp;Totally, current study documented a downregulation of ZO-1 and Claudin-1in TMAO treated cells through HULC/P38MAPK axis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn contrast to ZO-1 and Claudin-1, the regulation of Occludin in CRC appears to follow distinct mechanisms. Treatment of Caco2 cells with TMAO reduced the expression level of Occludin, like what happen for ZO-1 and Claudin-1. However, HULC knockdown and SB203580 treatment did not apply significant changes in Occludin expression. This suggests that while TMAO affects Occludin similarly to other tight junction, its upstream regulation may be different. This result is consistent with previous work of Mattos et al \u0026nbsp;that showed a significant reduction of Occludin in tissues of patients with CRC(38). \u0026nbsp;Further details about the regulatory mechanism of Occludin in response to TMAO should be elucidated in the future. The previous finding of Voutsadakis et al \u0026nbsp; confirm the presence of different \u0026nbsp;regulatory mechanism for \u0026nbsp;tight junctions in CRC (39). \u0026nbsp; the comparative analysis of this research group revealed that tight junction\u0026rsquo;s regulation mechanisms are genetically different and also depends on CRC subgroups. \u0026nbsp;Furthermore, unlike many other luminal tight junctions, Occludin structurally is a big transmembrane tight junction that may have different regulatory mechanism rather than other tight junctions so remained unaffected by our studied HULC/P38MAPK axis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn conclusion, this study sheds light on the molecular mechanisms underlying the dysregulation of tight junction in colorectal cancer (CRC). The dysregulation of ZO-1, Claudin-1, and Occludin, as main components of tight junctions, plays a pivotal role in CRC progression, especially metastatic behavior of CRC cells. Our findings provided evidence a novel and mechanistic association between Trimethylamine N-Oxide (TMAO) and the long non-coding RNA HULC for regulation of tight junctions expression through the P38MAPK pathway.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding information:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was supported financially by vice chancellor in research of Kurdistan University of Medical Sciences [ IR.MUK.REC.1401.153].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interests and disclosure:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing financial interest and nothing to disclose.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors Contributions:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSonya Najafpour carried out the sample collection, all laboratory works, and final report preparation. \u0026nbsp;Mohammad Moradzad contributed to Crisper-Cas set up, statistical analyses and manuscript preparation, Karim Rahimi, provided us the vectors needed for this study, helped and advised in the design of cloning and CRISPR experiments. Zahra Alighardashi contributed to the experimental stages. Zakaria Vahabzadeh carried out the design, supervised the study, and prepared the final manuscript. The manuscript\u0026rsquo;s contents have been read and approved by all authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work as a Ph.D. thesis was financially supported by a grant received from voice chancellor in research of Kurdistan University of Medical Sciences (IR.MUK.REC.1401.153). The authors thank to cellular and molecular research labs of medicine school of the Kurdistan University of Medical Sciences\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSignificant conclusion:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTMAO-a gut-liver metabolite can leverage a highly oncogenic long non-coding RNA, called HULC to develop colorectal cancer.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eEthical Statement:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study did not use human subject or animal; Therefore, there is not ethical consideration to be stated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData sharing:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed in this study are available upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eHe Q, Long J, Yin Y, Li Y, Lei X, Li Z, Zhu W. Emerging roles of lncRNAs in the formation and progression of colorectal cancer. Frontiers in oncology. 