Clitorin, a Flavonoid Compound of Papaya, Ameliorates Non-Alcoholic Fatty Liver Disease in Western Diet- induced Mice and Oleic Acid-induced HepG2 Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Clitorin, a Flavonoid Compound of Papaya, Ameliorates Non-Alcoholic Fatty Liver Disease in Western Diet- induced Mice and Oleic Acid-induced HepG2 Cells Divina C. Cominguez, Yea-Jin Park, Yun-Mi Kang, Agung Nugroho, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-841938/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Nonalcoholic fatty liver disease (NAFLD) is usually correlated with metabolic diseases, such as obesity, insulin resistance, and hyperglycemia. Herein, we investigated the inhibitory effects and underlying governing mechanism of clitorin in a western diet (WD)-induced mouse model, and in oleic acid-induced HepG2 cells. Male C57BL/6 mice were fed a normal diet, WD, WD + 10 or 20 mg/kg orlistat, and WD + 10 or 20 mg/kg clitorin. HepG2 cells were treated with 1 mM oleic acid to induce lipid accumulation with or without clitorin. Clitorin administration reduced body weight gain and hepatic steatosis symptoms in WD-induced mice. Additionally, clitorin administration decreased the expression of sterol regulatory element-binding protein 1 (SREBP1), peroxisome proliferator-activated receptor γ (PPARγ), and CCAAT/enhancer binding protein α (C/EBPα) in WD-induced mice. Moreover, clitorin administration significantly decreased the mRNA levels of liver X receptor (LXR) and acetyl-CoA carboxylase (ACC); additionally, it enhanced the mRNA levels of peroxisome proliferator-activated receptor α (PPARα) and carnitine palmitoyltranserase-1 (CTP-1), as well as adenosine monophosphate-activated protein kinase (AMPK) mRNA levels, in the liver of WD-induced mice. Furthermore, clitorin treatment significantly impeded lipid accumulation in oleic acid-induced HepG2 cells. Our findings demonstrated that clitorin is a potentially efficacious candidate for NAFLD treatment. Biological sciences/Cell biology Biological sciences/Plant sciences Health sciences/Diseases clitorin nonalcoholic fatty liver disease adipogenesis lipogenesis fatty acid oxidation Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Nonalcoholic fatty liver disease (NAFLD) is the most ubiquitous chronic liver disease in Western countries, affecting nearly 25% of adults worldwide 1 . In the United States, the number of NAFLD cases is anticipated to increase from 83.1 million in 2015 to 100.9 million in 2030 2 . NAFLD is characterized by excessive internal fat accumulation in hepatocytes. It ranges from relatively benign nonalcoholic fatty liver to the aggressive form termed nonalcoholic steatohepatitis, typifying both fatty liver and liver inflammation 3 . NAFLD is usually correlated with metabolic diseases, such as obesity, insulin resistance, hyperglycemia, and hypertension. Although considerable progress has been achieved with regard to drug development for NAFLD, no suitable therapeutic agent has yet been approved 2 . Therefore, there is a critical need to develop optimal therapeutic agents for NAFLD. Hepatic steatosis can be stimulated by increased de novo lipogenesis and decreased fatty acid oxidation 4 . When the high-fat diet feeding, peroxisome proliferator-activated receptor γ (PPARγ) is the early-induced lipogenic transcription factor in the liver 5 . Hepatic lipid synthesis is also modulated by several important transcription factors, including the liver X receptor (LXR) and sterol regulatory element–binding protein 1c (SREBP1c) 6 . As a major transcription factor, SREBP1 has been reported to control key enzymes involved in fatty acid biosynthesis, such as acetyl-CoA carboxylase (ACC) 6 . ACC catalyzes a master rate-controlling step in de novo lipogenesis and fatty acid oxidation, that is, the synthesis of malonyl-CoA, which is both an intermediate in fatty acid synthesis and an allosteric inhibitor of carnitine palmitoyltranserase-1 (CTP-1) 7 . Peroxisome proliferator-activated receptor α (PPARα) is closely associated with the transcription of genes related to hepatic beta-oxidation, including CPT-1 8 . This beta-oxidation provides energy in the form of ATP, and the activity of adenosine monophosphate-activated protein kinase (AMPK) hinders fat accumulation by inducing lipolysis and beta-oxidation in adipose tissue and liver 9 . Papaya ( Carica papaya L.) is a fruit crop that is widely grown in tropical and sub-tropical regions. Traditionally, papaya plants are used to treat various ailments such as asthma, ulcers, eczema, diabetes, helminth infections, and fever 10 . Papaya plants have been reported to possess therapeutic potential for metabolic disorders, such as diabetes mellitus type 2, causing alterations in both glycemic metabolism and lipid metabolism, oxidative stress, and in models of arterial hypertension 10 , 11 . Previous profiling indicates that four flavonoids, including manghaslin, clitorin, rutin, and nicotiflorin, were identified in papaya plants 12 , 13 . Among them, we focused on clitorin, a kaempferol glycoside, because it has only been reported antioxidant effects 14 . Based on these findings, the present study was designed to provide basic data to delineate the pharmacological effects of clitorin on the alleviation of NAFLD in western diet (WD)-induced mice and oleic acid-induced HepG2 cells. Results Clitorin reduced the total body weight and weight gain in the WD-induced NAFLD mouse model A representative photograph of the experimental mice revealed that the 20 mg/kg clitorin-administered group mice were slightly smaller than those in the WD group (Fig. 1A). When mice were fed a WD for 12 weeks, we observed a significant difference in the change in total body weight and weight gain between the CON and WD groups. The clitorin-administered group mice displayed significantly lower total body weight and weight gain than the WD group mice (Fig. 1B and 1C). However, we did not observe any differences in food intake among the WD-fed groups (Fig. 1D). These data clearly showed that clitorin administration reduces body weight gain in WD-induced mice. Clitorin ameliorated liver steatosis in the WD-induced NAFLD mouse model Because NAFLD participants manifested higher serum levels of TC and TG than those without NAFLD 15 , we first investigated the impact of clitorin on serum TC and TG levels. Compared to the corresponding levels recorded in the CON group, we detected significant increases in the serum TC and TG levels in the WD group; furthermore, the marked increases in serum TC and TG levels were all lower in the clitorin-administered groups (Fig. 2A and 2B). Second, the liver weight and liver index (mg/body weight) in the WD group were significantly higher than the corresponding parameters in the CON group. In contrast, clitorin administration significantly reversed these changes compared to the parameters observed in the WD group (Fig. 2C and 2D). Moreover, we observed smaller sized and fewer hepatocytic lipid vacuoles in the livers of the clitorin-administered group mice than in the WD group mice (Fig. 2E). Finally, compared to the corresponding levels observed in the WD group, serum ALT and AST levels also tended to decrease in the clitorin-administered mice; however, these were not statistically significant (Fig. 2F and 2G). Altogether, these data indicated that the NAFLD mouse model, utilized in the present study, was an optimal and completely established one; additionally clitorin administration demonstrated a protective effect against NAFLD in mice challenged with WD. Clitorin regulated adipogenesis, lipogenesis, and fatty acid oxidation in the WD-induced NAFLD mouse model liver To investigate the mechanisms suppressing lipid accumulation in the livers of WD mice administered with clitorin, adipogenic and lipogenic transcriptional expression profiles were further examined. In the liver, the protein expression levels of SREBP1 , as well as PPARγ and C/EBPα , were higher in the WD group; however, this was rescued by clitorin administration (Fig. 3A). qRT-PCR analysis revealed that the upregulated SREBP1, PPARγ, and C/EBPα protein expression levels in the livers of WD mice coincided with increases in SREBP1 , PPARγ , and C/EBPα mRNA levels. Notably, the marked upregulation of these genes was strongly suppressed in the livers of clitorin-administered mice compared to the corresponding expression profiles in the WD group (Fig. 3B, 3C, and 3D). Since high rates of hepatic lipogenesis and lipid oxidation are distinguishing features of NAFLD in rodents and humans, we next assessed the impact of clitorin on lipogenesis and fatty acid oxidation genes. The mRNA levels of both LXR and ACC , hepatic lipogenesis genes, were significantly inhibited in the clitorin-administered groups (Fig. 3E). Furthermore, the mRNA levels of CPT-1 and PPARα , fatty acid oxidation genes, were significantly elevated in the clitorin-administered groups (Fig. 3E). We also found that the AMPK mRNA level, which was eliminated in the WD group, was augmented by clitorin administration (Fig. 3E). These data supported the concept that clitorin counteracts WD-induced NAFLD by regulating lipogenesis and fatty acid oxidation genes in the liver. WD: western diet; NAFLD: nonalcoholic fatty liver disease; SREBP1 sterol regulatory element binding protein 1; PPARγ: peroxisome proliferator activated receptor γ; C/EBPα: CCAAT/enhancer binding protein α; ACC: acetyl-CoA carboxylase; AMPK: adenosine monophosphate-activated protein kinase; LXR: liver X receptor Clitorin improved oleic acid-induced steatosis in HepG2 Cells The MTT assay was used to examine the effects of various concentrations of clitorin on cell viability. Clitorin treatment (0-200 μM) did not induce cytotoxicity for 24 h in HepG2 cells (Fig. 4A). Accordingly, we designated three doses of clitorin at 50, 100, and 200 µM for further study. Oil Red O staining showed a significant increase in lipid droplets in 1 mM oleic acid-treated cells compared to the lipid droplet concentration in non-treated cells. However, this lipid accumulation was significantly decreased by high concentrations of clitorin in oleic acid-induced HepG2 cells (Fig. 4B and 4C). Discussion Obesity directly contributes to the abundance of hepatic TG accumulation, which is linked to NAFLD progression 16 . Immoderate exposure to a high-fat diet has been determined as a key attribute in an increasing number of NAFLD patients, which is demonstrated by the fact that the prevalence of NAFLD in obese patients is reported to be up to 90% 17 . Consequently, a high-fat diet is widely used to construct NAFLD animal models 18 . In the present study, clitorin administration significantly reduced the body weight gain in a WD-induced NAFLD mouse model (Fig. 1). Moreover, clitorin administration significantly reduced the liver index (mg/body weight) and notably decreased lipid droplet concentration without hepatic toxicity (ALT and AST) in the livers of WD-induced mice; this demonstrates that it suppresses hepatic steatosis (Fig. 2 ). Orlistat was used as a positive control because it has been reported that orlistat effectively alleviates steatosis and may serve as a viable