FOXA2 modulates the proliferation and metastasis of esophageal squamous cell carcinoma by suppressing proteasome activity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article FOXA2 modulates the proliferation and metastasis of esophageal squamous cell carcinoma by suppressing proteasome activity Wenqiang Xia, Ning Li, Xin Li, Hao Li, Chunxia Gong, Bowen Shi, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4834108/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Background Esophageal squamous cell carcinoma (ESCC) represents a highly lethal malignancy. The FOXA2 was involved in cellular proliferation, differentiation, tumorigenesis, and metastasis. The precise regulatory mechanisms of FOXA2 in ESCC progression remain unclear. Materials and methods Western blotting, reverse transcription-quantitative polymerase chain reaction, and immunohistochemistry were used to detect the expression level of FOXA2, CCK-8, transwell, and wound healing assays in vitro and xenograft tumor model in vivo were applied to assess the function of FOXA2. RNA-Seq analysis and the following functional assays were used to elucidate the relationship between FOXA2 and proteasome activity. Results The expression level of FOXA2 was downregulated in ECSS tissues and cells. Overexpression of FOXA2 in ESCC cells inhibited epithelial-mesenchymal transition in ESCC cells with the upregulation of E-cadherin and downregulation of Vimentin. Meanwhile, overexpression of FOXA2 inhibited the proliferation, migration, and invasion of ESCC cells. Mechanically, proteasome was involved in the ESCC cells proliferation and invasion inhibition induced by FOXA2, and reduced proteasome activity inhibited ESCC cells proliferation and invasion. Conclusion FOXA2 inhibited the proliferation and invasion of ESCC cells by regulating proteasome activity. FOXA2 plays a critical role in ESCC progression and may act as a potential candidate target for ESCC treatment. esophageal squamous cell carcinomas FOXA2 EMT proteasome tumor invasion tumor migration Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Esophageal squamous cell carcinoma (ESCC) emerges as one of the predominant malignancies within the gastrointestinal tract, confronting worldwide healthcare systems. According to the 2020 statistics, esophageal cancer accounted for approximately 604,000 new cases, positioning it as the seventh most prevalent cancer globally, and leading to around 544,000 deaths, marking it as the sixth leading cause of cancer-related mortality [ 1 ]. Notably, in China, ESCC constitutes around 90% of all esophageal cancer cases [ 2 ]. Despite advances in therapeutic strategies, which principally rely on surgery and radiotherapy, the treatment outcomes for esophageal cancer remain largely unsatisfactory [ 3 ]. Advanced stages of ESCC are characterized by rapid progression, with a meager 5-year survival rate hovering around 25% [ 4 ]. The Forkhead box A2 (FOXA2), a pivotal member of the forkhead box (FOX) gene family, plays a critical role in regulating gene expression [[ 5 ]. FOXA family members are known to modulate target gene expression by displacing histones in chromatin and functioning as transcription factors within promoter-enhancer regions [ 6 ]. The FOXA2 gene is nestled on the short arm of chromosome 20, and its protein product encompasses evolutionarily conserved winged helical DNA binding domains, nuclear localization signals, and dual transactivation domains [ 7 ]. These structural features empower FOXA2 to bind to DNA sequences in the promoter regions of target genes, thereby regulating a spectrum of biological processes, including embryonic development, cell proliferation, differentiation, and growth [ 8 ]. Accumulating evidence has implicated the involvement of FOXA2 in various human malignancies such as hepatocellular carcinoma, endometrial carcinoma, gallbladder cancer, glioma, thyroid cancer, pancreatic cancer, and lung cancer [ 9 – 15 ], with its downregulation being associated with cancer development [ 16 ]. Moreover, the proteasome, which is an intricate protease complex [ 17 ], underpins protein degradation within the cytoplasm and nucleus [ 18 ]. Dysfunctions in proteasome-mediated degradation pathways have been linked to diverse pathological conditions, including cancer and neurodegenerative disorders [ 19 ]. The distinct regulatory functions of FOXA2 in tumorigenesis differ inherently across genders and cancer subtypes, acting as either oncogenes or tumor suppressor genes [ 20 ]. Despite these advancements, the specific expression patterns and functional roles of FOXA2 in the context of ESCC remain to be elucidated. Therefore, this study aims to delve into the function of FOXA2 within ESCC and unravel its mechanism influencing the pathophysiology of ESCC. Materials and methods Tissue specimen collection and preservation: This study was approved by the Ethics Committee of the Naval Medical University. The esophageal cancer samples from 56 ESCC patients at the First Affiliated Hospital of Naval Medical University from June to December 2023was collected. All patients underwent radical esophageal cancer surgery without prior radiotherapy or chemotherapy. Tumor tissues and adjacent tissues were collected, one part was stored in liquid nitrogen for RNA and protein extraction, while the other was fixed in 4% paraformaldehyde for 48 hours at room temperature. Cell culture and passaging: Two ESCC cell lines (Eca-109, TE-1) and esophageal epithelial cells (HET-1A) were obtained from the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). ESCC cells were cultured in a medium containing 10% fetal bovine serum (Gibico, USA), 100 U/ml penicillin, and 100 µg/ml streptomycin in a 5% CO 2 incubator at 37°C. Lentiviral infection was carried out by incubating the cells with lentivirus in a medium containing 10% fetal bovine serum (Gibico, USA), 100 U/ml penicillin, and 100 µg/ml streptomycin. Lentivirus Vector Construction and Stable Transfection: The overexpression and control lentiviral were procured from HeYuan Biotechnology Co. (Shanghai). Following stable transfection was confirmed by treatment with 2 µg/ml puromycin (Abcam, USA) and assessed by BD FACSCanto II (USA). Reverse transcription-quantitative polymerase chain reaction (RT-qPCR): Total RNA was extracted from either 100 mg tissue or 1×10 6 cells using Trizol reagent (Invitrogen). Subsequently, first-strand complementary DNA (cDNA) was synthesized by the PrimeScript RT kit (TaKaRa, Japan), and the subsequent PCR procedure was under the guidance of the PCR instrument (Roche, Switzerland) by TB Green (TaKaRa, Japan). Relative expression levels of target genes were calculated by 2 −△△ct methods. The corresponding primers are listed in Table 1 . Table 1 Primer sequence Primer Sequence Vimentin-Forward CCTGCAATCTTTCAGACAGG Vimentin-Reverse CTCCTGGATTTCCTCTTCGT E-cadherin- Forward CGACAAAGGACAGCCTATTT E-cadherin- Reverse AGTTGGGAAATGTGAGCAAT β-actin- Forward GCTCGTCGTCGACAACGGCT β-actin- Reverse CAAACATGATCTGGGTCATCTTCTC FOXA2- Forward GGGAGCGGTGAAGATGGA FOXA2- Reverse TCATGTTGCTCACGGAGGAGTA Western blotting: A mixture of SDS and PMSF (phenylmethylsulfonyl fluoride) was added in a 200 µl solution at a ratio of 100:1 to extract total proteins from either 100 mg of tissue or 1 × 10 6 cells. Protein concentrations were measured and adjusted using a BCA kit (Beyotime, Shanghai). Following electrophoresis and transfer onto a PVDF membrane through electroblotting, the membrane was incubated in 5% defatted milk for 1 hour at room temperature. Subsequently, the membrane was incubated with primary antibody (anti-FOXA2, 1:1000, 22474-1-AP, Proteintech; anti-β-actin, 1:3000, AB2839420, Affinity; anti-E-cadherin, 1:1000, AB2833315, Affinity; anti-Vimentin, 1:1000, AB2835318, Affinity; anti- Proteasome beta 8, 1:500, HY-P80876, MCE; anti-GAPDH, 1:3000, AB2833041, Affinity) overnight at 4°C with gentle shaking, and then incubated with corresponding secondary antibody for 1 hour before expose. The normalized expression levels of targeted proteins were compared and subjected to grey-value analysis using Image-Pro Plus 6.0 software. Transwell assay: ESCC cells were preprocessed with a 12-hour starvation period, followed by digestion, counting, and seeding at approximately 50,000 cells in 200 µl of fetal bovine serum-free medium in the upper chamber, and 600 µl of DMEM medium containing 15% fetal bovine serum in the lower chamber. After 24 hours of incubation, the cells were fixed with 4% formaldehyde for 30 minutes and stained with 0.1% crystal violet. Subsequently, images of migrating or invading cells were captured under a microscope. Wound healing assay: Scratches were created using the tip of a sterilized 200 µl pipette when the cells in the 6-well plate reached 80% confluence. The area where the horizontal and vertical