ALIX and ITCH localize to the base of primary cilia and negatively regulate ciliary Polycystin-2 levels

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-06 · read from full text

The study investigated whether the ESCRT-associated protein ALIX and the ubiquitin ligase ITCH localize to primary cilia and regulate ciliary signaling output in cultured mammalian cells, using immunofluorescence, protein–protein interaction assays, and gene depletion in wild-type versus KIF13B-deficient (with rescue) cell models. ALIX was found at the base of primary cilia, and its retention required the kinesin motor KIF13B via a physical interaction between KIF13B-related machinery and ITCH, which was enriched at the ciliary base and was essential for ALIX stability. Depletion of either ALIX or ITCH increased ciliary levels of Polycystin-2, and ITCH loss additionally caused constitutive accumulation of Smoothened, a Sonic hedgehog effector, within cilia. The paper is a preprint and not peer-reviewed, and its conclusions are derived from cultured cell experiments rather than in vivo models. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Primary cilia are antenna-like organelles that function as cellular hubs for signaling pathways, including Sonic hedgehog and signaling mediated by the Polycystin-1/Polycystin-2 cation channel complex. Proper regulation of signaling output depends on the dynamic control of ciliary protein composition, which involves intraflagellar transport-mediated trafficking, protein retrieval, and the shedding of extracellular vesicles from cilia. Here we identify ALIX, a protein previously linked to the biogenesis of small extracellular vesicles, as a novel component localized at the base of primary cilia in cultured mammalian cells. We show that ALIX retention at this site requires the ciliary kinesin-3 motor protein KIF13B, which physically interacts with the E3 ubiquitin ligase ITCH. In turn, ITCH is enriched at the ciliary base and is essential for ALIX stability. Depletion of either ALIX or ITCH results in elevated ciliary levels of Polycystin-2, while ITCH loss additionally leads to constitutive accumulation of Smoothened, a key Sonic hedgehog effector, within the cilium. Collectively, our findings establish ALIX and ITCH as critical regulators of ciliary membrane protein homeostasis and signaling, acting in coordination with KIF13B to maintain proper ciliary function.
Full text 167,837 characters · extracted from preprint-html · click to expand
ALIX and ITCH localize to the base of primary cilia and negatively regulate ciliary Polycystin-2 levels | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article ALIX and ITCH localize to the base of primary cilia and negatively regulate ciliary Polycystin-2 levels Christina Rahlff Berggreen, Julie Laplace, Fabiola Campestre, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7376140/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 25 Feb, 2026 Read the published version in BMC Molecular and Cell Biology → Version 1 posted 9 You are reading this latest preprint version Abstract Primary cilia are antenna-like organelles that function as cellular hubs for signaling pathways, including Sonic hedgehog and signaling mediated by the Polycystin-1/Polycystin-2 cation channel complex. Proper regulation of signaling output depends on the dynamic control of ciliary protein composition, which involves intraflagellar transport-mediated trafficking, protein retrieval, and the shedding of extracellular vesicles from cilia. Here we identify ALIX, a protein previously linked to the biogenesis of small extracellular vesicles, as a novel component localized at the base of primary cilia in cultured mammalian cells. We show that ALIX retention at this site requires the ciliary kinesin-3 motor protein KIF13B, which physically interacts with the E3 ubiquitin ligase ITCH. In turn, ITCH is enriched at the ciliary base and is essential for ALIX stability. Depletion of either ALIX or ITCH results in elevated ciliary levels of Polycystin-2, while ITCH loss additionally leads to constitutive accumulation of Smoothened, a key Sonic hedgehog effector, within the cilium. Collectively, our findings establish ALIX and ITCH as critical regulators of ciliary membrane protein homeostasis and signaling, acting in coordination with KIF13B to maintain proper ciliary function. ALIX primary cilia KIF13B polycystin-2 ITCH Bardet-Biedl syndrome BBSome intraflagellar transport Smoothened Hedgehog signaling Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Cilia are dynamic, surface-exposed organelles that play pivotal roles in cell motility, fluid flow regulation, and sensory signaling of many eukaryotic cell types and organisms, ranging from the green alga Chlamydomonas to nematodes and humans. Both motile (9 + 2) and non-motile (9 + 0) cilia, such as primary cilia, are composed of a microtubule-based core, the axoneme, which is templated by a centriole-derived basal body and ensheathed by a lipid bilayer membrane enriched with specific receptors and ion channels that function in signaling. In vertebrates, primary cilia are critical for mediating several signaling pathways, most notably the Sonic hedgehog (SHH) pathway and signaling via the polycystin-1 (PC1) and polycystin-2 (PC2) cation channel complex, the latter of which is implicated in autosomal dominant (AD) polycystic kidney disease (PKD) ( 1 , 2 ). Cilia are compartmentalized organelles whose assembly, disassembly and composition are tightly regulated in response to cellular and environmental cues. This regulation is essential for controlling downstream cilia-dependent processes during development and homeostasis of tissues and organs. Consequently, mutations that perturb ciliary structure or composition can result in a broad spectrum of disorders known as ciliopathies; over 35 severe, pleiotropic diseases that include ADPKD and Bardet-Bield Syndrome (BBS) ( 2 , 3 ). Although the ciliary membrane is continuous with the plasma membrane, ciliary compartmentalization is maintained by the transition zone (TZ), which acts as a selective gate at the proximal part of the cilium ( 4 ). Additionally, the targeted trafficking of proteins into and out of cilia is mediated by the intraflagellar transport (IFT) system, along with associated cargo adaptors such as the BBSome, a complex of ciliary proteins encoded by genes mutated in BBS ( 5 – 8 ). Beyond trafficking, increasing evidence indicates that both motile and non-motile cilia release extracellular vesicles (EVs), which may serve roles in clearing ciliary components and facilitating intercellular communication ( 9 – 12 ). Virtually all cells release EVs that transport macromolecules that can regulate physiological and pathological processes ( 13 , 14 ). EVs are generally classified into two major subtypes based on their biogenesis: exosomes, which are small vesicles (ca. 50–150 nm in diameter) originating from the endosomal system via multivesicular bodies (MVBs), and ectosomes, which range from ca. 100 nm to several micrometers in size and are formed by direct outward budding and scission from the plasma membrane. Alternative classification categorizes these EVs based on size, distinguishing between small and large EVs, respectively, since it is almost impossible to distinguish the two types upon cellular release. Under this system, exosomes fall into the small EV category, while ectosomes can encompass both small and large EV populations ( 13 , 14 ). In the context of cilia, the ciliary membrane is thought to predominantly release large EVs, which are formed by outward budding of the ciliary membrane, mechanistically similar to ectosome formation at the plasma membrane ( 9 – 12 ). Furthermore, during ciliary shortening or disassembly, EV-like particles can be shed through specialized processes such as decapitation, involving loss of the ciliary tip ( 15 ) or autotomy, in which the entire cilium is released ( 16 ). Several cellular pathways that regulate the sorting of cargo into small EVs and their biogenesis exist. These include: (i) the ESCRT (Endosomal Sorting Complex Required for Transport) pathway, which is initiated by HGS- and STAM-mediated recognition and sorting of ubiquitylated EV cargo; (ii) the ALIX-syntenin pathway; and (iii) the neutral sphingomyelinase (N-SMase)/ceramide-dependent pathway, in which cargo is concentrated within flotillin- and cholesterol-enriched membrane microdomains ( 13 ). Components of these pathways may also contribute to the formation of large EVs, or ectosomes, which typically originate from actin-driven membrane blebs that are subsequently excised and shed as large EVs or ectosomes ( 13 ). An additional mechanism for large EV formation is the ARMMs (ARrestin domain-containing protein 1-Mediated Microvesicles) pathway, which involves several key proteins, including the ubiquitin E3 ligase ITCH (also known as AIP4), the palmitoyl transferase ZDHHC5, and the ESCRT-1 component TSG101 ( 17 , 18 ). Notably, ARMMs components such as ITCH physically and functionally interact with ALIX, an ESCRT-associated protein implicated in both exosome and ectosome biogenesis ( 19 – 22 ). ITCH also binds to the ESCRT-0 subunits HGS and STAM ( 20 ), highlighting the extensive crosstalk and functional versatility among components of the EV biogenesis machinery. In a previous study, we showed that the ESCRT-0 protein HGS and the ARMMS pathway component ZDHHC5 localize to primary cilia of cultured mouse cortical collecting duct (mCCD) cells and are released in small EVs, along with ITCH, in a manner dependent on the ciliary kinesin-3 motor protein KIF13B ( 23 ). Conversely, HGS, ZDHHC5 and ITCH were found to be enriched in small EVs isolated from Bbs4 or Bbs6 mutant kidney epithelial cells, compared to small EVs from control cells ( 24 ). Moreover, both HGS and ZDHHC5 accumulated within cilia of BBSome-deficient cells ( 23 ), and their depletion disrupted the ciliary localization or homeostasis of PC2 ( 23 , 25 ). These findings suggest that components of the ESCRT and ARMMs pathways may operate in parallel to regulate ciliary membrane protein composition. In support of this idea, ITCH was identified in the ciliary proteome of several cells types, including kidney epithelial cells ( 26 – 28 ), and has been reported to interact with key SHH signaling proteins such as the SHH receptor PTCH1 ( 29 ), SUFU ( 30 ), NUMB ( 31 , 32 ) and GLI1 ( 32 , 33 ). GLI1 functions a transcriptional effector downstream of Smoothened (SMO), a class F G protein-coupled receptor and a central activator in the SHH signaling pathway ( 34 , 35 ). Nevertheless, specific ciliary functions for ITCH have so far not been defined. In addition, ALIX has been detected in the ciliary TZ and EVs of Chlamydomonas cells ( 36 , 37 ), but its localization to and function at the primary cilium in vertebrates remain unclear. Notably, ALIX localizes to centrosomes in both Drosophila and mammalian cells ( 38 – 40 ) and has been identified in the primary cilia proteome of cultured mouse kidney epithelial cells ( 26 , 41 ). Genetic evidence also supports a potential ciliary role: a homozygous frameshift mutation in PDCD6IP (encoding ALIX) has been linked to primary microcephaly in humans ( 42 ), and Alix knockout mice exhibit hydrocephalus and other brain malformations ( 43 , 44 ), phenotypes commonly associated with centrosomal and ciliary defects ( 45 , 46 ). Together, these findings point to possible, yet unexplored, ciliary functions for ALIX and ITCH. In this study, we show that ALIX localizes to the base of, and within, primary cilia across multiple mammalian cell types, and that its retention at the cilium is promoted by KIF13B. Moreover, we provide evidence that KIF13B may regulate ALIX indirectly via ITCH, which also localizes to the ciliary base and is required for ALIX stability. Supporting functional roles for both proteins a the cilium, depletion of either ALIX or ITCH results in elevated ciliary levels of PC2 and SMO. Together, our findings uncover ALIX and ITCH as novel regulators of ciliary membrane protein homeostasis and signaling and offer new insight into the molecular mechanisms that maintain ciliary composition and function. Results ALIX localizes to the base of primary cilia in a KIF13B-dependent manner Given the reports hinting at conserved ciliary or centrosomal functions for ALIX, we investigated whether it localizes to primary cilia of cultured mammalian cells. We first performed immunofluorescence microscopy (IFM) analysis of 24 or 72 h serum-starved wild-type (WT) mCCD cells using antibodies against endogenous ALIX and the ciliary marker acetylated a-tubulin and found that ALIX is localized at the base of primary cilia in these cells (Fig. 1 a), which is in line with earlier work identifying ALIX in the TZ proteome of Chlamydomonas ( 36 ). Interestingly, when we analyzed our previously described Kif13b −/− and rescue mCCD cell lines ( 23 ) in a similar way, we found that loss of KIF13B leads to depletion of ALIX from the ciliary base over time compared to the WT and rescue lines (Fig. 1 a, b); overall cellular levels of ALIX were not affected in the mutant cells (Fig. 1 c). These results suggest that while KIF13B is not required for the initial recruitment of ALIX to the ciliary base, it is essential for its retention at this site. To test if this phenotype is specific to mCCD cells, we performed similar analyses in WT, KIF13B −/− , and rescue hTERT-immortalized retinal pigment epithelial (RPE)1 cell lines that were serum-starved for 48 h to induce ciliogenesis. Western blot analysis using a KIF13B-specific antibody confirmed the successful knockout of KIF13B in the RPE1 cells, as well as a near-endogenous level of expression of mCherry-KIF13B in the rescue line (Fig. 2 a). Furthermore, IFM analysis demonstrated that ALIX localizes to the ciliary base of RPE1 cells and is partially depleted from this site upon loss of KIF13B (Fig. 2 b, c), reminiscent of our results in mCCD cells (Fig. 1 a, b). Overall cellular levels of ALIX were similar between WT and KIF13B −/− RPE1 cells, as demonstrated by western blotting (Fig. 2 a). Moreover, by co-staining for the TZ marker RPGRIP1L, we found that ALIX primarily localizes at the basal body, below the ciliary TZ, and the adjacent daughter centriole although co-localization of ALIX with RPGRIP1L at the TZ was occasionally observed (Fig. 2 b, asterisk). A previous study identified ALIX in the ciliary proteome of mouse inner medullary collecting duct (IMCD)3 cells, where it appeared to accumulate upon loss of IFT27 ( 26 ), a component of the IFT-B subcomplex thought to function together with the BBSome and retrograde IFT machinery during ciliary membrane protein export ( 47 , 48 ). To explore this further, we analyzed ALIX localization by IFM in serum-starved WT and Ift27 −/− IMCD3 cells. As seen in mCCD and RPE1 cells, ALIX localized to primary cilia of both WT and Ift27 −/− IMCD3 cells, predominantly at the ciliary base, but sometimes also along the cilium itself (Figure S1 a, b). However, in contrast to our results obtained for mCCD or RPE1 cells lacking KIF13B (Fig. 1 , 2 ), the ciliary localization pattern of ALIX was similar in WT and Ift27 −/− cells (Figure S1 a, b), and total cellular levels of ALIX were also comparable between these two cell lines (Figure S1 c). In summary, these results indicate that ALIX localizes to the base of primary cilia in multiple cell types and that KIF13B, but not IFT27, is required for its retention at this site. ITCH interacts with KIF13B and regulates ciliary ALIX levels We then investigated the mechanism by which KIF13B may promote the retention of ALIX at the base of primary cilia. In a previous study, we showed that KIF13B binds to Angiomotin (AMOT) isoform 2, which also localizes to the base of primary cilia ( 49 ). Notably, ITCH was reported to bind to AMOT isoform 1 ( 50 , 51 ) as well as to ALIX ( 20 , 22 ). Moreover, since previous studies identified ITCH in the ciliary proteome of multiple cell types, including kidney epithelial cells ( 26 – 28 ), we hypothesized that KIF13B may regulate ciliary ALIX localization via ITCH. To investigate this, we first tested if KIF13B binds physically to ITCH. We performed immunoprecipitation (IP) analysis in HEK293T cells co-expressing relevant fusion proteins and found that the cargo-binding, motorless region of KIF13B tagged with GFP at the N-terminus (GFP-Dmotor) co-precipitated Myc-ITCH (Fig. 3 a, b). IP analysis using additional KIF13B truncations that either contain or lack the forkhead-associated (FHA) domain indicated that the latter domain is essential, but likely not sufficient, for KIF13B’s binding to ITCH (Fig. 3 a, b). Next, we performed IFM analysis of 24 or 72 h serum-starved WT, Kif13b −/− , and rescue mCCD cell lines ( 23 ) using antibodies against ITCH and the ciliary marker acetylated a-tubulin and found that ITCH localizes to the base of primary cilia in these cells (Fig. 3 c). Interestingly, we found that the levels of ITCH at the ciliary base were significantly reduced in the Kif13b −/− cells at the 24 h time point compared to WT, while ITCH was conversely significantly enriched at this site in the mCherry-KIF13B-expressing rescue line; a similar trend was observed at the 72 h time point (Fig. 3 d). The overall cellular levels of ITCH were similar between the three cell lines under these conditions, as judged by western blot analysis (Fig. 3 e). Taken together, our results indicate that