Effects of continuous cropping on growth and rhizosphere soil microbial community structure of Salvia miltiorrhiza Bge

Effects of continuous cropping on growth and rhizosphere soil microbial community structure of Salvia miltiorrhiza Bge | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Effects of continuous cropping on growth and rhizosphere soil microbial community structure of Salvia miltiorrhiza Bge Ji dong JU, Bingqian Zhou, Yuan Meng, Guohong Yang, Xinyu Fu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4565313/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Continuous cropping has restricted the development of high-quality and high-yield Salvia miltiorrhiza , which has become an urgent problem to be addressed. The evolution of microbial rhizosphere communities is closely related to plant growth, which may be a key factor that is aggravating obstacles to continuous cropping. Therefore, this study explored the effects of continuous cropping on the microbial rhizosphere community of S. miltiorrhiza . Methods: The effects of continuous cropping on the physiological and morphological indices of S. miltiorrhiza were evaluated by pot experiments. The V4 region of the rhizosphere bacterial 16S rDNA gene and ITS1 region of the fungal gene were sequenced by NovaSeq platform high-throughput sequencing technology to explore the effects of continuous cropping on the bacterial and fungal community structure in the rhizosphere of S. miltiorrhiza . Results: After continuous cropping, the biomass of S. miltiorrhiza decreased, the plant wilted and dwarfed, and the effective leaf area, main root length, and diameter significantly decreased. The accumulation of total chlorophyll, carbohydrates, and effective components was significantly reduced, and photosynthesis was reduced. The bacterial and fungal community composition and function in the rhizosphere soil altered significantly. The bacterial diversity in continuous cropping soil decreased, while the fungal community diversity increased, along with the emergence of pathogenic fungi such as Fusarium solani . Conclusion: Continuous cropping led to morphological changes, weak physiological activity, and reduced bioaccumulation of S. miltiorrhiza , and affected the composition of the microbial rhizosphere community. This may be a key factor that aggravates obstacles in continuous cropping. Biological sciences/Plant sciences/Plant physiology Biological sciences/Plant sciences/Plant stress responses Salvia miltiorrhiza rhizosphere microorganisms continuous cropping obstacle high-throughput sequencing technology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 1 Introduction The dried roots and rhizomes of Salvia miltiorrhiza Bge. have various pharmacological effects, such as decreasing inflammation, reducing oxidative stress, promoting blood circulation, and removing blood stasis, and they are the first choice for the prevention and treatment of cardiovascular and cerebrovascular diseases [ 1 ] . Consequently, S. miltiorrhiza Bge. has broad prospects in the fields of drug production, food health care, skin care, and cosmetics. Owing to the constant increase in the demand for S. miltiorrhiza , continuous cropping of S. miltiorrhiza has been developed. However, continuous cropping can lead to various complications such as deterioration of soil texture, aggravation of pests and diseases, and increase in physiologically dead seedlings, emerging as one of the main factors limiting the increase in yield, quality, and market expansion of S. miltiorrhiza [ 2 ] . Assessment of the quality of medicinal plants includes an evaluation of the appearance quality and internal quality. Appearance quality is assessed by the morphology of roots and effective leaf area, while internal quality includes an assessment of the accumulation of carbohydrates and active ingredients. Green plants accomplish morphological construction via photosynthesis, and use organic matter such as carbohydrates as energy raw materials for growth and development. In addition, the synthesis and accumulation of active ingredients in medicinal plants are sometimes closely associated with photosynthetic products. However, most medicinal rhizomatous plants, such as Pseudostellaria heterophylla [ 3 ] , Lilium L [ 4 ] , Atractylodes macrocephala [ 5 ] , and Panax ginseng [ 6 ] , suffer from quality deterioration and even crop failure. Similarly, the impact of continuous cropping on the S. miltiorrhiza industry is also directly reflected on changes in yield and quality. Therefore, a systematic study of continuous cropping using a series of indicators such as aboveground and underground morphology, biological accumulation, and growth physiology of S. miltiorrhiza plants is crucial to elucidate the underlying mechanism of continuous cropping and formulate corresponding countermeasures. Soil microorganisms are widely involved in the transformation of plant nutrients and degradation of harmful substances, and are known as the second genome of plants, closely related to plant growth and metabolism. Plants, soil, and microorganisms perform functions such as material exchange and signal transmission in the rhizosphere environment, and their interaction network along with the environment can effectively resist various biotic and environmental stresses [ 7 ] . However, related studies have shown that continuous cropping can affect the evolution of microbial rhizosphere community structure and aggravate soil-borne diseases [ 8 – 10 ] , making microorganisms a key factor that limits productivity in continuous cropping. With the extension of planting years, some plant pathogens get enriched in the rhizosphere of continuous cropping plants, while some functional beneficial bacteria such as Pseudomonas and Bacillus show negative feedback effects [ 11 – 13 ] . Increasing studies have indicated that continuous cropping obstacles are mainly caused by an imbalance in the microbial rhizosphere community structure, allelopathic autotoxicity, and deterioration of soil physical and chemical properties [ 14 – 17 ] . However, to date, knowledge about the effects of S. miltiorrhiza continuous cropping system on microbial rhizosphere community structure is limited. With the development of molecular biology techniques, high-throughput nucleic acid sequence analysis has been widely used for the classification and identification of microorganisms. In particular, the high-throughput, high-depth, and high-precision NovaSeq sequencing platform provides the possibility to elucidate the interaction between soil microorganisms and continuous cropping systems [ 18 ] . Therefore, in this study, potted S. miltiorrhiza was used to explore the degree of damage of continuous cropping of S. miltiorrhiza on plant growth and physiological indices. The bacterial and fungal community structure and diversity in the rhizosphere soil of S. miltiorrhiza under continuous cropping were analyzed by using a new-generation high-throughput sequencing technology. The objective of this study was to explore the physiological mechanism of yield reduction and quality decline after continuous cropping of S. miltiorrhiza and its correlation with rhizosphere microflora changes. The obtained results provide an important theoretical and practical foundation for elucidating the mechanism of continuous cropping obstacles of medicinal plants and improving the cultivation soil for the production of Chinese medicinal materials. 2 Materials and methods 2.1 S. miltiorrhiza seedling and sampling High-quality Salvia miltiorrhiza seeds were screened from a S. miltiorrhiza planting base at Ziguang Ecological Park in Miaoshan Town, Laiwu City, Shandong Province, China, and used in pot experiments. In brief, S. miltiorrhiza was cultivated in non-continuous cropping and continuous cropping soils (Table 1 ) in a light culture room at Shandong Provincial Analysis and Testing Center (Shandong, China). When the S. miltiorrhiza plants in the continuous cropping soil showed disease symptoms, the plants from each group were collected for morphological and physiological activity assays. Fresh soil samples of groups F (Noncontinuous cropping) and L (Continuous cropping) (5 replicates in each group) were obtained by a “shaking root method [ 31 ] ,” sieved using 40 mesh, stored in dry ice, and transported to Nuohe Science and Technology Co., Ltd., (Beijing, China) for high-throughput sequencing of 16S rDNA and fungal ITS amplicons based on the Illumina NovaSeq platform. Table 1 Soil composition of non-continuous cropping and continuous cropping Treatment Sterilized soil Planting soil Continuous cropping soil F group 50% 50% 0 L group 50% 0 50% 2.2 Determination of morphological indices The S. miltiorrhiza plants in groups F and L were taken out from a ceramic flowerpots, and the soil was shaken off. After cleaning, the fresh weights (g) of the aboveground and underground plant parts were measured. Then, the samples were heated in an oven at 85°C for 20 min, cooled to 70°C, and dried to a constant weight. The dry weight data were recorded and the drying rate was calculated. The number of complete leaves, number of dry or diseased leaves, and total number of leaves in each group were recorded. The maximum leaf length and maximum leaf width of each leaf were measured, and the leaf length:leaf width ratio and leaf area (in cm 2 ) were calculated. The length and cross-sectional diameter of the main root of S. miltiorrhiza from the reed head to the root tip were determined, which were recorded as the longest root length and the main root diameter, respectively (in cm). Furthermore, the number of roots (strip) with a diameter > 0.2 cm was recorded. 