treatment option for NAFLD 19 . The hepatic effect of PPARγ appears to be steatogenic; hepatocyte-specific PPARγ knockout mice showed a remarkable decrease in the number of hepatic lipid vacuoles, as well as downregulation of de novo lipogenesis activators 20 . Conversely, PPARγ overexpression in the liver induced by HFD feeding leads to lipid accumulation, which is the initiation step in the development of NAFLD 5 . CCAAT/enhancer binding proteins (C/EBPs), including C/EBPα and SREBP1, are also considered key regulators of adipogenesis. SREBP1 plays an important role in the regulation of de novo lipogenesis in the liver 21 . SREBP1c levels are enhanced in the fatty livers of obese, insulin-resistant, and hyperinsulinemic ob / ob mice 7 . In addition, SREBP1c expression is also elevated in patients with NAFLD; additionally, in concordance with its lipogenic role, hepatic triglyceride levels are higher in SREBP1c-overexpressing transgenic mice 22 . Thus, SREBP1, PPARγ, and C/EBPα are crucial transcription factors that upregulate the expression of genes modulating fat accumulation in the liver. Clitorin administration remarkably downregulated the protein and mRNA expression of SREBP1 , PPARγ , and C/EBPα in the livers of WD-induced NAFLD mice (Fig. 3A, 3B, 3C, and 3D). LXRs are involved in hepatic lipogenesis via direct regulation of SREBP1c 23 , which positively modulates ACC expression 24 . ACC catalyzes a key rate-limiting step in fatty acid biosynthesis, and is also associated with the control of fatty acid oxidation by the synthesis of malonyl-CoA, an inhibitor of CPT-1 4 . CPT-1 is the rate-limiting enzyme in fatty acid oxidation 25 . Indeed, inhibition of the liver-specific isoform ACC1 in mice ameliorated hepatic triglyceride levels in mice by simultaneously suppressing fatty acid biosynthesis and augmenting fatty acid beta oxidation in the liver 4 . CPT-1 is also linked to PPARα expression. PPARα activation gives rise to the transcription of CPT-1 , a target gene that is responsible for beta-oxidation, as it allows fatty acids to reach the mitochondrial matrix 8 . Among the three PPAR isotypes, PPARα, PPARβ/δ, and PPARγ, PPARα is the most abundant isotype in hepatocytes and is related to numerous aspects of lipid metabolism 26 and high fatty acid oxidation rates 27 . Ineffective PPAR-α sensing leads to diminished energy burning, resulting in hepatic steatosis and steatohepatitis 28 ; it is thus inferred that it can potentially prevent NAFLD. Therefore, targeting lipogenesis and beta-oxidation genes is considered a promising therapeutic approach to control NAFLD. AMPK, a major energy sensor of the cell, downregulates ACC activity to suppress lipid biosynthesis 29 . In addition, AMPK regulates hepatic and adipose lipid metabolism by modulating lipogenesis, lipolysis, gluconeogenesis, and adipogenesis; AMPK inhibits de novo lipogenesis by downregulating PPARγ , C/EBPα , and SREBP1 ; furthermore, it promotes fatty acid oxidation by upregulating CPT-1a 30 . Our results showed that clitorin administration significantly decreased the mRNA levels of LXR and ACC , which are lipogenic genes. It also enhanced the mRNA levels of PPARα and CTP-1 , beta-oxidation genes, as well as AMPK mRNA levels in the livers of WD-induced NAFLD mice (Fig. 3E). HepG2 cells have been widely used to model NAFLD in vitro , and steatosis in this cell line can be induced by treatment with oleic acid 31 – 33 . Several studies have also used HepG2 cells to evaluate their effects on the management and prevention of NAFLD 34 – 36 . Hence, we used an oleic acid-induced HepG2 cell model to evaluate the effect of clitorin on NAFLD in vitro . Consistent with in vivo experiments, our results showed that clitorin treatment significantly diminished lipid accumulation in oleic acid-induced differentiated HepG2 cells (Fig. 4 ). Taken together, clitorin administration reduced the adipogenic genes, including SREBP1, PPARγ, and C/EBPα in WD-induced NAFLD mice liver. In addition, it significantly decreased the mRNA levels of lipogenic genes LXR , and ACC ; additionally it enhanced the mRNA levels of beta-oxidation genes PPARα and CTP- 1, as well as AMPK mRNA levels, in the liver of WD-induced mice. The present study is the first to report on the positive impact of clitorin on NAFLD. Furthermore, our findings provide basic data, which lead to deeper understanding of the pharmacological effects of clitorin on the improvement of NAFLD in WD-induced mice and oleic acid-induced HepG2 cells. Materials And Methods Chemicals and reagents Oil Red O powder, oleic acid, and methyl alcohol were purchased from Sigma-Aldrich Co. LLC (St. Louis, MO, USA). Minimum Essential Medium (MEM), fetal bovine serum (FBS), and penicillin were purchased from Life Technologies Inc. (Grand Island, NY, USA). Orlistat was purchased from Tokyo Chemical Inc. (Tokyo, Japan). The Research Diets (New Brunswick, NJ, USA) provided 45% of the WD (D-12451). Antibodies against PPARγ (cat. no. sc-7273), C/EBPα (cat. no. sc-365318), SREBP1 (cat. no. sc-13551), and β-actin (cat. No. sc-47778) were purchased from Santa Cruz Biotechnology Inc. (Dallas, TX, USA). Horseradish peroxidase-conjugated secondary antibodies were purchased from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA, USA). Preparation of clitorin Clitorin, a compound derived from Carica papaya L., was identified by Professor Agung Nugroho (Lambung Mangkurat University, Indonesia). The leaves of Carica papaya were collected from a papaya farm near Pelaihari City, South Kalimantan Province. The collected leaves were dried completely at 40°C. The dried powder of C. papaya leaf (750 g) was extracted thrice with MeOH (6 L) under reflux at 70°C for 5 h. Thereafter, clitorin was isolated and purified from the fraction. Freeze-dried samples were dissolved in dimethyl sulfoxide. Experimental animal care protocols and treatment cycles Six-week-old male C57BL/6J mice were procured from Daehan Biolink (Daejeon, Republic of Korea). The mice were maintained under conditions of controlled temperature (22 ± 2°C) and humidity (55 ± 9 %), with a 12-h light/dark cycle. After a week of adjustment, the mice were fed 45 % WD for 7 weeks, except for the normal diet group (CON). After 7 weeks, the mice were divided into five groups of six mice each: WD group, WD + treatment group with 10 or 20 mg/kg orlistat as a positive control, and WD + treatment group with 10 or 20 mg/kg clitorin. Orlistat and clitorin were orally administered to the mice once daily for 4 weeks. Mice in the CON and WD groups were administered water as a vehicle. The mice were allowed free access to water and food, and their body weight and food intake were measured every week. The livers of the mice were excised, cleaned with phosphate-buffered saline (PBS), weighed, and directly stored at − 80°C. All protocols were performed under the Ethical Committee for Animal Care and the Use of Laboratory Animals, Sangji University (approval document no. 2017-22). Serum analysis During blood sample collection, the animals were already under the influence of terminal anesthesia. Blood samples were collected via cardiac puncture. The samples were centrifuged at 1000 × g for 20 min to obtain the serum samples. The concentrations of alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglyceride (TG), and total cholesterol (TC) were measured by enzymatic methods using commercially available kits (BioVision; Milpitas, CA, USA). Histological analysis The liver tissues from the mice in each group were fixed in 10% formalin, embedded in paraffin, and cut into 8 µm sections. Certain sections were stained with hematoxylin and eosin (H&E) for histological examination. Stained liver sections were observed for the evaluation of lipid droplet. All observations were performed using an Olympus SZX10 microscope (Olympus, Tokyo, Japan). Western blot analysis Fresh liver tissues were homogenized using PRO-PREP ® (Intron Biotechnology, Gyeonggi-do, Republic of Korea), a protein extraction solution. The same amount (15–30 µg) of protein sample was separated on an 8 %–12 % sodium dodecyl sulfate polyacrylamide gel and transferred onto a polyvinylidene fluoride membrane. The membranes were blocked with 2.5 % skim milk solution for 30 min, incubated with PPARγ (1:1000), C/EBPα (1:1000), SREBP1 (1:1000), and β-actin (1:2500) primary antibodies overnight at 4°C, followed by incubation with anti-mouse horseradish peroxidase-conjugated secondary antibody (1:2500) for 2 h at 25°C. The membranes were washed thrice for 10 min with Tris-buffered saline containing Tween 20 and visualized by enhanced chemiluminescence using Amersham Imager 680 (GE Healthcare Bio-Sciences AB, Sweden). Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis qRT-PCR analysis was performed as previously described 37 . Briefly, the liver was homogenized, and total RNA was isolated using the Easy-Blue ® reagent according to the manufacturer’s instructions (Intron Biotechnology; Seongnam, Republic of Korea). Total RNA was converted to cDNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems; Foster City, CA, USA) and thermocycler (Gene Amp ® PCR system 9700; Applied Biosystems). qPCR analysis was conducted using a Step One Plus ® Real-time PCR system (Applied Biosystems). Gene expression was determined using the comparative threshold cycle method. GAPDH was used as an internal control. Sequences of mouse oligonucleotide primers are presented in Table 1 . Table 1 Real-Time PCR primer sequences Gene Forward (5’-3’) Reverse (5’-3’) PPARγ ATCGAGTGCCGAGTCTGTGG GCAAGGCACTTCTGAAACCG SREBP1 GGCTATTCCGTGAACATCTCCTA ATCCAAGGGCAGTTCTTGTG C/EBPα GGAACTTGAAGCACAATCGATC TGGTAAAGGTTCTCA LXRα CAGGAGACCAGGGAGGCAAC GCAGGGCTGTAGGCTCTGCT ACC TTTTCGATGTCCTCCCAAACTTT GCTCATAGGCGATATAAGCTCT CPT-1 CTCAGTGGGAGCGACTCTTCA GGCCTCTGTGGTACACGACAA PPARα CAGGAGAGCAGGGATTTGCA CCTACGCTCAGCCCTCTTCAT AMPK GGTGGATTCCCAAAAGTGCT AAGCAGTGCTGGGTCACAAG GAPDH ATGGAAATCCCATCACCATCTT CGCCCCACTTGATTTTGG Cell culture and differentiation of HepG2 cells The human hepatoma cell line HepG2 (No. 88065) was obtained from the Korean Cell Line Bank (KCLB, Seoul, Republic of Korea). HepG2 cells were grown in MEM containing 10 % FBS and 100 mg/L penicillin. The cells were maintained under a humidified atmosphere of 5 % CO 2 at 37°C. For induction of hepatocyte differentiation, cells were seeded at a density of 2 × 10 5 cells per well into 6-well plates with oleic acid (1 mM) and incubated for 48 h. After incubation, the cells were treated with different concentrations of clitorin (50, 100, and 200 µM) for 24 h. Cell viability assay HepG2 cells were seeded into a 96-well plate at a concentration of 1 × 10 6 cells per well for 24 h. After incubation, the cells were treated with different concentrations of clitorin (0–200 µM) for 24 h. After treatment, the cells were treated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) solution (5 mg/mL) and incubated again for 4 h. The supernatant from the plates was discarded, and the purple formazan product was dissolved in dimethyl sulfoxide. The absorbance was measured at 540 nm using an Epoch microplate spectrometer (Biotek, Winooski, VT, USA). Oil red O staining of HepG2 cells