2020;9:1542.\u003c/li\u003e\n\u003cli\u003eFan Y-H, Wu M-J, Jiang Y, Ye M, Lu S-G, Wu L, Zhu X-G. Long non-coding RNA HULC as a potential prognostic biomarker in human cancers: a meta-analysis. Oncotarget. 2017;8(13):21410.\u003c/li\u003e\n\u003cli\u003eYu X, Zheng H, Chan MT, Wu WKK. HULC: an oncogenic long non‐coding RNA in human cancer. Journal of cellular and molecular medicine. 2017;21(2):410-7.\u003c/li\u003e\n\u003cli\u003eDing Y, Sun C, Li J, Hu L, Li M, Liu J, et al. The significance of long non-coding RNA HULC in predicting prognosis and metastasis of cancers: a meta-analysis. Pathology \u0026amp; Oncology Research. 2019;25:311-8.\u003c/li\u003e\n\u003cli\u003eYang X-J, Huang C-Q, Peng C-W, Hou J-X, Liu J-Y. Long noncoding RNA HULC promotes colorectal carcinoma progression through epigenetically repressing NKD2 expression. Gene. 2016;592(1):172-8.\u003c/li\u003e\n\u003cli\u003eShaker OG, Senousy MA, Elbaz EM. Association of rs6983267 at 8q24, HULC rs7763881 polymorphisms and serum lncRNAs CCAT2 and HULC with colorectal cancer in Egyptian patients. Scientific Reports. 2017;7(1):16246.\u003c/li\u003e\n\u003cli\u003eXu R, Wang Q, Li L. A genome-wide systems analysis reveals strong link between colorectal cancer and trimethylamine N-oxide (TMAO), a gut microbial metabolite of dietary meat and fat. BMC genomics. 2015;16:1-9.\u003c/li\u003e\n\u003cli\u003eJalandra R, Dalal N, Yadav AK, Verma D, Sharma M, Singh R, et al. Emerging role of trimethylamine-N-oxide (TMAO) in colorectal cancer. Applied Microbiology and Biotechnology. 2021:1-10.\u003c/li\u003e\n\u003cli\u003eYang S, Dai H, Lu Y, Li R, Gao C, Pan S. Trimethylamine N-Oxide promotes cell proliferation and angiogenesis in colorectal cancer. Journal of Immunology Research. 2022;2022.\u003c/li\u003e\n\u003cli\u003eYang G, Lin C-C, Yang Y, Yuan L, Wang P, Wen X, et al. Nobiletin prevents trimethylamine oxide-induced vascular inflammation via inhibition of the NF-\u0026kappa;B/MAPK pathways. Journal of agricultural and food chemistry. 2019;67(22):6169-76.\u003c/li\u003e\n\u003cli\u003eLai Y, Tang H, Zhang X, Zhou Z, Zhou M, Hu Z, et al. Trimethylamine-N-oxide aggravates kidney injury via activation of p38/MAPK signaling and upregulation of HuR. Kidney and Blood Pressure Research. 2022;47(1):61-71.\u003c/li\u003e\n\u003cli\u003eSeldin MM, Meng Y, Qi H, Zhu W, Wang Z, Hazen SL, et al. Trimethylamine N‐oxide promotes vascular inflammation through signaling of mitogen‐activated protein kinase and nuclear factor‐\u0026kappa;B. Journal of the American Heart Association. 2016;5(2):e002767.\u003c/li\u003e\n\u003cli\u003eShen X, Guo H, Xu J, Wang J. Inhibition of lncRNA HULC improves hepatic fibrosis and hepatocyte apoptosis by inhibiting the MAPK signaling pathway in rats with nonalcoholic fatty liver disease. Journal of cellular physiology. 2019;234(10):18169-79.\u003c/li\u003e\n\u003cli\u003eJiang X-R, Guo N, Li X-Q, Yang H-Y, Wang K, Zhang C-L, et al. Long non-coding RNA HULC promotes proliferation and osteogenic differentiation of bone mesenchymal stem cells via down-regulation of miR-195. European Review for Medical \u0026amp; Pharmacological Sciences. 2018;22(10).\u003c/li\u003e\n\u003cli\u003eWang X, Tully O, Ngo B, Zitin M, Mullin JM. Epithelial tight junctional changes in colorectal cancer tissues. TheScientificWorldJournal. 2011;11:826-41.\u003c/li\u003e\n\u003cli\u003eGr\u0026ouml;ne J, Weber B, Staub E, Heinze M, Klaman I, Pilarsky C, et al. Differential expression of genes encoding tight junction proteins in colorectal cancer: frequent dysregulation of claudin-1,-8 and-12. International journal of colorectal disease. 2007;22:651-9.\u003c/li\u003e\n\u003cli\u003ePaquet-Fifield S, Koh SL, Cheng L, Beyit LM, Shembrey C, M\u0026oslash;lck C, et al. Tight junction protein claudin-2 promotes self-renewal of human colorectal cancer stem-like cells. Cancer research. 