2.3 Evaluation of physiological indices 2.3.1 Determination of chlorophyll and sugar contents The fresh leaves of groups F and L were collected and their veins were removed, and cut into fragments of 1–2-mm width. Then, 1.0 g of the leaves fragments were immersed in 50 mL of 95% ethanol for extraction (dark) until the leaf tissue became completely white. The absorbance (A) of the extract was determined using UV-2700 ultraviolet spectrophotometer at the wavelengths of 665, 649, and 470 nm, and the contents of total chlorophyll, chlorophyll a (C-a), chlorophyll b (C-b), and carotenoids (C-carotenoid) were calculated as follows: C-a = 13.95 × A665-6.88 × A649 C-b = 24.96 × A649-7.32 × A665 C-carotenoid = (1000 × A470-2.05 × C-a-114.8 × C-b) / 24 Chlorophyll content (mg/g) = (C chlorophyll × V extract × dilution) / sample fresh weight To determine the soluble sugar and sucrose contents, 3.0 g of the leaves and roots of S. miltiorrhiza were extracted with ethanol (80%) in a water bath (80°C) for 30 min. After cooling to room temperature, the extracts were centrifuged (4000 rpm for 1.5 min) and the supernatants were collected. The soluble sugar content was measured using anthrone colorimetry, and the sucrose content was determined by resorcinol method. For the calculation of glucose and fructose contents, the leaves and roots of S. miltiorrhiza were dried and crushed, and 0.1 g was of the crushed samples was mixed with 5 mL of distilled water and ground in a motor. Then, the ground samples were centrifuged (3000 rpm for 1.5 min) and the supernatant was collected and subjected to anthrone colorimetry to ascertain the contents of glucose and fructose. 2.3.2 Determination of active ingredients content The root tissue of S. miltiorrhiza from each group was crushed and passed through a 50-mesh sieve. Then, 0.5 g of the crushed sample was mixed with equal amount of methanol (70%) and stirred ultrasonically for 30 min, and the filtrate was passed through a 0.45-µm microporous membrane for subsequent high-performance liquid chromatography (HPLC). The HPLC analysis conditions were as follows: Compass chromatographic column C18 (4.6 mm × 250 mm, 5 µm); mobile phase: ultrapure water (with 0.2% acetic acid) as aqueous phase and acetonitrile as organic phase; gradient program: 0–25 min, 5–35% B; 25–30 min, 35–55% B; 30–40 min, 55–75% B; 40–50 min, 75–95% B; flow rate: 1.0 mL/min; column temperature: 25°C; and injection volume: 10 µL. 2.4 Rhizosphere soil microbial amplicon sequencing 2.4.1 DNA extraction and PCR amplification Genomic DNA from the rhizosphere soil of each group was extracted by the Cetyltrimethylammonium Bromide (CTAB), and the purity and concentration of the DNA was assessed by agarose gel electrophoresis. Then, appropriate amount of DNA was diluted to 1 ng/µL using sterile water, and employed as a template for PCR amplification of the bacterial 16S V4 and fungal ITS1-5F regions to assess the microbial diversity in the rhizosphere soil. The primer sequences used for PCR are shown in Table 2 . A TruSeq®DNA PCR-Free Sample Preparation Kit was employed to construct a DNA library. The constructed library was quantified using Qubit and Q-PCR, and NovaSeq 6000 was used for sequencing. Table 2 PCR amplification region and primer sequence Group Amplification region Primer sequence Bacteria 16Sv4 F:GTGCCAGCMGCCGCGGTAA R:GGACTACHVGGGTWTCTAAT Fungi ITS1-5F F:GGAAGTAAAAGTCGTAACAAGG R:GCTGCGTTCTTCATCGATGC 2.4.2 Sequence analysis The offline data obtained from NovaSeq high-throughput sequencing were split into sample data, and the final effective data were obtained and comprehensively analyzed by splicing filtering and removal of chimeric sequences. Uparse v7.0.1001 software was employed to perform OTU cluster analysis on the effective sequences with 97% consistency, and species annotation was performed on the representative sequences. Chao1 index, Shannon index, Simpson index, and coverage were calculated using Qiime software (version 1.9.1), and the data were processed and plotted using Excel software. 3. Results 3.1 Effect of continuous cropping on the growth of S. miltiorrhiza As shown in Table 3 , the fresh and dry weights of the aboveground and underground plant parts of the continuous cropping group were reduced (aboveground parts: decreased by 27.1% and 30.2%, respectively; underground parts: decreased by 25.3% and 25.2%, respectively), when compared with those of the non-continuous cropping group. Furthermore, when compared with the non-continuous cropping group, continuous cropping group presented lower number of normal leaves and leaf area and higher rate of dead leaves, while the leaf length:leaf width ratio did not exhibit much difference. The underground part of the stubble of S. miltiorrhiza under non-continuous cropping was obviously more developed, characterized by thicker main roots, long roots, and multiple roots, when compared with that under continuous cropping. These results indicated that continuous cropping conditions were not conducive to the morphological growth and biomass accumulation of the aboveground and underground parts of S. miltiorrhiza , and significantly affected the overall yield of S. miltiorrhiza . Table 3 Effect of continuous cropping on growth index of Salvia miltiorrhiza Note: Different lowercase letters in the same column indicate significant differences. morphological index F L Aboveground fresh weight (g / plant) 4.76 ± 1.17ab 3.47 ± 0.90b Aboveground dry weight (g / plant) 0.86 ± 0.16bc 0.60 ± 0.07c Fresh weight of underground part (g / plant) 4.78 ± 1.79ab 3.57 ± 1.25b Dry weight of underground part (g / plant) 1.27 ± 0.48a 0.95 ± 0.50a Drying rate % 26.75 ± 4.32a 24.75 ± 5.85a Number of normal leaves (pieces) 31.0 ± 3.67bc 26.0 ± 7.87c Number of dead leaves (pieces) 7.5 ± 3.20b 12.5 ± 4.15ab Total number of leaves (pieces) 38.5 ± 1.66b 38.5 ± 4.50b Leaf area (cm 2 ) 217.60 ± 37.94b 183.76 ± 47.86b Leaf length / leaf width 1.33 ~ 1.93 1.22 ~ 1.77 The longest root length (cm) 16.00 ± 2.45a 14.75 ± 2.59b Main root diameter (cm) 0.63 ± 0.13a 0.50 ± 0.07a Number of root (article) 5.75 ± 0.43b 4.25 ± 1.09b 3.2 Differences in the physiological indices between continuous cropping and non-continuous cropping groups 3.2.1 Differences in the chlorophyll, soluble sugar, and sucrose contents The contents of chlorophyll a, chlorophyll b, total chlorophyll, and carotenoids in the continuous cropping group decreased by 42.4%, 41.5%, 42.1%, and 37.0%, when compared with those in the non-continuous cropping group, respectively (Fig. 1 ). Furthermore, the contents of soluble sugar, sucrose, glucose, and fructose in the leaves and roots of S. miltiorrhiza under continuous cropping were lower than those under non-continuous cropping, and the sugar components in the leaves of group L were reduced by 65.4%, 45.0%, 35.4%, and 44.6%, when compared with those in the leaves of group F, respectively (Table 4 ). Besides, the contents of soluble sugar, sucrose, and fructose in the roots of group L decreased by 59.9%, 26.3%, and 31.8%, when compared with those in the roots of group F, respectively. Table 4 Table of content of sugar components in Salvia miltiorrhiza Note: different lowercase letters in the same column indicate significant differences; * P < 0.05. group soluble sugar(mg/g) sucrose(mg/g) glucose(mg/g) fructose(mg/g) F- leaf 1.641 ± 0.09ab 0.768 ± 0.06ab 0.754 ± 0.11 0.623 ± 0.25ab L- leaf 0.567 ± 0.04c 0.318 ± 0.04c 0.487 ± 0.15* 0.345 ± 0.08b F- root 2.463 ± 0.16a 0.994 ± 0.15a —— 0.825 ± 0.22a L- root 0.987 ± 0.15bc 0.733 ± 0.17b —— 0.458 ± 0.11ab 3.2.2 Difference in the active ingredients content It can be seen from Table 5 that the effect of continuous cropping on the active ingredients content of S. miltiorrhiza was specific. When compared with non-continuous cropping, continuous cropping increased the content of salvianolic acid B by 28.8% and decreased the content of rosmarinic acid by 51.4%. The contents of tanshinone I, tanshinone IIA, and dihydrotanshinone I decreased by 55.4%, 4.4%, and 100%, respectively, while that of cryptotanshinone increased by 50.0% after continuous cropping, when compared with those following non-continuous cropping. In particular, the content of dihydrotanshinone I was difficult to detect in the roots of S. miltiorrhiza after continuous cropping. These results revealed that the content of active ingredients in S. miltiorrhiza significantly decreased after continuous cropping, reducing the overall quality of S. miltiorrhiza . Table 5 The content of effective components in Salvia miltiorrhiza (mg / g) Note: The content of dihydrotanshinone in group L was extremely low and did not reach the lowest value of detection.