After cell differentiation with oleic acid, the cells were washed with PBS and fixed with 10% formaldehyde in PBS at 25°C for 1 h. Cells were then washed thrice with distilled water and stained with Oil Red O working solution (3 mg/mL in 60 % isopropanol) at 25°C for 2 h. The cells were rinsed thrice with distilled water and photographed using an Olympus SZX10 microscope. Next, the Oil Red O dye was eluted with isopropanol to determine the intracellular lipid content and was measured using an Epoch® microvolume spectrophotometer at 520 nm. Statistical analysis Data are expressed as the mean ± standard deviation (SD) of triplicate experiments. Statistically significant values were compared using ANOVA and Dunnett’s post hoc test, and p -values < 0.05 were considered statistically significant. Statistical analysis was performed using SPSS statistical analysis software (version 19.0, IBM SPSS, Armonk, NY, USA). Abbreviations adenosine monophosphate-activated protein kinase (AMPK), acetyl-CoA carboxylase (ACC), CCAAT/enhancer binding protein α (C/EBPα), carnitine palmitoyltranserase-1 (CTP-1), liver X receptor (LXR), Nonalcoholic fatty liver disease (NAFLD), peroxisome proliferator-activated receptor α (PPARα), peroxisome proliferator-activated receptor γ (PPARγ), sterol regulatory element-binding protein 1 (SREBP1), western diet (WD) Declarations Author Information: Corresponding Athor Hyo-Jin An - Department of Pharmacology, College of Korean Medicine, Sangji University, Wonju, Gangwon-do 26339, Republic of Korea; E-mail: [email protected] ; Tel: +82-33-738-7503 Athors Divina C. Cominguez - Department of Pharmacology, College of Korean Medicine, Sangji University, Wonju, Gangwon-do 26339, Republic of Korea Yea-Jin Park - Department of Pharmacology, College of Korean Medicine, Sangji University, Wonju, Gangwon-do 26339, Republic of Korea Yun-Mi Kang - Department of Pharmacology, College of Korean Medicine, Sangji University, Wonju, Gangwon-do 26339, Republic of Korea Agung Nugroho - Department of Agro-Industrial Technology, Lambung Mangkurat University, Banjarbaru, Indonesia Suhyun Kim - Department of Obstetrics & Gynecology College of Korean Medicine, Sangji University, Wonju-si, Gangwon-do 26339, Republic of Korea Author Contribution staement : D.C.C. and H.J.A. conceived and designed the experiments. D.C.C. and Y.J.P. wrote the manuscript. D.C.C. conducted the experiments. A.N. supplied the clitorin used in experimental analyses, which is derived from the papaya plant. Y.J.P., Y.M.K., and H.J.A. substantially contributed to the analysis and interpretation of data and revised the manuscript. All authors read and approved the final manuscript. Acknowledgements : The present study was supported by a National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIP; Ministry of Science, ICT & Future Planning) (No. NRF-2020R1G1A1011494). Data Availability Statement: The datasets used and/or analyzed in this study are available from the corresponding authors on reasonable request. Declaration of competing interest: The authors declare no conflict of interest. References 1 Drescher, H. K., Weiskirchen, S. & Weiskirchen, R. Current Status in Testing for Nonalcoholic Fatty Liver Disease (NAFLD) and Nonalcoholic Steatohepatitis (NASH). Cells 8 , doi:10.3390/cells8080845 (2019). 2 Friedman, S. L., Neuschwander-Tetri, B. A., Rinella, M. & Sanyal, A. J. Mechanisms of NAFLD development and therapeutic strategies. Nat Med 24 , 908-922, doi:10.1038/s41591-018-0104-9 (2018). 3 Pydyn, N., Miekus, K., Jura, J. & Kotlinowski, J. New therapeutic strategies in nonalcoholic fatty liver disease: a focus on promising drugs for nonalcoholic steatohepatitis. Pharmacol Rep 72 , 1-12, doi:10.1007/s43440-019-00020-1 (2020). 4 Koo, S. H. Nonalcoholic fatty liver disease: molecular mechanisms for the hepatic steatosis. Clin Mol Hepatol 19 , 210-215, doi:10.3350/cmh.2013.19.3.210 (2013). 5 Lee, Y. K., Park, J. E., Lee, M. & Hardwick, J. P. Hepatic lipid homeostasis by peroxisome proliferator-activated receptor gamma 2. Liver Res 2 , 209-215, doi:10.1016/j.livres.2018.12.001 (2018). 6 Wang, L. F. et al. Inhibition of NAMPT aggravates high fat diet-induced hepatic steatosis in mice through regulating Sirt1/AMPKalpha/SREBP1 signaling pathway. Lipids Health Dis 16 , 82, doi:10.1186/s12944-017-0464-z (2017). 7 Musso, G., Gambino, R. & Cassader, M. Recent insights into hepatic lipid metabolism in non-alcoholic fatty liver disease (NAFLD). Prog Lipid Res 48 , 1-26, doi:10.1016/j.plipres.2008.08.001 (2009). 8 Souza-Mello, V. Peroxisome proliferator-activated receptors as targets to treat non-alcoholic fatty liver disease. World J Hepatol 7 , 1012-1019, doi:10.4254/wjh.v7.i8.1012 (2015). 9 Seo, Y. J., Lee, K., Song, J. H., Chei, S. & Lee, B. Y. Ishige okamurae Extract Suppresses Obesity and Hepatic Steatosis in High Fat Diet-Induced Obese Mice. Nutrients 10 , doi:10.3390/nu10111802 (2018). 10 Pandey, S., Cabot, P. J., Shaw, P. N. & Hewavitharana, A. K. Anti-inflammatory and immunomodulatory properties of Carica papaya. J Immunotoxicol 13 , 590-602, doi:10.3109/1547691X.2016.1149528 (2016). 11 Santana, L. F. et al. Nutraceutical Potential of Carica papaya in Metabolic Syndrome. Nutrients 11 , doi:10.3390/nu11071608 (2019). 12 Julianti, T. et al. HPLC-based activity profiling for antiplasmodial compounds in the traditional Indonesian medicinal plant Carica papaya L. J Ethnopharmacol 155 , 426-434, doi:10.1016/j.jep.2014.05.050 (2014). 13 Brasil, G. A. et al. Antihypertensive effect of Carica papaya via a reduction in ACE activity and improved baroreflex. Planta Med 80 , 1580-1587, doi:10.1055/s-0034-1383122 (2014). 14 Ma, H., Li, J., An, M., Gao, X. M. & Chang, Y. X. A powerful on line ABTS(+)-CE-DAD method to screen and quantify major antioxidants for quality control of Shuxuening Injection. Scientific reports 8 , 5441, doi:10.1038/s41598-018-23748-x (2018). 15 Xie, W. & Chen, S. A nomogram for estimating the probability of nonalcoholic fatty liver disease in a Chinese population: A retrospective cohort study. Medicine (Baltimore) 99 , e23049, doi:10.1097/MD.0000000000023049 (2020). 16 Lakhani, H. V. et al. Phenotypic Alteration of Hepatocytes in Non-Alcoholic Fatty Liver Disease. Int J Med Sci 15 , 1591-1599, doi:10.7150/ijms.27953 (2018). 17 Hu, Y. et al. Acerola polysaccharides ameliorate high-fat diet-induced non-alcoholic fatty liver disease through reduction of lipogenesis and improvement of mitochondrial functions in mice. Food Funct 11 , 1037-1048, doi:10.1039/c9fo01611b (2020). 18 Zhong, F., Zhou, X., Xu, J. & Gao, L. Rodent Models of Nonalcoholic Fatty Liver Disease. Digestion 101 , 522-535, doi:10.1159/000501851 (2020). 19 Ye, J. et al. Effect of orlistat on liver fat content in patients with nonalcoholic fatty liver disease with obesity: assessment using magnetic resonance imaging-derived proton density fat fraction. Therap Adv Gastroenterol 12 , 1756284819879047, doi:10.1177/1756284819879047 (2019). 20 Skat-Rordam, J., Hojland Ipsen, D., Lykkesfeldt, J. & Tveden-Nyborg, P. A role of peroxisome proliferator-activated receptor gamma in non-alcoholic fatty liver disease. Basic Clin Pharmacol Toxicol 124 , 528-537, doi:10.1111/bcpt.13190 (2019). 21 Jo, H. K., Kim, G. W., Jeong, K. J., Kim, D. Y. & Chung, S. H. Eugenol ameliorates hepatic steatosis and fibrosis by down-regulating SREBP1 gene expression via AMPK-mTOR-p70S6K signaling pathway. Biol Pharm Bull 37 , 1341-1351, doi:10.1248/bpb.b14-00281 (2014). 22 Shimano, H. et al. Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells. J Clin Invest 99 , 846-854, doi:10.1172/JCI119248 (1997). 23 Grønning-Wang, L. M., Bindesbøll, C. & Nebb, H. I. The role of liver X receptor in hepatic de novo lipogenesis and cross-talk with insulin and glucose signaling. Lipid metabolism , 61-90 (2013). 24 Kohjima, M. et al. SREBP-1c, regulated by the insulin and AMPK signaling pathways, plays a role in nonalcoholic fatty liver disease. Int J Mol Med 21 , 507-511 (2008). 25 Dai, J. et al. Chemoproteomics reveals baicalin activates hepatic CPT1 to ameliorate diet-induced obesity and hepatic steatosis. Proc Natl Acad Sci U S A 115 , E5896-E5905, doi:10.1073/pnas.1801745115 (2018). 26 Montagner, A. et al. Liver PPARalpha is crucial for whole-body fatty acid homeostasis and is protective against NAFLD. Gut 65 , 1202-1214, doi:10.1136/gutjnl-2015-310798 (2016). 27 Pawlak, M., Lefebvre, P. & Staels, B. Molecular mechanism of PPARalpha action and its impact on lipid metabolism, inflammation and fibrosis in non-alcoholic fatty liver disease. J Hepatol 62 , 720-733, doi:10.1016/j.jhep.2014.10.039 (2015). 28 Reddy, J. K. & Rao, M. S. Lipid metabolism and liver inflammation. II. Fatty liver disease and fatty acid oxidation. Am J Physiol Gastrointest Liver Physiol 290 , G852-858, doi:10.1152/ajpgi.00521.2005 (2006). 29 Liou, C. J. et al. Fisetin Protects Against Hepatic Steatosis Through Regulation of the Sirt1/AMPK and Fatty Acid beta-Oxidation Signaling Pathway in High-Fat Diet-Induced Obese Mice. Cell Physiol Biochem 49 , 1870-1884, doi:10.1159/000493650 (2018). 30 Inamdar, S., Joshi, A., Malik, S., Boppana, R. & Ghaskadbi, S. Vitexin alleviates non-alcoholic fatty liver disease by activating AMPK in high fat diet fed mice. Biochem Biophys Res Commun 519 , 106-112, doi:10.1016/j.bbrc.2019.08.139 (2019). 31 Kanuri, G. & Bergheim, I. In vitro and in vivo models of non-alcoholic fatty liver disease (NAFLD). International journal of molecular sciences 14 , 11963-11980, doi:10.3390/ijms140611963 (2013). 32 Müller, F. A. & Sturla, S. J. Human in vitro models of nonalcoholic fatty liver disease. Current Opinion in Toxicology 16 , 9-16 (2019). 33 Lee, M. R., Yang, H. J., Park, K. I. & Ma, J. Y. Lycopus lucidus Turcz. ex Benth. Attenuates free fatty acid-induced steatosis in HepG2 cells and non-alcoholic fatty liver disease in high-fat diet-induced obese mice. Phytomedicine 55 , 14-22, doi:10.1016/j.phymed.2018.07.008 (2019). 34 Ali, O., Darwish, H. A., Eldeib, K. M. & Abdel Azim, S. A. miR-26a Potentially Contributes to the Regulation of Fatty Acid and Sterol Metabolism In Vitro Human HepG2 Cell Model of Nonalcoholic Fatty Liver Disease. Oxid Med Cell Longev 2018 , 8515343, doi:10.1155/2018/8515343 (2018). 35 Gomaraschi, M. et al. Lipid accumulation impairs lysosomal acid lipase activity in hepatocytes: Evidence in NAFLD patients and cell cultures. Biochim Biophys Acta Mol Cell Biol Lipids 1864 , 158523, doi:10.1016/j.bbalip.2019.158523 (2019). 36 Xia, H. et al. Alpha-naphthoflavone attenuates non-alcoholic fatty liver disease in oleic acid-treated HepG2 hepatocytes and in high fat diet-fed mice. Biomed Pharmacother 118 , 109287, doi:10.1016/j.biopha.2019.109287 (2019). 37 Park, Y. J., Lee, G. S., Cheon, S. Y., Cha, Y. Y. & An, H. J. The anti-obesity effects of Tongbi-san in a high-fat diet-induced obese mouse model. BMC Complement Altern Med 19 , 1, doi:10.1186/s12906-018-2420-5 (2019). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 05 Oct, 2021 Reviews received at journal 29 Sep, 2021 Reviewers agreed at journal 15 Sep, 2021 Reviewers invited by journal 15 Sep, 2021 Editor assigned by journal 15 Sep, 2021 Editor invited by journal 15 Sep, 2021 Submission checks completed at journal 15 Sep, 2021 First submitted to journal 24 Aug, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-841938","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":47995310,"identity":"f54cd7e1-15a3-431c-a75e-56f46a409792","order_by":0,"name":"Divina C. Cominguez","email":"","orcid":"","institution":"Sangji University","correspondingAuthor":false,"prefix":"","firstName":"Divina","middleName":"C.","lastName":"Cominguez","suffix":""},{"id":47995311,"identity":"7d7477dc-870e-43f9-9094-6f43ec668043","order_by":1,"name":"Yea-Jin Park","email":"","orcid":"","institution":"Sangji University","correspondingAuthor":false,"prefix":"","firstName":"Yea-Jin","middleName":"","lastName":"Park","suffix":""},{"id":47995313,"identity":"d08cd07a-fbe7-43df-a6cd-67605a20ece2","order_by":2,"name":"Yun-Mi Kang","email":"","orcid":"","institution":"Sangji University","correspondingAuthor":false,"prefix":"","firstName":"Yun-Mi","middleName":"","lastName":"Kang","suffix":""},{"id":47995314,"identity":"b8d4a683-4956-4b2d-a302-86673129928e","order_by":3,"name":"Agung Nugroho","email":"","orcid":"","institution":"Lambung Mangkurat University","correspondingAuthor":false,"prefix":"","firstName":"Agung","middleName":"","lastName":"Nugroho","suffix":""},{"id":47995315,"identity":"164ce26c-1b12-4665-950b-071babb2bb9f","order_by":4,"name":"Suhyun Kim","email":"","orcid":"","institution":"Sangji University","correspondingAuthor":false,"prefix":"","firstName":"Suhyun","middleName":"","lastName":"Kim","suffix":""},{"id":47995316,"identity":"43575f9f-3816-4d2a-bbcc-2e83e705c933","order_by":5,"name":"Hyo-Jin An","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYLACCQOGBCDF+ABI8PCRooXZAKSFjViLQFrYJEAsglrk288efmFRcCePf/bptMqvOXYybAzMDx/dwKPF4ExemoWEwbNiiXO5227LbksGOozN2DgHnxaGHDMDCYPDiQ1neLfdltzGDNTCwyaNT4t8/xuIlvlALcWS2+oJa2G4kWP8AKRlA1AL48dthwlrMbjxxgwYyM8SN57h3SzNuO04DxszAb/I9+cYf5b4cydx3hnejR9/bqu252dvfvgYr8OAESEtwXAAzGLmAZP4lYOVfPwA1cL4g7DqUTAKRsEoGIEAACYYSXjBqmdCAAAAAElFTkSuQmCC","orcid":"","institution":"Sangji University","correspondingAuthor":true,"prefix":"","firstName":"Hyo-Jin","middleName":"","lastName":"An","suffix":""}],"badges":[],"createdAt":"2021-08-24 06:44:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-841938/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-841938/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":12768773,"identity":"f3ed49d3-e9bd-4699-b2df-da30236ddd91","added_by":"auto","created_at":"2021-08-26 01:26:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":627412,"visible":true,"origin":"","legend":"Effect of clitorin on total body weight, weight gain, and food intake in the WD-induced NAFLD mouse model.\nThe WD-induced mice were administered orlistat (10 or 20 mg/kg) or clitorin (10 or 20 mg/kg) for 4 weeks, whereas control mice were fed a normal diet. (A) Macroscopic body images of the mice in each group were taken at the end of the 13-week experimental period. (B) Body weight, (C) weight gain, and (D) food intake were recorded every week. The values are represented as the mean ± SD (n=6 per group). ##P \u003c 0.01, ###P \u003c 0.001 vs. CON group; *P \u003c 0.05, **P \u003c 0.01, ***P \u003c 0.001 vs. WD group; significance was determined using two-way ANOVA followed by a Bonferroni post hoc test, and one-way ANOVA followed by Dunnett’s post hoc test.\nWD: western diet; NAFLD: nonalcoholic fatty liver disease\n","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-841938/v1/e59d858cf8b51f39866363a7.png"},{"id":12769016,"identity":"fc51fd41-ec0f-465f-8735-333a29affa0e","added_by":"auto","created_at":"2021-08-26 01:29:13","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1641547,"visible":true,"origin":"","legend":"Effect of clitorin on liver steatosis in the WD-induced NAFLD mouse model. \nThe levels of (A) serum TG and (B) serum TC were determined using enzymatic methods. (C) The weight of liver tissue and (D) relative liver weight ratio (mg/body weight) were measured at the end of the experimental period. (E) Morphology and H\u0026E staining images are shown. The liver tissues from representative mice in each group were fixed, embedded in paraffin, and stained with H\u0026E solution. Images are shown at an original magnification of 100 ×. The levels of (F) serum ALT and (G) serum AST were determined using enzymatic methods. The values are represented as the mean ± SD (n=6 per group). ###P \u003c 0.001 vs. CON group; ***P \u003c 0.001 vs. WD group; significance was determined using one-way ANOVA followed by Dunnett’s post hoc test.\nWD: western diet; NAFLD: nonalcoholic fatty liver disease; TG: triglyceride; TC: total cholesterol; H\u0026E: hematoxylin and eosin\n","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-841938/v1/17876eac624c2bb3652fbc22.png"},{"id":12768776,"identity":"dfc5fd5f-bc21-46d8-8e0f-bc97706d0f09","added_by":"auto","created_at":"2021-08-26 01:26:13","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":257413,"visible":true,"origin":"","legend":"Effect of clitorin on adipogenic, lipogenic, and fatty acid oxidation-related genes in the WD-induced NAFLD mouse model liver.\nThe protein levels of (A) SREBP1, PPARγ, and C/EBPα were determined using western blot analysis. Densitometric analysis was performed using ImageJ ver. 1.50i. The mRNA levels of (B) SREBP1, (C) PPARγ, and (D) C/EBPα were determined using qRT-PCR analysis. (E) The mRNA levels of LXR, ACC, CPT-1, PPARα, and AMPK were determined using qRT-PCR analysis. The values are represented as the mean ± SD (n=6 per group). ##P \u003c 0.01 and ###P \u003c 0.001 vs. CON group; *P \u003c 0.05, **P \u003c 0.01, and ***P \u003c 0.001 vs. WD group; significance was determined using one-way ANOVA followed by Dunnett’s post hoc test.\nWD: western diet; NAFLD: nonalcoholic fatty liver disease; SREBP1 sterol regulatory element binding protein 1; PPARγ: peroxisome proliferator activated receptor γ; C/EBPα: CCAAT/enhancer binding protein α; ACC: acetyl-CoA carboxylase; AMPK: adenosine monophosphate-activated protein kinase; LXR: liver X receptor\n","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-841938/v1/7e0ca6e3de6e68e1029c36f3.png"},{"id":12769017,"identity":"48809062-02d8-4eca-911b-ca6873a9163d","added_by":"auto","created_at":"2021-08-26 01:29:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1024168,"visible":true,"origin":"","legend":"Effect of clitorin on oleic acid-induced steatosis in HepG2 Cells. \n(A) Cell viability was evaluated using the MTT assay in HepG2 cells. (B) The lipid accumulation rate was measured by Oil Red O staining. (C) The lipid content was quantified by measuring absorbance. The values are represented as mean ± S.D of three independent experiments. ###P \u003c 0.001 vs. non-treated cells; *P \u003c 0.05, **P \u003c 0.01, and ***P \u003c 0.001 vs. oleic acid-treated cells; significances were determined using one-way ANOVA followed by Dunnett’s post hoc test.\n","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-841938/v1/7a19b535cf20c537c7c4879c.png"},{"id":13711895,"identity":"96d27d58-ba70-4113-a973-9a14201f5877","added_by":"auto","created_at":"2021-09-17 14:24:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1926285,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-841938/v1/f13be62a-1650-40c6-91a8-74d63bd59542.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Clitorin, a Flavonoid Compound of Papaya, Ameliorates Non-Alcoholic Fatty Liver Disease in Western Diet- induced Mice and Oleic Acid-induced HepG2 Cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNonalcoholic fatty liver disease (NAFLD) is the most ubiquitous chronic liver disease in Western countries, affecting nearly 25% of adults worldwide \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. In the United States, the number of NAFLD cases is anticipated to increase from 83.1\u0026nbsp;million in 2015 to 100.9\u0026nbsp;million in 2030 \u003csup\u003e2\u003c/sup\u003e. NAFLD is characterized by excessive internal fat accumulation in hepatocytes. It ranges from relatively benign nonalcoholic fatty liver to the aggressive form termed nonalcoholic steatohepatitis, typifying both fatty liver and liver inflammation \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. NAFLD is usually correlated with metabolic diseases, such as obesity, insulin resistance, hyperglycemia, and hypertension. Although considerable progress has been achieved with regard to drug development for NAFLD, no suitable therapeutic agent has yet been approved \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Therefore, there is a critical need to develop optimal therapeutic agents for NAFLD.\u003c/p\u003e \u003cp\u003eHepatic steatosis can be stimulated by increased \u003cem\u003ede novo\u003c/em\u003e lipogenesis and decreased fatty acid oxidation \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. When the high-fat diet feeding, peroxisome proliferator-activated receptor γ (PPARγ) is the early-induced lipogenic transcription factor in the liver \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Hepatic lipid synthesis is also modulated by several important transcription factors, including the liver X receptor (LXR) and sterol regulatory element\u0026ndash;binding protein 1c (SREBP1c) \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. As a major transcription factor, SREBP1 has been reported to control key enzymes involved in fatty acid biosynthesis, such as acetyl-CoA carboxylase (ACC) \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. ACC catalyzes a master rate-controlling step in \u003cem\u003ede novo\u003c/em\u003e lipogenesis and fatty acid oxidation, that is, the synthesis of malonyl-CoA, which is both an intermediate in fatty acid synthesis and an allosteric inhibitor of carnitine palmitoyltranserase-1 (CTP-1) \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Peroxisome proliferator-activated receptor α (PPARα) is closely associated with the transcription of genes related to hepatic beta-oxidation, including \u003cem\u003eCPT-1\u003c/em\u003e \u003csup\u003e8\u003c/sup\u003e. This beta-oxidation provides energy in the form of ATP, and the activity of adenosine monophosphate-activated protein kinase (AMPK) hinders fat accumulation by inducing lipolysis and beta-oxidation in adipose tissue and liver \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePapaya (\u003cem\u003eCarica papaya\u003c/em\u003e L.) is a fruit crop that is widely grown in tropical and sub-tropical regions. Traditionally, papaya plants are used to treat various ailments such as asthma, ulcers, eczema, diabetes, helminth infections, and fever \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Papaya plants have been reported to possess therapeutic potential for metabolic disorders, such as diabetes mellitus type 2, causing alterations in both glycemic metabolism and lipid metabolism, oxidative stress, and in models of arterial hypertension \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Previous profiling indicates that four flavonoids, including manghaslin, clitorin, rutin, and nicotiflorin, were identified in papaya plants \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Among them, we focused on clitorin, a kaempferol glycoside, because it has only been reported antioxidant effects \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Based on these findings, the present study was designed to provide basic data to delineate the pharmacological effects of clitorin on the alleviation of NAFLD in western diet (WD)-induced mice and oleic acid-induced HepG2 cells.