KIF13B physically binds to ITCH, which localizes to the ciliary base in a KIF13B-dependent manner. Loss of ITCH leads to ciliary depletion of ALIX To investigate how ITCH might affect ciliary localization of ALIX, we used Crispr/Cas9 methodology to knock out the corresponding gene in mCCD cells and confirmed that ITCH was depleted from the knockout cells by western blot analysis, as expected (Figure S2a). Subsequently, WT and Itch −/− cells were serum-starved for 24 or 72 h to promote ciliation and subjected to IFM analysis using antibodies against ALIX and the ciliary marker acetylated a-tubulin to test how loss of ITCH affects ciliary localization of ALIX, as well as ciliary length and frequency. Our results indicated that loss of ITCH has little influence on ciliary length and frequency under the conditions tested (Figure S2b-d) but causes a significant depletion of ALIX from the ciliary base compared to WT cells (Fig. 4 a, b). This could be due to a general instability of ALIX in the Itch −/− cells, and not just due to defective trafficking or localization, since western blot analysis indicated that the average cellular level of ALIX was reduced by approximately 30% in these cells compared to the WT (Fig. 4 c, d). Depletion of ALIX and ITCH causes ciliary accumulation of PC2 Next, we explored the ciliary function of ALIX in mCCD cells by addressing its role in regulating ciliogenesis, ciliary length, and localization of PC2. Since ALIX has many important cellular functions, including an essential role in cytokinesis ( 52 ), we used siRNA rather than gene knockout to partially deplete it from mCCD cells (Fig. 5 a, b), and subjected the cells to 24 or 72 h of serum starvation, followed by IFM analysis with antibodies against ciliary markers and PC2 (Fig. 5 c). Partial depletion of ALIX to approximately 50% of WT levels (Fig. 5 b) did not affect ciliation frequency (Fig. 5 d) and led to a small but significant reduction in ciliary length at the 24 h time point compared to control cells (Fig. 5 e). Moreover, partial depletion of ALIX caused a significant accumulation of PC2 within cilia after 72 h of serum starvation, compared to control cells (Fig. 5 c, f). Similar analysis of Itch −/− cells showed a significant accumulation of PC2 within cilia of the mutant cells at both the 24 and 72 h time points compared to the WT (Figure S2b, e), in agreement with our observation that ALIX levels are reduced in the Itch −/− cells (Fig. 4 ). However, as the effect of ITCH loss on ciliary PC2 levels appears more pronounced compared to that of ALIX depletion, the results suggest that ITCH negatively regulates ciliary PC2 levels not only via ALIX. We conclude that ALIX and ITCH negatively regulate ciliary PC2 levels and may interact functionally in this context. Loss of ITCH alters ciliary dynamics of SMO ITCH was previously shown to bind and ubiquitylate multiple components of the SHH signaling pathway ( 33 ), which is intimately connected to primary cilia in vertebrates ( 53 – 55 ). In the off state, the SHH receptor PTCH1 is enriched in the cilium and suppresses ciliary accumulation of SMO. This leads to the processing of the GLI transcription factors into their repressor forms, preventing downstream target gene expression. Upon binding to SHH, PTCH1 exits the cilium, causing concomitant ciliary enrichment of SMO, followed by the stabilization and conversion of GLI transcription factors into their activator forms, which initiate the expression of target genes such as GLI1 and PTCH1 ( 34 , 35 ). Ciliary accumulation of SMO and activation of GLI-mediated target gene transcription can also be induced by purmorphamine (PMA), which directly binds and activates SMO independently of PTCH1 ( 56 ). The respective accumulation and depletion of SMO and PTCH1 from cilia during SHH signaling rely on their ubiquitylation, which targets them for BBSome-mediated retrieval from cilia ( 57 – 60 ). For example, Lv and colleagues showed that the E3 ubiquitin ligase WWP1 localizes to primary cilia of mouse embryonic fibroblasts in the basal state, where it binds to PTCH1 and promotes SMO ubiquitylation and export from cilia. Binding of SHH to PTCH1 causes its removal from the cilium along with WWP1, which promotes ciliary accumulation of SMO ( 59 ). In addition to binding WWP1, PTCH1 also binds to ITCH. Specifically, it was reported that ITCH negatively regulates the basal levels of PTCH1 by binding to its C-terminal domain and mediating ubiquitylation at K1413, which leads to internalization and subsequent degradation of PTCH1. However, this role of ITCH appears not to be relevant in the context of SHH signaling at the primary cilium ( 61 ). We tested how loss of ITCH affects ciliary SMO localization in the absence and presence of PMA by subjecting 48 h serum-starved WT and Itch −/− cells to DMSO (vehicle) or PMA treatment for an additional 24 h, followed by IFM analysis using antibodies against SMO and the ciliary marker acetylated a-tubulin. Interestingly, while WT cells accumulated SMO within cilia only in the presence of PMA, as expected, the Itch −/− cells displayed significantly elevated ciliary levels of SMO under control conditions (DMSO treatment), and treatment with PMA did not lead to further ciliary accumulation of SMO in these cells (Figure S3). These results indicate that loss of ITCH leads to the constitutive accumulation of SMO in cilia, thereby expanding its already established role in regulating SHH signaling ( 33 ). However, the molecular mechanisms involved remain to be clarified. Conclusions In this study, we show that ALIX localizes to the base of or within primary cilia of multiple mammalian cell types, including mCCD, RPE1, and IMCD3 cells. This observation is consistent with previously published reports identifying ALIX in the centrosomes of Drosophila and mammalian cells ( 38 – 40 ), the ciliary proteome of mouse kidney epithelial cells ( 26 , 41 ), and isolated TZs or cilia-derived EVs from Chlamydomonas ( 36 , 37 ). By analyzing WT and relevant mutant and rescue lines, we furthermore demonstrate that the retention or stability of ALIX at a specific site at the ciliary base depends on KIF13B and ITCH, which, in turn, interact physically with each other to promote KIF13B-dependent recruitment or retention of ITCH at the ciliary base. Although more work will be needed to define the specific mechanism(s) by which KIF13B and ITCH regulate ALIX at the cilium, our results suggest a model whereby KIF13B initially recruits or retains ITCH at the ciliary base, which, in turn, is required for regulating ALIX stability or retention at this site. Since partial depletion of ALIX in mCCD cells causes a significant accumulation of PC2 within cilia over time but has no major impact on ciliary length and frequency, our results point toward a role for ALIX in promoting removal/retrieval of PC2 from the cilium. Time-dependent ciliary accumulation of PC2 was also observed for mCCD cells lacking KIF13B ( 23 ), while loss of ITCH in these cells caused PC2 depletion after both 24 and 72 h of starvation (this study), supporting that ALIX, KIF13B, and ITCH functionally interact to downregulate ciliary PC2 levels with effects that may vary over time. Such variation may, in part, be explained by the different methods used for protein depletion (gene knockout versus siRNA depletion), however, KIF13B and ITCH may also affect ciliary PC2 homeostasis independently of each other and of ALIX. In our previous work, we showed that Kif13b −/− mCCD cells initially accumulate PC2 within cilia, whereas prolonged serum starvation (72 h) reverses this phenotype and leads to excessive release of large EVs containing PC2 and other ciliary proteins from the mutant cells. We proposed that KIF13B promotes endocytic retrieval of PC2 and other proteins from cilia by a flotillin-dependent pathway, and when this pathway is defective, such proteins initially accumulate within cilia, but over time, the cells compensate by getting rid of excess ciliary components through the release of large EVs ( 23 ). Considering the well-described roles of ITCH and ALIX in EV cargo sorting and biogenesis ( 13 ), it will be interesting to investigate their involvement in ciliary protein retrieval and EV biogenesis in more detail in the future. In this context, it is notable that ITCH was shown to interact physically and functionally with NUMB ( 31 , 32 ), which localizes to the ciliary pocket, where it functions as an endocytic adaptor for clathrin-mediated endocytic retrieval of PTCH1 from the primary cilium ( 28 ). Hence, it will be relevant to explore if and how the effects of ITCH depletion on ciliary PC2 and SMO levels, described here, involve interaction between ITCH and NUMB in the context of endocytosis at the ciliary pocket region. Methods Cell lines and reagents. An overview of cell lines and reagents described in this study is shown in Table 1 . Immortalized WT mCCD cells were from Dr. Eric Féraille from University of Lausanne, Switzerland, and have been described previously ( 62 ), whereas Kif13b −/− and rescue mCCD cell lines were described in ( 23 ). Human embryonic kidney (HEK) 293T cells were from ATCC (cat. #CRL-3216); WT and Ift27 −/− and Arl6 −/− IMCD3 Flp-In cell lines were from Dr. Maxence Nachury from the University of California, San Francisco (UCSF), USA ( 48 ). hTERT-RPE1 cells with endogenously mNeonGreen- and TurboID-tagged ARL13B were provided by Drs. Stefanie Kuhns and Jens S. Andersen from University of Southern Denmark and have been described in ( 63 ). Table 1 Cell lines, reagents, and plasmids used in this study. Reagent type (species) or resource Designation Source or reference Identifiers Additional information Cell line ( Mus musculus ) mCCD Eric Féraille lab, University of Lausanne, Switzerland Wild type (parental) Cell line ( M. musculus ) mCCD Kif13b −/− ( 23 ) Pool Generated by CRISPR/Cas9 methodology Cell line ( M. musculus ) mCCD/mNG-KIF13B ( 23 ) Pool/rescue line Generated by lentiviral transduction Cell line ( M. musculus ) mCCD Kif13b −/− / mCherry-KIF13B ( 23 ) Pool/rescue line Generated by lentiviral transduction Cell line ( M. musculus ) mCCD Zdhhc5 −/− ( 23 ) Clone 22 Generated by CRISPR/Cas9 methodology Cell line ( M. musculus ) mCCD Itch −/− This study Clone 14 Generated by CRISPR/Cas9 methodology Cell line ( Homo sapiens ) HEK293T ATCC Cat# CRL-3216 Cell line ( H. sapiens ) hTERT-RPE1 mNG-endoARL13B-TurboID ( 63 ) Parental control Endogenous ARL13B tagged with mNG and TurboID Cell line ( H. sapiens ) hTERT-RPE1 mNG-endoARL13B-TurboID KIF13B −/− This study Clone A6 Generated by CRISPR/Cas9 methodology Cell line ( H. sapiens ) hTERT-RPE1 mNG-endoARL13B-TurboID KIF13B −/− /mCherry-KIF13B This study Clone A6/rescue line Generated by lentiviral transduction Cell line ( M. musculus ) IMCD3 Flp-In ( 48 ) Wild type (parental) Cell line ( M. musculus ) IMCD3 Flp-In Ift27 −/− ( 48 ) Ift27 −/− Cell line ( M. musculus ) IMCD3 Flp-In Arl6 −/− ( 48 ) Arl6 −/− Strain, strain background ( Escherichia coli ) DH10B Lab stock N/A Antibody Anti-acetylated alpha-tubulin (mouse monoclonal) Sigma-Aldrich Cat# T7451 IFM (1:2000) WB (1:5000) Antibody Anti-acetylated alpha-tubulin (rabbit monoclonal) Abcam Cat# ab179484 IFM (1:2000) Antibody Anti-AIP1 (ALIX; mouse monoclonal) BD Transduction Laboratories Cat# 611620 WB (1:1000) Antibody Anti-ALIX (rabbit polyclonal) Merck/Sigma-Aldrich Cat# ABC40 IFM (1:1000) WB (1:3000) Antibody Anti-ARL13B (rabbit polyclonal) Proteintech Cat# 17711-1-AP IFM (1:600) WB (1:600) Antibody Anti-CEP164 (rabbit polyclonal) Sigma-Aldrich Cat# HPA037606 IFM (1:500) Antibody Anti-FLAG (mouse monoclonal) Sigma-Aldrich Cat. #F1804 WB (1:1000) Antibody Anti-GAPDH (rabbit polyclonal) Cell Signaling Technology Cat# 2118 WB (1:1000) Antibody Anti-GFP (rabbit polyclonal) Sigma Cat# SAB4301138 WB (1:500) Antibody Anti-HA (rabbit polyclonal) Santa Cruz Biotechnology Cat#sc-805 WB (1:500) Antibody Anti-ITCH (rabbit polyclonal) ThermoFischer Scientific Cat# PA5-65539 IFM (1:200) WB (1:500) Antibody Anti-KIF13B (mouse monoclonal) Merck Cat# SAB1412812 WB (1:600) Antibody Anti-Mouse IgG 680 LI-COR Bioscience Cat# 925-68072 Secondary antibody WB (1:10000) Antibody Anti-Mouse IgG 800 LI-COR Bioscience Cat# 925-32212 Secondary antibody WB (1:10000) Antibody Anti-Myc (mouse monoclonal) Cell Signaling Technology Cat# 2276 WB (1:1000) Antibody Anti-PC2 (mouse monoclonal) Santa Cruz Cat# sc-28331 IFM (1:500) WB (1:1000) Antibody Anti-SMO Proteintech Cat# 20787-1-AP IFM (1:500) Antibody Anti-Rabbit IgG 680 LI-COR Bioscience Cat# 925-68073 Secondary antibody WB (1:10000) Chemical Reagent Lipofectamine 3000 Thermo Fisher Scientific Cat# L3000015 Chemical Reagent Purmorphamine Sigma-Aldrich Cat# SML0863 Dissolved in DMSO and used at 1 µM final concentration for 24 h Sequence-based reagent M. musculus Control siRNA Eurofins Genomics Control siRNA 5’- (GCCAUAGAGAUAAGGUAAGAA)TT-3’ Sequence-based reagent M. musculus ALIX siRNA Eurofins Genomics ALIX siRNA 5’- (AAUCUGAUCAUAAUACCUCAG)TT-3’ DNA plasmid pEGFP-C1 BD Biosciences Clontech Codes for EGFP, used for IP experiments DNA plasmid H. sapiens Dmotor-KIF13B-eGFP/pcDNA3 ( 68 ) Codes for GFP-tagged motorless KIF13B; used for IP experiments DNA plasmid H. sapiens KIF13B aa 1-557/pEGFP-N1 ( 64 ) KIF13B motor + FHA-GFP Codes for KIF13B residues 1-557 (motor and FHA domain) tagged with GFP at C-terminus, used for IP experiments DNA plasmid H. sapiens KIF13B aa 561–1826/pEGFP-C1 ( 49 ) GFP-KIF13B-Tail 6 Codes for GFP-KIF13B residues 561–1826, used for IP experiments DNA plasmid H. sapiens KIF13B aa 840–1826/pEGFP-C1 ( 64 ) GFP-KIF13B-Tail 5 Codes for GFP-KIF13B residues 840–1826, used for IP experiments DNA plasmid M. musculus ITCH/pCINeo-Myc ( 69 ); Addgene Cat. #11427 Codes for Myc-tagged ITCH, used for IP experiments DNA plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 Addgene Cat. # 62988 Other GFP-Trap Agarose ChromoTek GmbH Cat# gta-20 Cell culture conditions . WT, Kif13b −/− , and rescue mCCD cell lines were grown as described in ( 23 ); Itch −/− mCCD cells (see below) were cultured in a similar way. Cell culture procedures for HEK293T and IMCD3 cells were described in ( 41 ). hTERT-RPE1 cells with endogenously mNeonGreen- and TurboID-tagged ARL13B were cultured in 1x DMEM high glucose medium (Gibco, cat. #41966-029) supplemented with 10% FBS (Sigma, #F995) and 1% penicillin/streptomycin (Sigma, cat. #P0781). To induce ciliogenesis, serum starvation with 1x DMEM medium was done for 48 h before experiments. To activate Hedgehog signaling, the mCCD cells were incubated with 1 µM of PMA for 24 h in serum starvation medium, following an initial period of 48 h of serum starvation without PMA. Generation of Itch knockout kidney epithelial cell lines. For knockout of Itch in mCCD cells we used CRISPR/Cas9 methodology. A Mammalian CRISPR Vector (Dual gRNA) was customized from VectorBuilder using the function “Design My Vector” and purchased. The resulting plasmid encodes a Cas9-GFP fusion protein and two sgRNA against Itch from the VectorBuilder database (see Table 1 for specific sequences). Next, by following the manufacturer's instructions the plasmid was transfected into WT mCCD cells using Lipofectamine 3000 (Invitrogen, cat. #L3000015). On the following day, cells positive for GFP were sorted into single cells in a 96 well plate by using a FACS Aria III instrument. After reaching confluency, the cells were sub-cultured into two 96 well plates, one for screening the clones for ITCH depletion by western blot analysis, the other for keeping the clones in culture. One Itch knockout clone (clone number 14) was selected and used for this study. Generation of KIF13B −/− hTERT-RPE1 cells and rescue line expressing mCherry-KIF13B. Using a parental hTERT-RPE1 cell line expressing endogenously mNeonGreen- and TurboID-tagged ARL13B ( 63 ), KIF13B was knocked out using CRISPR/Cas9 methodology as described previously ( 64 ). For generation of a rescue line, KIF13B −/− cells (clone A6) were inoculated with lentiviruses carrying mCherry-KIF13B construct ( 23 ), and the cells were incubated with DMEM containing 10% FBS, 1% penicillin-streptomycin, and 5 µg/ml blasticidin at 37°C and 5% CO 2 . The next day, the blasticidin concentration was increased to 10 µg/ml. After 9 days of selection, cells expressing mCherry-KIF13B were sorted by FACS based on the mCherry fluorescence level. Gene silencing with siRNA. Gene silencing of ALIX was performed in mCCD cells using siRNA and Lipofectamine® 3000 (Thermo Fisher Scientific). mCCD WT cells were seeded in DMEM/F12 in 6-well plates and grown to approximately 70–80% confluency. Transfection was performed by combining 40 nM of either ALIX-specific or control siRNA (Table 1 ) and 7.5 µl Lipofectamine® 3000 (Thermo Fisher Scientific) in 250 µl serum-deprived DMEM/F12 medium and incubated for 15 min at room temperature prior to dropwise addition onto the cells. Subsequently, the medium was swirled gently to ensure proper dispersion before the cells were incubated at 37°C and 5% CO 2 . Transfection medium was removed after 24 h and cells were serum starved for either 24 or 72 h before being used for further experiments. Immunoprecipitation, SDS-PAGE and western blot analysis. Immunoprecipitation in HEK293T cells was carried out using relevant antibody-conjugated beads (see Table 1 ) as described previously ( 65 ) except that the washing buffer contained 0.1% NP-40 instead of 0.5% NP-40. For SDS-PAGE and western blotting, we used