scratches intersected was marked to ensure observation consistency. These marked scratches were regularly monitored, and photographed, and their width measured under a microscope to validate the results. Immunohistochemistry: Tumor tissues were fixed in 4% formaldehyde for 48 hours at room temperature, and then paraffin-embedded, followed by sectioned with a thickness of 5 µm. The antigen retrieval procedure was conducted in heated citrate buffer (Biotronik) for 30 minutes after deparaffinization and rehydration. Then, endogenous peroxidase and nonspecific antigen retrieval were conducted under the guidance. Corresponding primary antibody incubation was carried out overnight at 4°C, followed by secondary antibody incubation and diaminobenzidine (DAB) staining (Dako, Carpinteria, CA, USA) to visualize specific markers. The nucleus was counterstained with hematoxylin for 20 seconds. Images were then observed and captured under a microscope. CCK‑8 assay: ESCC cells were seeded into 96-well plates, with each well containing approximately 2000 cells. The plates were then incubated at 37°C with 5% CO 2 for 24, 48, 72, and 96 hours. Before each measurement, ESCCs cells in each well were treated with 10 µl of CCK-8 reagent and incubated for 2 hours. The absorbance at 450 nm was subsequently measured. Five replicate wells were processed simultaneously. Xenograft tumor model: Five-week-old nude mice were randomly assigned to experimental and control groups based on gender. The experimental group received injections of Lenti-FOXA2 ESCC cells, while the control group received injections of Lenti-GFP ESCC cells, with each injection consisting of 5×10 6 cells in 150 µl volume into the right axilla. Tumor growth was monitored starting at 200–250 mm³ and stopping at 1000–1200 mm³. At last, the nude mice were euthanized, and tumors were harvested. Tumor volume was calculated using the formula: Volume = (longest diameter×shortest diameter²)/2. Proteasome activity assay: Proteasome activity was assessed under the guidance of the Proteasome Activity Assay Kit (Abcam, ab107921). The change in relative fluorescence units (ΔRFU) was calculated as (RFU2-iRFU2)-(RFU1-iRFU1). By applying the ΔRFU to the AMC standard curve, the proteasome activity was determined as the proteasome activity unit = ((B/[(T 2 - T 1 ) × V])) × D. RNA-Seq: The RNA-seq analysis was conducted on three replicate samples from ECA109 Lenti-FOXA2/Lenti-GFP. Total RNA was extracted using Trizol reagent and stored at -80°C for RNA-seq library construction and subsequent analysis. Differentially expressed genes (DEGs) were identified using the DESeq2 package in R language, with significance determined at a P-value < 0.05 and a fold change of ≥ 1.50-fold or ≤ 0.67-fold. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was carried out using the cluster Profiler package in R language. The RNA sequencing data was deposited in the Gene Expression Omnibus (GEO) database for public access. Additionally, gene set enrichment analysis was performed utilizing GSEA software to further investigate the biological implications of the identified DEGs. Statistical analysis: The statistical analysis and graphing were conducted using SPSS 28 software and Prism 9 GraphPad software. Clinical characteristics were assessed using a chi-squared test, Fisher's exact test, or a two-tailed t-test appropriately. Three independent experiments were analyzed using analysis of variance (ANOVA). A P-value of less than 0.05 was considered statistically significant. Results The expression of FOXA2 in both ESCC cells and tissues was downregulated As shown in Fig. 1 , compared to non-cancerous esophageal epithelial cells (HET-1A), the expression level of FOXA2 was lower in ESCC cells (ECA109), which was identified by RT-qPCR and Western blotting (Fig. 1 A-C). Furthermore, the expression level of FOXA2 in ESCC tissues and paracancerous tissues was analyzed by RT-qPCR and Western blotting. The expression level of FOXA2 was reduced in the cancerous tissues compared to the paracancerous tissues (Fig. 1 D-F). The results of immunohistochemistry were similar to that of Western blotting as shown in Fig. 1 G. Additionally, the low expression level of FOXA2 was associated with the tumor size (Table 2 ). A negative correlation was also found between the low expression of FOXA2 and the level of squamous cell carcinoma antigen (SCC-Ag). Table 2 Clinicopathological correlation of FOXA2 expression in ESCC. Clinicopathologic characteristics Cases (n = 56) FOXA2 expression P-value Low (n = 26) High (n = 30) Age (years) 0.854 < 60 6 3 3 ≥ 60 50 26 30 Gender 0.075 Male 41 22 19 Female 15 4 11 Tumor diameter < 0.001 < 4cm 35 8 27 ≥ 4cm 21 18 3 Differentiation 0.130 Low 22 13 91 Mid and high 34 13 21 Lesion location 0.190 Upper/middle 27 15 12 Lower 29 11 18 Clinical stage 0.009 I–II 30 9 21 III–IV 26 17 9 T stage < 0.001 t1-t2 24 41 20 t3-t4 32 22 10 N stage 0.004 n0 31 9 22 n1-n3 25 17 8 CEA(ng/ml) 0.972 < 5 47 23 24 ≥ 5 9 3 6 SCC-Ag(ng/ml) 0.362 < 1.5 39 15 24 ≥ 1.5 17 11 6 *P < 0.05, **P < 0.01, ***P < 0.001. The correlation analysis between FOXA2 and the clincial pathological characteristics in 56 ESCC samples. Statistical significance (P < 0.05) is shown in bold. Overexpression of FOXA2 inhibited epithelial-mesenchymal transition in ESCC cells To delve deeper into the effect of FOXA2 on cellular phenotypes in ESCC cells, lentivirus vector was constructed to ensure continuous overexpression in the ECA109 and TE1 cell lines (Fig. 2 A-D). The cell morphology transformed from a spindle to a polygonal structure in the Lenti-FOXA2 group compared to those treated with Lenti-GFP (Fig. 2 E), indicating a potential suppression of cellular migration and penetration abilities. Moreover, the expression level of E-cadherin in the Lenti-FOXA2 group was significantly upregulated when compared to the control group in both ECA109 and TE1 cell lines. On the contrary, the expression level of Vimentin was significantly downregulated in the Lenti-FOXA2 group, which was identified by Western blotting analyses (Fig. 2 F-I). The aforementioned results suggest that the upregulation of FOXA2 expression could inhibit epithelial-mesenchymal transition (EMT) in ESCC cells. Overexpression of FOXA2 inhibited the proliferation and invasion of ESCC cell lines To further elucidate the functional effects of FOXA2 on ESCC cell lines, we examined its effects on cellular proliferation and invasion. Figure 3 A, B revealed the result of overexpression of FOXA2 on cell growth by CCK-8 assay in the ECA109 and TE1 cell lines. Compared to the Lenti-GFP group, the cell viability was significantly suppressed in the Lenti-FOXA2 group in both ECA109 and TE1 cell lines (Fig. 3 A, B). Additionally, the invasive and migratory capacities of these cells were evaluated via transwell and wound-healing assays. Figure 3 C-H showed a significant reduction in both invasion and migration in ESCC cells transduced with Lenti-FOXA2 when compared to those transduced with Lenti-GFP. To validate these in vitro findings, an in vivo tumor model was established. Tumor sizes were measured by volumes recorded throughout the experimental period periodically, and tumors in the Lenti-FOXA2 group grew more slowly than those in the Lenti-GFP group (Fig. 3 I). At the end of the in vivo study, mice were euthanized, and tumor tissue harvested from the Lenti-FOXA2 group was notably smaller than those from the control group (Fig. 3 J, K). Immunohistochemical analyses of the tumor tissues corroborated the enhanced expression of FOXA2 in the Lenti-FOXA2 group (Fig. 3 L). Collectively, these in vivo and in vitro studies confirmed that the overexpression of FOXA2 significantly hampers the proliferation and invasion of ECA109 and TE1 ESCC cell lines, underscoring its potential role as a modulatory agent in the pathobiology of ESCC. The proteasome is involved in the ESCC cells proliferation and invasion inhibition induced by FOXA2 To elucidate the mechanisms underlying the ESCC cells proliferation and invasion inhibition induced by FOXA2, we conducted RNA-Seq analysis on ECA109 cells treated with either Lenti-FOXA2 or Lenti-GFP. A total of 2,740 DEGs were screened in the analysis set (Fig. 4 A, B). The functional annotations and pathway analyses were further explored, and the proteasome pathway was proved to be involved (Fig. 4 C-E). Subsequent evaluation of proteasome activity within HET-1A, Lenti-FOXA2, and Lenti-GFP groups revealed a marked decrease in proteasome activity in the Lenti-FOXA2 group compared to both the Lenti-GFP and HET-1A groups (Fig. 4 F, G). The expression level of beta 8, which was a marker of proteasome, was higher in carcinoma tissues than that of para-carcinoma tissues (Fig. 4 H, I). The consistent results were also demonstrated by immunohistochemical staining as shown in