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eClitorin reduced the total body weight and weight gain in the WD-induced NAFLD mouse model\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA representative photograph of the experimental mice revealed that the 20 mg/kg clitorin-administered group mice were slightly smaller than those in the WD group (Fig. 1A). When mice were fed a WD for 12 weeks, we observed a significant difference in the change in total body weight and weight gain between the CON and WD groups. The clitorin-administered group mice displayed significantly lower total body weight and weight gain than the WD group mice (Fig. 1B and 1C). However, we did not observe any differences in food intake among the WD-fed groups (Fig. 1D). These data clearly showed that clitorin administration reduces body weight gain in WD-induced mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eClitorin ameliorated liver steatosis in the WD-induced NAFLD mouse model\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBecause NAFLD participants manifested higher serum levels of TC and TG than those without NAFLD \u003ca href=\"#_ENREF_15\" title=\"Xie, 2020 #101\"\u003e\u003csup\u003e15\u003c/sup\u003e\u003c/a\u003e, we first investigated the impact of clitorin on serum TC and TG levels. Compared to the corresponding levels recorded in the CON group, we detected significant increases in the serum TC and TG levels in the WD group; furthermore, the marked increases in serum TC and TG levels were all lower in\u0026nbsp;the clitorin-administered groups (Fig. 2A and 2B). Second, the liver weight and liver index (mg/body weight) in the WD group were significantly higher than\u0026nbsp;the corresponding parameters in the CON group. In contrast, clitorin administration significantly reversed these changes compared to the parameters observed in the WD group (Fig. 2C and 2D). Moreover, we observed\u0026nbsp;smaller sized and fewer hepatocytic lipid vacuoles in the livers of the clitorin-administered group mice than in the WD group mice (Fig. 2E). Finally, compared to the corresponding levels observed in the WD group, serum ALT and AST levels also tended to decrease in the clitorin-administered mice; however, these were not statistically significant (Fig. 2F and 2G).\u0026nbsp;Altogether, these data indicated that\u0026nbsp;the NAFLD mouse model, utilized in the present study, was an optimal and completely established one; additionally clitorin administration demonstrated a protective effect against NAFLD in mice challenged with WD.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eClitorin regulated adipogenesis, lipogenesis, and fatty acid oxidation in the WD-induced NAFLD mouse model liver\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the mechanisms suppressing lipid accumulation in the livers of WD mice administered with clitorin, adipogenic and lipogenic transcriptional expression profiles were further examined. In the liver, the protein expression levels of \u003cem\u003eSREBP1\u003c/em\u003e, as well as \u003cem\u003ePPAR\u0026gamma;\u003c/em\u003e and \u003cem\u003eC/EBP\u0026alpha;\u003c/em\u003e, were higher in the WD group; however, this was rescued by clitorin administration (Fig. 3A). qRT-PCR analysis revealed that the upregulated SREBP1, PPAR\u0026gamma;, and C/EBP\u0026alpha; protein expression levels in the livers of WD mice coincided with increases in \u003cem\u003eSREBP1\u003c/em\u003e, \u003cem\u003ePPAR\u0026gamma;\u003c/em\u003e, and \u003cem\u003eC/EBP\u0026alpha;\u003c/em\u003e mRNA levels. Notably, the marked upregulation of these genes was strongly suppressed in the livers of clitorin-administered mice compared to the corresponding expression profiles in the WD group (Fig. 3B, 3C, and 3D). Since high rates of hepatic lipogenesis and lipid oxidation are distinguishing features of NAFLD in rodents and humans, we next assessed the impact of clitorin on lipogenesis and fatty acid oxidation genes. The mRNA levels of both \u003cem\u003eLXR\u003c/em\u003e and \u003cem\u003eACC\u003c/em\u003e, hepatic lipogenesis genes, were significantly inhibited in the clitorin-administered groups (Fig. 3E). Furthermore, the mRNA levels of \u003cem\u003eCPT-1\u003c/em\u003e and \u003cem\u003ePPAR\u0026alpha;\u003c/em\u003e, fatty acid oxidation genes, were significantly elevated in the clitorin-administered groups (Fig. 3E). We also found that the AMPK mRNA level, which was eliminated in the WD group, was augmented by clitorin administration (Fig. 3E). These data supported the concept that clitorin counteracts WD-induced NAFLD by regulating lipogenesis and fatty acid oxidation genes in the liver.\u003c/p\u003e\n\u003cp\u003eWD: western diet;\u0026nbsp;NAFLD: nonalcoholic fatty liver disease;\u0026nbsp;SREBP1 sterol regulatory element binding protein 1; PPAR\u0026gamma;: peroxisome proliferator activated receptor \u0026gamma;; C/EBP\u0026alpha;: CCAAT/enhancer binding protein \u0026alpha;;\u0026nbsp;ACC: acetyl-CoA carboxylase;\u0026nbsp;AMPK: adenosine monophosphate-activated protein kinase; LXR:\u0026nbsp;liver X receptor\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eClitorin improved oleic acid-induced steatosis in HepG2 Cells\u003c/em\u003e\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe MTT assay was used to examine the effects of various concentrations of clitorin on cell viability. Clitorin treatment (0-200 \u0026mu;M) did not induce cytotoxicity for 24 h in HepG2 cells (Fig. 4A). Accordingly, we designated three doses of clitorin at 50, 100, and 200 \u0026micro;M for further study. Oil Red O staining showed a significant increase in lipid droplets in 1 mM oleic acid-treated cells compared to the lipid droplet concentration in non-treated cells. However, this lipid accumulation was significantly decreased by high concentrations of clitorin in oleic acid-induced HepG2 cells (Fig. 4B and 4C).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eObesity directly contributes to the abundance of hepatic TG accumulation, which is linked to NAFLD progression \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Immoderate exposure to a high-fat diet has been determined as a key attribute in an increasing number of NAFLD patients, which is demonstrated by the fact that the prevalence of NAFLD in obese patients is reported to be up to 90% \u003csup\u003e17\u003c/sup\u003e. Consequently, a high-fat diet is widely used to construct NAFLD animal models \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In the present study, clitorin administration significantly reduced the body weight gain in a WD-induced NAFLD mouse model (Fig.\u0026nbsp;1). Moreover, clitorin administration significantly reduced the liver index (mg/body weight) and notably decreased lipid droplet concentration without hepatic toxicity (ALT and AST) in the livers of WD-induced mice; this demonstrates that it suppresses hepatic steatosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Orlistat was used as a positive control because it has been reported that orlistat effectively alleviates steatosis and may serve as a viable treatment option for NAFLD \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe hepatic effect of PPARγ appears to be steatogenic; hepatocyte-specific \u003cem\u003ePPARγ\u003c/em\u003e knockout mice showed a remarkable decrease in the number of hepatic lipid vacuoles, as well as downregulation of \u003cem\u003ede novo\u003c/em\u003e lipogenesis activators \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Conversely, PPARγ overexpression in the liver induced by HFD feeding leads to lipid accumulation, which is the initiation step in the development of NAFLD \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. CCAAT/enhancer binding proteins (C/EBPs), including C/EBPα and SREBP1, are also considered key regulators of adipogenesis. SREBP1 plays an important role in the regulation of \u003cem\u003ede novo\u003c/em\u003e lipogenesis in the liver \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. SREBP1c levels are enhanced in the fatty livers of obese, insulin-resistant, and hyperinsulinemic \u003cem\u003eob\u003c/em\u003e/\u003cem\u003eob\u003c/em\u003e mice \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. In addition, SREBP1c expression is also elevated in patients with NAFLD; additionally, in concordance with its lipogenic role, hepatic triglyceride levels are higher in SREBP1c-overexpressing transgenic mice \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Thus, SREBP1, PPARγ, and C/EBPα are crucial transcription factors that upregulate the expression of genes modulating fat accumulation in the liver. Clitorin administration remarkably downregulated the protein and mRNA expression of \u003cem\u003eSREBP1\u003c/em\u003e, \u003cem\u003ePPARγ\u003c/em\u003e, and \u003cem\u003eC/EBPα\u003c/em\u003e in the livers of WD-induced NAFLD mice (Fig.\u0026nbsp;3A, 3B, 3C, and 3D).\u003c/p\u003e \u003cp\u003eLXRs are involved in hepatic lipogenesis via direct regulation of SREBP1c \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e, which positively modulates ACC expression \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. ACC catalyzes a key rate-limiting step in fatty acid biosynthesis, and is also associated with the control of fatty acid oxidation by the synthesis of malonyl-CoA, an inhibitor of CPT-1 \u003csup\u003e4\u003c/sup\u003e. CPT-1 is the rate-limiting enzyme in fatty acid oxidation \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Indeed, inhibition of the liver-specific isoform ACC1 in mice ameliorated hepatic triglyceride levels in mice by simultaneously suppressing fatty acid biosynthesis and augmenting fatty acid beta oxidation in the liver \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. CPT-1 is also linked to PPARα expression. PPARα activation gives rise to the transcription of \u003cem\u003eCPT-1\u003c/em\u003e, a target gene that is responsible for beta-oxidation, as it allows fatty acids to reach the mitochondrial matrix \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Among the three PPAR isotypes, PPARα, PPARβ/δ, and PPARγ, PPARα is the most abundant isotype in hepatocytes and is related to numerous aspects of lipid metabolism \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e and high fatty acid oxidation rates \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Ineffective PPAR-α sensing leads to diminished energy burning, resulting in hepatic steatosis and steatohepatitis \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e; it is thus inferred that it can potentially prevent NAFLD. Therefore, targeting lipogenesis and beta-oxidation genes is considered a promising therapeutic approach to control NAFLD. AMPK, a major energy sensor of the cell, downregulates ACC activity to suppress lipid biosynthesis \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. In addition, AMPK regulates hepatic and adipose lipid metabolism by modulating lipogenesis, lipolysis, gluconeogenesis, and adipogenesis; AMPK inhibits \u003cem\u003ede novo\u003c/em\u003e lipogenesis by downregulating \u003cem\u003ePPARγ\u003c/em\u003e, \u003cem\u003eC/EBPα\u003c/em\u003e, and \u003cem\u003eSREBP1\u003c/em\u003e; furthermore, it promotes fatty acid oxidation by upregulating \u003cem\u003eCPT-1a\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Our results showed that clitorin administration significantly decreased the mRNA levels of \u003cem\u003eLXR\u003c/em\u003e and \u003cem\u003eACC\u003c/em\u003e, which are lipogenic genes. It also enhanced the mRNA levels of \u003cem\u003ePPARα\u003c/em\u003e and \u003cem\u003eCTP-1\u003c/em\u003e, beta-oxidation genes, as well as \u003cem\u003eAMPK\u003c/em\u003e mRNA levels in the livers of WD-induced NAFLD mice (Fig.