* is significant at 0.05 level, * * is 0.01 level, * * * is 0.001 level. active principle F L TanshinoneⅠ 0.148 ± 0.002 0.066 ± 0.0001*** Tanshinone Ⅱ A 1.137 ± 0.005 1.087 ± 0.005** Cryptotanshinone 0.008 ± 0.0004 0.012 ± 0.0002** Dihydrotanshinone Ⅰ 0.075 ± 0.002 0*** Salvianolic acid B 12.5 ± 0.082 16.1 ± 0.170*** Rosmarinic acid 5.383 ± 0.045 2.617 ± 0.012*** 3.3 Analysis of amplicon sequencing results 3.3.1 Sequencing data statistics and OTU analysis The original high-throughput sequences of rhizosphere soil genomic DNA of groups F and L were spliced to obtain spliced sequences, and the effective sequences were obtained after filtering the chimeras (Table 6 ). After continuous cropping of S. miltiorrhiza , the number of raw tags and effective tags decreased, while those of bacterial and fungal OTUs increased by 3.45% and 3.78%, respectively. Subsequently, cluster analysis was performed on the representative OTU sequences obtained from groups F and L, and the sequences were subjected to species annotation at six different classification levels of phylum, class, order, family, genus, and species. As shown in Table 7 , following continuous cropping, the OTU number of the soil bacterial community decreased by 0.3%, 1.67%, and 2.48% at the order, family, and genus levels, respectively, while that of the fungal community increased by 15.38%, 5.45%, and 1.67% at the phylum, order, and family levels, respectively. In addition, the fungi:bacteria ratio in continuous cropping soil showed an increasing trend, when compared with that in non-continuous cropping soil. Table 6 Sequencing data statistics of bacteria and fungi in rhizosphere soil of continuous and non-continuous cropping of Salvia miltiorrhiza Note: Original tags = tag sequences obtained by splicing; effective label = the label sequence finally used for subsequent analysis after filtering the chimera; base = the base of the final valid data; effectiveness (%) = the percentage of the number of valid labels to the number of original PEs; oTUs = the number of operational taxonomic units. index Bacteria Fungi F group L group F group L group Raw Tags 83256 82089 75428 74409 Effective Tags 77993 76756 74600 73511 Base(nt) 19741183 19424898 17312674 16595521 Effective (%) 92.52 92.32 89.00 86.85 OTUs 3942 4078 980 1017 Table 7 OTU statistics of bacterial and fungal communities in rhizosphere soil of continuous and non-continuous cropping of Salvia miltiorrhiza Microbial type Treatment Phylum Class Order Family Genus Species Bacteria F group 66 150 307 420 644 288 L group 70 154 306 413 628 278 Fungi F group 13 48 110 235 381 524 L group 15 50 116 242 385 528 3.3.2 Differences in the influences of α-diversity index The PD-whole-tree of the soil bacterial and fungal communities in groups F and L varied by 5.89% and 4.32%, respectively, indicating that the diversity of rhizosphere microbial communities significantly changed after continuous cropping (Table 8 ). After continuous cropping, the Shannon index decreased by 9%, whereas the Chao1 index increased by 1.80%, implying that the rhizosphere soil bacterial diversity decreased after continuous cropping. In contrast, the Shannon and Simpson indices of the rhizosphere soil fungal community increased by 8.6% and 3.6%, respectively, after continuous cropping, when compared with those noted after non-continuous cropping, suggesting that the diversity of the soil fungal community increased and the species distribution was more uniform after continuous cropping. Table 8 Effects of continuous cropping on the alfa diversity index of bacteria and fungi in rhizosphere soil of Salvia miltiorrhiza Microbial type Treatment Shannon Simpson Chao1 Goods- coverage PD-whole-tree Bacteria F group 9.94 0.997 4298.82 0.9904 241.0228 L group 9.85 0.993 4376.41 0.9912 255.2186 Fungi F group 5.12 0.896 1237.13 0.9936 507.4566 L group 5.56 0.932 1254.23 0.9940 485.54 Note: Shannon: The total number of categories in the sample and their proportions. The higher the community diversity, the more uniform the species distribution, and the larger the Shannon index. Chao1: Estimation of the total number of species in community samples. Coverage of goods: Coverage. The higher the coverage of the sort, the larger the index. PD whole tree: the genetic relationship of species in the community. Simpson: Diversity and uniformity of species distribution in a community. The analysis used the Simpson diversity index (1-D). The better the species evenness, the greater the Simpson index. 3.3.3 Differences in the effects of β-diversity index The bacterial composition significantly varied between continuous and non-continuous cropping soils. Principal coordinate analysis showed the differences in the soil bacterial communities between groups F and L (Fig. 2 A). The first and second principal component axes (contribution: 22.67% and 12.71%, respectively) distinguished the soil bacterial communities between continuous cropping and non-continuous cropping groups. In addition, the first and second principal component axes (contribution: 44.01% and 28.54%, respectively) also exhibited differences in the soil fungal community composition between groups F and L (Fig. 2 B). 3.3.4 Analysis of the rhizosphere soil bacterial community structure after continuous cropping The soil bacterial community OTUs derived from the non-continuous cropping and continuous cropping groups were analyzed (Fig. 3 A). The Venn diagram showed that the number of OTUs shared by the two groups was 5747. The number of unique OTUs in the non-continuous cropping and continuous cropping groups were 1099 and 1297, respectively. With the increase in the duration of continuous cropping, some specific bacterial strains disappeared and some new strains were enriched, indicating change in the structure and composition of the soil bacterial community. There was no significant difference in the relative abundance of each dominant phylum, class, and order of the soil bacterial community in groups F and L. The dominant phyla in groups F and L were Firmicutes (17.2% and 18.1%, respectively), Proteobacteria (24.1% and 24.3%, respectively), Acinetobacter (7.2% and 7.5%, respectively), Actinobacteria (4.8% and 4.4%, respectively), and Bacteroidetes (4.9% and 4.8%, respectively) (Fig. 3 B). The dominant classes in groups F and L were Clostridium (10.2% and 8.0%, respectively), Bacillus (6.3% and 9.2%, respectively), γ-Proteobacteria (13.8% and 14.2%, respectively), α-Proteobacteria (10.3% and 10.1%, respectively), and Bacteroidia (4.8% and 4.8%, respectively) (Fig. 4 A). The dominant orders in groups F and L were Leptospirales (5.3% and 3.3%, respectively), Oscillospirales (3.1% and 1.8%, respectively), Lactobacillus (2.2% and 2.3%, respectively), and Rhizopus (4.2% and 4.2%, respectively) (Fig. 4 B). Simper (Similarity percentage) was used to break down the Bray-Curtis difference index to quantify the contribution of each species to the difference between the continuous cropping and non-continuous cropping groups. At the family level (Fig. 5 A), the relative abundance of Lachnospiracea and Nitrosopharacea, both of which exhibit soil nitrogen cycle function, decreased by 38.32% and 22.75%, respectively, in the rhizosphere soil of the continuous cropping group. Furthermore, the relative abundance of Erysipelotrichaceae and Ruminococcaceae decreased by 42.49% and 40.82%, respectively, while those of Staphylococcaceae, Peptostreptococcaceae, Lactobacillaceae, and Acidithiobacillaceae decreased at varying degrees in the rhizosphere soil of the continuous cropping group. At the genus level (Fig. 5 B), the relative abundance of the dominant genera of the rhizosphere soil bacterial community in groups F and L showed significant variation after continuous cropping. In particular, the relative abundances of Staphylococcus (0.3% and 2.2%, respectively), Romboutsia (0.6% and 2.1%, respectively), Acidithiobacillus (0.006% and 1.1%, respectively), Leptospirillum (0.0006% and 1.0%, respectively), Allobaculum (0.9% and 0.5%, respectively), Blautia (1.3% and 0.8%, respectively), Lactobacillus (0.6% and 0.8%, respectively), Pseudomonas (1.4% and 1.0%, respectively), Ruminococcus (0.9% and 0.4%, respectively), and Bacillus (0.8% and 1.6%, respectively) significantly differed between groups F and L. 3.3.5 Analysis of the rhizosphere soil fungal community structure after continuous cropping The soil fungal community OTUs (Fig. 6 A) derived from the non-continuous cropping and continuous cropping groups were analyzed. The Venn diagram showed that the number of OTUs shared between groups F and L was 1356. The number of unique OTUs in the non-continuous cropping and continuous cropping groups were 968 and 1007, respectively. Furthermore, significant differences in the soil fungal community at the phylum level were observed between the groups F and L (Fig. 6 B), and the relative abundances of the top 10 dominant phyla, including Mortiellomycota, Chytridillomycota, Zoopagomycota, Aphelidiomycota, Mucoromycota, Glomeromycota, and Blastocladiomycota, increased by 127.5%, 325.0%, 32.4%, 253.1%, 265.7%, 14.0%, and 1230.8%, respectively, while those of Ascomycota, Basidiomycota, and Rozellomycota decreased by 19.42%, 90.6%, and 30.9%, respectively, after continuous cropping. As shown in Fig. 7 A, the dominant fungal classes in groups F and L were Sordariomycetes (37.2% and 38.7%, respectively), Mortierellomycetes (9.1% and 20.7%, respectively), Agaricomycetes (5.8% and 4.4%, respectively), Orbiliomycetes (10.4% and 6.1%, respectively), Dothideomycetes (10.2% and 4.0%, respectively), Eurotiomycetes (7.4% and 4.9%, respectively), Leotiomycetes (2.3% and 1.2%, respectively), and Tremellomycetes (1.7% and 2.6%, respectively). Furthermore, the dominant fungal orders in groups F and L were Pyrrophyta (23.7% and 16.6%, respectively), Mortierela (9.1% and 20.7%, respectively), Thesephorales (4.6% and 0.08%, respectively), Orbiliales (10.4% and 6.1%, respectively), Microscales (3.0% and 9.2%, respectively), Capnodiales (8.0% and 1.1%, respectively), Eurotiales (8.0% and 1.1%, respectively), Pleospores (7.0% and 4.6%, respectively), and Sordariales (2.0% and 2.7%, respectively) (Fig. 7 B). The cluster heatmap of species abundance (Fig. 7 C) revealed significant differences in species richness and composition at the family level between groups F and L. The proportion of Coniochaetacaeae and Coniochaetacaeae in the rhizosphere fungal community of continuous cropping S. miltiorrhiza increased, while the proportion of Coniochaetacaeae and Coniochaetacaeae decreased. With the increase in the duration of continuous cropping, the structure and composition of the soil fungal community changed, and some common soil-borne pathogenic fungi, such as Leptosphaeria turcica , some Cladosporium spp., some subspecies of Alternaria , Fusarium solani , and other subspecies of Fusarium , were enriched. Based on LEfSe (LDA Effect Size) analysis, the relationship between continuous cropping and non-continuous cropping soils was further explored. The results revealed that the abundance of the microbial species in the S. miltiorrhiza soil was