Fig. 4 J. Furthermore, the immunohistochemical staining results showed that the beta8 expression level in the Lenti-FOXA2 group was lower than that in the Lenti-GFP group in the nude mice cancer model (Fig. 4 K). Collectively, these data suggest that FOXA2 overexpression may impede ESCC progression by inhibiting the proteasome activity. Reduced Proteasome activity inhibits ESCC cells proliferation and invasion. To investigate the impact of diminished proteasome activity on ESCC cells behaviors, we employed MG132 (benzyloxy-L-leucyl-L-leucyl-L-leucine), a proteasome inhibitor of natural origin extracted from Chinese medicinal plants, in our studies. The optimal inhibition concentration of MG132 in ECA109 cells was achieved by treating with 20µg/ml for 12 hours, as determined by proteasome activity assays (Fig. 5 A). To further validate the effect of reduced proteasome activity on ESCC cells proliferation and invasion capabilities, CCK-8 assay, wound healing, and transwell assay were conduct. As shown in Fig. 5 B, the cell proliferation in the MG132 + Lenti-GFP group was significantly lower than that of the Lenti-GFP group. Additionally, both the Lenti-FOXA2 and MG132 + Lenti-GFP groups exhibited decreased invasion and migration abilities compared to the Lenti-GFP group (Fig. 5 C-F). The aforementioned data were corroborated by an in vivo tumor model in nude mice (Fig. 5 G-I). To sum up, reduced proteasome activity led to inhibited proliferation and invasion of ESCC cells. Discussion In the present study, we explored the role of FOXA2 in ESCC and delineated its mechanisms by regulating proteasome activity. FOXA2 expression level was reduced in ESCC tissues, on the contrary, the proteasome activity in clinical samples was increased. This investigation reveals the novel role of FOXA2 as a suppressor of proteasome activity, thereby shedding light on a potential molecular mechanism, by which FOXA2 may restrain ESCC cells proliferation and invasion. EMT is a process through which epithelial cells acquire mesenchymal characteristics. In cancer, EMT is associated with tumorigenesis, invasion, metastasis, and therapy resistance [ 21 ]. This process involves the loss of epithelial markers (E-cadherin) and an increase in mesenchymal markers (Vimentin) [ 22 ]. In this study, we found that FOXA2 overexpression stimulates the expression of E-cadherin and inhibits the expression of Vimentin in ESCC cells, indicating that FOXA2 overexpression inhibits EMT in ESCC cells. Furthermore, our findings also suggest that the proteasome function was regulated by FOXA2. The dysregulation of the ubiquitin-proteasome system is implicated in numerous diseases, including cancer [ 23 ]. Cancer cells often depend on elevated proteasome levels [ 24 ], and proteasome inhibitors such as bortezomib and carfilzomib, which are FDA-approved, have been employed in treating certain cancers [ 25 ]. This study highlights the significance of FOXA2 overexpression in inhibiting proteasome activity during the development of ESCC and elucidates potential molecular mechanisms by which FOXA2 regulates ESCC cells proliferation and invasion. In summary, we revealed that FOXA2 inhibited the proliferation and invasion of ESCC cells by regulating proteasome activity. FOXA2 plays a critical role in ESCC progression and may act as a potential candidate target for ESCC treatment. However, the function and mechanism of FOXA2 and proteasome activity in ESCC remains to be fully elucidated. Declarations Acknowledgements Not applicable. Funding This work is supported by Natural Science Foundation of Shanghai(20ZR1456200), the “234 Discipline Climbing Plan” of the First Affiliated Hospital of Naval Medical University (2020YXK054). Conflicts of interest The authors declared no conflicts of interest. Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Authors' contributions WX, NL and BS collected, analyzed, interpreted the data and provided the majority of statistical analysis as well as provided the figures and tables for the manuscript as well as were major contributors in writing the manuscript. XL,CG and HL collected data. HZ oversaw the analysis of the dataset, provided guidance in creating the dataset and manuscript, and were major contributors in writing the manuscript. All authors have read and approved the manuscript in its current state. Ethics approval and consent to participate The present study was approved by the Ethics Committee of the First Affiliated Hospital of Naval Medical University. Written informed consent was obtained from all patients. Competing interests The authors declare that they have no competing interests. References Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-249. Smyth EC, Lagergren J, Fitzgerald RC, et al. Oesophageal cancer[J]. Nat Rev Dis Primers, 2017, 3:17048。 ZHANG Y L, CHEN P, GUO Y,et al., Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis. Open Med. (Wars.),2022, 17(1):527-535. Yang H, Liu H, Chen Y, et al. Long-term Efficacy of Neoadjuvant Chemoradiotherapy Plus Surgery for the Treatment of Locally Advanced Esophageal Squamous Cell Carcinoma: The NEOCRTEC5010 Randomized Clinical Trial [published correction appears in JAMA Surg. 2022 Sep 1;157(9):859]. JAMA Surg. 2021;156(8):721-729. Katoh M, Katoh M. Human FOX gene family (Review). Int J Oncol. 2004;25(5):1495-1500. Weigel D, Jäckle H. The fork head domain: a novel DNA binding motif of eukaryotic transcription factors?Cell, 1990, 63 (3): 455~456 Tabassum R, Chavali S, Dwivedi OP, Tandon N, Bharadwaj D. Genetic variants of FOXA2: risk of type 2 diabetes and effect on metabolic traits in North Indians. J Hum Genet . 2008;53(11-12):957-965. Liu N, Wang A, Xue M, Zhu X, Liu Y, Chen M. FOXA1 and FOXA2: the regulatory mechanisms and therapeutic implications in cancer. Cell Death Discov . 2024;10(1):172. Published 2024 Apr 11. Huang H, Wang Y, Huang T, et al. FOXA2 inhibits doxorubicin-induced apoptosis via transcriptionally activating HBP rate-limiting enzyme GFPT1 in HCC cells. J Physiol Biochem. 2021;77(4):625-638. Sahoo SS, Ramanand SG, Gao Y, et al. FOXA2 suppresses endometrial carcinogenesis and epithelial-mesenchymal transition by regulating enhancer activity. J Clin Invest. 2022;132(12):e157574. Hong L, Chen M, Huang M, et al. FOXA2 suppresses gallbladder carcinoma cell migration, invasion,and epithelial-mesenchymal transition by targeting SERPINB5. Environ Toxicol. Published online September 4, 2023. Ding B, Liang H, Gao M, et al. Forkhead Box A2 (FOXA2) Inhibits Invasion and Tumorigenesis in Glioma Cells. Oncol Res. 2017;25(5):701-708. He Y, Chen W, Yu L, et al. FOXA2 suppresses PKM2 transcription and affects the Wnt/β-catenin activity to block aerobic glycolysis in thyroid carcinoma. Clin Exp Pharmacol Physiol. 2023;50(7):561-572. Vorvis C, Hatziapostolou M, Mahurkar-Joshi S, et al. Transcriptomic and CRISPR/Cas9 technologies reveal FOXA2 as a tumor suppressor gene in pancreatic cancer. Am J Physiol Gastrointest Liver Physiol . 2016;310(11):G1124-G1137. Tang Y, Shu G, Yuan X, Jing N, Song J. FOXA2 functions as a suppressor of tumor metastasis by inhibition of epithelial-to-mesenchymal transition in human lung cancers. Cell Res. 2011;21(2):316-326. S.S. Myatt, E.W. Lam, The emerging roles of forkhead box (Fox) proteins in cancer, Nat. Rev. Cancer 7 (2007) 847–859. Saeki Y, Tanaka K. Assembly and function of the proteasome. Methods Mol Biol. 2012;832:315-337. Bard JAM, Goodall EA, Greene ER, Jonsson E, Dong KC, Martin A. Structure and Function of the 26S Proteasome. Annu Rev Biochem. 2018 Jun 20;87:697-724. Rousseau A, Bertolotti A. Regulation of proteasome assembly and activity in health and disease. Nat Rev Mol Cell Biol. 2018;19(11):697-712. Liu N, Wang A, Xue M, Zhu X, Liu Y, Chen M. FOXA1 and FOXA2: the regulatory mechanisms and therapeutic implications in cancer. Cell Death Discov. 2024;10(1):172. Pastushenko I, Blanpain C. EMT Transition States during Tumor Progression and Metastasis. Trends Cell Biol. 2019;29(3):212-226. Paolillo M, Schinelli S. Extracellular Matrix Alterations in Metastatic Processes. Int J Mol Sci. 2019;20(19):4947. Published 2019 Oct 7. Park J, Cho J, Song EJ. Ubiquitin-proteasome system (UPS) as a target for anticancer treatment. Arch Pharm Res. 2020;43(11):1144-1161. Rousseau A, Bertolotti A. Regulation of proteasome assembly and activity in health and disease. Nat Rev Mol Cell Biol. 2018;19(11):697-712. Fricker LD. Proteasome Inhibitor Drugs. Annu Rev Pharmacol Toxicol . 