procedures that were described in ( 65 ) and employed antibodies and dilutions as listed in Table 1 . Uncropped western blots are shown in Figure S4. Immunofluorescence microscopy . mCCD cells were grown until they reached approximately 80% confluency. Subsequently, they were deprived of serum and hormones for either 24 or 72 h. Unless specified otherwise, cells were initially fixed using 4% paraformaldehyde (PFA) for 15 min at room temperature or 20 min at 4°C. This was followed by permeabilization with a solution of 1% bovine serum albumin (BSA) and 0.2% Triton X-100 in phosphate-buffered saline (PBS) for 12 min. The cells were then blocked with blocking buffer consisting of 2% BSA in PBS for 1 h at room temperature. Primary antibodies, diluted in 2% BSA in PBS were applied and left for 1–2 h at room temperature or overnight at 4°C. After washing with PBS several times, secondary antibodies, also diluted in 2% BSA in PBS, were added for a 1 h incubation at room temperature. Finally, the cell nuclei were stained using DAPI (Sigma-Aldrich, cat. #D9542). Coverslips were mounted onto slides with Shandon Immu-Mount (Thermo Scientific, cat. #9990402) with the addition of 0.5% N-propyl gallate. For staining PC2, a specific IFM protocol was employed as detailed in ( 66 ). This involved a pre-fixation with 0.4% PFA for 5 min at 37°C, followed by permeabilization with PHEM buffer (containing 50 mM PIPES; 50 mM HEPES; 10 mM MgCl 2 ; pH 6.9) with the addition of 0.5% Triton X-100 for 5 min at 37°C, and then a final fixation with 4% PFA for 15 min at room temperature. Imaging was done as described previously ( 41 ). Procedures for IFM analysis of RPE1 cells were as described in ( 65 ), using antibodies and dilutions listed in Table 1 . Quantitative and statistical analysis of IFM and western blot data . Image data from IFM was processed and analyzed quantitatively using methods previously described in ( 23 , 41 ). For quantitative western blot analysis, the average pixel intensity of the bands was measured using Fiji software ( 67 ). These measurements were then normalized against the loading control, and subsequent statistical analysis was performed using GraphPad Prism 10. All quantitative data are presented as mean ± standard deviation (SD). Unless otherwise noted, all the experiments were repeated in at least three independent biological replicates. Significance levels are indicated as follows: p > 0.05 not significant (ns), p ≤ 0.05 *, p ≤ 0.01, ** p ≤ 0.001 ***, p ≤ 0.0001, ****. Declarations Ethics approval and consent to participate Not applicable. Consent for publication All authors consent to this publication. Availability of data and materials Data sharing is not applicable to this article as no datasets were generated or analysed during the current study. Cell lines and reagents generated in this study are available from the corresponding author. Competing interest The authors declare no competing interests. Funding This study was supported by grants NNF18SA0032928 and NNF22OC0080406 from the Novo Nordisk Foundation, grant 2032-00115B from the Independent Research Fund Denmark, the TheRaCil consortium funded by the European Union (Horizon-health-2022-disease-06-two stage, grant 101080717), and grant CF22-0670 from the Carlsberg Foundation. Authors’ contributions CRB, JL, FC, ALWP, AMF, LEW, GL, SG, CKR performed experiments; CRB, JL, FC, ALWP, AMF, GL, BM, MC analyzed data; CRB, JL, FC, ALWP, AMF, BM, MC and LBP prepared the figures; LBP and HMS supervised students; LBP conceived the project and wrote the paper with input from all authors. LBP, STC, and ZA obtained funding for the study. Acknowledgements We thank Eric Féraille for mCCD cells, Maxence Nachury for IMCD3 cells, and Martin Berchtold for ALIX antibodies. We are grateful to Søren L. Johansen for technical support. References Anvarian Z, Mykytyn K, Mukhopadhyay S, Pedersen LB, Christensen ST. Cellular signalling by primary cilia in development, organ function and disease. Nat Rev Nephrol. 2019;15(4):199–219. Mill P, Christensen ST, Pedersen LB. Primary cilia as dynamic and diverse signalling hubs in development and disease. Nat Rev Genet. 2023;24(7):421–41. Reiter JF, Leroux MR. Genes and molecular pathways underpinning ciliopathies. Nat Rev Mol Cell Biol. 2017;18(9):533–47. Moran AL, Louzao-Martinez L, Norris DP, Peters DJM, Blacque OE. Transport and barrier mechanisms that regulate ciliary compartmentalization and ciliopathies. Nat Rev Nephrol. 2024;20(2):83–100. Wingfield JL, Lechtreck KF, Lorentzen E. Trafficking of ciliary membrane proteins by the intraflagellar transport/BBSome machinery. Essays Biochem. 2018;62(6):753–63. Nachury MV, Mick DU. Establishing and regulating the composition of cilia for signal transduction. Nat Rev Mol Cell Biol. 2019;20(7):389–405. Lacey SE, Pigino G. The intraflagellar transport cycle. Nat Rev Mol Cell Biol. 2024. Tian X, Zhao H, Zhou J. Organization, functions, and mechanisms of the BBSome in development, ciliopathies, and beyond. Elife. 2023;12. Wood CR, Rosenbaum JL. Ciliary ectosomes: transmissions from the cell's antenna. Trends Cell Biol. 2015;25(5):276–85. Wang J, Barr MM. Cell-cell communication via ciliary extracellular vesicles: clues from model systems. Essays Biochem. 2018;62(2):205–13. Ojeda Naharros I, Nachury MV. Shedding of ciliary vesicles at a glance. J Cell Sci. 2022;135(19). Luxmi R, King SM. Cilia-derived vesicles: An ancient route for intercellular communication. Semin Cell Dev Biol. 2022;129:82–92. Dixson AC, Dawson TR, Di Vizio D, Weaver AM. Context-specific regulation of extracellular vesicle biogenesis and cargo selection. Nat Rev Mol Cell Biol. 2023;24(7):454–76. Jeppesen DK, Zhang Q, Coffey RJ. Extracellular vesicles and nanoparticles at a glance. J Cell Sci. 2024;137(23). Phua SC, Chiba S, Suzuki M, Su E, Roberson EC, Pusapati GV et al. Dynamic Remodeling of Membrane Composition Drives Cell Cycle through Primary Cilia Excision. Cell. 2017;168(1–2):264 – 79 e15. Quarmby LM. Cellular deflagellation. Int Rev Cytol. 2004;233:47–91. Nabhan JF, Hu R, Oh RS, Cohen SN, Lu Q. Formation and release of arrestin domain-containing protein 1-mediated microvesicles (ARMMs) at plasma membrane by recruitment of TSG101 protein. Proc Natl Acad Sci U S A. 2012;109(11):4146–51. Wang Q, Lu Q. Plasma membrane-derived extracellular microvesicles mediate non-canonical intercellular NOTCH signaling. Nat Commun. 2017;8(1):709. Rauch S, Martin-Serrano J. Multiple interactions between the ESCRT machinery and arrestin-related proteins: implications for PPXY-dependent budding. J Virol. 2011;85(7):3546–56. O'Connor HF, Lyon N, Leung JW, Agarwal P, Swaim CD, Miller KM, et al. Ubiquitin-Activated Interaction Traps (UBAITs) identify E3 ligase binding partners. EMBO Rep. 2015;16(12):1699–712. Lee CP, Liu GT, Kung HN, Liu PT, Liao YT, Chow LP, et al. The Ubiquitin Ligase Itch and Ubiquitination Regulate BFRF1-Mediated Nuclear Envelope Modification for Epstein-Barr Virus Maturation. J Virol. 2016;90(20):8994–9007. Shen S, Cai D, Liang H, Zeng G, Liu W, Yan R, et al. NEDD4 family ubiquitin ligase AIP4 interacts with Alix to enable HBV naked capsid egress in an Alix ubiquitination-independent manner. PLoS Pathog. 2024;20(9):e1012485. Rezi CK, Frei A, Campestre F, Boldt K, Mary B, Fixdahl AM et al. KIF13B controls ciliary protein content by promoting endocytic retrieval and suppressing release of large extracellular vesicles from cilia. bioRxiv. 2025:2024.03.21.586066. Volz AK, Frei A, Kretschmer V, de Jesus Domingues AM, Ketting RF, Ueffing M, et al. Bardet-Biedl syndrome proteins modulate the release of bioactive extracellular vesicles. Nat Commun. 2021;12(1):5671. Hu J, Wittekind SG, Barr MM. STAM and Hrs down-regulate ciliary TRP receptors. Mol Biol Cell. 2007;18(9):3277–89. Mick DU, Rodrigues RB, Leib RD, Adams CM, Chien AS, Gygi SP, et al. Proteomics of Primary Cilia by Proximity Labeling. Dev Cell. 2015;35(4):497–512. Aslanyan MG, Doornbos C, Diwan GD, Anvarian Z, Beyer T, Junger K, et al. A targeted multi-proteomics approach generates a blueprint of the ciliary ubiquitinome. Front Cell Dev Biol. 2023;11:1113656. Liu X, Yam PT, Schlienger S, Cai E, Zhang J, Chen WJ, et al. Numb positively regulates Hedgehog signaling at the ciliary pocket. Nat Commun. 2024;15(1):3365. Kim J, Hsia EY, Brigui A, Plessis A, Beachy PA, Zheng X. The role of ciliary trafficking in Hedgehog receptor signaling. Sci Signal. 2015;8(379):ra55. Infante P, Faedda R, Bernardi F, Bufalieri F, Lospinoso Severini L, Alfonsi R, et al. Itch/beta-arrestin2-dependent non-proteolytic ubiquitylation of SuFu controls Hedgehog signalling and medulloblastoma tumorigenesis. Nat Commun. 2018;9(1):976. McGill MA, McGlade CJ. Mammalian numb proteins promote Notch1 receptor ubiquitination and degradation of the Notch1 intracellular domain. J Biol Chem. 2003;278(25):23196–203. Di Marcotullio L, Ferretti E, Greco A, De Smaele E, Po A, Sico MA, et al. Numb is a suppressor of Hedgehog signalling and targets Gli1 for Itch-dependent ubiquitination. Nat Cell Biol. 2006;8(12):1415–23. Infante P, Lospinoso Severini L, Bernardi F, Bufalieri F, Di Marcotullio L. Targeting Hedgehog Signalling through the Ubiquitylation Process: The Multiple Roles of the HECT-E3 Ligase Itch. Cells. 2019;8(2). Mukhopadhyay S, Rohatgi R. G-protein-coupled receptors, Hedgehog signaling and primary cilia. Semin Cell Dev Biol. 2014;33:63–72. Bangs F, Anderson KV. Primary Cilia and Mammalian Hedgehog Signaling. Cold Spring Harb Perspect Biol. 2017;9(5):a028175. Diener DR, Lupetti P, Rosenbaum JL. Proteomic analysis of isolated ciliary transition zones reveals the presence of ESCRT proteins. Curr Biol. 2015;25(3):379–84. Long H, Zhang F, Xu N, Liu G, Diener DR, Rosenbaum JL, et al. Comparative Analysis of Ciliary Membranes and Ectosomes. Curr Biol. 2016;26(24):3327–35. Carlton JG, Martin-Serrano J. Parallels between cytokinesis and retroviral budding: a role for the ESCRT machinery. Science. 2007;316(5833):1908–12. Morita E, Sandrin V, Chung HY, Morham SG, Gygi SP, Rodesch CK, et al. Human ESCRT and ALIX proteins interact with proteins of the midbody and function in cytokinesis. EMBO J. 2007;26(19):4215–27. Malerod L, Le Borgne R, Lie-Jensen A, Eikenes AH, Brech A, Liestol K, et al. Centrosomal ALIX regulates mitotic spindle orientation by modulating astral microtubule dynamics. EMBO J. 2018;37:13. Rezi CK, Aslanyan MG, Diwan GD, Cheng T, Chamlali M, Junger K, et al. DLG1 functions upstream of SDCCAG3 and IFT20 to control ciliary targeting of polycystin-2. EMBO Rep. 2024;25(7):3040–63. Khan A, Alaamery M, Massadeh S, Obaid A, Kashgari AA, Walsh CA, et al. PDCD6IP, encoding a regulator of the ESCRT complex, is mutated in microcephaly. Clin Genet. 2020;98(1):80–5. Campos Y, Qiu X, Gomero E, Wakefield R, Horner L, Brutkowski W, et al. Alix-mediated assembly of the actomyosin-tight junction polarity complex preserves epithelial polarity and epithelial barrier. Nat Commun. 2016;7:11876. Laporte MH, Chatellard C, Vauchez V, Hemming FJ, Deloulme JC, Vossier F, et al. Alix is required during development for normal growth of the mouse brain. Sci Rep. 2017;7:44767. Phan TP, Holland AJ. Time is of the essence: the molecular mechanisms of primary microcephaly. Genes Dev. 2021;35(23–24):1551–78. Andreu-Cervera A, Catala M, Schneider-Maunoury S. Cilia, ciliopathies and hedgehog-related forebrain developmental disorders. Neurobiol Dis. 2021;150:105236. Eguether T, San Agustin JT, Keady BT, Jonassen JA, Liang Y, Francis R, et al. IFT27 links the BBSome to IFT for maintenance of the ciliary signaling compartment. Dev Cell. 2014;31(3):279–90. Liew GM, Ye F, Nager AR, Murphy JP, Lee JS, Aguiar M, et al. The Intraflagellar Transport Protein IFT27 Promotes BBSome Exit from Cilia through the GTPase ARL6/BBS3. Dev Cell. 2014;31(3):265–78. Morthorst SK, Nielsen C, Farinelli P, Anvarian Z, Rasmussen CBR, Serra-Marques A et al. Angiomotin isoform 2 promotes binding of PALS1 to KIF13B at primary cilia and regulates ciliary length and signaling. J Cell Sci. 2022;135(12). Wang C, An J, Zhang P, Xu C, Gao K, Wu D, et al. The Nedd4-like ubiquitin E3 ligases target angiomotin/p130 to ubiquitin-dependent degradation. Biochem J. 2012;444(2):279–89. Adler JJ, Heller BL, Bringman LR, Ranahan WP, Cocklin RR, Goebl MG, et al. Amot130 adapts atrophin-1 interacting protein 4 to inhibit yes-associated protein signaling and cell growth. J Biol Chem. 2013;288(21):15181–93. Vietri M, Radulovic M, Stenmark H. The many functions of ESCRTs. Nat Rev Mol Cell Biol. 2020;21(1):25–42. Huangfu D, Liu A, Rakeman AS, Murcia NS, Niswander L, Anderson KV. Hedgehog signalling in the mouse requires intraflagellar transport proteins. Nature. 2003;426:83–7. Corbit KC, Aanstad P, Singla V, Norman AR, Stainier DY, Reiter JF. Vertebrate Smoothened functions at the primary cilium. Nature. 2005;437(7061):1018–21. Rohatgi R, Milenkovic L, Scott MP. Patched1 regulates hedgehog signaling at the primary cilium. Science. 2007;317(5836):372–6. Sinha S, Chen JK. Purmorphamine activates the Hedgehog pathway by targeting Smoothened. Nat Chem Biol. 2006;2(1):29–30. Shinde SR, Nager AR, Nachury MV. Ubiquitin chains earmark GPCRs for BBSome-mediated removal from cilia. J Cell Biol. 2020;219(12). Desai PB, Stuck MW, Lv B, Pazour GJ. Ubiquitin links smoothened to intraflagellar transport to regulate Hedgehog signaling. J Cell Biol. 2020;219(7). Lv B, Stuck MW, Desai PB, Cabrera OA, Pazour GJ. E3 ubiquitin ligase Wwp1 regulates ciliary dynamics of the Hedgehog receptor Smoothened. J Cell Biol. 2021;220(9). Lv B, Zhang XO, Pazour GJ. Arih2 regulates Hedgehog signaling through smoothened ubiquitylation and ER-associated degradation. J Cell Sci. 2022;135(16). Chen XL, Chinchilla P, Fombonne J, Ho L, Guix C, Keen JH, et al. Patched-1 proapoptotic activity is downregulated by modification of K1413 by the E3 ubiquitin-protein ligase Itchy homolog. Mol Cell Biol. 2014;34(20):3855–66. Montesano R, Ghzili H, Carrozzino F, Rossier BC, Feraille E. cAMP-dependent chloride secretion mediates tubule enlargement and cyst formation by cultured mammalian collecting duct cells. Am J Physiol Ren Physiol. 2009;296(2):F446–57. Kuhns S, Juhl AD, Anvarian Z, Wustner D, Pedersen LB, Andersen JS. Endogenous Tagging of Ciliary Genes in Human RPE1 Cells for Live-Cell Imaging. Methods Mol Biol. 2024;2725:147–66. Schou KB, Mogensen JB, Morthorst SK, Nielsen BS, Aleliunaite A, Serra-Marques A, et al. KIF13B establishes a CAV1-enriched microdomain at the ciliary transition zone to promote Sonic hedgehog signalling. Nat Commun. 2017;8:14177. Goncalves AB, Hasselbalch SK, Joensen BB, Patzke S, Martens P, Ohlsen SK et al. CEP78 functions downstream of CEP350 to control biogenesis of primary cilia by negatively regulating CP110 levels. Elife. 2021;10. He K, Ma X, Xu T, Li Y, Hodge A, Zhang Q, et al. Axoneme polyglutamylation regulated by Joubert syndrome protein ARL13B controls ciliary targeting of signaling molecules. Nat Commun. 2018;9(1):3310. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9(7):676–82. Lamason RL, Kupfer A, Pomerantz JL. The dynamic distribution of CARD11 at the immunological synapse is regulated by the inhibitory kinesin GAKIN. Mol Cell. 2010;40(5):798–809. Magnifico A, Ettenberg S, Yang C, Mariano J, Tiwari S, Fang S, et al. WW domain HECT E3s target Cbl RING finger E3s for proteasomal degradation. J Biol Chem. 2003;278(44):43169–77. Additional Declarations No competing interests reported. Supplementary Files SupplementalFigures180825.pdf SupplementaryFigureCaptions.docx Cite Share Download PDF Status: Published Journal Publication published 25 Feb, 2026 Read the published version in BMC Molecular and Cell Biology → Version 1 posted Editorial decision: Revision requested 16 Dec, 2025 Reviews received at journal 09 Dec, 2025 Reviewers agreed at journal 15 Nov, 2025 Reviews received at journal 04 Oct, 2025 Reviewers agreed at journal 03 Sep, 2025 Reviewers invited by journal 01 Sep, 2025 Editor assigned by journal 19 Aug, 2025 Submission checks completed at journal 19 Aug, 2025 First submitted to journal 14 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7376140","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":545808860,"identity":"e31de894-aa50-45cb-afa6-43f87b76e49f","order_by":0,"name":"Christina Rahlff Berggreen","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Christina","middleName":"Rahlff","lastName":"Berggreen","suffix":""},{"id":545808861,"identity":"d56e457f-b8b1-40f3-9bb2-899610695f14","order_by":1,"name":"Julie Laplace","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Julie","middleName":"","lastName":"Laplace","suffix":""},{"id":545808862,"identity":"5aef3abe-a0d4-4e5d-99f2-619bf066ac6a","order_by":2,"name":"Fabiola Campestre","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Fabiola","middleName":"","lastName":"Campestre","suffix":""},{"id":545808863,"identity":"aaba2bb9-c0c7-4188-a73e-7a2866c83d3a","order_by":3,"name":"Anna-Louise With Petersen","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Anna-Louise","middleName":"With","lastName":"Petersen","suffix":""},{"id":545808864,"identity":"6c48e31e-096a-4cae-8960-04891c3a3636","order_by":4,"name":"Anna Maria Fixdahl","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Anna","middleName":"Maria","lastName":"Fixdahl","suffix":""},{"id":545808865,"identity":"67507d00-4af8-4cf7-ad22-cbcc0dd94c3d","order_by":5,"name":"Benjamin Mary","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Benjamin","middleName":"","lastName":"Mary","suffix":""},{"id":545808866,"identity":"1bd7965b-30b0-4b47-a75f-efba1f7e60ff","order_by":6,"name":"Saba Ghazanfar","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Saba","middleName":"","lastName":"Ghazanfar","suffix":""},{"id":545808867,"identity":"8749e123-2de2-4e68-a798-79a4134dacee","order_by":7,"name":"Geyi Li","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Geyi","middleName":"","lastName":"Li","suffix":""},{"id":545808868,"identity":"ca1ea320-6954-486d-8770-2e05fb7b2dc4","order_by":8,"name":"Lotta Elisabeth Wagner","email":"","orcid":"","institution":"Johannes Gutenberg-University","correspondingAuthor":false,"prefix":"","firstName":"Lotta","middleName":"Elisabeth","lastName":"Wagner","suffix":""},{"id":545808869,"identity":"6c2165f2-5642-49c0-b52e-b3e3a4e292a2","order_by":9,"name":"Csenge K. Rezi","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Csenge","middleName":"K.","lastName":"Rezi","suffix":""},{"id":545808870,"identity":"b5f6cd36-f04b-4112-970e-bd85267858a4","order_by":10,"name":"Mohamed Chamlali","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"","lastName":"Chamlali","suffix":""},{"id":545808871,"identity":"e1362d8f-437f-47e7-95f8-25dd15b95f33","order_by":11,"name":"Zeinab Anvarian","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Zeinab","middleName":"","lastName":"Anvarian","suffix":""},{"id":545808872,"identity":"db7fd5de-7385-4371-a635-0ac690930ada","order_by":12,"name":"Søren T. Christensen","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Søren","middleName":"T.","lastName":"Christensen","suffix":""},{"id":545808873,"identity":"d2113582-2f3f-4290-a6bf-d024eea2a397","order_by":13,"name":"Helen L. May-Simera","email":"","orcid":"","institution":"Johannes Gutenberg-University","correspondingAuthor":false,"prefix":"","firstName":"Helen","middleName":"L.","lastName":"May-Simera","suffix":""},{"id":545808874,"identity":"cdab2f11-e3f7-4e04-820d-3dd605641c8c","order_by":14,"name":"Lotte B. Pedersen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3klEQVRIiWNgGAWjYBACPgkgwQNmMh9jSGBgMACyjPFqYUNoYUsjWQuPGYgkQot078EHbyru2fNL93x78KCCwdjgAPNmA7xaZM4lG845U5w4c87Z7QYJZxjMDA6wFSfgd1iOmTRvW0KCwY3cbRKJbQw2Bgd4jA8Q0GL+m/dfgr39jZxnRGsxY+ZtSGDcIJHDBtJiBtKC32FAv0jOOZaQOONGmjnQLxLGkofZivF6nx8YYh/e1CTY889IfvbwR4WNYd/x5s0S+LTAIgUGgIqZ8avH0DIKRsEoGAWjABMAAMHhQ17RZM04AAAAAElFTkSuQmCC","orcid":"","institution":"University of Copenhagen","correspondingAuthor":true,"prefix":"","firstName":"Lotte","middleName":"B.","lastName":"Pedersen","suffix":""}],"badges":[],"createdAt":"2025-08-14 17:53:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7376140/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7376140/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12860-026-00571-1","type":"published","date":"2026-02-25T15:58:01+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":96707192,"identity":"f82a0340-a1b7-4b2a-b493-8ecef673d6d2","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":228118,"visible":true,"origin":"","legend":"","description":"","filename":"Berggreenetalmanuscript180825.docx","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/c6976fb2326edb9fdd90c0de.docx"},{"id":96707193,"identity":"46c549bd-52ef-4574-bf13-3a204ec4740a","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"json","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13974,"visible":true,"origin":"","legend":"","description":"","filename":"6e7b6eb182644476b934b37402f22cab.json","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/936399a01020763e04ab555c.json"},{"id":96707196,"identity":"18899bad-6426-4cf4-9d62-f19f4c420571","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"pdf","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9617088,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalFigures180825.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/1803cc7a580872bde421ba19.pdf"},{"id":96707194,"identity":"ea13fd5d-22e2-4d86-9270-b4a8684f54ed","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"xml","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":171497,"visible":true,"origin":"","legend":"","description":"","filename":"6e7b6eb182644476b934b37402f22cab1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/4cf96e38fe75e069fed70bb1.xml"},{"id":96707203,"identity":"02b83228-fa57-4468-b57b-07bf7cffe109","added_by":"auto","created_at":"2025-11-25 09:33:48","extension":"eps","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11056930,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1130525.eps","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/d2cfce5270a9fab9d5229500.eps"},{"id":96711555,"identity":"189108c2-0c21-48c7-86f1-9bbec3d779d6","added_by":"auto","created_at":"2025-11-25 10:12:12","extension":"eps","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10594726,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2RPE1130525.eps","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/b1c60b719456d4c3cebcf28c.eps"},{"id":96707201,"identity":"e4cc11f4-aa82-40b4-9205-16020ebce4db","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"eps","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":27502136,"visible":true,"origin":"","legend":"","description":"","filename":"Figure307082025.eps","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/43dd4ceddf677449c365a05c.eps"},{"id":96707199,"identity":"3f549e04-bb11-497f-ba01-fc35979a3915","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"eps","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5114194,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4090725.eps","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/b0de2d991cb74489ffd3df09.eps"},{"id":96707195,"identity":"816ba370-f586-423c-9df1-4fe6a85c3af4","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"eps","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4961654,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5140525gray.eps","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/7b9e9ea3684e568d0a9ea8a4.eps"},{"id":96707198,"identity":"682fce44-4201-4a89-9f21-c606a0f3182e","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"xml","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":170297,"visible":true,"origin":"","legend":"","description":"","filename":"6e7b6eb182644476b934b37402f22cab1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/54a4ed68b4104450dc1e8777.xml"},{"id":96707197,"identity":"fd8d018c-2a05-4f1f-8a34-09030d2436f5","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"html","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":182857,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/f253f1afa2bafd06b8805e83.html"},{"id":96707186,"identity":"743c023e-5d0f-4d05-97f7-12f7dba871d8","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":354393,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCiliary localization of ALIX in mCCD cells. \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Representative IFM images of cilia in indicated mCCD cell lines after 72 h of serum starvation and staining with antibodies against acetylated a-tubulin (AcTub; red) and ALIX (green). mCh-KIF13B, mCherry-KIF13B. (\u003cstrong\u003eb\u003c/strong\u003e) Quantification of relative ALIX level at the ciliary base in the indicated mCCD cell lines subjected to 24 or 72 h of serum starvation, based on images shown in (a). Rescue corresponds to the \u003cem\u003eKif13b\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e line stably expressing either mNG-KIF13B or mCherry-KIF13B (23). Mean fluorescence intensity (MFI) of ALIX at the ciliary base was measured for 40-50 cilia per cell line per experiment and normalized to the WT mean (n=5 for the 72 h time points; n=2 for the 24 h time point). Error bars represent SD. Statistical significance was determined using an unpaired ANOVA test. a.u., arbitrary units. (\u003cstrong\u003ec\u003c/strong\u003e) WT, \u003cem\u003eKif13b\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e and rescue (Resc.) mCCD cell lines serum starved for 24 or 72 h and analyzed by western blotting for ALIX. Please note that the GAPDH blot (loading control) was reproduced from (23). Molecular mass markers are shown in kDa to the left.\u003c/p\u003e","description":"","filename":"fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/962557ba250d307eb4778e57.jpg"},{"id":96707187,"identity":"68b46844-a014-498a-96ff-a4d74f058624","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":233862,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eALIX localizes to the ciliary base of RPE1 cells. (a) \u003c/strong\u003eWestern blot of parental (WT), \u003cem\u003eKIF13B\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e, and rescue RPE1 cell lines using antibodies against KIF13B, ALIX, and DCTN1 (loading control). Molecular mass markers are shown in kDa to the left.\u003cstrong\u003e (b) \u003c/strong\u003eIFM of cilia from the indicated RPE1 cell lines following 48 h of serum deprivation. Cells were stained with antibodies against acetylated α-tubulin (AcTub; magenta), ALIX (green), and RPGRIP1L (cyan).\u003cstrong\u003e (c) \u003c/strong\u003eQuantification of ALIX levels at the ciliary base, based on images as in (b).\u003cstrong\u003e \u003c/strong\u003eThe MFI of ALIX at the ciliary base was measured for 40-50 cilia per cell line per experiment (n=3) and normalized to that of the WT mean. Error bars represent SD. Statistical significance was determined using an unpaired ANOVA test. a.u., arbitrary units.\u003c/p\u003e","description":"","filename":"fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/5f78042ad14eccab16f06897.jpg"},{"id":96707188,"identity":"4967a254-f2fe-4bf5-8545-5d3b547b55e1","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":720233,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eITCH binds to KIF13B and localizes to the ciliary base\u003c/strong\u003e. (\u003cstrong\u003ea\u003c/strong\u003e) Immunoprecipitation (IP) of HEK293T cells co-expressing the indicated GFP-tagged KIF13B fusion proteins or GFP alone and Myc-ITCH. Cell lysates were subjected to anti-GFP IP, and pellet and input samples were analyzed by SDS-PAGE and western blotting with anti-GFP or anti-Myc antibodies. Molecular mass markers are shown in kDa to the left. (\u003cstrong\u003eb\u003c/strong\u003e) Schematic of KIF13B domain structure and plasmids used. Adapted from (49). (\u003cstrong\u003ec\u003c/strong\u003e) IFM analysis of the indicated mCCD cell lines after 24 or 72 h of serum starvation, stained for acetylated a-tubulin (AcTub; red) and ITCH (green). The ciliary base is marked with asterisk. mCh-KIF13B: mCherry-KIF13B. (\u003cstrong\u003ed\u003c/strong\u003e) Quantification of relative ITCH staining intensities at the ciliary base of the indicated mCCD cell lines, based on images as shown in (c). The MFI of ITCH at the ciliary base was measured for 40-50 cilia per cell line per experiment and normalized to the WT mean (n=3). Error bars represent SD. Statistical significance was determined using Kruskal-Wallis test. a.u., arbitrary units. (\u003cstrong\u003ee\u003c/strong\u003e) The indicated mCCD cell lines were serum starved for 24 or 72 h and analyzed by western blotting for ITCH and DCTN (loading control). Molecular mass markers are shown in kDa on the left.\u003c/p\u003e","description":"","filename":"fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/870534cbbfdda29e49f51f37.jpg"},{"id":96711316,"identity":"0d768dee-8ebb-4402-a4db-0a2a2e5fb54a","added_by":"auto","created_at":"2025-11-25 10:11:52","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":465479,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eITCH regulates ciliary ALIX levels in mCCD cells\u003c/strong\u003e. (\u003cstrong\u003ea\u003c/strong\u003e) IFM of WT and \u003cem\u003eItch\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e mCCD cells following 24 or 72 h of serum deprivation. Cells were stained with antibodies against acetylated α-tubulin (AcTub; magenta) and ALIX (green). Asterisks mark the ciliary base. \u003cstrong\u003e(b) \u003c/strong\u003eQuantification of ALIX levels at the ciliary base, based on images as in (a).\u003cstrong\u003e \u003c/strong\u003eThe MFI of ALIX at the ciliary base was measured for 40-50 cilia per cell line per experiment (n=3) and normalized to that of the WT mean. (\u003cstrong\u003ec\u003c/strong\u003e) Western blot analysis of WT and\u003cem\u003e Itch\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e cells using the indicated antibodies; molecular mass markers are shown in kDa on the left. (\u003cstrong\u003ed\u003c/strong\u003e) Quantification of relative cellular levels of ALIX, based on western blots as shown in (c). The ALIX band intensity was measured and normalized to that of GAPDH (n=2). Error bars represent SD. Statistical significance was determined using an unpaired ANOVA test. a.u., arbitrary units.\u003c/p\u003e","description":"","filename":"fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/93ee398c1c2a8238d84dee00.jpg"},{"id":96711289,"identity":"3d3dc180-bba5-477b-9d5e-06f530ac63e1","added_by":"auto","created_at":"2025-11-25 10:11:51","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":270737,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eALIX regulates ciliary PC2 levels in mCCD cells.\u003c/strong\u003e (\u003cstrong\u003ea\u003c/strong\u003e) Western blot analysis (upper panel) of mCCD cells treated with siRNA against ALIX (siALIX) or control siRNA (siCtrl) and subjected to 24 or 72 h of serum starvation, as indicated. Blots were probed with antibodies against ALIX or GAPDH (loading control). (\u003cstrong\u003eb\u003c/strong\u003e) Quantification of relative cellular ALIX levels under the indicated conditions, based on western blots as in panel a (n=3). (\u003cstrong\u003ec\u003c/strong\u003e) Representative IFM images of siCtrl- and siALIX-treated mCCD cells after 24 or 72 h of serum starvation and staining with antibodies against ARL13B and PC2; asterisk marks the ciliary base. (\u003cstrong\u003ed, e\u003c/strong\u003e) Ciliary frequency (\u003cstrong\u003ed\u003c/strong\u003e) and length (\u003cstrong\u003ee\u003c/strong\u003e) of siCtrl- and siALIX-treated mCCD cells after 24 or 72 h of serum starvation were determined based on images shown in panel c (n=3), analyzing at least 100 cells per condition per experiment for ciliary frequency, and 40-50 cilia per condition per experiment for ciliary length (n=3). (\u003cstrong\u003ef\u003c/strong\u003e) Relative ciliary PC2 levels of siCtrl- and siALIX-treated mCCD cells after 24 or 72 h of serum starvation and staining with antibodies against ARL13B and PC2. MFI of PC2 in cilia was measured for 40-50 cilia per condition per experiment and normalized to the mean value for siCtrl at 24 h (n=3). Error bars represent SD. Statistical significance was determined using an unpaired ANOVA test. a.u., arbitrary units.\u003c/p\u003e","description":"","filename":"fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/4164cb80a19e3525a928ca3a.jpg"},{"id":103766242,"identity":"61a10030-420f-40b6-afbd-0d69ed274243","added_by":"auto","created_at":"2026-03-02 16:13:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3384459,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/5608bc94-2f47-43c4-b657-d6fe22018c43.pdf"},{"id":96707202,"identity":"81e81c3f-e7fa-454e-a2f0-d520aa7def2b","added_by":"auto","created_at":"2025-11-25 09:33:47","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":9617088,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalFigures180825.