significantly different before and after continuous cropping. A total of 30 biomarkers with LDA score > 4 were enriched in the two groups (Fig. 8 A), with the abundance of Mortierella , Lophotrichus , Conocybe , Aspergillus , Arthrobotrys , and Cladosporium being statistically different in the two groups (Fig. 8 B). Mortierella polycephala , Lophotrichus sp., Mortierella stylospora , and Conocybe pubescens were the biomarkers in the continuous cropping soil, while Mortierella alpina , Arthrobotrys amerospora , and Cladosporium sp. were the biomarkers in the non-continuous cropping soil. 3.3.6 Function prediction analysis Based on the FunGuild tool, the corresponding categories of microbial ecological functions were annotated, and the statistical results are shown in Fig. 9 A and B. In the soil bacterial community, plant and animal pathological nutrition functions were relatively predominant. The abundance of saprophytic bacteria was relatively low and presented only slight variation between groups F and L. These results suggested that the function of bacteria in the rhizosphere soil of S. miltiorrhiza before and after continuous cropping was similar. The abundance of internal parasitic nutritional fungi in the soil fungal community decreased, while that of saprophytic nutritional fungi significantly increased after continuous cropping. Subsequently, principal component analysis was performed on the abundance statistics results based on the database functional annotations (Fig. 9 C). The soil fungal functional abundance showed good separation. The first and second principal component axes (contribution: 24.3% and 18.76%, respectively) distinguished the soil fungal composition between groups F and L. In contrast, the soil bacterial functional abundance between the two groups did not exhibit good separation (Fig. 9 D). Therefore, it can be concluded that continuous cropping changed the function of the rhizosphere soil fungi, and that long-term continuous cropping caused the enrichment of some pathogenic fungi that gradually became the dominant groups. 3.3.7 Correlation analysis between soil microbial species abundance and S. miltiorrhiza growth index The S. miltiorrhiza root morphology and root bioaccumulation were significantly positively correlated with the relative abundances of Lecythophora , Aspergillus , Alternaria , Eurotium , and other fungi, and the bacterium Pseudomonas , and were negatively correlated with Rhizophlycti and Papulaspora . The contents of chlorophyll a, chlorophyll b, and carotenoids in S. miltiorrhiza were significantly positively correlated with the relative abundances of Eurotium , Macroventuria , Gibberella , Geomyces , Aspergillus , Cladosporium , Arthrobotrys , Solirubrobacter , Clostridium innocuum , Lysobacter , and Gaiella , but significantly negatively correlated with the relative abundances of fungi such as Papulaspora , Fusicolla , Chaetomium , Solicoccozyma , and Mortierella , and some bacteria such as Ohtaekwangia , Streptomyces , Bacillus , and Leptospirillum (Fig. 10 A and 10 B). In general, the microbial species abundance and community structure were significantly correlated with the root morphological accumulation and photosynthetic intensity of S. miltiorrhiza . 4.Discussion Continuous cropping can significantly influence the morphological and physiological indices of S. miltiorrhiza . The development degree of roots and leaves, carbohydrate content, and active ingredients content are important indices to detect the growth and development ability of plants. The number of leaves and leaf area are related to the photosynthesis of plants and the yield of photosynthetic crops. The morphology and vitality of roots directly affect the absorption of nutrients by host plants and transport efficiency of photosynthetic products, thus affecting the growth and development of S. miltiorrhiza . Accordingly, in the present study, pot experiment with S. miltiorrhiza was performed, and the results showed that the biomass of S. miltiorrhiza decreased, aboveground leaves dried up, effective leaf area decreased, and underground main roots became shorter with lower diameter after continuous cropping. The effects of continuous cropping on the physiological indices of S. miltiorrhiza included decrease in the total chlorophyll content, significant decrease in the accumulation of soluble sugar, sucrose, glucose, and fructose, increase in the content of salvianolic acid B in the water-soluble components of S. miltiorrhiza , and significant decrease in the content of rosmarinic acid. Furthermore, except cryptotanshinone, the contents of tanshinone I, tanshinone IIA, and dihydrotanshinone I decreased after continuous cropping. Furthermore, the pot experiment demonstrated that the rhizosphere soil bacterial and fungal community compositions altered after continuous cropping. The diversity of the rhizosphere soil bacterial community decreased, while that of the rhizosphere soil fungal community increased following continuous cropping. Besides, continuous cropping led to a downward trend in the soil bacteria:fungi ratio, enrichment of strong pathogenic fungi such as Alternaria subspecies and F. solani , and an obvious transformation of the soil into “fungal type.” The results of Spearman analysis showed a significant correlation between the rhizosphere microbial population structure and root development degree and photosynthesis intensity of S. miltiorrhiza under continuous cropping, implying that the change in the microbial population could significantly alter the nutrients transport, growth, and development of S. miltiorrhiza . After continuous cropping of S. miltiorrhiza , the relative abundance of Actinobacteria and Bacteroidetes decreased to varying degrees, while that of Firmicutes and other oligotrophic bacteria increased, indicating that the continuous cropping system altered the rhizosphere soil environment, causing some soil microorganisms to modify their survival strategies to adapt to this change. Previous studies have shown that Mortierella can infect plants and cause large-scale crop infections. In the present study, at the family level, the abundance of Nitrosophaeraceae involved in soil nitrogen cycle decreased, while that of pathogenic Mortierellaceae and Cystaceae increased. These results further confirmed that the abundance and structure of soil bacterial community were affected by the continuous cropping system. The change in the soil bacterial community diversity after continuous cropping could be attributed to the decrease in the abundance of environment-friendly bacteria and increase in the abundance of pathogenic bacteria, leading to the dysfunction of rhizosphere soil microflora and more serious problem of continuous cropping obstacle. The results of the present study on the growth and physiology of S. miltiorrhiza before and after continuous cropping also confirmed this viewpoint. Furthermore, the changes in the soil fungal community composition and structure before and after continuous cropping were analyzed by ITS sequencing, and the findings showed that the continuous cropping system had significant influence on the relative abundance of the rhizosphere soil fungi at the phylum, class, order, and genus levels. The diversity index analysis showed that the soil fungal community structure significantly changed and the fungal richness and diversity significantly increased after continuous cropping. The results of cluster analysis at the genus level revealed that the abundances of Alternaria (an important plant pathogenic fungus) and Fusarium significantly increased, and pathogenic fungi such as F. solani were enriched in the rhizosphere soil of S. miltiorrhiza under continuous cropping, which may be related to the aggravation of disease after continuous cropping of S. miltiorrhiza . The increase in the abundance of pathogenic fungi to gradually become the dominant group can destroy the balance of the rhizosphere soil microecology and cause deterioration of its growth environment. Rhizosphere is a micro-soil area close to plant roots. As an organic combination of plant-soil-microorganisms, the micro-ecosystem formed by rhizosphere is an important part of plant-environment interaction and function [ 19 ] , which is closely related to the occurrence of continuous cropping obstacles. It is generally believed that the changes in soil nutrients, root allelochemicals, and microbial community evolution in the rhizosphere soil micro-ecological system are the main causes of continuous cropping obstacles [ 20 ] . In particular, the richness and diversity of soil microorganisms can comprehensively reflect the overall changes in the soil microflora and indicate the health status of soil, especially the bacteria:fungi ratio, which is the most important feature of soil function and can be used as a key indicator to assess the process of rhizosphere micro-ecosystem [ 21 ] . Many studies have reported that the soil bacteria:fungi ratio is significantly affected by the cropping system [ 22 , 23 ] . For instance, Wu [ 24 ] found that the rhizosphere microflora of Pseudostellaria heterophylla was prone to imbalance and structural disorder under continuous monoculture conditions, which may be caused by the intervention of phenolic acids. Similarly, Yu [ 25 ] also demonstrated that the abundance of harmful microorganisms in the rhizosphere soil increased after continuous cropping of Asarum , disturbing the balance between beneficial and harmful bacteria. In general, the microbial community stability and resistance to environmental interference enhance with the increasing richness of the soil microbial diversity. Therefore, the decrease in rhizosphere bacterial richness and diversity and the increase in harmful fungal abundance may be one of the factors responsible for the poor growth of