\u0026nbsp;3E).\u003c/p\u003e \u003cp\u003eHepG2 cells have been widely used to model NAFLD \u003cem\u003ein vitro\u003c/em\u003e, and steatosis in this cell line can be induced by treatment with oleic acid \u003csup\u003e\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Several studies have also used HepG2 cells to evaluate their effects on the management and prevention of NAFLD \u003csup\u003e\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Hence, we used an oleic acid-induced HepG2 cell model to evaluate the effect of clitorin on NAFLD \u003cem\u003ein vitro\u003c/em\u003e. Consistent with \u003cem\u003ein vivo\u003c/em\u003e experiments, our results showed that clitorin treatment significantly diminished lipid accumulation in oleic acid-induced differentiated HepG2 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTaken together, clitorin administration reduced the adipogenic genes, including SREBP1, PPARγ, and C/EBPα in WD-induced NAFLD mice liver. In addition, it significantly decreased the mRNA levels of lipogenic genes \u003cem\u003eLXR\u003c/em\u003e, and \u003cem\u003eACC\u003c/em\u003e; additionally it enhanced the mRNA levels of beta-oxidation genes \u003cem\u003ePPARα\u003c/em\u003e and \u003cem\u003eCTP-\u003c/em\u003e1, as well as \u003cem\u003eAMPK\u003c/em\u003e mRNA levels, in the liver of WD-induced mice. The present study is the first to report on the positive impact of clitorin on NAFLD. Furthermore, our findings provide basic data, which lead to deeper understanding of the pharmacological effects of clitorin on the improvement of NAFLD in WD-induced mice and oleic acid-induced HepG2 cells.\u003c/p\u003e"},{"header":"Materials And Methods","content":" \u003cp\u003e\u003cem\u003eChemicals and reagents\u003c/em\u003e \u003c/p\u003e \u003cp\u003eOil Red O powder, oleic acid, and methyl alcohol were purchased from Sigma-Aldrich Co. LLC (St. Louis, MO, USA). Minimum Essential Medium (MEM), fetal bovine serum (FBS), and penicillin were purchased from Life Technologies Inc. (Grand Island, NY, USA). Orlistat was purchased from Tokyo Chemical Inc. (Tokyo, Japan). The Research Diets (New Brunswick, NJ, USA) provided 45% of the WD (D-12451). Antibodies against PPARγ (cat. no. sc-7273), C/EBPα (cat. no. sc-365318), SREBP1 (cat. no. sc-13551), and β-actin (cat. No. sc-47778) were purchased from Santa Cruz Biotechnology Inc. (Dallas, TX, USA). Horseradish peroxidase-conjugated secondary antibodies were purchased from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA, USA).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of clitorin\u003c/h2\u003e \u003cp\u003eClitorin, a compound derived from \u003cem\u003eCarica papaya\u003c/em\u003e L., was identified by Professor Agung Nugroho (Lambung Mangkurat University, Indonesia). The leaves of \u003cem\u003eCarica papaya\u003c/em\u003e were collected from a papaya farm near Pelaihari City, South Kalimantan Province. The collected leaves were dried completely at 40\u0026deg;C. The dried powder of \u003cem\u003eC. papaya\u003c/em\u003e leaf (750 g) was extracted thrice with MeOH (6 L) under reflux at 70\u0026deg;C for 5 h. Thereafter, clitorin was isolated and purified from the fraction. Freeze-dried samples were dissolved in dimethyl sulfoxide.\u003c/p\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003eExperimental animal care protocols and treatment cycles\u003c/h2\u003e \u003cp\u003eSix-week-old male C57BL/6J mice were procured from Daehan Biolink (Daejeon, Republic of Korea). The mice were maintained under conditions of controlled temperature (22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C) and humidity (55\u0026thinsp;\u0026plusmn;\u0026thinsp;9 %), with a 12-h light/dark cycle. After a week of adjustment, the mice were fed 45 % WD for 7 weeks, except for the normal diet group (CON). After 7 weeks, the mice were divided into five groups of six mice each: WD group, WD\u0026thinsp;+\u0026thinsp;treatment group with 10 or 20 mg/kg orlistat as a positive control, and WD\u0026thinsp;+\u0026thinsp;treatment group with 10 or 20 mg/kg clitorin. Orlistat and clitorin were orally administered to the mice once daily for 4 weeks. Mice in the CON and WD groups were administered water as a vehicle. The mice were allowed free access to water and food, and their body weight and food intake were measured every week. The livers of the mice were excised, cleaned with phosphate-buffered saline (PBS), weighed, and directly stored at \u0026minus;\u0026thinsp;80\u0026deg;C. All protocols were performed under the Ethical Committee for Animal Care and the Use of Laboratory Animals, Sangji University (approval document no. 2017-22).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003eSerum analysis\u003c/h2\u003e \u003cp\u003eDuring blood sample collection, the animals were already under the influence of terminal anesthesia. Blood samples were collected via cardiac puncture. The samples were centrifuged at 1000 \u0026times; g for 20 min to obtain the serum samples. The concentrations of alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglyceride (TG), and total cholesterol (TC) were measured by enzymatic methods using commercially available kits (BioVision; Milpitas, CA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003eHistological analysis\u003c/h2\u003e \u003cp\u003eThe liver tissues from the mice in each group were fixed in 10% formalin, embedded in paraffin, and cut into 8 \u0026micro;m sections. Certain sections were stained with hematoxylin and eosin (H\u0026amp;E) for histological examination. Stained liver sections were observed for the evaluation of lipid droplet. All observations were performed using an Olympus SZX10 microscope (Olympus, Tokyo, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eFresh liver tissues were homogenized using PRO-PREP\u003csup\u003e\u0026reg;\u003c/sup\u003e (Intron Biotechnology, Gyeonggi-do, Republic of Korea), a protein extraction solution. The same amount (15\u0026ndash;30 \u0026micro;g) of protein sample was separated on an 8 %\u0026ndash;12 % sodium dodecyl sulfate polyacrylamide gel and transferred onto a polyvinylidene fluoride membrane. The membranes were blocked with 2.5 % skim milk solution for 30 min, incubated with PPARγ (1:1000), C/EBPα (1:1000), SREBP1 (1:1000), and β-actin (1:2500) primary antibodies overnight at 4\u0026deg;C, followed by incubation with anti-mouse horseradish peroxidase-conjugated secondary antibody (1:2500) for 2 h at 25\u0026deg;C. The membranes were washed thrice for 10 min with Tris-buffered saline containing Tween 20 and visualized by enhanced chemiluminescence using Amersham Imager 680 (GE Healthcare Bio-Sciences AB, Sweden).\u003c/p\u003e \u003cdiv id=\"Sec13\" class=\"Section4\"\u003e \u003ch2\u003eQuantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis\u003c/h2\u003e \u003cp\u003eqRT-PCR analysis was performed as previously described \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Briefly, the liver was homogenized, and total RNA was isolated using the Easy-Blue\u003csup\u003e\u0026reg;\u003c/sup\u003e reagent according to the manufacturer\u0026rsquo;s instructions (Intron Biotechnology; Seongnam, Republic of Korea). Total RNA was converted to cDNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems; Foster City, CA, USA) and thermocycler (Gene Amp\u003csup\u003e\u0026reg;\u003c/sup\u003e PCR system 9700; Applied Biosystems). qPCR analysis was conducted using a Step One Plus\u003csup\u003e\u0026reg;\u003c/sup\u003e Real-time PCR system (Applied Biosystems). Gene expression was determined using the comparative threshold cycle method. \u003cem\u003eGAPDH\u003c/em\u003e was used as an internal control. Sequences of mouse oligonucleotide primers\u003c/p\u003e \u003cp\u003eare presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eReal-Time PCR primer sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePPARγ\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCGAGTGCCGAGTCTGTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAAGGCACTTCTGAAACCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSREBP1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCTATTCCGTGAACATCTCCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCCAAGGGCAGTTCTTGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eC/EBPα\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAACTTGAAGCACAATCGATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTAAAGGTTCTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eLXRα\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGAGACCAGGGAGGCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGGGCTGTAGGCTCTGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eACC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTTCGATGTCCTCCCAAACTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCATAGGCGATATAAGCTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCPT-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCAGTGGGAGCGACTCTTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCCTCTGTGGTACACGACAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePPARα\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGAGAGCAGGGATTTGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTACGCTCAGCCCTCTTCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAMPK\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTGGATTCCCAAAAGTGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGCAGTGCTGGGTCACAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGAAATCCCATCACCATCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCCCCACTTGATTTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003eCell culture and differentiation of HepG2 cells\u003c/h2\u003e \u003cp\u003eThe human hepatoma cell line HepG2 (No. 88065) was obtained from the Korean Cell Line Bank (KCLB, Seoul, Republic of Korea). HepG2 cells were grown in MEM containing 10 % FBS and 100 mg/L penicillin. The cells were maintained under a humidified atmosphere of 5 % CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C. For induction of hepatocyte differentiation, cells were seeded at a density of 2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per well into 6-well plates with oleic acid (1 mM) and incubated for 48 h. After incubation, the cells were treated with different concentrations of clitorin (50, 100, and 200 \u0026micro;M) for 24 h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003eCell viability assay\u003c/h2\u003e \u003cp\u003eHepG2 cells were seeded into a 96-well plate at a concentration of 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells per well for 24 h. After incubation, the cells were treated with different concentrations of clitorin (0\u0026ndash;200 \u0026micro;M) for 24 h. After treatment, the cells were treated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) solution (5 mg/mL) and incubated again for 4 h. The supernatant from the plates was discarded, and the purple formazan product was dissolved in dimethyl sulfoxide. The absorbance was measured at 540 nm using an Epoch microplate spectrometer (Biotek, Winooski, VT, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section3\"\u003e \u003ch2\u003eOil red O staining of HepG2 cells\u003c/h2\u003e \u003cp\u003eAfter cell differentiation with oleic acid, the cells were washed with PBS and fixed with 10% formaldehyde in PBS at 25\u0026deg;C for 1 h. Cells were then washed thrice with distilled water and stained with Oil Red O working solution (3 mg/mL in 60 % isopropanol) at 25\u0026deg;C for 2 h. The cells were rinsed thrice with distilled water and photographed using an Olympus SZX10 microscope. Next, the Oil Red O dye was eluted with isopropanol to determine the intracellular lipid content and was measured using an Epoch\u0026reg; microvolume spectrophotometer at 520 nm.