2018;78(11):2925-38.\u003c/li\u003e\n\u003cli\u003eAnderson JM, Van Itallie CM. Physiology and function of the tight junction. Cold Spring Harbor perspectives in biology. 2009;1(2):a002584.\u003c/li\u003e\n\u003cli\u003eBalda MS, Garrett MD, Matter K. The ZO-1\u0026ndash;associated Y-box factor ZONAB regulates epithelial cell proliferation and cell density. The Journal of cell biology. 2003;160(3):423-32.\u003c/li\u003e\n\u003cli\u003eLi D, Mrsny RJ. Oncogenic Raf-1 disrupts epithelial tight junctions via downregulation of occludin. The Journal of cell biology. 2000;148(4):791-800.\u003c/li\u003e\n\u003cli\u003eWang Z, Mandell KJ, Parkos CA, Mrsny RJ, Nusrat A. The second loop of occludin is required for suppression of Raf1-induced tumor growth. Oncogene. 2005;24(27):4412-20.\u003c/li\u003e\n\u003cli\u003eHAHN‐STR\u0026Ouml;MBERG V, Edvardsson H, Bodin L, FRANZE\u0026Eacute;N L. Tumor volume of colon carcinoma is related to the invasive pattern but not to the expression of cell adhesion proteins. Apmis. 2009;117(3):205-11.\u003c/li\u003e\n\u003cli\u003eKimura Y, Shiozaki H, Hirao M, Maeno Y, Doki Y, Inoue M, et al. Expression of occludin, tight-junction-associated protein, in human digestive tract. The American journal of pathology. 1997;151(1):45.\u003c/li\u003e\n\u003cli\u003eLopez-Escalera S, Wellejus A. Evaluation of Caco-2 and human intestinal epithelial cells as in vitro models of colonic and small intestinal integrity. Biochem Biophys Rep. 2022;31:101314.\u003c/li\u003e\n\u003cli\u003eMatouk IJ, Abbasi I, Hochberg A, Galun E, Dweik H, Akkawi M. Highly upregulated in liver cancer noncoding RNA is overexpressed in hepatic colorectal metastasis. European journal of gastroenterology \u0026amp; hepatology. 2009;21(6):688-92.\u003c/li\u003e\n\u003cli\u003eShi F, Xiao F, Ding P, Qin H, Huang R. Long noncoding RNA highly up-regulated in liver cancer predicts unfavorable outcome and regulates metastasis by MMPs in triple-negative breast cancer. Archives of Medical Research. 2016;47(6):446-53.\u003c/li\u003e\n\u003cli\u003eZhang H, Liao Z, Liu F, Su C, Zhu H, Li Y, et al. Long noncoding RNA HULC promotes hepatocellular carcinoma progression. Aging (Albany NY). 2019;11(20):9111.\u003c/li\u003e\n\u003cli\u003eGhafouri‐Fard S, Esmaeili M, Taheri M, Samsami M. Highly upregulated in liver cancer (HULC): An update on its role in carcinogenesis. Journal of Cellular Physiology. 2020;235(12):9071-9.\u003c/li\u003e\n\u003cli\u003ePranteda A, Piastra V, Stramucci L, Fratantonio D, Bossi G. The p38 MAPK signaling activation in colorectal cancer upon therapeutic treatments. International Journal of Molecular Sciences. 2020;21(8):2773.\u003c/li\u003e\n\u003cli\u003eXiang T, Fei R, Wang Z, Shen Z, Qian J, Chen W. Nicotine enhances invasion and metastasis of human colorectal cancer cells through the nicotinic acetylcholine receptor downstream p38 MAPK signaling pathway. Oncology reports. 2016;35(1):205-10.\u003c/li\u003e\n\u003cli\u003eZhang Y, Liao Y, Chen C, Sun W, Sun X, Liu Y, et al. p38‐regulated FOXC1 stability is required for colorectal cancer metastasis. The Journal of Pathology. 2020;250(2):217-30.\u003c/li\u003e\n\u003cli\u003eOu S, Liao Y, Shi J, Tang J, Ye Y, Wu F, et al. S100A16 suppresses the proliferation, migration and invasion of colorectal cancer cells in part via the JNK/p38 MAPK pathway. Molecular Medicine Reports. 2021;23(2):1-.\u003c/li\u003e\n\u003cli\u003eHernandez L, Ward LJ, Arefin S, Ebert T, Laucyte-Cibulskiene A, 1 G-FCPLNCMRVK-WAHMTKK, et al. Blood\u0026ndash;brain barrier and gut barrier dysfunction in chronic kidney disease with a focus on circulating biomarkers and tight junction proteins. Scientific reports. 2022;12(1):4414.\u003c/li\u003e\n\u003cli\u003eKaihara T, Kusaka T, Nishi M, Kawamata H, Imura J, Kitajima K, et al. Dedifferentiation and decreased expression of adhesion molecules, E-cadherin and ZO-1, in colorectal cancer are closely related to liver metastasis. Journal of experimental \u0026amp; clinical cancer research: CR. 2003;22(1):117-23.