S. miltiorrhiza , and the results of the present study also confirmed this notion. At present, studies on continuous cropping obstacles of medicinal plants mainly focus on the deterioration of soil environment, allelopathic autotoxicity, rhizosphere microecological imbalance, and frequent soil-borne diseases. The dynamic changes and functional analysis of rhizosphere microbial communities of medicinal plants have become crucial for understanding the phenomenon of continuous cropping obstacles of medicinal plants. On the one hand, functional microorganisms and pathogenic fungi aggressively compete for rhizosphere ecological sites under the mediation of root exudates, and their abundance ratio can negatively affect the growth and metabolism of medicinal plants after breaking a balance point [ 26 ] . On the other hand, long-term single cultivation of medicinal plants can cause continuous accumulation of the acid root exudates. Chemokines such as phenolic acids and coumarins can attract pathogenic fungi to the rhizosphere. It has been confirmed that components such as coumaric acid, benzoic acid, and saponins secreted by the roots of Panax notoginseng and Panax ginseng exhibit strong chemotaxis to pathogens, resulting in an increase in pathogen abundance in the rhizosphere soil with the increase in the duration of continuous cropping [ 27 – 28 ] . Moreover, the acidified soil environment is more conducive to the colonization and development of the soil fungal community. Consequently, continuous cropping soil gradually transforms from the bacterial type to fungal type, and this constant imbalance of the microflora negatively affects the host plant, causing abnormal growth and development [ 29 – 30 ] . However, current research, including the present study, on the challenges related to continuous cropping of medicinal plants has mainly focused on the unilateral changes in plants and rhizosphere microenvironment after continuous cropping, ignoring the interaction among plants, root exudates, and rhizosphere microorganisms and the subsequent dynamic correlation. Hence, future studies should explore the material transformation between plant and soil rhizosphere microorganisms and clarify the factors driving the formation of rhizosphere soil microbial communities. 5. Conclusion In summary, the continuous cropping system significantly affected the appearance, physiological activity, and biological accumulation of S. miltiorrhiza , causing changes in the bacterial and fungal community structure and metabolic function in the rhizosphere soil. When compared with non-continuous cropping soil, the bacterial diversity decreased and the fungal diversity increased in continuous cropping soil. At the same time, the composition of bacterial and fungal communities in the rhizosphere soil under continuous cropping of S. miltiorrhiza also changed, and pathogenic fungi such as F. solani were enriched. These changes might lead to further deterioration of the quality of S. miltiorrhiza . In summary, the present study systematically elucidated the effects of continuous cropping system on the growth and development of S. miltiorrhiza and rhizosphere microflora, and discussed the mechanism of continuous cropping obstacles and quality decline of Chinese medicinal materials based on rhizosphere microorganisms. The results obtained are crucial for regulating rhizosphere soil microecology and improving the cultivation of Chinese medicinal materials. Declarations Conflict of Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Funding This work was supported by National Natural Science Foundation of China (Grant No. 82173917), National key research and development plan (2023YFC3503801) and Qilu University of Technology (Shandong Academy of Sciences) Science, Education and Industry Integration In-novation Pilot Project (Grant Nos. 2023PYI004). Author Contribution J.J. and W.L. designed the experiments. J.J.、B.Z.、Y.M. and X.F. carried out sample collection, data analysis, and wrote the manuscript. X.W. and L.G. analyzed data. J.J., B.Z., G.Y. and W.L .assisted the experiments. All authors approved the final manuscript. Data Availability Sequence data that support the findings of this study have been deposited in the NCBl ShortRead Archive database (accession number: PRJNA1129673, PRJNA1129675). References Chang, C. C., Chang, Y. C., Hu, W. L., & Hung, Y. C. (2016). Oxidative Stress and Salvia miltiorrhiza in Aging-Associated Cardiovascular Diseases. Oxidative medicine and cellular longevity, 2016, 4797102. https://doi.org/10.1155/2016/4797102 Liu, H., Niu, M., Zhu, S., Zhang, F., Liu, Q., Liu, Y., Liu, R., & Zhang, Y. (2020). Effect Study of Continuous Monoculture on the Quality of Salvia miltiorrhiza Bge Roots. BioMed research international, 2020, 4284385. https://doi.org/10.1155/2020/4284385 Wu, L., Wang, J., Huang, W., Wu, H., Chen, J., Yang, Y., Zhang, Z., & Lin, W. (2015). Plant-microbe rhizosphere interactions mediated by Rehmannia glutinosa root exudates under consecutive monoculture. Scientific reports, 5, 15871. https://doi.org/10.1038/srep15871 Li, Y., Dai, S., Wang, B., Jiang, Y., Ma, Y., Pan, L., Wu, K., Huang, X., Zhang, J., Cai, Z., & Zhao, J. (2020). Autotoxic Ginsenoside Disrupts Soil Fungal Microbiomes by Stimulating Potentially Pathogenic Microbes. Applied and environmental microbiology, 86(9), e00130-20. https://doi.org/10.1128/AEM.00130-20 Wu, H., Qin, X., Wang, J., Wu, L., Chen, J., Fan, J., Zheng, L., Tangtai, H., Arafat, Y., Lin, W., Luo, X., Lin, S., Lin, W. (2019). Rhizosphere responses to environmental conditions in radix pseudostellariae under continuous monoculture regimes. Agriculture Ecosystems & Environment, 270, 19–31. https://doi.org/10.1016/j.agee.2018.10.014 Wu, Z., Yang, L., Wang, R., Zhang, Y., Shang, Q., Wang, L., Ren, Q., & Xie, Z. (2015). In vitro study of the growth, development and pathogenicity responses of Fusarium oxysporum to phthalic acid, an autotoxin from Lanzhou lily. World journal of microbiology & biotechnology, 31(8), 1227–1234. https://doi.org/10.1007/s11274-015-1872-8 Corato, U. D. (2020). Towards new soil management strategies for improving soil quality and ecosystem services in sustainable agriculture: editorial overview. Sustainability, 12(22), 9398. https://doi.org/10.3390/su12229398 Pervaiz, Z. H., Iqbal, J., Zhang, Q., Chen, D., & Saleem, M. (2020). Continuous cropping alters multiple biotic and abiotic indicators of soil health. Soil Systems, 4(4), 59. https://doi.org/10.3390/soilsystems4040059 Wang, Q., Sun, H., Li, M., Xu, C., & Zhang, Y. (2020). Different Age-Induced Changes in Rhizosphere Microbial Composition and Function of Panax ginseng in Transplantation Mode. Frontiers in plant science, 11, 563240. https://doi.org/10.3389/fpls.2020.563240 Rousk, J., Bååth, E., Brookes, P. C., Lauber, C. L., Lozupone, C., Caporaso, J. G., Knight, R., & Fierer, N. (2010). Soil bacterial and fungal communities across a pH gradient in an arable soil. The ISME journal, 4(10), 1340–1351. https://doi.org/10.1038/ismej.2010.58 Huang, W., Sun, D., Fu, J., Zhao, H., Wang, R., & An, Y. (2019). Effects of Continuous Sugar Beet Cropping on Rhizospheric Microbial Communities. Genes, 11(1), 13. https://doi.org/10.3390/genes11010013 Luo, L., Guo, C., Wang, L., Zhang, J., Deng, L., Luo, K., Huang, H., Liu, Y., Mei, X., Zhu, S., & Yang, M. (2019). Negative Plant-Soil Feedback Driven by Re-assemblage of the Rhizosphere Microbiome with the Growth of Panax notoginseng. Frontiers in microbiology, 10, 1597. https://doi.org/10.3389/fmicb.2019.01597 Liu, S., Wang, Z. Y., Niu, J. F., Dang, K. K., Zhang, S. K., Wang, S. Q., Wang, Z. Z. (2021). Changes in physicochemical properties, enzymatic activities, and the microbial community of soil significantly influence the continuous cropping of Panax quinquefolius L. (American ginseng). Plant Soil, 463, 427–446. https://doi.org/10.1007/s11104-021-04911-2 Zhao, J., Liu, J., Liang, H., Huang, J., Chen, Z., Nie, Y., Wang, C., & Wang, Y. (2018). Manipulation of the rhizosphere microbial community through application of a new bio-organic fertilizer improves watermelon quality and health. PloS one, 13(2), e0192967. https://doi.org/10.1371/journal.pone.0192967 Xin, AY., Li, XZ., Jin, H., Yang, XY., Zhao, RM., Liu, JK., Qin, B. (2018). The accumulation of reactive oxygen species in root tips caused by autotoxic allelochemicals – A significant factor for replant problem of Angelica sinensis (Oliv.) Diels[J]. Ind Crop Prod, 138, 111432. https://doi.org/10.1016/j.indcrop.2019.05.081 Na, XF., Ma, SL., Ma, CX., Liu, ZY., Xu, PX., Zhu, HB., Liang, WY., Kardol, P. (2021). Lycium barbarum L. (goji berry) monocropping causes microbial diversity loss and induces Fusarium spp. enrichment at distinct soil layers[J]. Appl Soil Ecol, 168, 104107. https://doi.org/10.1016/j.apsoil.2021.104107 Tan, G., Liu, Y., Peng, S., Yin, H., Meng, D., Tao, J., Gu, Y., Li, J., Yang, S., Xiao, N., Liu, D., Xiang, X., & Zhou, Z. (2021). Soil potentials to resist continuous cropping obstacle: Three field cases. Environmental research, 200, 111319. https://doi.org/10.1016/j.envres.2021.111319 Li, Y., Chi, J., Ao, J., Gao, X., Liu, X., Sun, Y., & Zhu, W. (2021). Effects of Different Continuous Cropping Years on Bacterial Community and Diversity of Cucumber Rhizosphere Soil in Solar-Greenhouse. Current microbiology, 78(6), 2380–2390. https://doi.org/10.1007/s00284-021-02485-x Kuypers, M. M. M., Marchant, H. K., & Kartal, B. (2018). The microbial nitrogen-cycling network. Nature reviews. Microbiology, 16(5), 263–276. https://doi.org/10.1038/nrmicro.2018.9 Bakker, P. A. H. M., Pieterse, C. M. J., de Jonge, R., & Berendsen, R. L. (2018). The Soil-Borne Legacy. Cell, 172(6), 1178–1180. https://doi.org/10.1016/j.cell.2018.02.024 Qin, X., Wu, H., Chen, J., Wu, L., Lin, S., Khan, M. U., Boorboori, M. R., & Lin, W. (2017). Transcriptome