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) of triplicate experiments. Statistically\u003c/p\u003e \u003cp\u003esignificant values were compared using ANOVA and Dunnett\u0026rsquo;s post hoc test, and \u003cem\u003ep\u003c/em\u003e-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u003c/p\u003e \u003cp\u003ewere considered statistically significant. Statistical analysis was performed using SPSS statistical\u003c/p\u003e \u003cp\u003eanalysis software (version 19.0, IBM SPSS, Armonk, NY, USA).\u003c/p\u003e "},{"header":"Abbreviations","content":"\u003cp\u003eadenosine monophosphate-activated protein kinase (AMPK), acetyl-CoA carboxylase (ACC), CCAAT/enhancer binding protein α (C/EBPα), carnitine palmitoyltranserase-1 (CTP-1), liver X receptor (LXR), Nonalcoholic fatty liver disease (NAFLD), peroxisome proliferator-activated receptor α (PPARα), peroxisome proliferator-activated receptor γ (PPARγ), sterol regulatory element-binding protein 1 (SREBP1), western diet (WD)\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Information:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding Athor\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHyo-Jin An -\u0026nbsp;\u003c/strong\u003eDepartment of Pharmacology, College of Korean Medicine, Sangji University, Wonju, Gangwon-do 26339, Republic of Korea; E-mail:
[email protected]; Tel: +82-33-738-7503\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAthors\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDivina C. Cominguez -\u0026nbsp;\u003c/strong\u003eDepartment of Pharmacology, College of Korean Medicine, Sangji University, Wonju, Gangwon-do 26339, Republic of Korea\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eYea-Jin Park -\u0026nbsp;\u003c/strong\u003eDepartment of Pharmacology, College of Korean Medicine, Sangji University, Wonju, Gangwon-do 26339, Republic of Korea\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eYun-Mi Kang -\u0026nbsp;\u003c/strong\u003eDepartment of Pharmacology, College of Korean Medicine, Sangji University, Wonju, Gangwon-do 26339, Republic of Korea\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAgung Nugroho -\u0026nbsp;\u003c/strong\u003eDepartment of Agro-Industrial Technology, Lambung Mangkurat University, Banjarbaru, Indonesia\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSuhyun Kim -\u0026nbsp;\u003c/strong\u003eDepartment of Obstetrics \u0026amp; Gynecology College of Korean Medicine, Sangji University, Wonju-si, Gangwon-do 26339, Republic of Korea\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003estaement\u003c/strong\u003e\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003eD.C.C. and H.J.A. conceived and designed the experiments. D.C.C. and Y.J.P. wrote the manuscript. D.C.C. conducted the experiments. A.N. supplied the clitorin used in experimental analyses, which is derived from the papaya plant. Y.J.P., Y.M.K., and H.J.A. substantially contributed to the analysis and interpretation of data and revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements :\u0026nbsp;\u003c/strong\u003eThe present study was supported by a National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIP; Ministry of Science, ICT \u0026amp; Future Planning) (No. NRF-2020R1G1A1011494).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u0026nbsp;\u003c/strong\u003eThe datasets used and/or analyzed in this study are available from the corresponding authors on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest:\u0026nbsp;\u003c/strong\u003eThe authors declare no conflict of interest.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003e1\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Drescher, H. K., Weiskirchen, S. \u0026amp; Weiskirchen, R. Current Status in Testing for Nonalcoholic Fatty Liver Disease (NAFLD) and Nonalcoholic Steatohepatitis (NASH). \u003cem\u003eCells\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, doi:10.3390/cells8080845 (2019).\u003c/p\u003e\n\u003cp\u003e2\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Friedman, S. L., Neuschwander-Tetri, B. A., Rinella, M. \u0026amp; Sanyal, A. J. Mechanisms of NAFLD development and therapeutic strategies. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 908-922, doi:10.1038/s41591-018-0104-9 (2018).\u003c/p\u003e\n\u003cp\u003e3\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Pydyn, N., Miekus, K., Jura, J. \u0026amp; Kotlinowski, J. New therapeutic strategies in nonalcoholic fatty liver disease: a focus on promising drugs for nonalcoholic steatohepatitis. \u003cem\u003ePharmacol Rep\u003c/em\u003e \u003cstrong\u003e72\u003c/strong\u003e, 1-12, doi:10.1007/s43440-019-00020-1 (2020).\u003c/p\u003e\n\u003cp\u003e4\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Koo, S. H. Nonalcoholic fatty liver disease: molecular mechanisms for the hepatic steatosis. \u003cem\u003eClin Mol Hepatol\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 210-215, doi:10.3350/cmh.2013.19.3.210 (2013).\u003c/p\u003e\n\u003cp\u003e5\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Lee, Y. K., Park, J. E., Lee, M. \u0026amp; Hardwick, J. P. Hepatic lipid homeostasis by peroxisome proliferator-activated receptor gamma 2. \u003cem\u003eLiver Res\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 209-215, doi:10.1016/j.livres.2018.12.001 (2018).\u003c/p\u003e\n\u003cp\u003e6\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Wang, L. F.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Inhibition of NAMPT aggravates high fat diet-induced hepatic steatosis in mice through regulating Sirt1/AMPKalpha/SREBP1 signaling pathway. \u003cem\u003eLipids Health Dis\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 82, doi:10.1186/s12944-017-0464-z (2017).\u003c/p\u003e\n\u003cp\u003e7\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Musso, G., Gambino, R. \u0026amp; Cassader, M. Recent insights into hepatic lipid metabolism in non-alcoholic fatty liver disease (NAFLD). \u003cem\u003eProg Lipid Res\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, 1-26, doi:10.1016/j.plipres.2008.08.001 (2009).\u003c/p\u003e\n\u003cp\u003e8\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Souza-Mello, V. Peroxisome proliferator-activated receptors as targets to treat non-alcoholic fatty liver disease. \u003cem\u003eWorld J Hepatol\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1012-1019, doi:10.4254/wjh.v7.i8.1012 (2015).\u003c/p\u003e\n\u003cp\u003e9\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Seo, Y. J., Lee, K., Song, J. H., Chei, S. \u0026amp; Lee, B. Y. Ishige okamurae Extract Suppresses Obesity and Hepatic Steatosis in High Fat Diet-Induced Obese Mice. \u003cem\u003eNutrients\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, doi:10.3390/nu10111802 (2018).\u003c/p\u003e\n\u003cp\u003e10\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Pandey, S., Cabot, P. J., Shaw, P. N. \u0026amp; Hewavitharana, A. K. Anti-inflammatory and immunomodulatory properties of Carica papaya. \u003cem\u003eJ Immunotoxicol\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 590-602, doi:10.3109/1547691X.2016.1149528 (2016).\u003c/p\u003e\n\u003cp\u003e11\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Santana, L. F.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Nutraceutical Potential of Carica papaya in Metabolic Syndrome. \u003cem\u003eNutrients\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, doi:10.3390/nu11071608 (2019).\u003c/p\u003e\n\u003cp\u003e12\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Julianti, T.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e HPLC-based activity profiling for antiplasmodial compounds in the traditional Indonesian medicinal plant Carica papaya L. \u003cem\u003eJ Ethnopharmacol\u003c/em\u003e \u003cstrong\u003e155\u003c/strong\u003e, 426-434, doi:10.1016/j.jep.2014.05.050 (2014).\u003c/p\u003e\n\u003cp\u003e13\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Brasil, G. A.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Antihypertensive effect of Carica papaya via a reduction in ACE activity and improved baroreflex. \u003cem\u003ePlanta Med\u003c/em\u003e \u003cstrong\u003e80\u003c/strong\u003e, 1580-1587, doi:10.1055/s-0034-1383122 (2014).\u003c/p\u003e\n\u003cp\u003e14\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Ma, H., Li, J., An, M., Gao, X. M. \u0026amp; Chang, Y. X. A powerful on line ABTS(+)-CE-DAD method to screen and quantify major antioxidants for quality control of Shuxuening Injection. \u003cem\u003eScientific reports\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 5441, doi:10.1038/s41598-018-23748-x (2018).\u003c/p\u003e\n\u003cp\u003e15\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Xie, W. \u0026amp; Chen, S. A nomogram for estimating the probability of nonalcoholic fatty liver disease in a Chinese population: A retrospective cohort study. \u003cem\u003eMedicine (Baltimore)\u003c/em\u003e \u003cstrong\u003e99\u003c/strong\u003e, e23049, doi:10.1097/MD.0000000000023049 (2020).\u003c/p\u003e\n\u003cp\u003e16\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Lakhani, H. V.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Phenotypic Alteration of Hepatocytes in Non-Alcoholic Fatty Liver Disease. \u003cem\u003eInt J Med Sci\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 1591-1599, doi:10.7150/ijms.27953 (2018).\u003c/p\u003e\n\u003cp\u003e17\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Hu, Y.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Acerola polysaccharides ameliorate high-fat diet-induced non-alcoholic fatty liver disease through reduction of lipogenesis and improvement of mitochondrial functions in mice. \u003cem\u003eFood Funct\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1037-1048, doi:10.1039/c9fo01611b (2020).