2020;60:457-476. Additional Declarations No competing interests reported. Supplementary Files supplementaryfilefulluncroppedGelsandBlotsimages.zip Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 30 May, 2025 Reviews received at journal 12 Nov, 2024 Reviewers agreed at journal 05 Nov, 2024 Reviewers invited by journal 04 Sep, 2024 Editor assigned by journal 23 Aug, 2024 Submission checks completed at journal 01 Aug, 2024 First submitted to journal 31 Jul, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4834108","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":344046552,"identity":"e13a15d1-46f4-4a82-8300-47b1bc1f73e2","order_by":0,"name":"Wenqiang Xia","email":"","orcid":"","institution":"The First Affiliated Hospital of Naval Medical University, Naval Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wenqiang","middleName":"","lastName":"Xia","suffix":""},{"id":344046553,"identity":"ff60d05f-f467-4ab6-a995-e2d9edc9dfe1","order_by":1,"name":"Ning Li","email":"","orcid":"","institution":"Naval Medical Center of PLA, Naval Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ning","middleName":"","lastName":"Li","suffix":""},{"id":344046554,"identity":"9a317e3a-2597-41b8-ac32-e86a55321bbb","order_by":2,"name":"Xin Li","email":"","orcid":"","institution":"The First Affiliated Hospital of Naval Medical University, Naval Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Li","suffix":""},{"id":344046555,"identity":"e6b4b9c0-b820-48d0-bfd9-7cb935fe5dcc","order_by":3,"name":"Hao Li","email":"","orcid":"","institution":"The First Affiliated Hospital of Naval Medical University, Naval Medical University","correspondingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Li","suffix":""},{"id":344046559,"identity":"c915884e-c184-4c48-bad1-d547ea1b7aa4","order_by":4,"name":"Chunxia Gong","email":"","orcid":"","institution":"The First Affiliated Hospital of Naval Medical University, Naval Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chunxia","middleName":"","lastName":"Gong","suffix":""},{"id":344046560,"identity":"ccd39595-7319-4c30-b02a-167731dbe4a3","order_by":5,"name":"Bowen Shi","email":"","orcid":"","institution":"The First Affiliated Hospital of Naval Medical University, Naval Medical University","correspondingAuthor":false,"prefix":"","firstName":"Bowen","middleName":"","lastName":"Shi","suffix":""},{"id":344046565,"identity":"07a7ed4d-c361-43cd-b0d2-d85ac1e66bb2","order_by":6,"name":"Hezhong Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsklEQVRIiWNgGAWjYDCCAwxsYJKfmfnwA9K0SLazpRmQpsXgPI+CBFE6+G4ffvbg44479saHeRgMGGpsoglqkTyXZm4488wzZrPDvAceMBxLy20gpMXgDA+bNG/bYTazw3wJBowNh4nU8rftMI9xM4+BBPFaGNsOSxgwE6tF8gybmWRv22EDicPAQE4gxi98Z5ifSfxsO2zP33/48IMPNTaEtaCCBNKUj4JRMApGwSjABQDAcz3SpQoN8QAAAABJRU5ErkJggg==","orcid":"","institution":"The First Affiliated Hospital of Naval Medical University, Naval Medical University","correspondingAuthor":true,"prefix":"","firstName":"Hezhong","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2024-07-31 09:18:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4834108/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4834108/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":63444385,"identity":"6d6ce5b0-cca2-484d-a773-c772aa95f34a","added_by":"auto","created_at":"2024-08-28 08:15:00","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":224508,"visible":true,"origin":"","legend":"\u003cp\u003eFOXA2 exhibits low expression levels in ESCC tissues and squamous cell carcinoma cells. (A, B) Western blotting analysis revealed the protein expression and relative levels of FOXA2 in ECA109 and HET-1A cells. (C) RT-qPCR quantified the absolute mRNA expression of FOXA2 in ECA109 and HET-1A cells. (D-F) Western blotting analysis of FOXA2 protein expression in cancerous and paracancerous tissues. (G) Immunohistochemical assessment of FOXA2 expression in cancerous and paracancerous tissues. *P\u0026lt;0.05, ***P\u0026lt;0.001 denote statistically significant differences.\u003c/p\u003e","description":"","filename":"fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4834108/v1/127d9add81bcbb8d7b88f29d.jpg"},{"id":63445025,"identity":"82c13fd8-f5ca-4011-8540-4b9c8e8abbfa","added_by":"auto","created_at":"2024-08-28 08:23:00","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":210131,"visible":true,"origin":"","legend":"\u003cp\u003eFOXA2 attenuates epithelial-mesenchymal transition in ESCC cells. (A) Stable overexpression of FOXA2 is illustrated via fluorescence imaging. The expression level of FOXA2 protein and mRNA in ESCC cells were assessed by Western blotting (B, C) and RT-qPCR (D), revealing significantly higher expression of FOXA2 in the Lenti-FOXA2 group compared to the Lenti-GFP group. (E) Cell morphology analysis of overexpression of FOXA2 by Lenti-FOXA2. (F-I) Western blotting analysis indicates that FOXA2 overexpression upregulates the expression of E-cadherin in ESCC cells and suppresses the expression of Vimentin. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 denote statistically significant differences.\u003c/p\u003e","description":"","filename":"fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4834108/v1/e42d2b11d2438858f84ec2df.jpg"},{"id":63444389,"identity":"a689fe69-25c6-4a07-9116-7bbcaa9eebba","added_by":"auto","created_at":"2024-08-28 08:15:00","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":322453,"visible":true,"origin":"","legend":"\u003cp\u003eFOXA2 suppresses proliferation and invasion of ESCC cells. (A, B) Cell viability analysis in ESCC cell lines by CCK-8 assay. (C-F) Wound healing assays demonstrated that FOXA2 overexpression decreased the migratory capacity of ECA109 and TE1 cells. (G, H) Transwell assays revealed that overexpression of FOXA2 significantly reduced migration in ECA109 and TE1 cells. (I) Volume changes in tumor formation in nude mice. (J, K) final tumor volumes were assessed, demonstrating that FOXA2 overexpression impeded tumor growth. (L) Immunohistochemical analysis of tumor tissues from two groups, showing higher expression of FOXA2 in the Lenti-FOXA2 group. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001 denote statistically significant differences.\u003c/p\u003e","description":"","filename":"fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4834108/v1/5833a4f51cbcb25fc60376b0.jpg"},{"id":63444388,"identity":"ccf22fb8-fd06-40b2-80cb-a7e27cc9e596","added_by":"auto","created_at":"2024-08-28 08:15:00","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":935978,"visible":true,"origin":"","legend":"\u003cp\u003eFOXA2 overexpression inhibits proteasome activity. (A-C) mRNA-seq are presented as volcano plots, bar graphs, and heat maps. (D, E) Pathway analysis identified the top 20 pathways enriched in the mRNA dataset. (F, G) cellular proteasome activity and proteasome subunit beta8 expression level. (H, I) Western blotting analysis of clinical samples from cancerous and paracancerous tissues. (J) Immunohistochemistry staining of clinical samples from carcinoma and paracancerous tissues. (K) Immunohistochemistry of tumor tissues from nude mice demonstrated that proteasome subunit beta8 expression was lower in the FOXA2 overexpression group than in the control group. *P \u0026lt; 0.05, **P \u0026lt; 0.01 signify statistically significant differences.\u003c/p\u003e","description":"","filename":"fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4834108/v1/b6bcc4fb7d275b653ceec0c0.jpg"},{"id":63444386,"identity":"ecdcf176-16d4-437e-993a-6ad97d22c0b5","added_by":"auto","created_at":"2024-08-28 08:15:00","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":859511,"visible":true,"origin":"","legend":"\u003cp\u003eDiminished proteasome activity suppresses proliferation and invasion of ESCC cells. (A) ESCC cells treated with 0, 10, 20, and 40 µg/ml MG132 for 12 and 24 hours, and 20 µg/ml MG132 with 12h treatment was demonstrated to be the optimal value. (B) Cell viability of ESCC cells assessed by CCK-8 assay, showing that MG132 inhibited the proliferation of ECA109 cells. (C, D) Wound healing assays indicated that MG132 treatment suppressed the migration of ECA109 cells. (E, F) Transwell assays revealed significant reductions in cell migration after MG132 treatment. (G) Measurements of tumor volume changes in nude mice and (H, I) final tumor volumes confirmed that MG132 treatment inhibited tumor growth. *P \u0026lt; 0.05, **P \u0026lt; 0.01, denote statistically significant changes.\u003c/p\u003e","description":"","filename":"fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4834108/v1/c87fd48ef41400939275ac9b.jpg"},{"id":63445028,"identity":"d72cdca1-14e9-4162-a3c3-611c25e1a9be","added_by":"auto","created_at":"2024-08-28 08:23:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2996051,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4834108/v1/119983df-e880-4522-9551-b3801808b4e5.pdf"},{"id":63444390,"identity":"b393a4a6-d68d-43fa-be6c-d49e8c3e74a1","added_by":"auto","created_at":"2024-08-28 08:15:00","extension":"zip","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":8504069,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfilefulluncroppedGelsandBlotsimages.zip","url":"https://assets-eu.researchsquare.com/files/rs-4834108/v1/2b9618ef3b2de04d83aa0857.