analysis of Pseudostellaria heterophylla in response to the infection of pathogenic Fusarium oxysporum. BMC plant biology, 17(1), 155. https://doi.org/10.1186/s12870-017-1106-3 Lauber, C. L., Strickland, M. S., Bradford, M. A., & Fiererg, N. (2008). The influence of soil properties on the structure of bacterial and fungal communities across land-use types. Soil Biology and Biochemistry, 40(9), 2407–2415. https://doi.org/10.1016/j.soilbio.2008.05.021 . Pereira e Silva, M. C., Dias, A. C., van Elsas, J. D., & Salles, J. F. (2012). Spatial and temporal variation of archaeal, bacterial and fungal communities in agricultural soils. PloS one, 7(12), e51554. https://doi.org/10.1371/journal.pone.0051554 Wu, H., Xu, J., Wang, J., Qin, X., Wu, L., Li, Z., Lin, S., Lin, W., Zhu, Q., Khan, M. U., & Lin, W. (2017). Insights into the Mechanism of Proliferation on the Special Microbes Mediated by Phenolic Acids in the Radix pseudostellariae Rhizosphere under Continuous Monoculture Regimes. Frontiers in plant science, 8, 659. https://doi.org/10.3389/fpls.2017.00659 Yu, CL., Gao, S., Sun, WS. (2022). Effects of continuous cropping on soil physical and chemical properties and rhizosphere microbial community characteristics of Asarum sibiricum. Jiangsu Agricultural Science, 50(14), 250–258. https://doi.org/10.15889/j.issn.1002-1302.2022.14.036 Dong, LL., Niu, WH., Wang, R., Xu, J., Zhang, LJ., Zhang, J., Chen, SL. (2017). Variation of rhizosphere fungal community diversity and composition in ginseng [J]. China journal of Chinese Materia Medica, 42(3): 443–449. https://doi.org/10.19540/j.cnki.cjcmm.20161222.032 Wang, B., Xia, Q., Li, Y., Zhao, J., & Cai, Z. (2021). Root rot-infected sanqi ginseng rhizosphere harbors dynamically pathogenic microbiotas driven by the shift of phenolic acids. Plant and Soil, 465(1–2), 385–402. https://doi.org/10.1007/s11104-021-05034-4 Dong, LinlinXu, JiangLi, YongFang, HailanNiu, WeihaoLi, XiwenZhang, YujunDing, WanlongChen, Shilin. (2018). Manipulation of microbial community in the rhizosphere alleviates the replanting issues in panax ginseng. Soil Biology & Biochemistry, 125, 64–74. https://doi.org/10.1016/j.soilbio.2018.06.028 Jin, X., Wu, F., & Zhou, X. (2020). Different toxic effects of ferulic and p-hydroxybenzoic acids on cucumber seedling growth were related to their different influences on rhizosphere microbial composition. Biology and Fertility of Soils, 56(1), 125–136. https://doi.org/10.1007/s00374-019-01408-0 . Hontoria, C., García-González, I., Quemada, M., Roldán, A., & Alguacil, M. M. (2019). The cover crop determines the AMF community composition in soil and in roots of maize after a ten-year continuous crop rotation. The Science of the total environment, 660, 913–922. https://doi.org/10.1016/j.scitotenv.2019.01.095 Guo, Y., Lv, J., Zhao, Q., Dong, Y., & Dong, K. (2020). Cinnamic Acid Increased the Incidence of Fusarium Wilt by Increasing the Pathogenicity of Fusarium oxysporum and Reducing the Physiological and Biochemical Resistance of Faba Bean, Which Was Alleviated by Intercropping with Wheat. Frontiers in plant science, 11, 608389. https://doi.org/10.3389/fpls.2020.608389 Additional Declarations No competing interests reported. Supplementary Files RAWdata.rar Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4565313","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":330043014,"identity":"a0ae130e-1a99-40cc-af5b-837ae2fec04c","order_by":0,"name":"Ji dong JU","email":"","orcid":"","institution":"Qilu University of Technology (Shandong Academy of Sciences)","correspondingAuthor":false,"prefix":"","firstName":"Ji","middleName":"dong","lastName":"JU","suffix":""},{"id":330043015,"identity":"807b343f-2319-4189-b480-6fe26785642e","order_by":1,"name":"Bingqian Zhou","email":"","orcid":"","institution":"Qilu University of Technology (Shandong Academy of Sciences)","correspondingAuthor":false,"prefix":"","firstName":"Bingqian","middleName":"","lastName":"Zhou","suffix":""},{"id":330043016,"identity":"c8b81db1-ad23-4110-8e58-a3656f88f478","order_by":2,"name":"Yuan Meng","email":"","orcid":"","institution":"Qilu University of Technology (Shandong Academy of Sciences)","correspondingAuthor":false,"prefix":"","firstName":"Yuan","middleName":"","lastName":"Meng","suffix":""},{"id":330043017,"identity":"1e8432e0-443e-4779-8fd1-7f1a9ea28b59","order_by":3,"name":"Guohong Yang","email":"","orcid":"","institution":"Qilu University of Technology (Shandong Academy of Sciences)","correspondingAuthor":false,"prefix":"","firstName":"Guohong","middleName":"","lastName":"Yang","suffix":""},{"id":330043018,"identity":"d5a10cb7-33ce-475c-8628-68f915128780","order_by":4,"name":"Xinyu Fu","email":"","orcid":"","institution":"Qilu University of Technology (Shandong Academy of Sciences)","correspondingAuthor":false,"prefix":"","firstName":"Xinyu","middleName":"","lastName":"Fu","suffix":""},{"id":330043019,"identity":"3e7f060b-110c-454a-9cb3-042689083a3a","order_by":5,"name":"Xiao Wang","email":"","orcid":"","institution":"Qilu University of Technology (Shandong Academy of Sciences)","correspondingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Wang","suffix":""},{"id":330043020,"identity":"e1c3f6a2-0805-4091-9a92-1b3cd734e3f4","order_by":6,"name":"Lanping Guo","email":"","orcid":"","institution":"Institute of Chinese Materia Medica China Academy of Chinese Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Lanping","middleName":"","lastName":"Guo","suffix":""},{"id":330043021,"identity":"117b1af6-b4b5-4019-ad41-644dde6c22a5","order_by":7,"name":"Wei Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyElEQVRIiWNgGAWjYBACPmYQaSDBY3/g8IEDH34QoYUNosVGjuHgscSDM3uI0QKh0owZDp8xPszBRowWdh4ziQ8FhxMb2858OMzAwyDPL3aAkMN4zCRnGBxObOY5u+FwgQWD4czZCYS13OYBammTAGqZwcOQYHCbGC1/gFp65N88OMzDRqwWBoM0YwmGMwzEamEr/9kDDGQDhmMGwECWIOwXfv7Dmw1+/JHgMWA4/PjDhx828vzSBLSgAwnSlI+CUTAKRsEowA4AfkVDCKjiVKAAAAAASUVORK5CYII=","orcid":"","institution":"Qilu University of Technology (Shandong Academy of Sciences)","correspondingAuthor":true,"prefix":"","firstName":"Wei","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-06-11 15:47:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4565313/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4565313/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60995125,"identity":"f59762d2-eebf-4c1a-8a48-452ad01966b0","added_by":"auto","created_at":"2024-07-24 12:01:03","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":712962,"visible":true,"origin":"","legend":"\u003cp\u003eDifference of chlorophyll content between continuous cropping and non-continuous cropping \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/e1f5725906132fda7005b415.jpg"},{"id":60995132,"identity":"b668a834-811b-498c-bd41-68f0a1c33dfc","added_by":"auto","created_at":"2024-07-24 12:01:03","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":372422,"visible":true,"origin":"","legend":"\u003cp\u003eDifferences in microbial community structure based on principal coordinate analysis (PCoA). A: Bacteria, B: Fungi\u003c/p\u003e","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/1ddd87c0cc9cd5b845ef63d4.jpg"},{"id":60995640,"identity":"94bdc270-cc7d-4774-bca0-2bf75cadebb3","added_by":"auto","created_at":"2024-07-24 12:09:04","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":290846,"visible":true,"origin":"","legend":"\u003cp\u003eStructure and distribution of bacterial community in the rhizosphere of continuous cropping Salvia miltiorrhiza A: OUT Venn diagram, B: relative abundance of bacteria at the phylum level.\u003c/p\u003e","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/7055c0848353bc0cd1e89e32.jpg"},{"id":60995122,"identity":"6e1e568b-8804-44db-9345-6491c95176d0","added_by":"auto","created_at":"2024-07-24 12:01:03","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":187123,"visible":true,"origin":"","legend":"\u003cp\u003eThe relative abundance of soil bacteria at the class and order level in the continuous cropping and non-continuous cropping of Salvia miltiorrhizaA: class level, B: order level\u003c/p\u003e","description":"","filename":"FIG4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/628832addeae1677965315fb.jpg"},{"id":60995639,"identity":"21268e8b-adeb-45b3-a17f-db8570597f4e","added_by":"auto","created_at":"2024-07-24 12:09:03","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":211573,"visible":true,"origin":"","legend":"\u003cp\u003eContribution of bacterial community differences based on Simper analysis A: family level, B: genus level\u003c/p\u003e","description":"","filename":"Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/02cbce81808fc2355b10622b.jpg"},{"id":60995126,"identity":"91035eed-46c4-4895-80ee-ce93c99baaca","added_by":"auto","created_at":"2024-07-24 12:01:03","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":167129,"visible":true,"origin":"","legend":"\u003cp\u003eStructure and distribution of rhizosphere fungal community in continuous cropping \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e A: OUT Wayne diagram, B: the relative abundance of fungi at the phylum classification level\u003c/p\u003e","description":"","filename":"Fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/23507eac4506acc7848f607f.jpg"},{"id":60995637,"identity":"70e433e1-dfb5-4dd3-86cd-26252d253c07","added_by":"auto","created_at":"2024-07-24 12:09:03","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":399237,"visible":true,"origin":"","legend":"\u003cp\u003eThe relative abundance of soil fungi at class and order classification level in continuous cropping and non-continuous cropping \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e at class and order classification level A: class level, B: order level, C: family level of species abundance clustering heat