\u003c/p\u003e\n\u003cp\u003e18\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Zhong, F., Zhou, X., Xu, J. \u0026amp; Gao, L. Rodent Models of Nonalcoholic Fatty Liver Disease. \u003cem\u003eDigestion\u003c/em\u003e \u003cstrong\u003e101\u003c/strong\u003e, 522-535, doi:10.1159/000501851 (2020).\u003c/p\u003e\n\u003cp\u003e19\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Ye, J.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Effect of orlistat on liver fat content in patients with nonalcoholic fatty liver disease with obesity: assessment using magnetic resonance imaging-derived proton density fat fraction. \u003cem\u003eTherap Adv Gastroenterol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 1756284819879047, doi:10.1177/1756284819879047 (2019).\u003c/p\u003e\n\u003cp\u003e20\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Skat-Rordam, J., Hojland Ipsen, D., Lykkesfeldt, J. \u0026amp; Tveden-Nyborg, P. A role of peroxisome proliferator-activated receptor gamma in non-alcoholic fatty liver disease. \u003cem\u003eBasic Clin Pharmacol Toxicol\u003c/em\u003e \u003cstrong\u003e124\u003c/strong\u003e, 528-537, doi:10.1111/bcpt.13190 (2019).\u003c/p\u003e\n\u003cp\u003e21\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Jo, H. K., Kim, G. W., Jeong, K. J., Kim, D. Y. \u0026amp; Chung, S. H. Eugenol ameliorates hepatic steatosis and fibrosis by down-regulating SREBP1 gene expression via AMPK-mTOR-p70S6K signaling pathway. \u003cem\u003eBiol Pharm Bull\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 1341-1351, doi:10.1248/bpb.b14-00281 (2014).\u003c/p\u003e\n\u003cp\u003e22\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Shimano, H.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells. \u003cem\u003eJ Clin Invest\u003c/em\u003e \u003cstrong\u003e99\u003c/strong\u003e, 846-854, doi:10.1172/JCI119248 (1997).\u003c/p\u003e\n\u003cp\u003e23\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Gr\u0026oslash;nning-Wang, L. M., Bindesb\u0026oslash;ll, C. \u0026amp; Nebb, H. I. The role of liver X receptor in hepatic de novo lipogenesis and cross-talk with insulin and glucose signaling. \u003cem\u003eLipid metabolism\u003c/em\u003e, 61-90 (2013).\u003c/p\u003e\n\u003cp\u003e24\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Kohjima, M.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e SREBP-1c, regulated by the insulin and AMPK signaling pathways, plays a role in nonalcoholic fatty liver disease. \u003cem\u003eInt J Mol Med\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 507-511 (2008).\u003c/p\u003e\n\u003cp\u003e25\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Dai, J.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Chemoproteomics reveals baicalin activates hepatic CPT1 to ameliorate diet-induced obesity and hepatic steatosis. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e115\u003c/strong\u003e, E5896-E5905, doi:10.1073/pnas.1801745115 (2018).\u003c/p\u003e\n\u003cp\u003e26\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Montagner, A.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Liver PPARalpha is crucial for whole-body fatty acid homeostasis and is protective against NAFLD. \u003cem\u003eGut\u003c/em\u003e \u003cstrong\u003e65\u003c/strong\u003e, 1202-1214, doi:10.1136/gutjnl-2015-310798 (2016).\u003c/p\u003e\n\u003cp\u003e27\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Pawlak, M., Lefebvre, P. \u0026amp; Staels, B. Molecular mechanism of PPARalpha action and its impact on lipid metabolism, inflammation and fibrosis in non-alcoholic fatty liver disease. \u003cem\u003eJ Hepatol\u003c/em\u003e \u003cstrong\u003e62\u003c/strong\u003e, 720-733, doi:10.1016/j.jhep.2014.10.039 (2015).\u003c/p\u003e\n\u003cp\u003e28\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Reddy, J. K. \u0026amp; Rao, M. S. Lipid metabolism and liver inflammation. II. Fatty liver disease and fatty acid oxidation. \u003cem\u003eAm J Physiol Gastrointest Liver Physiol\u003c/em\u003e \u003cstrong\u003e290\u003c/strong\u003e, G852-858, doi:10.1152/ajpgi.00521.2005 (2006).\u003c/p\u003e\n\u003cp\u003e29\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Liou, C. J.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Fisetin Protects Against Hepatic Steatosis Through Regulation of the Sirt1/AMPK and Fatty Acid beta-Oxidation Signaling Pathway in High-Fat Diet-Induced Obese Mice. \u003cem\u003eCell Physiol Biochem\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 1870-1884, doi:10.1159/000493650 (2018).\u003c/p\u003e\n\u003cp\u003e30\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Inamdar, S., Joshi, A., Malik, S., Boppana, R. \u0026amp; Ghaskadbi, S. Vitexin alleviates non-alcoholic fatty liver disease by activating AMPK in high fat diet fed mice. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e \u003cstrong\u003e519\u003c/strong\u003e, 106-112, doi:10.1016/j.bbrc.2019.08.139 (2019).\u003c/p\u003e\n\u003cp\u003e31\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Kanuri, G. \u0026amp; Bergheim, I. In vitro and in vivo models of non-alcoholic fatty liver disease (NAFLD). \u003cem\u003eInternational journal of molecular sciences\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 11963-11980, doi:10.3390/ijms140611963 (2013).\u003c/p\u003e\n\u003cp\u003e32\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;M\u0026uuml;ller, F. A. \u0026amp; Sturla, S. J. Human in vitro models of nonalcoholic fatty liver disease. \u003cem\u003eCurrent Opinion in Toxicology\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 9-16 (2019).\u003c/p\u003e\n\u003cp\u003e33\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Lee, M. R., Yang, H. J., Park, K. I. \u0026amp; Ma, J. Y. Lycopus lucidus Turcz. ex Benth. Attenuates free fatty acid-induced steatosis in HepG2 cells and non-alcoholic fatty liver disease in high-fat diet-induced obese mice. \u003cem\u003ePhytomedicine\u003c/em\u003e \u003cstrong\u003e55\u003c/strong\u003e, 14-22, doi:10.1016/j.phymed.2018.07.008 (2019).\u003c/p\u003e\n\u003cp\u003e34\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Ali, O., Darwish, H. A., Eldeib, K. M. \u0026amp; Abdel Azim, S. A. miR-26a Potentially Contributes to the Regulation of Fatty Acid and Sterol Metabolism In Vitro Human HepG2 Cell Model of Nonalcoholic Fatty Liver Disease. \u003cem\u003eOxid Med Cell Longev\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, 8515343, doi:10.1155/2018/8515343 (2018).\u003c/p\u003e\n\u003cp\u003e35\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Gomaraschi, M.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Lipid accumulation impairs lysosomal acid lipase activity in hepatocytes: Evidence in NAFLD patients and cell cultures. \u003cem\u003eBiochim Biophys Acta Mol Cell Biol Lipids\u003c/em\u003e \u003cstrong\u003e1864\u003c/strong\u003e, 158523, doi:10.1016/j.bbalip.2019.158523 (2019).\u003c/p\u003e\n\u003cp\u003e36\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Xia, H.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Alpha-naphthoflavone attenuates non-alcoholic fatty liver disease in oleic acid-treated HepG2 hepatocytes and in high fat diet-fed mice. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e \u003cstrong\u003e118\u003c/strong\u003e, 109287, doi:10.1016/j.biopha.2019.109287 (2019).\u003c/p\u003e\n\u003cp\u003e37\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Park, Y. J., Lee, G. S., Cheon, S. Y., Cha, Y. Y. \u0026amp; An, H. J. The anti-obesity effects of Tongbi-san in a high-fat diet-induced obese mouse model. \u003cem\u003eBMC Complement Altern Med\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 1, doi:10.1186/s12906-018-2420-5 (2019).\u003c/p\u003e\n"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"clitorin, nonalcoholic fatty liver disease, adipogenesis, lipogenesis, fatty acid oxidation","lastPublishedDoi":"10.21203/rs.3.rs-841938/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-841938/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Nonalcoholic fatty liver disease (NAFLD) is usually correlated with metabolic diseases, such as obesity, insulin resistance, and hyperglycemia. Herein, we investigated the inhibitory effects and underlying governing mechanism of clitorin in a western diet (WD)-induced mouse model, and in oleic acid-induced HepG2 cells. Male C57BL/6 mice were fed a normal diet, WD, WD + 10 or 20 mg/kg orlistat, and WD + 10 or 20 mg/kg clitorin. HepG2 cells were treated with 1 mM oleic acid to induce lipid accumulation with or without clitorin. Clitorin administration reduced body weight gain and hepatic steatosis symptoms in WD-induced mice. Additionally, clitorin administration decreased the expression of sterol regulatory element-binding protein 1 (SREBP1), peroxisome proliferator-activated receptor γ (PPARγ), and CCAAT/enhancer binding protein α (C/EBPα) in WD-induced mice. Moreover, clitorin administration significantly decreased the mRNA levels of liver X receptor (LXR) and acetyl-CoA carboxylase (ACC); additionally, it enhanced the mRNA levels of peroxisome proliferator-activated receptor α (PPARα) and carnitine palmitoyltranserase-1 (CTP-1), as well as adenosine monophosphate-activated protein kinase (AMPK) mRNA levels, in the liver of WD-induced mice. Furthermore, clitorin treatment significantly impeded lipid accumulation in oleic acid-induced HepG2 cells. Our findings demonstrated that clitorin is a potentially efficacious candidate for NAFLD treatment.","manuscriptTitle":"Clitorin, a Flavonoid Compound of Papaya, Ameliorates Non-Alcoholic Fatty Liver Disease in Western Diet- induced Mice and Oleic Acid-induced HepG2 Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-08-26 01:26:11","doi":"10.21203/rs.3.rs-841938/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2021-10-05T11:19:16+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-09-29T07:12:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"90810696-9750-4f0b-94b4-2efd22ae8352","date":"2021-09-15T17:54:31+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2021-09-15T16:28:19+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2021-09-15T16:26:20+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2021-09-15T12:42:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2021-09-15T12:37:04+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2021-08-24T06:39:40+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"73a25cf7-b811-4584-9029-ea6769cb9cc3","owner":[],"postedDate":"August 26th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":6692053,"name":"Biological sciences/Cell biology"},{"id":6692054,"name":"Biological sciences/Plant sciences"},{"id":6692055,"name":"Health sciences/Diseases"}],"tags":[],"updatedAt":"2022-02-28T04:29:07+00:00","versionOfRecord":[],"versionCreatedAt":"2021-08-26 01:26:11","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-841938","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-841938","identity":"rs-841938","version":["v1"]},"buildId":"J0_U0BvcaRcwD8yVFaRlm","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.