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"FOXA2 modulates the proliferation and metastasis of esophageal squamous cell carcinoma by suppressing proteasome activity","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEsophageal squamous cell carcinoma (ESCC) emerges as one of the predominant malignancies within the gastrointestinal tract, confronting worldwide healthcare systems. According to the 2020 statistics, esophageal cancer accounted for approximately 604,000 new cases, positioning it as the seventh most prevalent cancer globally, and leading to around 544,000 deaths, marking it as the sixth leading cause of cancer-related mortality [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Notably, in China, ESCC constitutes around 90% of all esophageal cancer cases [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Despite advances in therapeutic strategies, which principally rely on surgery and radiotherapy, the treatment outcomes for esophageal cancer remain largely unsatisfactory [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Advanced stages of ESCC are characterized by rapid progression, with a meager 5-year survival rate hovering around 25% [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe Forkhead box A2 (FOXA2), a pivotal member of the forkhead box (FOX) gene family, plays a critical role in regulating gene expression [[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. FOXA family members are known to modulate target gene expression by displacing histones in chromatin and functioning as transcription factors within promoter-enhancer regions [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The FOXA2 gene is nestled on the short arm of chromosome 20, and its protein product encompasses evolutionarily conserved winged helical DNA binding domains, nuclear localization signals, and dual transactivation domains [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. These structural features empower FOXA2 to bind to DNA sequences in the promoter regions of target genes, thereby regulating a spectrum of biological processes, including embryonic development, cell proliferation, differentiation, and growth [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Accumulating evidence has implicated the involvement of FOXA2 in various human malignancies such as hepatocellular carcinoma, endometrial carcinoma, gallbladder cancer, glioma, thyroid cancer, pancreatic cancer, and lung cancer [\u003cspan additionalcitationids=\"CR10 CR11 CR12 CR13 CR14\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], with its downregulation being associated with cancer development [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Moreover, the proteasome, which is an intricate protease complex [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], underpins protein degradation within the cytoplasm and nucleus [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Dysfunctions in proteasome-mediated degradation pathways have been linked to diverse pathological conditions, including cancer and neurodegenerative disorders [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe distinct regulatory functions of FOXA2 in tumorigenesis differ inherently across genders and cancer subtypes, acting as either oncogenes or tumor suppressor genes [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Despite these advancements, the specific expression patterns and functional roles of FOXA2 in the context of ESCC remain to be elucidated. Therefore, this study aims to delve into the function of FOXA2 within ESCC and unravel its mechanism influencing the pathophysiology of ESCC.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eTissue specimen collection and preservation: This study was approved by the Ethics Committee of the Naval Medical University. The esophageal cancer samples from 56 ESCC patients at the First Affiliated Hospital of Naval Medical University from June to December 2023was collected. All patients underwent radical esophageal cancer surgery without prior radiotherapy or chemotherapy. Tumor tissues and adjacent tissues were collected, one part was stored in liquid nitrogen for RNA and protein extraction, while the other was fixed in 4% paraformaldehyde for 48 hours at room temperature.\u003c/p\u003e \u003cp\u003eCell culture and passaging: Two ESCC cell lines (Eca-109, TE-1) and esophageal epithelial cells (HET-1A) were obtained from the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). ESCC cells were cultured in a medium containing 10% fetal bovine serum (Gibico, USA), 100 U/ml penicillin, and 100 \u0026micro;g/ml streptomycin in a 5% CO\u003csub\u003e2\u003c/sub\u003e incubator at 37\u0026deg;C. Lentiviral infection was carried out by incubating the cells with lentivirus in a medium containing 10% fetal bovine serum (Gibico, USA), 100 U/ml penicillin, and 100 \u0026micro;g/ml streptomycin.\u003c/p\u003e \u003cp\u003eLentivirus Vector Construction and Stable Transfection: The overexpression and control lentiviral were procured from HeYuan Biotechnology Co. (Shanghai). Following stable transfection was confirmed by treatment with 2 \u0026micro;g/ml puromycin (Abcam, USA) and assessed by BD FACSCanto II (USA).\u003c/p\u003e \u003cp\u003eReverse transcription-quantitative polymerase chain reaction (RT-qPCR): Total RNA was extracted from either 100 mg tissue or 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells using Trizol reagent (Invitrogen). Subsequently, first-strand complementary DNA (cDNA) was synthesized by the PrimeScript RT kit (TaKaRa, Japan), and the subsequent PCR procedure was under the guidance of the PCR instrument (Roche, Switzerland) by TB Green (TaKaRa, Japan). Relative expression levels of target genes were calculated by 2\u003csup\u003e\u0026minus;△△ct\u003c/sup\u003e methods. The corresponding primers are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVimentin-Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGCAATCTTTCAGACAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVimentin-Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCCTGGATTTCCTCTTCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE-cadherin- Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGACAAAGGACAGCCTATTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eE-cadherin- Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTTGGGAAATGTGAGCAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin- Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCGTCGTCGACAACGGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin- Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAACATGATCTGGGTCATCTTCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFOXA2- Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGAGCGGTGAAGATGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFOXA2- Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCATGTTGCTCACGGAGGAGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eWestern blotting: A mixture of SDS and PMSF (phenylmethylsulfonyl fluoride) was added in a 200 \u0026micro;l solution at a ratio of 100:1 to extract total proteins from either 100 mg of tissue or 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells. Protein concentrations were measured and adjusted using a BCA kit (Beyotime, Shanghai). Following electrophoresis and transfer onto a PVDF membrane through electroblotting, the membrane was incubated in 5% defatted milk for 1 hour at room temperature. Subsequently, the membrane was incubated with primary antibody (anti-FOXA2, 1:1000, 22474-1-AP, Proteintech; anti-β-actin, 1:3000, AB2839420, Affinity; anti-E-cadherin, 1:1000, AB2833315, Affinity; anti-Vimentin, 1:1000, AB2835318, Affinity; anti- Proteasome beta 8, 1:500, HY-P80876, MCE; anti-GAPDH, 1:3000, AB2833041, Affinity) overnight at 4\u0026deg;C with gentle shaking, and then incubated with corresponding secondary antibody for 1 hour before expose. The normalized expression levels of targeted proteins were compared and subjected to grey-value analysis using Image-Pro Plus 6.0 software.\u003c/p\u003e \u003cp\u003eTranswell assay: ESCC cells were preprocessed with a 12-hour starvation period, followed by digestion, counting, and seeding at approximately 50,000 cells in 200 \u0026micro;l of fetal bovine serum-free medium in the upper chamber, and 600 \u0026micro;l of DMEM medium containing 15% fetal bovine serum in the lower chamber. After 24 hours of incubation, the cells were fixed with 4% formaldehyde for 30 minutes and stained with 0.1% crystal violet. Subsequently, images of migrating or invading cells were captured under a microscope.