map\u003c/p\u003e","description":"","filename":"Fig7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/c949664e25237d4c76375454.jpg"},{"id":60995123,"identity":"3267be6b-b029-41c8-bd9c-81a08bd7c4ef","added_by":"auto","created_at":"2024-07-24 12:01:03","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":630548,"visible":true,"origin":"","legend":"\u003cp\u003eLEfSe analysis of rhizosphere soil microorganisms in continuous cropping and non-continuous cropping \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e A: LDA value distribution histogram, B: evolutionary branch diagram\u003c/p\u003e","description":"","filename":"Fig8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/e93dff9af112202cef3ef77d.jpg"},{"id":60995638,"identity":"00736a88-ced7-4fb9-ba21-13cbc4a9a912","added_by":"auto","created_at":"2024-07-24 12:09:03","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":323998,"visible":true,"origin":"","legend":"\u003cp\u003eF group and L group function annotation relative abundance display A: bacterial FunGuild function annotation relative abundance histogram, B: fungal FunGuild function annotation relative abundance histogram, C: fungal FunGuild function annotation PCA result display, D: bacterial FunGuild function annotation PCA result display\u003c/p\u003e","description":"","filename":"Fig9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/422476d249f2a1aa432a9ff7.jpg"},{"id":60995129,"identity":"2919142c-0d90-4594-a97a-50b10dfefa09","added_by":"auto","created_at":"2024-07-24 12:01:03","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":833602,"visible":true,"origin":"","legend":"\u003cp\u003eSpearman analysis of bacterial and fungal species abundance and physiological indexes of \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Fig10.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/aaecb9c7b0b99e33927de4c7.jpg"},{"id":78357008,"identity":"8a996a7e-ce20-42b5-a20d-f7da7d6a5b47","added_by":"auto","created_at":"2025-03-12 11:38:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5494688,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/b5f829f2-92ab-4f69-b7de-6cbecac5f1cf.pdf"},{"id":60995145,"identity":"39a43735-77a0-4bb3-8cea-157730e158de","added_by":"auto","created_at":"2024-07-24 12:01:25","extension":"rar","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":511261706,"visible":true,"origin":"","legend":"","description":"","filename":"RAWdata.rar","url":"https://assets-eu.researchsquare.com/files/rs-4565313/v1/31cd3781f5816ddd1b8ff50a.rar"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effects of continuous cropping on growth and rhizosphere soil microbial community structure of Salvia miltiorrhiza Bge","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eThe dried roots and rhizomes of \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e Bge. have various pharmacological effects, such as decreasing inflammation, reducing oxidative stress, promoting blood circulation, and removing blood stasis, and they are the first choice for the prevention and treatment of cardiovascular and cerebrovascular diseases \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Consequently, \u003cem\u003eS. miltiorrhiza\u003c/em\u003e Bge. has broad prospects in the fields of drug production, food health care, skin care, and cosmetics. Owing to the constant increase in the demand for \u003cem\u003eS. miltiorrhiza\u003c/em\u003e, continuous cropping of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e has been developed. However, continuous cropping can lead to various complications such as deterioration of soil texture, aggravation of pests and diseases, and increase in physiologically dead seedlings, emerging as one of the main factors limiting the increase in yield, quality, and market expansion of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAssessment of the quality of medicinal plants includes an evaluation of the appearance quality and internal quality. Appearance quality is assessed by the morphology of roots and effective leaf area, while internal quality includes an assessment of the accumulation of carbohydrates and active ingredients. Green plants accomplish morphological construction via photosynthesis, and use organic matter such as carbohydrates as energy raw materials for growth and development. In addition, the synthesis and accumulation of active ingredients in medicinal plants are sometimes closely associated with photosynthetic products. However, most medicinal rhizomatous plants, such as \u003cem\u003ePseudostellaria heterophylla\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e, \u003cem\u003eLilium L\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e, \u003cem\u003eAtractylodes macrocephala\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e, and \u003cem\u003ePanax ginseng\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e, suffer from quality deterioration and even crop failure. Similarly, the impact of continuous cropping on the \u003cem\u003eS. miltiorrhiza\u003c/em\u003e industry is also directly reflected on changes in yield and quality. Therefore, a systematic study of continuous cropping using a series of indicators such as aboveground and underground morphology, biological accumulation, and growth physiology of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e plants is crucial to elucidate the underlying mechanism of continuous cropping and formulate corresponding countermeasures.\u003c/p\u003e \u003cp\u003eSoil microorganisms are widely involved in the transformation of plant nutrients and degradation of harmful substances, and are known as the second genome of plants, closely related to plant growth and metabolism. Plants, soil, and microorganisms perform functions such as material exchange and signal transmission in the rhizosphere environment, and their interaction network along with the environment can effectively resist various biotic and environmental stresses \u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. However, related studies have shown that continuous cropping can affect the evolution of microbial rhizosphere community structure and aggravate soil-borne diseases \u003csup\u003e[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e, making microorganisms a key factor that limits productivity in continuous cropping. With the extension of planting years, some plant pathogens get enriched in the rhizosphere of continuous cropping plants, while some functional beneficial bacteria such as \u003cem\u003ePseudomonas\u003c/em\u003e and \u003cem\u003eBacillus\u003c/em\u003e show negative feedback effects \u003csup\u003e[\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Increasing studies have indicated that continuous cropping obstacles are mainly caused by an imbalance in the microbial rhizosphere community structure, allelopathic autotoxicity, and deterioration of soil physical and chemical properties \u003csup\u003e[\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. However, to date, knowledge about the effects of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e continuous cropping system on microbial rhizosphere community structure is limited.\u003c/p\u003e \u003cp\u003eWith the development of molecular biology techniques, high-throughput nucleic acid sequence analysis has been widely used for the classification and identification of microorganisms. In particular, the high-throughput, high-depth, and high-precision NovaSeq sequencing platform provides the possibility to elucidate the interaction between soil microorganisms and continuous cropping systems \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Therefore, in this study, potted \u003cem\u003eS. miltiorrhiza\u003c/em\u003e was used to explore the degree of damage of continuous cropping of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e on plant growth and physiological indices. The bacterial and fungal community structure and diversity in the rhizosphere soil of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e under continuous cropping were analyzed by using a new-generation high-throughput sequencing technology. The objective of this study was to explore the physiological mechanism of yield reduction and quality decline after continuous cropping of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e and its correlation with rhizosphere microflora changes. The obtained results provide an important theoretical and practical foundation for elucidating the mechanism of continuous cropping obstacles of medicinal plants and improving the cultivation soil for the production of Chinese medicinal materials.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.1 \u003cem\u003eS. miltiorrhiza\u003c/em\u003e seedling and sampling\u003c/h2\u003e \u003cp\u003eHigh-quality \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e seeds were screened from a \u003cem\u003eS. miltiorrhiza\u003c/em\u003e planting base at Ziguang Ecological Park in Miaoshan Town, Laiwu City, Shandong Province, China, and used in pot experiments. In brief, \u003cem\u003eS. miltiorrhiza\u003c/em\u003e was cultivated in non-continuous cropping and continuous cropping soils (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e1\u003c/span\u003e) in a light culture room at Shandong Provincial Analysis and Testing Center (Shandong, China). When the \u003cem\u003eS. miltiorrhiza\u003c/em\u003e plants in the continuous cropping soil showed disease symptoms, the plants from each group were collected for morphological and physiological activity assays. Fresh soil samples of groups F (Noncontinuous cropping) and L (Continuous cropping) (5 replicates in each group) were obtained by a \u0026ldquo;shaking root method \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e,\u0026rdquo; sieved using 40 mesh, stored in dry ice, and transported to Nuohe Science and Technology Co., Ltd., (Beijing, China) for high-throughput sequencing of 16S rDNA and fungal ITS amplicons based on the Illumina NovaSeq platform.