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/96f14f62b37fc0e03daf003a.pdf"},{"id":96711081,"identity":"cc18f09b-f901-49fe-a1ff-735eea63bcc6","added_by":"auto","created_at":"2025-11-25 10:11:36","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":16251,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigureCaptions.docx","url":"https://assets-eu.researchsquare.com/files/rs-7376140/v1/d6be49e50268548fc523b46c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"ALIX and ITCH localize to the base of primary cilia and negatively regulate ciliary Polycystin-2 levels","fulltext":[{"header":"Background","content":"\u003cp\u003eCilia are dynamic, surface-exposed organelles that play pivotal roles in cell motility, fluid flow regulation, and sensory signaling of many eukaryotic cell types and organisms, ranging from the green alga \u003cem\u003eChlamydomonas\u003c/em\u003e to nematodes and humans. Both motile (9\u0026thinsp;+\u0026thinsp;2) and non-motile (9\u0026thinsp;+\u0026thinsp;0) cilia, such as primary cilia, are composed of a microtubule-based core, the axoneme, which is templated by a centriole-derived basal body and ensheathed by a lipid bilayer membrane enriched with specific receptors and ion channels that function in signaling. In vertebrates, primary cilia are critical for mediating several signaling pathways, most notably the Sonic hedgehog (SHH) pathway and signaling via the polycystin-1 (PC1) and polycystin-2 (PC2) cation channel complex, the latter of which is implicated in autosomal dominant (AD) polycystic kidney disease (PKD) (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eCilia are compartmentalized organelles whose assembly, disassembly and composition are tightly regulated in response to cellular and environmental cues. This regulation is essential for controlling downstream cilia-dependent processes during development and homeostasis of tissues and organs. Consequently, mutations that perturb ciliary structure or composition can result in a broad spectrum of disorders known as ciliopathies; over 35 severe, pleiotropic diseases that include ADPKD and Bardet-Bield Syndrome (BBS) (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Although the ciliary membrane is continuous with the plasma membrane, ciliary compartmentalization is maintained by the transition zone (TZ), which acts as a selective gate at the proximal part of the cilium (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Additionally, the targeted trafficking of proteins into and out of cilia is mediated by the intraflagellar transport (IFT) system, along with associated cargo adaptors such as the BBSome, a complex of ciliary proteins encoded by genes mutated in BBS (\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Beyond trafficking, increasing evidence indicates that both motile and non-motile cilia release extracellular vesicles (EVs), which may serve roles in clearing ciliary components and facilitating intercellular communication (\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eVirtually all cells release EVs that transport macromolecules that can regulate physiological and pathological processes (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). EVs are generally classified into two major subtypes based on their biogenesis: exosomes, which are small vesicles (ca. 50\u0026ndash;150 nm in diameter) originating from the endosomal system via multivesicular bodies (MVBs), and ectosomes, which range from ca. 100 nm to several micrometers in size and are formed by direct outward budding and scission from the plasma membrane. Alternative classification categorizes these EVs based on size, distinguishing between small and large EVs, respectively, since it is almost impossible to distinguish the two types upon cellular release. Under this system, exosomes fall into the small EV category, while ectosomes can encompass both small and large EV populations (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). In the context of cilia, the ciliary membrane is thought to predominantly release large EVs, which are formed by outward budding of the ciliary membrane, mechanistically similar to ectosome formation at the plasma membrane (\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Furthermore, during ciliary shortening or disassembly, EV-like particles can be shed through specialized processes such as decapitation, involving loss of the ciliary tip (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e) or autotomy, in which the entire cilium is released (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSeveral cellular pathways that regulate the sorting of cargo into small EVs and their biogenesis exist. These include: (i) the ESCRT (Endosomal Sorting Complex Required for Transport) pathway, which is initiated by HGS- and STAM-mediated recognition and sorting of ubiquitylated EV cargo; (ii) the ALIX-syntenin pathway; and (iii) the neutral sphingomyelinase (N-SMase)/ceramide-dependent pathway, in which cargo is concentrated within flotillin- and cholesterol-enriched membrane microdomains (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Components of these pathways may also contribute to the formation of large EVs, or ectosomes, which typically originate from actin-driven membrane blebs that are subsequently excised and shed as large EVs or ectosomes (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). An additional mechanism for large EV formation is the ARMMs (ARrestin domain-containing protein 1-Mediated Microvesicles) pathway, which involves several key proteins, including the ubiquitin E3 ligase ITCH (also known as AIP4), the palmitoyl transferase ZDHHC5, and the ESCRT-1 component TSG101 (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Notably, ARMMs components such as ITCH physically and functionally interact with ALIX, an ESCRT-associated protein implicated in both exosome and ectosome biogenesis (\u003cspan additionalcitationids=\"CR20 CR21\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). ITCH also binds to the ESCRT-0 subunits HGS and STAM (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e), highlighting the extensive crosstalk and functional versatility among components of the EV biogenesis machinery.\u003c/p\u003e\u003cp\u003eIn a previous study, we showed that the ESCRT-0 protein HGS and the ARMMS pathway component ZDHHC5 localize to primary cilia of cultured mouse cortical collecting duct (mCCD) cells and are released in small EVs, along with ITCH, in a manner dependent on the ciliary kinesin-3 motor protein KIF13B (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Conversely, HGS, ZDHHC5 and ITCH were found to be enriched in small EVs isolated from \u003cem\u003eBbs4\u003c/em\u003e or \u003cem\u003eBbs6\u003c/em\u003e mutant kidney epithelial cells, compared to small EVs from control cells (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Moreover, both HGS and ZDHHC5 accumulated within cilia of BBSome-deficient cells (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), and their depletion disrupted the ciliary localization or homeostasis of PC2 (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). These findings suggest that components of the ESCRT and ARMMs pathways may operate in parallel to regulate ciliary membrane protein composition. In support of this idea, ITCH was identified in the ciliary proteome of several cells types, including kidney epithelial cells (\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e), and has been reported to interact with key SHH signaling proteins such as the SHH receptor PTCH1 (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e), SUFU (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e), NUMB (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e) and GLI1 (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). GLI1 functions a transcriptional effector downstream of Smoothened (SMO), a class F G protein-coupled receptor and a central activator in the SHH signaling pathway (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Nevertheless, specific ciliary functions for ITCH have so far not been defined.\u003c/p\u003e\u003cp\u003eIn addition, ALIX has been detected in the ciliary TZ and EVs of \u003cem\u003eChlamydomonas\u003c/em\u003e cells (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e), but its localization to and function at the primary cilium in vertebrates remain unclear. Notably, ALIX localizes to centrosomes in both \u003cem\u003eDrosophila\u003c/em\u003e and mammalian cells (\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e) and has been identified in the primary cilia proteome of cultured mouse kidney epithelial cells (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). Genetic evidence also supports a potential ciliary role: a homozygous frameshift mutation in \u003cem\u003ePDCD6IP\u003c/em\u003e (encoding ALIX) has been linked to primary microcephaly in humans (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e), and \u003cem\u003eAlix\u003c/em\u003e knockout mice exhibit hydrocephalus and other brain malformations (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e), phenotypes commonly associated with centrosomal and ciliary defects (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e). Together, these findings point to possible, yet unexplored, ciliary functions for ALIX and ITCH.\u003c/p\u003e\u003cp\u003eIn this study, we show that ALIX localizes to the base of, and within, primary cilia across multiple mammalian cell types, and that its retention at the cilium is promoted by KIF13B. Moreover, we provide evidence that KIF13B may regulate ALIX indirectly via ITCH, which also localizes to the ciliary base and is required for ALIX stability. Supporting functional roles for both proteins a the cilium, depletion of either ALIX or ITCH results in elevated ciliary levels of PC2 and SMO. Together, our findings uncover ALIX and ITCH as novel regulators of ciliary membrane protein homeostasis and signaling and offer new insight into the molecular mechanisms that maintain ciliary composition and function.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eALIX localizes to the base of primary cilia in a KIF13B-dependent manner\u003c/h2\u003e\u003cp\u003eGiven the reports hinting at conserved ciliary or centrosomal functions for ALIX, we investigated whether it localizes to primary cilia of cultured mammalian cells. We first performed immunofluorescence microscopy (IFM) analysis of 24 or 72 h serum-starved wild-type (WT) mCCD cells using antibodies against endogenous ALIX and the ciliary marker acetylated a-tubulin and found that ALIX is localized at the base of primary cilia in these cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea), which is in line with earlier work identifying ALIX in the TZ proteome of \u003cem\u003eChlamydomonas\u003c/em\u003e (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). Interestingly, when we analyzed our previously described \u003cem\u003eKif13b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e and rescue mCCD cell lines (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e) in a similar way, we found that loss of KIF13B leads to depletion of ALIX from the ciliary base over time compared to the WT and rescue lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b); overall cellular levels of ALIX were not affected in the mutant cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). These results suggest that while KIF13B is not required for the initial recruitment of ALIX to the ciliary base, it is essential for its retention at this site. To test if this phenotype is specific to mCCD cells, we performed similar analyses in WT, \u003cem\u003eKIF13B\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e, and rescue hTERT-immortalized retinal pigment epithelial (RPE)1 cell lines that were serum-starved for 48 h to induce ciliogenesis. Western blot analysis using a KIF13B-specific antibody confirmed the successful knockout of \u003cem\u003eKIF13B\u003c/em\u003e in the RPE1 cells, as well as a near-endogenous level of expression of mCherry-KIF13B in the rescue line (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Furthermore, IFM analysis demonstrated that ALIX localizes to the ciliary base of RPE1 cells and is partially depleted from this site upon loss of KIF13B (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, c), reminiscent of our results in mCCD cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b). Overall cellular levels of ALIX were similar between WT and \u003cem\u003eKIF13B\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e RPE1 cells, as demonstrated by western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Moreover, by co-staining for the TZ marker RPGRIP1L, we found that ALIX primarily localizes at the basal body, below the ciliary TZ, and the adjacent daughter centriole although co-localization of ALIX with RPGRIP1L at the TZ was occasionally observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, asterisk).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eA previous study identified ALIX in the ciliary proteome of mouse inner medullary collecting duct (IMCD)3 cells, where it appeared to accumulate upon loss of IFT27 (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e), a component of the IFT-B subcomplex thought to function together with the BBSome and retrograde IFT machinery during ciliary membrane protein export (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). To explore this further, we analyzed ALIX localization by IFM in serum-starved WT and \u003cem\u003eIft27\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e IMCD3 cells. As seen in mCCD and RPE1 cells, ALIX localized to primary cilia of both WT and \u003cem\u003eIft27\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e IMCD3 cells, predominantly at the ciliary base, but sometimes also along the cilium itself (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ea, b). However, in contrast to our results obtained for mCCD or RPE1 cells lacking KIF13B (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), the ciliary localization pattern of ALIX was similar in WT and \u003cem\u003eIft27\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ea, b), and total cellular levels of ALIX were also comparable between these two cell lines (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ec). In summary, these results indicate that ALIX localizes to the base of primary cilia in multiple cell types and that KIF13B, but not IFT27, is required for its retention at this site.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eITCH interacts with KIF13B and regulates ciliary ALIX levels\u003c/h3\u003e\n\u003cp\u003eWe then investigated the mechanism by which KIF13B may promote the retention of ALIX at the base of primary cilia. In a previous study, we showed that KIF13B binds to Angiomotin (AMOT) isoform 2, which also localizes to the base of primary cilia (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). Notably, ITCH was reported to bind to AMOT isoform 1 (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e) as well as to ALIX (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). Moreover, since previous studies identified ITCH in the ciliary proteome of multiple cell types, including kidney epithelial cells (\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e), we hypothesized that KIF13B may regulate ciliary ALIX localization via ITCH. To investigate this, we first tested if KIF13B binds physically to ITCH. We performed immunoprecipitation (IP) analysis in HEK293T cells co-expressing relevant fusion proteins and found that the cargo-binding, motorless region of KIF13B tagged with GFP at the N-terminus (GFP-Dmotor) co-precipitated Myc-ITCH (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b). IP analysis using additional KIF13B truncations that either contain or lack the forkhead-associated (FHA) domain indicated that the latter domain is essential, but likely not sufficient, for KIF13B\u0026rsquo;s binding to ITCH (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b). Next, we performed IFM analysis of 24 or 72 h serum-starved WT, \u003cem\u003eKif13b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e, and rescue mCCD cell lines (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e) using antibodies against ITCH and the ciliary marker acetylated a-tubulin and found that ITCH localizes to the base of primary cilia in these cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Interestingly, we found that the levels of ITCH at the ciliary base were significantly reduced in the \u003cem\u003eKif13b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells at the 24 h time point compared to WT, while ITCH was conversely significantly enriched at this site in the mCherry-KIF13B-expressing rescue line; a similar trend was observed at the 72 h time point (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003ed). The overall cellular levels of ITCH were similar between the three cell lines under these conditions, as judged by western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003ee). Taken together, our results indicate that KIF13B physically binds to ITCH, which localizes to the ciliary base in a KIF13B-dependent manner.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eLoss of ITCH leads to ciliary depletion of ALIX\u003c/h3\u003e\n\u003cp\u003eTo investigate how ITCH might affect ciliary localization of ALIX, we used Crispr/Cas9 methodology to knock out the corresponding gene in mCCD cells and confirmed that ITCH was depleted from the knockout cells by western blot analysis, as expected (Figure S2a). Subsequently, WT and \u003cem\u003eItch\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells were serum-starved for 24 or 72 h to promote ciliation and subjected to IFM analysis using antibodies against ALIX and the ciliary marker acetylated a-tubulin to test how loss of ITCH affects ciliary localization of ALIX, as well as ciliary length and frequency. Our results indicated that loss of ITCH has little influence on ciliary length and frequency under the conditions tested (Figure S2b-d) but causes a significant depletion of ALIX from the ciliary base compared to WT cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, b). This could be due to a general instability of ALIX in the \u003cem\u003eItch\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells, and not just due to defective trafficking or localization, since western blot analysis indicated that the average cellular level of ALIX was reduced by approximately 30% in these cells compared to the WT (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, d).