\u003c/p\u003e \u003cp\u003eWound healing assay: Scratches were created using the tip of a sterilized 200 \u0026micro;l pipette when the cells in the 6-well plate reached 80% confluence. The area where the horizontal and vertical scratches intersected was marked to ensure observation consistency. These marked scratches were regularly monitored, and photographed, and their width measured under a microscope to validate the results.\u003c/p\u003e \u003cp\u003eImmunohistochemistry: Tumor tissues were fixed in 4% formaldehyde for 48 hours at room temperature, and then paraffin-embedded, followed by sectioned with a thickness of 5 \u0026micro;m. The antigen retrieval procedure was conducted in heated citrate buffer (Biotronik) for 30 minutes after deparaffinization and rehydration. Then, endogenous peroxidase and nonspecific antigen retrieval were conducted under the guidance. Corresponding primary antibody incubation was carried out overnight at 4\u0026deg;C, followed by secondary antibody incubation and diaminobenzidine (DAB) staining (Dako, Carpinteria, CA, USA) to visualize specific markers. The nucleus was counterstained with hematoxylin for 20 seconds. Images were then observed and captured under a microscope.\u003c/p\u003e \u003cp\u003eCCK‑8 assay: ESCC cells were seeded into 96-well plates, with each well containing approximately 2000 cells. The plates were then incubated at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e for 24, 48, 72, and 96 hours. Before each measurement, ESCCs cells in each well were treated with 10 \u0026micro;l of CCK-8 reagent and incubated for 2 hours. The absorbance at 450 nm was subsequently measured. Five replicate wells were processed simultaneously.\u003c/p\u003e \u003cp\u003eXenograft tumor model: Five-week-old nude mice were randomly assigned to experimental and control groups based on gender. The experimental group received injections of Lenti-FOXA2 ESCC cells, while the control group received injections of Lenti-GFP ESCC cells, with each injection consisting of 5\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells in 150 \u0026micro;l volume into the right axilla. Tumor growth was monitored starting at 200\u0026ndash;250 mm\u0026sup3; and stopping at 1000\u0026ndash;1200 mm\u0026sup3;. At last, the nude mice were euthanized, and tumors were harvested. Tumor volume was calculated using the formula: Volume = (longest diameter\u0026times;shortest diameter\u0026sup2;)/2.\u003c/p\u003e \u003cp\u003eProteasome activity assay: Proteasome activity was assessed under the guidance of the Proteasome Activity Assay Kit (Abcam, ab107921). The change in relative fluorescence units (ΔRFU) was calculated as (RFU2-iRFU2)-(RFU1-iRFU1). By applying the ΔRFU to the AMC standard curve, the proteasome activity was determined as the proteasome activity unit = ((B/[(T\u003csub\u003e2\u003c/sub\u003e - T\u003csub\u003e1\u003c/sub\u003e) \u0026times; V])) \u0026times; D.\u003c/p\u003e \u003cp\u003eRNA-Seq: The RNA-seq analysis was conducted on three replicate samples from ECA109 Lenti-FOXA2/Lenti-GFP. Total RNA was extracted using Trizol reagent and stored at -80\u0026deg;C for RNA-seq library construction and subsequent analysis. Differentially expressed genes (DEGs) were identified using the DESeq2 package in R language, with significance determined at a P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and a fold change of \u0026ge;\u0026thinsp;1.50-fold or \u0026le;\u0026thinsp;0.67-fold. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was carried out using the cluster Profiler package in R language. The RNA sequencing data was deposited in the Gene Expression Omnibus (GEO) database for public access. Additionally, gene set enrichment analysis was performed utilizing GSEA software to further investigate the biological implications of the identified DEGs.\u003c/p\u003e \u003cp\u003eStatistical analysis: The statistical analysis and graphing were conducted using SPSS 28 software and Prism 9 GraphPad software. Clinical characteristics were assessed using a chi-squared test, Fisher's exact test, or a two-tailed t-test appropriately. Three independent experiments were analyzed using analysis of variance (ANOVA). A P-value of less than 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eThe expression of FOXA2 in both ESCC cells and tissues was downregulated\u003c/p\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, compared to non-cancerous esophageal epithelial cells (HET-1A), the expression level of FOXA2 was lower in ESCC cells (ECA109), which was identified by RT-qPCR and Western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-C). Furthermore, the expression level of FOXA2 in ESCC tissues and paracancerous tissues was analyzed by RT-qPCR and Western blotting. The expression level of FOXA2 was reduced in the cancerous tissues compared to the paracancerous tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-F). The results of immunohistochemistry were similar to that of Western blotting as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG. Additionally, the low expression level of FOXA2 was associated with the tumor size (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). A negative correlation was also found between the low expression of FOXA2 and the level of squamous cell carcinoma antigen (SCC-Ag).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eClinicopathological correlation of FOXA2 expression in ESCC.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClinicopathologic characteristics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCases (n\u0026thinsp;=\u0026thinsp;56)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eFOXA2 expression\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eP-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLow (n\u0026thinsp;=\u0026thinsp;26)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHigh (n\u0026thinsp;=\u0026thinsp;30)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge (years)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.854\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.075\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTumor diameter\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;4cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;4cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDifferentiation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.130\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLow\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMid and high\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLesion location\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.190\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUpper/middle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLower\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClinical stage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e0.009\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eI\u0026ndash;II\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIII\u0026ndash;IV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT stage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003et1-t2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003et3-t4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eN stage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e0.004\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003en0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003en1-n3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCEA(ng/ml)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.972\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSCC-Ag(ng/ml)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.362\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;1.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;1.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e*P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eThe correlation analysis between FOXA2 and the clincial pathological characteristics in 56 ESCC samples.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eStatistical significance (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) is shown in bold.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eOverexpression of FOXA2 inhibited epithelial-mesenchymal transition in ESCC cells\u003c/p\u003e \u003cp\u003eTo delve deeper into the effect of FOXA2 on cellular phenotypes in ESCC cells, lentivirus vector was constructed to ensure continuous overexpression in the ECA109 and TE1 cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-D). The cell morphology transformed from a spindle to a polygonal structure in the Lenti-FOXA2 group compared to those treated with Lenti-GFP (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), indicating a potential suppression of cellular migration and penetration abilities. Moreover, the expression level of E-cadherin in the Lenti-FOXA2 group was significantly upregulated when compared to the control group in both ECA109 and TE1 cell lines. On the contrary, the expression level of Vimentin was significantly downregulated in the Lenti-FOXA2 group, which was identified by Western blotting analyses (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF-I). The aforementioned results suggest that the upregulation of FOXA2 expression could inhibit epithelial-mesenchymal transition (EMT) in ESCC cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOverexpression of FOXA2 inhibited the proliferation and invasion of ESCC cell lines\u003c/p\u003e \u003cp\u003eTo further elucidate the functional effects of FOXA2 on ESCC cell lines, we examined its effects on cellular proliferation and invasion. Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B revealed the result of overexpression of FOXA2 on cell growth by CCK-8 assay in the ECA109 and TE1 cell lines. Compared to the Lenti-GFP group, the cell viability was significantly suppressed in the Lenti-FOXA2 group in both ECA109 and TE1 cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). Additionally, the invasive and migratory capacities of these cells were evaluated via transwell and wound-healing assays. Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-H showed a significant reduction in both invasion and migration in ESCC cells transduced with Lenti-FOXA2 when compared to those transduced with Lenti-GFP. To validate these in vitro findings, an in vivo tumor model was established. Tumor sizes were measured by volumes recorded throughout the experimental period periodically, and tumors in the Lenti-FOXA2 group grew more slowly than those in the Lenti-GFP group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI). At the end of the in vivo study, mice were euthanized, and tumor tissue harvested from the Lenti-FOXA2 group was notably smaller than those from the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ, K). Immunohistochemical analyses of the tumor tissues corroborated the enhanced expression of FOXA2 in the Lenti-FOXA2 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eL). Collectively, these in vivo and in vitro studies confirmed that the overexpression of FOXA2 significantly hampers the proliferation and invasion of ECA109 and TE1 ESCC cell lines, underscoring its potential role as a modulatory agent in the pathobiology of ESCC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe proteasome is involved in the ESCC cells proliferation and invasion inhibition induced by FOXA2\u003c/p\u003e \u003cp\u003eTo elucidate the mechanisms underlying the ESCC cells proliferation and invasion inhibition induced by FOXA2, we conducted RNA-Seq analysis on ECA109 cells treated with either Lenti-FOXA2 or Lenti-GFP. A total of 2,740 DEGs were screened in the analysis set (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B). The functional annotations and pathway analyses were further explored, and the proteasome pathway was proved to be involved (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-E). Subsequent evaluation of proteasome activity within HET-1A, Lenti-FOXA2, and Lenti-GFP groups revealed a marked decrease in proteasome activity in the Lenti-FOXA2 group compared to both the Lenti-GFP and HET-1A groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF, G). The expression level of beta 8, which was a marker of proteasome, was higher in carcinoma tissues than that of para-carcinoma tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH, I). The consistent results were also demonstrated by immunohistochemical staining as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ. Furthermore, the immunohistochemical staining results showed that the beta8 expression level in the Lenti-FOXA2 group was lower than that in the Lenti-GFP group in the nude mice cancer model (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK). Collectively, these data suggest that FOXA2 overexpression may impede ESCC progression by inhibiting the proteasome activity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eReduced Proteasome activity inhibits ESCC cells proliferation and invasion.\u003c/p\u003e \u003cp\u003eTo investigate the impact of diminished proteasome activity on ESCC cells behaviors, we employed MG132 (benzyloxy-L-leucyl-L-leucyl-L-leucine), a proteasome inhibitor of natural origin extracted from Chinese medicinal plants, in our studies. The optimal inhibition concentration of MG132 in ECA109 cells was achieved by treating with 20\u0026micro;g/ml for 12 hours, as determined by proteasome activity assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). To further validate the effect of reduced proteasome activity on ESCC cells proliferation and invasion capabilities, CCK-8 assay, wound healing, and transwell assay were conduct. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, the cell proliferation in the MG132\u0026thinsp;+\u0026thinsp;Lenti-GFP group was significantly lower than that of the Lenti-GFP group. Additionally, both the Lenti-FOXA2 and MG132\u0026thinsp;+\u0026thinsp;Lenti-GFP groups exhibited decreased invasion and migration abilities compared to the Lenti-GFP group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-F). The aforementioned data were corroborated by an in vivo tumor model in nude mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG-I). To sum up, reduced proteasome activity led to inhibited proliferation and invasion of ESCC cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the present study, we explored the role of FOXA2 in ESCC and delineated its mechanisms by regulating proteasome activity. FOXA2 expression level was reduced in ESCC tissues, on the contrary, the proteasome activity in clinical samples was increased. This investigation reveals the novel role of FOXA2 as a suppressor of proteasome activity, thereby shedding light on a potential molecular mechanism, by which FOXA2 may restrain ESCC cells proliferation and invasion.\u003c/p\u003e \u003cp\u003eEMT is a process through which epithelial cells acquire mesenchymal characteristics. In cancer, EMT is associated with tumorigenesis, invasion, metastasis, and therapy resistance [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. This process involves the loss of epithelial markers (E-cadherin) and an increase in mesenchymal markers (Vimentin) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In this study, we found that FOXA2 overexpression stimulates the expression of E-cadherin and inhibits the expression of Vimentin in ESCC cells, indicating that FOXA2 overexpression inhibits EMT in ESCC cells. Furthermore, our findings also suggest that the proteasome function was regulated by FOXA2.\u003c/p\u003e \u003cp\u003eThe dysregulation of the ubiquitin-proteasome system is implicated in numerous diseases, including cancer [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Cancer cells often depend on elevated proteasome levels [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], and proteasome inhibitors such as bortezomib and carfilzomib, which are FDA-approved, have been employed in treating certain cancers [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. This study highlights the significance of FOXA2 overexpression in inhibiting proteasome activity during the development of ESCC and elucidates potential molecular mechanisms by which FOXA2 regulates ESCC cells proliferation and invasion. In summary, we revealed that FOXA2 inhibited the proliferation and invasion of ESCC cells by regulating proteasome activity. FOXA2 plays a critical role in ESCC progression and may act as a potential candidate target for ESCC treatment. However, the function and mechanism of FOXA2 and proteasome activity in ESCC remains to be fully elucidated.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis work is supported by Natural Science Foundation of Shanghai(20ZR1456200), the \u0026ldquo;234 Discipline Climbing Plan\u0026rdquo; of the First Affiliated Hospital of Naval Medical University (2020YXK054).\u003c/p\u003e\n\u003cp\u003eConflicts of interest\u003c/p\u003e\n\u003cp\u003eThe authors declared no conflicts of interest.\u003c/p\u003e\n\u003cp\u003eAvailability of data and materials\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003eAuthors\u0026apos; contributions\u003c/p\u003e\n\u003cp\u003eWX, NL and BS collected, analyzed, interpreted the data and provided the majority of statistical analysis as well as provided the figures and tables for the manuscript as well as were major contributors in writing the manuscript. XL,CG\u0026nbsp;and HL collected data. HZ oversaw the analysis of the dataset, provided guidance in creating the dataset and manuscript, and were major contributors in writing the manuscript. All authors have read and approved the manuscript in its current state.