\u003c/li\u003e\n\u003cli\u003eKe J, Shao W, Jiang Y, Xu J, Li F, Qin J. MicroRNA‑103 regulates tumorigenesis in colorectal cancer by targeting ZO‑1. Molecular Medicine Reports. 2018;17(1):783-8.\u003c/li\u003e\n\u003cli\u003eChen Y, Tang L, Ye X, Chen Y, Shan E, Han H, Zhong C. Regulation of ZO-1 on \u0026beta;-catenin mediates sulforaphane suppressed colorectal cancer stem cell properties in colorectal cancer. Food \u0026amp; Function. 2022;13(23):12363-70.\u003c/li\u003e\n\u003cli\u003eResnick MB, Konkin T, Routhier J, Sabo E, Pricolo VE. Claudin-1 is a strong prognostic indicator in stage II colonic cancer: a tissue microarray study. Modern pathology. 2005;18(4):511-8.\u003c/li\u003e\n\u003cli\u003ede Mattos RLM, Kanno DT, Campos FG, Pacciulli Pereira G, Magami Yoshitani M, de Godoy Delben A, et al. Tissue Content and Pattern of Expression of Claudin-3 and Occludin in Normal and Neoplastic Tissues in Patients with Colorectal Cancer. Journal of Gastrointestinal Surgery. 2022;26(11):2351-3.\u003c/li\u003e\n\u003cli\u003eVoutsadakis IA. Tight Junction Claudins and Occludin Are Differentially Regulated and Expressed in Genomically Defined Subsets of Colon Cancer. Current Issues in Molecular Biology. 2023;45(11):8670-86.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e. Specific gRNAs to target HULC, ANXA4 and for Non targeting Control\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003eTargets\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003eNames\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 391px;\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003eHULC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003egRNA1+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 391px;\"\u003e\n \u003cp\u003e5\u0026rsquo; AAACAAAGAATATTCCGGCCTTTACTTCAGAGTT 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003egRNA1-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 391px;\"\u003e\n \u003cp\u003e5\u0026rsquo; CTTGAACTCTGAAGTAAAGGCCGGAATATTCTTT 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003eANXA4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003egRNA1+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 391px;\"\u003e\n \u003cp\u003e5\u0026rsquo; AACAATTAGGCAGCCCTCATCAGTGCCGGCTCC3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003egRNA1-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 391px;\"\u003e\n \u003cp\u003e5\u0026rsquo; CTTGGGAGCCGGCACTGATGAGGGCTGCCTAATT3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003eNon targeting Control\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003egRNA1+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 391px;\"\u003e\n \u003cp\u003e5\u0026rsquo; AAACTCACCAGAAGCGTACCATACTCACGAACAG3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003egRNA1-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 391px;\"\u003e\n \u003cp\u003e5\u0026rsquo; CTTGCTGTTCGTGAGTATGGTACGCTTCTGGTGA3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Table 2.\u003c/strong\u003e Specific Primers in this Study\u003c/p\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003eGene of interest\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003eProduct Size\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003eHULC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eForward: 5\u0026prime;‐ATCTGCAAGCCAGGAAGAGTC-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e184bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eReverse: 5\u0026prime;‐\u0026nbsp;CTTGCTTGATGCTTTGGTCTGT-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003eP38MAPK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eForward:5\u0026prime;‐TGTTGGACGTTTTTACACCTGC-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e193bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eReverse: 5\u0026prime;‐AACATGGTCATCTGTAAGCTTCTG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003eZO-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eForward:5\u0026prime;‐AAGGCTTAGAGGAAGGTGATCA -3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e135bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eReverse: 