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eDepletion of ALIX and ITCH causes ciliary accumulation of PC2\u003c/h3\u003e\n\u003cp\u003eNext, we explored the ciliary function of ALIX in mCCD cells by addressing its role in regulating ciliogenesis, ciliary length, and localization of PC2. Since ALIX has many important cellular functions, including an essential role in cytokinesis (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e), we used siRNA rather than gene knockout to partially deplete it from mCCD cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, b), and subjected the cells to 24 or 72 h of serum starvation, followed by IFM analysis with antibodies against ciliary markers and PC2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). Partial depletion of ALIX to approximately 50% of WT levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eb) did not affect ciliation frequency (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003ed) and led to a small but significant reduction in ciliary length at the 24 h time point compared to control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003ee). Moreover, partial depletion of ALIX caused a significant accumulation of PC2 within cilia after 72 h of serum starvation, compared to control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003ec, f). Similar analysis of \u003cem\u003eItch\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells showed a significant accumulation of PC2 within cilia of the mutant cells at both the 24 and 72 h time points compared to the WT (Figure S2b, e), in agreement with our observation that ALIX levels are reduced in the \u003cem\u003eItch\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e). However, as the effect of ITCH loss on ciliary PC2 levels appears more pronounced compared to that of ALIX depletion, the results suggest that ITCH negatively regulates ciliary PC2 levels not only via ALIX. We conclude that ALIX and ITCH negatively regulate ciliary PC2 levels and may interact functionally in this context.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eLoss of ITCH alters ciliary dynamics of SMO\u003c/h3\u003e\n\u003cp\u003eITCH was previously shown to bind and ubiquitylate multiple components of the SHH signaling pathway (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e), which is intimately connected to primary cilia in vertebrates (\u003cspan additionalcitationids=\"CR54\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e). In the off state, the SHH receptor PTCH1 is enriched in the cilium and suppresses ciliary accumulation of SMO. This leads to the processing of the GLI transcription factors into their repressor forms, preventing downstream target gene expression. Upon binding to SHH, PTCH1 exits the cilium, causing concomitant ciliary enrichment of SMO, followed by the stabilization and conversion of GLI transcription factors into their activator forms, which initiate the expression of target genes such as \u003cem\u003eGLI1\u003c/em\u003e and \u003cem\u003ePTCH1\u003c/em\u003e (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Ciliary accumulation of SMO and activation of GLI-mediated target gene transcription can also be induced by purmorphamine (PMA), which directly binds and activates SMO independently of PTCH1 (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). The respective accumulation and depletion of SMO and PTCH1 from cilia during SHH signaling rely on their ubiquitylation, which targets them for BBSome-mediated retrieval from cilia (\u003cspan additionalcitationids=\"CR58 CR59\" citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e). For example, Lv and colleagues showed that the E3 ubiquitin ligase WWP1 localizes to primary cilia of mouse embryonic fibroblasts in the basal state, where it binds to PTCH1 and promotes SMO ubiquitylation and export from cilia. Binding of SHH to PTCH1 causes its removal from the cilium along with WWP1, which promotes ciliary accumulation of SMO (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e). In addition to binding WWP1, PTCH1 also binds to ITCH. Specifically, it was reported that ITCH negatively regulates the basal levels of PTCH1 by binding to its C-terminal domain and mediating ubiquitylation at K1413, which leads to internalization and subsequent degradation of PTCH1. However, this role of ITCH appears not to be relevant in the context of SHH signaling at the primary cilium (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eWe tested how loss of ITCH affects ciliary SMO localization in the absence and presence of PMA by subjecting 48 h serum-starved WT and \u003cem\u003eItch\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells to DMSO (vehicle) or PMA treatment for an additional 24 h, followed by IFM analysis using antibodies against SMO and the ciliary marker acetylated a-tubulin. Interestingly, while WT cells accumulated SMO within cilia only in the presence of PMA, as expected, the \u003cem\u003eItch\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e cells displayed significantly elevated ciliary levels of SMO under control conditions (DMSO treatment), and treatment with PMA did not lead to further ciliary accumulation of SMO in these cells (Figure S3). These results indicate that loss of ITCH leads to the constitutive accumulation of SMO in cilia, thereby expanding its already established role in regulating SHH signaling (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). However, the molecular mechanisms involved remain to be clarified.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, we show that ALIX localizes to the base of or within primary cilia of multiple mammalian cell types, including mCCD, RPE1, and IMCD3 cells. This observation is consistent with previously published reports identifying ALIX in the centrosomes of \u003cem\u003eDrosophila\u003c/em\u003e and mammalian cells (\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e), the ciliary proteome of mouse kidney epithelial cells (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e), and isolated TZs or cilia-derived EVs from \u003cem\u003eChlamydomonas\u003c/em\u003e (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). By analyzing WT and relevant mutant and rescue lines, we furthermore demonstrate that the retention or stability of ALIX at a specific site at the ciliary base depends on KIF13B and ITCH, which, in turn, interact physically with each other to promote KIF13B-dependent recruitment or retention of ITCH at the ciliary base. Although more work will be needed to define the specific mechanism(s) by which KIF13B and ITCH regulate ALIX at the cilium, our results suggest a model whereby KIF13B initially recruits or retains ITCH at the ciliary base, which, in turn, is required for regulating ALIX stability or retention at this site.\u003c/p\u003e\u003cp\u003eSince partial depletion of ALIX in mCCD cells causes a significant accumulation of PC2 within cilia over time but has no major impact on ciliary length and frequency, our results point toward a role for ALIX in promoting removal/retrieval of PC2 from the cilium. Time-dependent ciliary accumulation of PC2 was also observed for mCCD cells lacking KIF13B (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), while loss of ITCH in these cells caused PC2 depletion after both 24 and 72 h of starvation (this study), supporting that ALIX, KIF13B, and ITCH functionally interact to downregulate ciliary PC2 levels with effects that may vary over time. Such variation may, in part, be explained by the different methods used for protein depletion (gene knockout versus siRNA depletion), however, KIF13B and ITCH may also affect ciliary PC2 homeostasis independently of each other and of ALIX.\u003c/p\u003e\u003cp\u003eIn our previous work, we showed that \u003cem\u003eKif13b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mCCD cells initially accumulate PC2 within cilia, whereas prolonged serum starvation (72 h) reverses this phenotype and leads to excessive release of large EVs containing PC2 and other ciliary proteins from the mutant cells. We proposed that KIF13B promotes endocytic retrieval of PC2 and other proteins from cilia by a flotillin-dependent pathway, and when this pathway is defective, such proteins initially accumulate within cilia, but over time, the cells compensate by getting rid of excess ciliary components through the release of large EVs (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Considering the well-described roles of ITCH and ALIX in EV cargo sorting and biogenesis (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e), it will be interesting to investigate their involvement in ciliary protein retrieval and EV biogenesis in more detail in the future. In this context, it is notable that ITCH was shown to interact physically and functionally with NUMB (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e), which localizes to the ciliary pocket, where it functions as an endocytic adaptor for clathrin-mediated endocytic retrieval of PTCH1 from the primary cilium (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Hence, it will be relevant to explore if and how the effects of ITCH depletion on ciliary PC2 and SMO levels, described here, involve interaction between ITCH and NUMB in the context of endocytosis at the ciliary pocket region.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cb\u003eCell lines and reagents.\u003c/b\u003e An overview of cell lines and reagents described in this study is shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Immortalized WT mCCD cells were from Dr. Eric F\u0026eacute;raille from University of Lausanne, Switzerland, and have been described previously (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e), whereas \u003cem\u003eKif13b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e and rescue mCCD cell lines were described in (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Human embryonic kidney (HEK) 293T cells were from ATCC (cat. #CRL-3216); WT and \u003cem\u003eIft27\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e and \u003cem\u003eArl6\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e IMCD3 Flp-In cell lines were from Dr. Maxence Nachury from the University of California, San Francisco (UCSF), USA (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). hTERT-RPE1 cells with endogenously mNeonGreen- and TurboID-tagged ARL13B were provided by Drs. Stefanie Kuhns and Jens S. Andersen from University of Southern Denmark and have been described in (\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eCell lines, reagents, and plasmids used in this study.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReagent type (species) or resource\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDesignation\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSource or reference\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eIdentifiers\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eAdditional information\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eMus musculus\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003emCCD\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eEric F\u0026eacute;raille lab, University of Lausanne, Switzerland\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eWild type (parental)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eM. musculus\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003emCCD \u003cem\u003eKif13b\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePool\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGenerated by CRISPR/Cas9 methodology\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eM. musculus\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003emCCD/mNG-KIF13B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePool/rescue line\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGenerated by lentiviral transduction\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eM. musculus\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003emCCD \u003cem\u003eKif13b\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e/\u003c/em\u003emCherry-KIF13B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePool/rescue line\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGenerated by lentiviral transduction\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eM. musculus\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003emCCD \u003cem\u003eZdhhc5\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eClone 22\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGenerated by CRISPR/Cas9 methodology\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eM. musculus\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003emCCD \u003cem\u003eItch\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eClone 14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGenerated by CRISPR/Cas9 methodology\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eHomo sapiens\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHEK293T\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# CRL-3216\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eH. sapiens\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ehTERT-RPE1 mNG-endoARL13B-TurboID\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eParental control\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eEndogenous ARL13B tagged with mNG and TurboID\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eH. sapiens\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ehTERT-RPE1 mNG-endoARL13B-TurboID \u003cem\u003eKIF13B\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eClone A6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGenerated by CRISPR/Cas9 methodology\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eH. sapiens\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ehTERT-RPE1 mNG-endoARL13B-TurboID \u003cem\u003eKIF13B\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e/mCherry-KIF13B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eClone A6/rescue line\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eGenerated by lentiviral transduction\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eM. musculus\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIMCD3 Flp-In\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eWild type (parental)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eM. musculus\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIMCD3 Flp-In \u003cem\u003eIft27\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003eIft27\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCell line (\u003cem\u003eM. musculus\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIMCD3 Flp-In \u003cem\u003eArl6\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cem\u003eArl6\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eStrain, strain background (\u003cem\u003eEscherichia coli\u003c/em\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDH10B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLab stock\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eN/A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-acetylated alpha-tubulin\u003c/p\u003e\u003cp\u003e(mouse monoclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSigma-Aldrich\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# T7451\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIFM (1:2000)\u003c/p\u003e\u003cp\u003eWB (1:5000)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-acetylated alpha-tubulin\u003c/p\u003e\u003cp\u003e(rabbit monoclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAbcam\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# ab179484\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIFM (1:2000)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-AIP1 (ALIX; mouse monoclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBD Transduction Laboratories\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# 611620\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWB (1:1000)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-ALIX (rabbit polyclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMerck/Sigma-Aldrich\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# ABC40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIFM (1:1000)\u003c/p\u003e\u003cp\u003eWB (1:3000)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-ARL13B (rabbit polyclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eProteintech\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# 17711-1-AP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIFM (1:600)\u003c/p\u003e\u003cp\u003eWB (1:600)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-CEP164 (rabbit polyclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSigma-Aldrich\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# HPA037606\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIFM (1:500)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-FLAG (mouse monoclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSigma-Aldrich\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat. #F1804\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWB (1:1000)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-GAPDH (rabbit polyclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCell Signaling Technology\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# 2118\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWB (1:1000)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-GFP (rabbit polyclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSigma\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# SAB4301138\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWB (1:500)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-HA (rabbit polyclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSanta Cruz Biotechnology\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat#sc-805\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWB (1:500)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-ITCH (rabbit polyclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThermoFischer Scientific\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# PA5-65539\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIFM (1:200)\u003c/p\u003e\u003cp\u003eWB (1:500)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-KIF13B (mouse monoclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMerck\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# SAB1412812\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWB (1:600)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-Mouse IgG 680\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLI-COR Bioscience\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# 925-68072\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSecondary antibody\u003c/p\u003e\u003cp\u003eWB (1:10000)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-Mouse IgG 800\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLI-COR Bioscience\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# 925-32212\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSecondary antibody\u003c/p\u003e\u003cp\u003eWB (1:10000)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-Myc (mouse monoclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCell Signaling Technology\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# 2276\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWB (1:1000)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-PC2 (mouse monoclonal)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSanta Cruz\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# sc-28331\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIFM (1:500)\u003c/p\u003e\u003cp\u003eWB (1:1000)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-SMO\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eProteintech\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# 20787-1-AP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIFM (1:500)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAnti-Rabbit IgG 680\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLI-COR Bioscience\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# 925-68073\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSecondary antibody\u003c/p\u003e\u003cp\u003eWB (1:10000)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eChemical Reagent\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLipofectamine 3000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eThermo Fisher Scientific\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# L3000015\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eChemical Reagent\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePurmorphamine\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSigma-Aldrich\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# SML0863\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eDissolved in DMSO and used at 1 \u0026micro;M final concentration for 24 h\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSequence-based reagent\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eM. musculus\u003c/em\u003e Control siRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eEurofins Genomics\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eControl siRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e5\u0026rsquo;- (GCCAUAGAGAUAAGGUAAGAA)TT-3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSequence-based reagent\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eM. musculus\u003c/em\u003e ALIX siRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eEurofins Genomics\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eALIX siRNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e5\u0026rsquo;- (AAUCUGAUCAUAAUACCUCAG)TT-3\u0026rsquo;\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA plasmid\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003epEGFP-C1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBD Biosciences Clontech\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCodes for EGFP, used for IP experiments\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA plasmid\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eH. sapiens\u003c/em\u003e Dmotor-KIF13B-eGFP/pcDNA3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCodes for GFP-tagged motorless KIF13B; used for IP experiments\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA plasmid\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eH. sapiens\u003c/em\u003e\u003c/p\u003e\u003cp\u003eKIF13B aa 1-557/pEGFP-N1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eKIF13B motor\u0026thinsp;+\u0026thinsp;FHA-GFP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCodes for KIF13B residues 1-557 (motor and FHA domain) tagged with GFP at C-terminus, used for IP experiments\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA plasmid\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eH. sapiens\u003c/em\u003e\u003c/p\u003e\u003cp\u003eKIF13B aa 561\u0026ndash;1826/pEGFP-C1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGFP-KIF13B-Tail 6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCodes for GFP-KIF13B residues 561\u0026ndash;1826, used for IP experiments\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA plasmid\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eH. sapiens\u003c/em\u003e\u003c/p\u003e\u003cp\u003eKIF13B aa 840\u0026ndash;1826/pEGFP-C1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGFP-KIF13B-Tail 5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCodes for GFP-KIF13B residues 840\u0026ndash;1826, used for IP experiments\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA plasmid\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eM. musculus\u003c/em\u003e ITCH/pCINeo-Myc\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e(\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e); Addgene\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat. #11427\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eCodes for Myc-tagged ITCH, used for IP experiments\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA plasmid\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003epSpCas9(BB)-2A-Puro (PX459) V2.0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAddgene\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat. # 62988\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOther\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGFP-Trap Agarose\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eChromoTek GmbH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCat# gta-20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eCell culture conditions\u003c/b\u003e. WT, \u003cem\u003eKif13b\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e, and rescue mCCD cell lines were grown as described in (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e); \u003cem\u003eItch\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mCCD cells (see below) were cultured in a similar way. Cell culture procedures for HEK293T and IMCD3 cells were described in (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). hTERT-RPE1 cells with endogenously mNeonGreen- and TurboID-tagged ARL13B were cultured in 1x DMEM high glucose medium (Gibco, cat. #41966-029) supplemented with 10% FBS (Sigma, #F995) and 1% penicillin/streptomycin (Sigma, cat. #P0781). To induce ciliogenesis, serum starvation with 1x DMEM medium was done for 48 h before experiments. To activate Hedgehog signaling, the mCCD cells were incubated with 1 \u0026micro;M of PMA for 24 h in serum starvation medium, following an initial period of 48 h of serum starvation without PMA.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGeneration of\u003c/b\u003e \u003cb\u003eItch\u003c/b\u003e \u003cb\u003eknockout kidney epithelial cell lines.\u003c/b\u003e For knockout of \u003cem\u003eItch\u003c/em\u003e in mCCD cells we used CRISPR/Cas9 methodology. A Mammalian CRISPR Vector (Dual gRNA) was customized from VectorBuilder using the function \u0026ldquo;Design My Vector\u0026rdquo; and purchased. The resulting plasmid encodes a Cas9-GFP fusion protein and two sgRNA against \u003cem\u003eItch\u003c/em\u003e from the VectorBuilder database (see Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e for specific sequences). Next, by following the manufacturer's instructions the plasmid was transfected into WT mCCD cells using Lipofectamine 3000 (Invitrogen, cat. #L3000015). On the following day, cells positive for GFP were sorted into single cells in a 96 well plate by using a FACS Aria III instrument. After reaching confluency, the cells were sub-cultured into two 96 well plates, one for screening the clones for ITCH depletion by western blot analysis, the other for keeping the clones in culture. One \u003cem\u003eItch\u003c/em\u003e knockout clone (clone number 14) was selected and used for this study.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGeneration of\u003c/b\u003e \u003cb\u003eKIF13B\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e \u003cb\u003ehTERT-RPE1 cells and rescue line expressing mCherry-KIF13B.\u003c/b\u003e Using a parental hTERT-RPE1 cell line expressing endogenously mNeonGreen- and TurboID-tagged ARL13B (\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e), \u003cem\u003eKIF13B\u003c/em\u003e was knocked out using CRISPR/Cas9 methodology as described previously (\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e). For generation of a rescue line, \u003cem\u003eKIF13B\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e cells (clone A6) were inoculated with lentiviruses carrying mCherry-KIF13B construct (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), and the cells were incubated with DMEM containing 10% FBS, 1% penicillin-streptomycin, and 5 \u0026micro;g/ml blasticidin at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. The next day, the blasticidin concentration was increased to 10 \u0026micro;g/ml. After 9 days of selection, cells expressing mCherry-KIF13B were sorted by FACS based on the mCherry fluorescence level.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGene silencing with siRNA.\u003c/b\u003e Gene silencing of ALIX was performed in mCCD cells using siRNA and Lipofectamine\u0026reg; 3000 (Thermo Fisher Scientific). mCCD WT cells were seeded in DMEM/F12 in 6-well plates and grown to approximately 70\u0026ndash;80% confluency. Transfection was performed by combining 40 nM of either ALIX-specific or control siRNA (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and 7.5 \u0026micro;l Lipofectamine\u0026reg; 3000 (Thermo Fisher Scientific) in 250 \u0026micro;l serum-deprived DMEM/F12 medium and incubated for 15 min at room temperature prior to dropwise addition onto the cells. Subsequently, the medium was swirled gently to ensure proper dispersion before the cells were incubated at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. Transfection medium was removed after 24 h and cells were serum starved for either 24 or 72 h before being used for further experiments.\u003c/p\u003e\u003cp\u003e\u003cb\u003eImmunoprecipitation, SDS-PAGE and western blot analysis.\u003c/b\u003e Immunoprecipitation in HEK293T cells was carried out using relevant antibody-conjugated beads (see Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) as described previously (\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e) except that the washing buffer contained 0.1% NP-40 instead of 0.5% NP-40. For SDS-PAGE and western blotting, we used procedures that were described in (\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e) and employed antibodies and dilutions as listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Uncropped western blots are shown in Figure S4.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eImmunofluorescence microscopy\u003c/b\u003e. mCCD cells were grown until they reached approximately 80% confluency. Subsequently, they were deprived of serum and hormones for either 24 or 72 h. Unless specified otherwise, cells were initially fixed using 4% paraformaldehyde (PFA) for 15 min at room temperature or 20 min at 4\u0026deg;C. This was followed by permeabilization with a solution of 1% bovine serum albumin (BSA) and 0.2% Triton X-100 in phosphate-buffered saline (PBS) for 12 min. The cells were then blocked with blocking buffer consisting of 2% BSA in PBS for 1 h at room temperature. Primary antibodies, diluted in 2% BSA in PBS were applied and left for 1\u0026ndash;2 h at room temperature or overnight at 4\u0026deg;C. After washing with PBS several times, secondary antibodies, also diluted in 2% BSA in PBS, were added for a 1 h incubation at room temperature. Finally, the cell nuclei were stained using DAPI (Sigma-Aldrich, cat. #D9542). Coverslips were mounted onto slides with Shandon Immu-Mount (Thermo Scientific, cat. #9990402) with the addition of 0.5% N-propyl gallate. For staining PC2, a specific IFM protocol was employed as detailed in (\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e). This involved a pre-fixation with 0.4% PFA for 5 min at 37\u0026deg;C, followed by permeabilization with PHEM buffer (containing 50 mM PIPES; 50 mM HEPES; 10 mM MgCl\u003csub\u003e2\u003c/sub\u003e; pH 6.9) with the addition of 0.5% Triton X-100 for 5 min at 37\u0026deg;C, and then a final fixation with 4% PFA for 15 min at room temperature. Imaging was done as described previously (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). Procedures for IFM analysis of RPE1 cells were as described in (\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e), using antibodies and dilutions listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cb\u003eQuantitative and statistical analysis of IFM and western blot data\u003c/b\u003e. Image data from IFM was processed and analyzed quantitatively using methods previously described in (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). For quantitative western blot analysis, the average pixel intensity of the bands was measured using Fiji software (\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e). These measurements were then normalized against the loading control, and subsequent statistical analysis was performed using GraphPad Prism 10. All quantitative data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Unless otherwise noted, all the experiments were repeated in at least three independent biological replicates. Significance levels are indicated as follows: p\u0026thinsp;\u0026gt;\u0026thinsp;0.05 not significant (ns), p\u0026thinsp;\u0026le;\u0026thinsp;0.05 *, p\u0026thinsp;\u0026le;\u0026thinsp;0.01, ** p\u0026thinsp;\u0026le;\u0026thinsp;0.001 ***, p\u0026thinsp;\u0026le;\u0026thinsp;0.0001, ****.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors consent to this publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData sharing is not applicable to this article as no datasets were generated or analysed during the current study. Cell lines and reagents generated in this study are available from the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by grants NNF18SA0032928 and NNF22OC0080406 from the Novo Nordisk Foundation, grant 2032-00115B from the Independent Research Fund Denmark, the TheRaCil consortium funded by the European Union (Horizon-health-2022-disease-06-two stage, grant 101080717), and grant CF22-0670 from the Carlsberg Foundation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCRB, JL, FC, ALWP, AMF, LEW, GL, SG, CKR performed experiments; CRB, JL, FC, ALWP, AMF, GL, BM, MC analyzed data; CRB, JL, FC, ALWP, AMF, BM, MC and LBP prepared the figures; LBP and HMS supervised students; LBP conceived the project and wrote the paper with input from all authors. LBP, STC, and ZA obtained funding for the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Eric F\u0026eacute;raille for mCCD cells, Maxence Nachury for IMCD3 cells, and Martin Berchtold for ALIX antibodies. We are grateful to S\u0026oslash;ren L. Johansen for technical support.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAnvarian Z, Mykytyn K, Mukhopadhyay S, Pedersen LB, Christensen ST. Cellular signalling by primary cilia in development, organ function and disease. Nat Rev Nephrol. 2019;15(4):199\u0026ndash;219.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMill P, Christensen ST, Pedersen LB. Primary cilia as dynamic and diverse signalling hubs in development and disease. Nat Rev Genet. 2023;24(7):421\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eReiter JF, Leroux MR. Genes and molecular pathways underpinning ciliopathies. Nat Rev Mol Cell Biol. 2017;18(9):533\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMoran AL, Louzao-Martinez L, Norris DP, Peters DJM, Blacque OE. Transport and barrier mechanisms that regulate ciliary compartmentalization and ciliopathies. Nat Rev Nephrol. 2024;20(2):83\u0026ndash;100.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWingfield JL, Lechtreck KF, Lorentzen E. Trafficking of ciliary membrane proteins by the intraflagellar transport/BBSome machinery. Essays Biochem. 2018;62(6):753\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNachury MV, Mick DU. Establishing and regulating the composition of cilia for signal transduction. Nat Rev Mol Cell Biol. 2019;20(7):389\u0026ndash;405.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLacey SE, Pigino G. The intraflagellar transport cycle. Nat Rev Mol Cell Biol. 2024.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTian X, Zhao H, Zhou J. Organization, functions, and mechanisms of the BBSome in development, ciliopathies, and beyond. Elife. 