\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eThe present study was approved by the Ethics Committee of the First Affiliated Hospital of Naval Medical University. Written informed consent was obtained from all patients.\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-249.\u003c/li\u003e\n\u003cli\u003eSmyth EC, Lagergren J, Fitzgerald RC, et al. Oesophageal cancer[J]. Nat Rev Dis Primers, 2017, 3:17048。\u003c/li\u003e\n\u003cli\u003eZHANG Y L, CHEN P, GUO Y,et al., Clinical value of SIRT1 as a prognostic biomarker in esophageal squamous cell carcinoma, a systematic meta-analysis. Open Med. (Wars.),2022, 17(1):527-535.\u003c/li\u003e\n\u003cli\u003eYang H, Liu H, Chen Y, et al. Long-term Efficacy of Neoadjuvant Chemoradiotherapy Plus Surgery for the Treatment of Locally Advanced Esophageal Squamous Cell Carcinoma: The NEOCRTEC5010 Randomized Clinical Trial [published correction appears in JAMA Surg. 2022 Sep 1;157(9):859]. JAMA Surg. 2021;156(8):721-729. \u003c/li\u003e\n\u003cli\u003eKatoh M, Katoh M. Human FOX gene family (Review). Int J Oncol. 2004;25(5):1495-1500.\u003c/li\u003e\n\u003cli\u003eWeigel D, J\u0026auml;ckle H. The fork head domain: a novel DNA binding motif of eukaryotic transcription factors?Cell, 1990, 63 (3): 455~456\u003c/li\u003e\n\u003cli\u003eTabassum R, Chavali S, Dwivedi OP, Tandon N, Bharadwaj D. Genetic variants of FOXA2: risk of type 2 diabetes and effect on metabolic traits in North Indians. \u003cem\u003eJ Hum Genet\u003c/em\u003e. 2008;53(11-12):957-965.\u003c/li\u003e\n\u003cli\u003eLiu N, Wang A, Xue M, Zhu X, Liu Y, Chen M. FOXA1 and FOXA2: the regulatory mechanisms and therapeutic implications in cancer. \u003cem\u003eCell Death Discov\u003c/em\u003e. 2024;10(1):172. Published 2024 Apr 11. \u003c/li\u003e\n\u003cli\u003eHuang H, Wang Y, Huang T, et al. FOXA2 inhibits doxorubicin-induced apoptosis via transcriptionally activating HBP rate-limiting enzyme GFPT1 in HCC cells. J Physiol Biochem. 2021;77(4):625-638. \u003c/li\u003e\n\u003cli\u003eSahoo SS, Ramanand SG, Gao Y, et al. FOXA2 suppresses endometrial carcinogenesis and epithelial-mesenchymal transition by regulating enhancer activity. J Clin Invest. 2022;132(12):e157574. \u003c/li\u003e\n\u003cli\u003eHong L, Chen M, Huang M, et al. FOXA2 suppresses gallbladder carcinoma cell migration, invasion,and epithelial-mesenchymal transition by targeting SERPINB5. Environ Toxicol. Published online September 4, 2023.\u003c/li\u003e\n\u003cli\u003eDing B, Liang H, Gao M, et al. Forkhead Box A2 (FOXA2) Inhibits Invasion and Tumorigenesis in Glioma Cells. Oncol Res. 2017;25(5):701-708. \u003c/li\u003e\n\u003cli\u003eHe Y, Chen W, Yu L, et al. FOXA2 suppresses PKM2 transcription and affects the Wnt/\u0026beta;-catenin activity to block aerobic glycolysis in thyroid carcinoma. Clin Exp Pharmacol Physiol. 2023;50(7):561-572. \u003c/li\u003e\n\u003cli\u003eVorvis C, Hatziapostolou M, Mahurkar-Joshi S, et al. Transcriptomic and CRISPR/Cas9 technologies reveal FOXA2 as a tumor suppressor gene in pancreatic cancer. \u003cem\u003eAm J Physiol Gastrointest Liver Physiol\u003c/em\u003e. 2016;310(11):G1124-G1137. \u003c/li\u003e\n\u003cli\u003eTang Y, Shu G, Yuan X, Jing N, Song J. FOXA2 functions as a suppressor of tumor metastasis by inhibition of epithelial-to-mesenchymal transition in human lung cancers. Cell Res. 2011;21(2):316-326.\u003c/li\u003e\n\u003cli\u003eS.S. Myatt, E.W. Lam, The emerging roles of forkhead box (Fox) proteins in cancer, Nat. Rev. Cancer 7 (2007) 847\u0026ndash;859.\u003c/li\u003e\n\u003cli\u003eSaeki Y, Tanaka K. Assembly and function of the proteasome. Methods Mol Biol. 2012;832:315-337. \u003c/li\u003e\n\u003cli\u003eBard JAM, Goodall EA, Greene ER, Jonsson E, Dong KC, Martin A. Structure and Function of the 26S Proteasome. Annu Rev Biochem. 2018 Jun 20;87:697-724.\u003c/li\u003e\n\u003cli\u003eRousseau A, Bertolotti A. Regulation of proteasome assembly and activity in health and disease. Nat Rev Mol Cell Biol. 2018;19(11):697-712.\u003c/li\u003e\n\u003cli\u003eLiu N, Wang A, Xue M, Zhu X, Liu Y, Chen M. FOXA1 and FOXA2: the regulatory mechanisms and therapeutic implications in cancer. Cell Death Discov. 2024;10(1):172. \u003c/li\u003e\n\u003cli\u003ePastushenko I, Blanpain C. EMT Transition States during Tumor Progression and Metastasis. Trends Cell Biol. 2019;29(3):212-226.\u003c/li\u003e\n\u003cli\u003ePaolillo M, Schinelli S. Extracellular Matrix Alterations in Metastatic Processes. Int J Mol Sci. 2019;20(19):4947. Published 2019 Oct 7.\u003c/li\u003e\n\u003cli\u003ePark J, Cho J, Song EJ. Ubiquitin-proteasome system (UPS) as a target for anticancer treatment. Arch Pharm Res. 2020;43(11):1144-1161. \u003c/li\u003e\n\u003cli\u003eRousseau A, Bertolotti A. Regulation of proteasome assembly and activity in health and disease. Nat Rev Mol Cell Biol. 2018;19(11):697-712. \u003c/li\u003e\n\u003cli\u003eFricker LD. Proteasome Inhibitor Drugs. \u003cem\u003eAnnu Rev Pharmacol Toxicol\u003c/em\u003e. 2020;60:457-476. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cancer-cell-international","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ccin","sideBox":"Learn more about [Cancer Cell International](http://cancerci.biomedcentral.com/)","snPcode":"12935","submissionUrl":"https://submission.nature.com/new-submission/12935/3","title":"Cancer Cell International","twitterHandle":"@OncoBioMed","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"esophageal squamous cell carcinomas, FOXA2, EMT, proteasome, tumor invasion, tumor migration","lastPublishedDoi":"10.21203/rs.3.rs-4834108/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4834108/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eEsophageal squamous cell carcinoma (ESCC) represents a highly lethal malignancy. The FOXA2 was involved in cellular proliferation, differentiation, tumorigenesis, and metastasis. The precise regulatory mechanisms of FOXA2 in ESCC progression remain unclear.\u003c/p\u003e\u003ch2\u003eMaterials and methods\u003c/h2\u003e \u003cp\u003eWestern blotting, reverse transcription-quantitative polymerase chain reaction, and immunohistochemistry were used to detect the expression level of FOXA2, CCK-8, transwell, and wound healing assays in vitro and xenograft tumor model in vivo were applied to assess the function of FOXA2. RNA-Seq analysis and the following functional assays were used to elucidate the relationship between FOXA2 and proteasome activity.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe expression level of FOXA2 was downregulated in ECSS tissues and cells. Overexpression of FOXA2 in ESCC cells inhibited epithelial-mesenchymal transition in ESCC cells with the upregulation of E-cadherin and downregulation of Vimentin. Meanwhile, overexpression of FOXA2 inhibited the proliferation, migration, and invasion of ESCC cells. Mechanically, proteasome was involved in the ESCC cells proliferation and invasion inhibition induced by FOXA2, and reduced proteasome activity inhibited ESCC cells proliferation and invasion.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eFOXA2 inhibited the proliferation and invasion of ESCC cells by regulating proteasome activity. FOXA2 plays a critical role in ESCC progression and may act as a potential candidate target for ESCC treatment.\u003c/p\u003e","manuscriptTitle":"FOXA2 modulates the proliferation and metastasis of esophageal squamous cell carcinoma by suppressing proteasome activity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-28 08:14:55","doi":"10.21203/rs.3.rs-4834108/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-05-30T17:02:55+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-12T09:07:47+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"213670696546106787997331290402401266957","date":"2024-11-05T09:26:32+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-09-05T01:49:31+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-23T07:46:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-01T12:47:41+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cancer Cell International","date":"2024-07-31T09:16:59+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cancer-cell-international","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ccin","sideBox":"Learn more about [Cancer Cell International](http://cancerci.biomedcentral.com/)","snPcode":"12935","submissionUrl":"https://submission.nature.com/new-submission/12935/3","title":"Cancer Cell International","twitterHandle":"@OncoBioMed","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b330aae4-3ed1-4219-8899-d03177d4b991","owner":[],"postedDate":"August 28th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-08-10T15:08:20+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-28 08:14:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4834108","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4834108","identity":"rs-4834108","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.