5\u0026prime;‐GCGACGATAAACATCCTTCTTC-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003eClaudin-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eForward:5\u0026prime;‐CGGGTTGCTTGCAATGTGC -3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e240bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eReverse: 5\u0026prime;‐ CCGGCGACAACATCGTGAC-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003eOccludin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eForward:5\u0026prime;‐ TGTGATGAGCTGGAGGAGGACT-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e120bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eReverse: 5\u0026prime;‐CAGCAGCAGCCATGTACTCTTC -3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e\u0026beta;-Actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eForward:5\u0026prime;‐\u0026nbsp;AGATCATTGCTCCTCCTGAG -3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e161bp\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 294px;\"\u003e\n \u003cp\u003eReverse: 5\u0026prime;‐\u0026nbsp;CTAAGTCATAGTCCGCCTAG-3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 88px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":false,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Colorectal cancer, tight junction proteins, HULC, TMAO, P38MAPK","lastPublishedDoi":"10.21203/rs.3.rs-5855488/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5855488/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackgrounds and Aim:\u003c/strong\u003eColorectal cancer (CRC) pathogenesis is correlated with dysregulation of tight junction. This study aimed to investigate the molecular mechanism by which trimethylamine N-oxide (TMAO) alters the expression of tight junction proteins in a colorectal cancer (CRC) cell line.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterial and Method:\u003c/strong\u003e The study utilized the CRISPR/Cas13 system for targeted knock down of HULC in Caco-2 cells, followed by treatment with trimethylamine N-Oxide (TMAO). Tight junction components, including ZO-1, Claudin-1, and Occludin, were analyzed using real-time quantitative polymerase chain reaction (RT-qPCR). To investigate the role of the P38MAPK pathway, the specific inhibitor SB203580 was used in cells treated with TMAO to comprehensively assess tight junction regulation. Statistical analysis was performed using one-way ANOVA to compare the mean ± SD between different groups, followed by paired comparisons using the t-test.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Cells treated with TMAO showed a significant upregulation of the oncogenic long non-coding RNA (lncRNA) HULC (Highly Upregulated in Liver Cancer), , accompanied by increased expression of p38 MAPK. Interestingly, a significant downregulation of ZO-1 and Claudin-1 was observed as a result of TMAO treatment, which was modulated by the HULC/p38 MAPK axis. However, Occludin expression was also reduced by TMAO, but it remained unaffected by the HULC/p38 MAPK pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThis study revealed a novel TMAO/HULC/p38 MAPK axis involved in the regulation of tight junctions in a colorectal cancer cell line model. TMAO treatment significantly reduced the expression of ZO-1, Claudin-1, and Occludin. Further in vivo research is strongly recommended to clarify the impact of TMAO on the integrity of colorectal cancer cells.\u003c/p\u003e","manuscriptTitle":"Trimethylamine N-Oxide dysregulates the expression of tight junctions through Highly Upregulated Liver Carcinoma (HULC) in cellular model of colorectal cancer.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-28 05:55:59","doi":"10.21203/rs.3.rs-5855488/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d5fdbc3e-d989-4165-83a0-139b510c7435","owner":[],"postedDate":"January 28th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-02-22T09:23:34+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-28 05:55:59","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5855488","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5855488","identity":"rs-5855488","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00