2023;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWood CR, Rosenbaum JL. Ciliary ectosomes: transmissions from the cell's antenna. Trends Cell Biol. 2015;25(5):276\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang J, Barr MM. Cell-cell communication via ciliary extracellular vesicles: clues from model systems. Essays Biochem. 2018;62(2):205\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOjeda Naharros I, Nachury MV. Shedding of ciliary vesicles at a glance. J Cell Sci. 2022;135(19).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLuxmi R, King SM. Cilia-derived vesicles: An ancient route for intercellular communication. Semin Cell Dev Biol. 2022;129:82\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDixson AC, Dawson TR, Di Vizio D, Weaver AM. Context-specific regulation of extracellular vesicle biogenesis and cargo selection. Nat Rev Mol Cell Biol. 2023;24(7):454\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJeppesen DK, Zhang Q, Coffey RJ. Extracellular vesicles and nanoparticles at a glance. J Cell Sci. 2024;137(23).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePhua SC, Chiba S, Suzuki M, Su E, Roberson EC, Pusapati GV et al. Dynamic Remodeling of Membrane Composition Drives Cell Cycle through Primary Cilia Excision. Cell. 2017;168(1\u0026ndash;2):264\u0026thinsp;\u0026ndash;\u0026thinsp;79 e15.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQuarmby LM. Cellular deflagellation. Int Rev Cytol. 2004;233:47\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNabhan JF, Hu R, Oh RS, Cohen SN, Lu Q. Formation and release of arrestin domain-containing protein 1-mediated microvesicles (ARMMs) at plasma membrane by recruitment of TSG101 protein. Proc Natl Acad Sci U S A. 2012;109(11):4146\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Q, Lu Q. Plasma membrane-derived extracellular microvesicles mediate non-canonical intercellular NOTCH signaling. Nat Commun. 2017;8(1):709.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRauch S, Martin-Serrano J. Multiple interactions between the ESCRT machinery and arrestin-related proteins: implications for PPXY-dependent budding. J Virol. 2011;85(7):3546\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eO'Connor HF, Lyon N, Leung JW, Agarwal P, Swaim CD, Miller KM, et al. Ubiquitin-Activated Interaction Traps (UBAITs) identify E3 ligase binding partners. EMBO Rep. 2015;16(12):1699\u0026ndash;712.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee CP, Liu GT, Kung HN, Liu PT, Liao YT, Chow LP, et al. The Ubiquitin Ligase Itch and Ubiquitination Regulate BFRF1-Mediated Nuclear Envelope Modification for Epstein-Barr Virus Maturation. J Virol. 2016;90(20):8994\u0026ndash;9007.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShen S, Cai D, Liang H, Zeng G, Liu W, Yan R, et al. NEDD4 family ubiquitin ligase AIP4 interacts with Alix to enable HBV naked capsid egress in an Alix ubiquitination-independent manner. PLoS Pathog. 2024;20(9):e1012485.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRezi CK, Frei A, Campestre F, Boldt K, Mary B, Fixdahl AM et al. KIF13B controls ciliary protein content by promoting endocytic retrieval and suppressing release of large extracellular vesicles from cilia. bioRxiv. 2025:2024.03.21.586066.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVolz AK, Frei A, Kretschmer V, de Jesus Domingues AM, Ketting RF, Ueffing M, et al. Bardet-Biedl syndrome proteins modulate the release of bioactive extracellular vesicles. Nat Commun. 2021;12(1):5671.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu J, Wittekind SG, Barr MM. STAM and Hrs down-regulate ciliary TRP receptors. Mol Biol Cell. 2007;18(9):3277\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMick DU, Rodrigues RB, Leib RD, Adams CM, Chien AS, Gygi SP, et al. Proteomics of Primary Cilia by Proximity Labeling. Dev Cell. 2015;35(4):497\u0026ndash;512.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAslanyan MG, Doornbos C, Diwan GD, Anvarian Z, Beyer T, Junger K, et al. A targeted multi-proteomics approach generates a blueprint of the ciliary ubiquitinome. Front Cell Dev Biol. 2023;11:1113656.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu X, Yam PT, Schlienger S, Cai E, Zhang J, Chen WJ, et al. Numb positively regulates Hedgehog signaling at the ciliary pocket. Nat Commun. 2024;15(1):3365.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim J, Hsia EY, Brigui A, Plessis A, Beachy PA, Zheng X. The role of ciliary trafficking in Hedgehog receptor signaling. Sci Signal. 2015;8(379):ra55.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eInfante P, Faedda R, Bernardi F, Bufalieri F, Lospinoso Severini L, Alfonsi R, et al. Itch/beta-arrestin2-dependent non-proteolytic ubiquitylation of SuFu controls Hedgehog signalling and medulloblastoma tumorigenesis. Nat Commun. 2018;9(1):976.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMcGill MA, McGlade CJ. Mammalian numb proteins promote Notch1 receptor ubiquitination and degradation of the Notch1 intracellular domain. J Biol Chem. 2003;278(25):23196\u0026ndash;203.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDi Marcotullio L, Ferretti E, Greco A, De Smaele E, Po A, Sico MA, et al. Numb is a suppressor of Hedgehog signalling and targets Gli1 for Itch-dependent ubiquitination. Nat Cell Biol. 2006;8(12):1415\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eInfante P, Lospinoso Severini L, Bernardi F, Bufalieri F, Di Marcotullio L. Targeting Hedgehog Signalling through the Ubiquitylation Process: The Multiple Roles of the HECT-E3 Ligase Itch. Cells. 2019;8(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMukhopadhyay S, Rohatgi R. G-protein-coupled receptors, Hedgehog signaling and primary cilia. Semin Cell Dev Biol. 2014;33:63\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBangs F, Anderson KV. Primary Cilia and Mammalian Hedgehog Signaling. Cold Spring Harb Perspect Biol. 2017;9(5):a028175.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDiener DR, Lupetti P, Rosenbaum JL. Proteomic analysis of isolated ciliary transition zones reveals the presence of ESCRT proteins. Curr Biol. 2015;25(3):379\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLong H, Zhang F, Xu N, Liu G, Diener DR, Rosenbaum JL, et al. Comparative Analysis of Ciliary Membranes and Ectosomes. Curr Biol. 2016;26(24):3327\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCarlton JG, Martin-Serrano J. Parallels between cytokinesis and retroviral budding: a role for the ESCRT machinery. Science. 2007;316(5833):1908\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMorita E, Sandrin V, Chung HY, Morham SG, Gygi SP, Rodesch CK, et al. Human ESCRT and ALIX proteins interact with proteins of the midbody and function in cytokinesis. EMBO J. 2007;26(19):4215\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMalerod L, Le Borgne R, Lie-Jensen A, Eikenes AH, Brech A, Liestol K, et al. Centrosomal ALIX regulates mitotic spindle orientation by modulating astral microtubule dynamics. EMBO J. 2018;37:13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRezi CK, Aslanyan MG, Diwan GD, Cheng T, Chamlali M, Junger K, et al. DLG1 functions upstream of SDCCAG3 and IFT20 to control ciliary targeting of polycystin-2. EMBO Rep. 2024;25(7):3040\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKhan A, Alaamery M, Massadeh S, Obaid A, Kashgari AA, Walsh CA, et al. PDCD6IP, encoding a regulator of the ESCRT complex, is mutated in microcephaly. Clin Genet. 2020;98(1):80\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCampos Y, Qiu X, Gomero E, Wakefield R, Horner L, Brutkowski W, et al. Alix-mediated assembly of the actomyosin-tight junction polarity complex preserves epithelial polarity and epithelial barrier. Nat Commun. 2016;7:11876.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLaporte MH, Chatellard C, Vauchez V, Hemming FJ, Deloulme JC, Vossier F, et al. Alix is required during development for normal growth of the mouse brain. Sci Rep. 2017;7:44767.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePhan TP, Holland AJ. Time is of the essence: the molecular mechanisms of primary microcephaly. Genes Dev. 2021;35(23\u0026ndash;24):1551\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAndreu-Cervera A, Catala M, Schneider-Maunoury S. Cilia, ciliopathies and hedgehog-related forebrain developmental disorders. Neurobiol Dis. 2021;150:105236.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEguether T, San Agustin JT, Keady BT, Jonassen JA, Liang Y, Francis R, et al. IFT27 links the BBSome to IFT for maintenance of the ciliary signaling compartment. Dev Cell. 2014;31(3):279\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiew GM, Ye F, Nager AR, Murphy JP, Lee JS, Aguiar M, et al. The Intraflagellar Transport Protein IFT27 Promotes BBSome Exit from Cilia through the GTPase ARL6/BBS3. Dev Cell. 2014;31(3):265\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMorthorst SK, Nielsen C, Farinelli P, Anvarian Z, Rasmussen CBR, Serra-Marques A et al. Angiomotin isoform 2 promotes binding of PALS1 to KIF13B at primary cilia and regulates ciliary length and signaling. J Cell Sci. 2022;135(12).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang C, An J, Zhang P, Xu C, Gao K, Wu D, et al. The Nedd4-like ubiquitin E3 ligases target angiomotin/p130 to ubiquitin-dependent degradation. Biochem J. 2012;444(2):279\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAdler JJ, Heller BL, Bringman LR, Ranahan WP, Cocklin RR, Goebl MG, et al. Amot130 adapts atrophin-1 interacting protein 4 to inhibit yes-associated protein signaling and cell growth. J Biol Chem. 2013;288(21):15181\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVietri M, Radulovic M, Stenmark H. The many functions of ESCRTs. Nat Rev Mol Cell Biol. 2020;21(1):25\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuangfu D, Liu A, Rakeman AS, Murcia NS, Niswander L, Anderson KV. Hedgehog signalling in the mouse requires intraflagellar transport proteins. Nature. 2003;426:83\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCorbit KC, Aanstad P, Singla V, Norman AR, Stainier DY, Reiter JF. Vertebrate Smoothened functions at the primary cilium. Nature. 2005;437(7061):1018\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRohatgi R, Milenkovic L, Scott MP. Patched1 regulates hedgehog signaling at the primary cilium. Science. 2007;317(5836):372\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSinha S, Chen JK. Purmorphamine activates the Hedgehog pathway by targeting Smoothened. Nat Chem Biol. 2006;2(1):29\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShinde SR, Nager AR, Nachury MV. Ubiquitin chains earmark GPCRs for BBSome-mediated removal from cilia. J Cell Biol. 2020;219(12).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDesai PB, Stuck MW, Lv B, Pazour GJ. Ubiquitin links smoothened to intraflagellar transport to regulate Hedgehog signaling. J Cell Biol. 2020;219(7).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLv B, Stuck MW, Desai PB, Cabrera OA, Pazour GJ. E3 ubiquitin ligase Wwp1 regulates ciliary dynamics of the Hedgehog receptor Smoothened. J Cell Biol. 2021;220(9).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLv B, Zhang XO, Pazour GJ. Arih2 regulates Hedgehog signaling through smoothened ubiquitylation and ER-associated degradation. J Cell Sci. 2022;135(16).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen XL, Chinchilla P, Fombonne J, Ho L, Guix C, Keen JH, et al. Patched-1 proapoptotic activity is downregulated by modification of K1413 by the E3 ubiquitin-protein ligase Itchy homolog. Mol Cell Biol. 2014;34(20):3855\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMontesano R, Ghzili H, Carrozzino F, Rossier BC, Feraille E. cAMP-dependent chloride secretion mediates tubule enlargement and cyst formation by cultured mammalian collecting duct cells. Am J Physiol Ren Physiol. 2009;296(2):F446\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKuhns S, Juhl AD, Anvarian Z, Wustner D, Pedersen LB, Andersen JS. Endogenous Tagging of Ciliary Genes in Human RPE1 Cells for Live-Cell Imaging. Methods Mol Biol. 2024;2725:147\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchou KB, Mogensen JB, Morthorst SK, Nielsen BS, Aleliunaite A, Serra-Marques A, et al. KIF13B establishes a CAV1-enriched microdomain at the ciliary transition zone to promote Sonic hedgehog signalling. Nat Commun. 2017;8:14177.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGoncalves AB, Hasselbalch SK, Joensen BB, Patzke S, Martens P, Ohlsen SK et al. CEP78 functions downstream of CEP350 to control biogenesis of primary cilia by negatively regulating CP110 levels. Elife. 2021;10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHe K, Ma X, Xu T, Li Y, Hodge A, Zhang Q, et al. Axoneme polyglutamylation regulated by Joubert syndrome protein ARL13B controls ciliary targeting of signaling molecules. Nat Commun. 2018;9(1):3310.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9(7):676\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLamason RL, Kupfer A, Pomerantz JL. The dynamic distribution of CARD11 at the immunological synapse is regulated by the inhibitory kinesin GAKIN. Mol Cell. 2010;40(5):798\u0026ndash;809.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMagnifico A, Ettenberg S, Yang C, Mariano J, Tiwari S, Fang S, et al. WW domain HECT E3s target Cbl RING finger E3s for proteasomal degradation. J Biol Chem. 2003;278(44):43169\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-molecular-and-cell-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cebi","sideBox":"Learn more about [BMC Molecular and Cell Biology](https://bmcmolcellbiol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cebi/default.aspx","title":"BMC Molecular and Cell Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"ALIX, primary cilia, KIF13B, polycystin-2, ITCH, Bardet-Biedl syndrome, BBSome, intraflagellar transport, Smoothened, Hedgehog signaling","lastPublishedDoi":"10.21203/rs.3.rs-7376140/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7376140/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePrimary cilia are antenna-like organelles that function as cellular hubs for signaling pathways, including Sonic hedgehog and signaling mediated by the Polycystin-1/Polycystin-2 cation channel complex. Proper regulation of signaling output depends on the dynamic control of ciliary protein composition, which involves intraflagellar transport-mediated trafficking, protein retrieval, and the shedding of extracellular vesicles from cilia. Here we identify ALIX, a protein previously linked to the biogenesis of small extracellular vesicles, as a novel component localized at the base of primary cilia in cultured mammalian cells. We show that ALIX retention at this site requires the ciliary kinesin-3 motor protein KIF13B, which physically interacts with the E3 ubiquitin ligase ITCH. In turn, ITCH is enriched at the ciliary base and is essential for ALIX stability. Depletion of either ALIX or ITCH results in elevated ciliary levels of Polycystin-2, while ITCH loss additionally leads to constitutive accumulation of Smoothened, a key Sonic hedgehog effector, within the cilium. Collectively, our findings establish ALIX and ITCH as critical regulators of ciliary membrane protein homeostasis and signaling, acting in coordination with KIF13B to maintain proper ciliary function.\u003c/p\u003e","manuscriptTitle":"ALIX and ITCH localize to the base of primary cilia and negatively regulate ciliary Polycystin-2 levels","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-25 09:33:42","doi":"10.21203/rs.3.rs-7376140/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-16T17:08:05+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-09T13:08:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"267197441868507852931309249383273969059","date":"2025-11-15T21:16:25+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-04T07:00:27+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"23949383253990482888924798258211494069","date":"2025-09-03T21:20:31+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-01T07:09:44+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-19T04:47:31+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-19T04:47:04+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Molecular and Cell Biology","date":"2025-08-14T17:42:48+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-molecular-and-cell-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cebi","sideBox":"Learn more about [BMC Molecular and Cell Biology](https://bmcmolcellbiol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cebi/default.aspx","title":"BMC Molecular and Cell Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0f5579d1-2f35-4248-baaa-921ca4ee1992","owner":[],"postedDate":"November 25th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-02T16:10:19+00:00","versionOfRecord":{"articleIdentity":"rs-7376140","link":"https://doi.org/10.1186/s12860-026-00571-1","journal":{"identity":"bmc-molecular-and-cell-biology","isVorOnly":false,"title":"BMC Molecular and Cell Biology"},"publishedOn":"2026-02-25 15:58:01","publishedOnDateReadable":"February 25th, 2026"},"versionCreatedAt":"2025-11-25 09:33:42","video":"","vorDoi":"10.1186/s12860-026-00571-1","vorDoiUrl":"https://doi.org/10.1186/s12860-026-00571-1","workflowStages":[]},"version":"v1","identity":"rs-7376140","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7376140","identity":"rs-7376140","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00