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSoil composition of non-continuous cropping and continuous cropping\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSterilized soil\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePlanting soil\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eContinuous cropping soil\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eF group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e50%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eL group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e50%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e50%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Determination of morphological indices\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eS. miltiorrhiza\u003c/em\u003e plants in groups F and L were taken out from a ceramic flowerpots, and the soil was shaken off. After cleaning, the fresh weights (g) of the aboveground and underground plant parts were measured. Then, the samples were heated in an oven at 85\u0026deg;C for 20 min, cooled to 70\u0026deg;C, and dried to a constant weight. The dry weight data were recorded and the drying rate was calculated. The number of complete leaves, number of dry or diseased leaves, and total number of leaves in each group were recorded. The maximum leaf length and maximum leaf width of each leaf were measured, and the leaf length:leaf width ratio and leaf area (in cm\u003csup\u003e2\u003c/sup\u003e) were calculated. The length and cross-sectional diameter of the main root of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e from the reed head to the root tip were determined, which were recorded as the longest root length and the main root diameter, respectively (in cm). Furthermore, the number of roots (strip) with a diameter\u0026thinsp;\u0026gt;\u0026thinsp;0.2 cm was recorded.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Evaluation of physiological indices\u003c/h2\u003e \u003cdiv id=\"Sec21\" class=\"Section3\"\u003e \u003ch2\u003e2.3.1 Determination of chlorophyll and sugar contents\u003c/h2\u003e \u003cp\u003eThe fresh leaves of groups F and L were collected and their veins were removed, and cut into fragments of 1\u0026ndash;2-mm width. Then, 1.0 g of the leaves fragments were immersed in 50 mL of 95% ethanol for extraction (dark) until the leaf tissue became completely white. The absorbance (A) of the extract was determined using UV-2700 ultraviolet spectrophotometer at the wavelengths of 665, 649, and 470 nm, and the contents of total chlorophyll, chlorophyll a (C-a), chlorophyll b (C-b), and carotenoids (C-carotenoid) were calculated as follows:\u003c/p\u003e \u003cp\u003eC-a\u0026thinsp;=\u0026thinsp;13.95 \u0026times; A665-6.88 \u0026times; A649\u003c/p\u003e \u003cp\u003eC-b\u0026thinsp;=\u0026thinsp;24.96 \u0026times; A649-7.32 \u0026times; A665\u003c/p\u003e \u003cp\u003eC-carotenoid = (1000 \u0026times; A470-2.05 \u0026times; C-a-114.8 \u0026times; C-b) / 24\u003c/p\u003e \u003cp\u003eChlorophyll content (mg/g) = (C chlorophyll \u0026times; V extract \u0026times; dilution) / sample fresh weight\u003c/p\u003e \u003cp\u003eTo determine the soluble sugar and sucrose contents, 3.0 g of the leaves and roots of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e were extracted with ethanol (80%) in a water bath (80\u0026deg;C) for 30 min. After cooling to room temperature, the extracts were centrifuged (4000 rpm for 1.5 min) and the supernatants were collected. The soluble sugar content was measured using anthrone colorimetry, and the sucrose content was determined by resorcinol method. For the calculation of glucose and fructose contents, the leaves and roots of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e were dried and crushed, and 0.1 g was of the crushed samples was mixed with 5 mL of distilled water and ground in a motor. Then, the ground samples were centrifuged (3000 rpm for 1.5 min) and the supernatant was collected and subjected to anthrone colorimetry to ascertain the contents of glucose and fructose.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e \u003ch2\u003e2.3.2 Determination of active ingredients content\u003c/h2\u003e \u003cp\u003eThe root tissue of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e from each group was crushed and passed through a 50-mesh sieve. Then, 0.5 g of the crushed sample was mixed with equal amount of methanol (70%) and stirred ultrasonically for 30 min, and the filtrate was passed through a 0.45-\u0026micro;m microporous membrane for subsequent high-performance liquid chromatography (HPLC). The HPLC analysis conditions were as follows: Compass chromatographic column C18 (4.6 mm \u0026times; 250 mm, 5 \u0026micro;m); mobile phase: ultrapure water (with 0.2% acetic acid) as aqueous phase and acetonitrile as organic phase; gradient program: 0\u0026ndash;25 min, 5\u0026ndash;35% B; 25\u0026ndash;30 min, 35\u0026ndash;55% B; 30\u0026ndash;40 min, 55\u0026ndash;75% B; 40\u0026ndash;50 min, 75\u0026ndash;95% B; flow rate: 1.0 mL/min; column temperature: 25\u0026deg;C; and injection volume: 10 \u0026micro;L.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Rhizosphere soil microbial amplicon sequencing\u003c/h2\u003e \u003cdiv id=\"Sec24\" class=\"Section3\"\u003e \u003ch2\u003e2.4.1 DNA extraction and PCR amplification\u003c/h2\u003e \u003cp\u003eGenomic DNA from the rhizosphere soil of each group was extracted by the Cetyltrimethylammonium Bromide (CTAB), and the purity and concentration of the DNA was assessed by agarose gel electrophoresis. Then, appropriate amount of DNA was diluted to 1 ng/\u0026micro;L using sterile water, and employed as a template for PCR amplification of the bacterial 16S V4 and fungal ITS1-5F regions to assess the microbial diversity in the rhizosphere soil. The primer sequences used for PCR are shown in Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e2\u003c/span\u003e. A TruSeq\u0026reg;DNA PCR-Free Sample Preparation Kit was employed to construct a DNA library. The constructed library was quantified using Qubit and Q-PCR, and NovaSeq 6000 was used for sequencing.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab8\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePCR amplification region and primer sequence\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmplification region\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBacteria\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16Sv4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:GTGCCAGCMGCCGCGGTAA\u003c/p\u003e \u003cp\u003eR:GGACTACHVGGGTWTCTAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFungi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eITS1-5F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:GGAAGTAAAAGTCGTAACAAGG\u003c/p\u003e \u003cp\u003eR:GCTGCGTTCTTCATCGATGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003e2.4.2 Sequence analysis\u003c/h2\u003e \u003cp\u003eThe offline data obtained from NovaSeq high-throughput sequencing were split into sample data, and the final effective data were obtained and comprehensively analyzed by splicing filtering and removal of chimeric sequences. Uparse v7.0.1001 software was employed to perform OTU cluster analysis on the effective sequences with 97% consistency, and species annotation was performed on the representative sequences. Chao1 index, Shannon index, Simpson index, and coverage were calculated using Qiime software (version 1.9.1), and the data were processed and plotted using Excel software.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Effect of continuous cropping on the growth of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e3\u003c/span\u003e, the fresh and dry weights of the aboveground and underground plant parts of the continuous cropping group were reduced (aboveground parts: decreased by 27.1% and 30.2%, respectively; underground parts: decreased by 25.3% and 25.2%, respectively), when compared with those of the non-continuous cropping group. Furthermore, when compared with the non-continuous cropping group, continuous cropping group presented lower number of normal leaves and leaf area and higher rate of dead leaves, while the leaf length:leaf width ratio did not exhibit much difference. The underground part of the stubble of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e under non-continuous cropping was obviously more developed, characterized by thicker main roots, long roots, and multiple roots, when compared with that under continuous cropping. These results indicated that continuous cropping conditions were not conducive to the morphological growth and biomass accumulation of the aboveground and underground parts of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e, and significantly affected the overall yield of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of continuous cropping on growth index of \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e Note: Different lowercase letters in the same column indicate significant differences.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003emorphological index\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAboveground fresh weight (g / plant)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.76\u0026thinsp;\u0026plusmn;\u0026thinsp;1.17ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.90b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAboveground dry weight (g / plant)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.86\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07c\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFresh weight of underground part (g / plant)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.78\u0026thinsp;\u0026plusmn;\u0026thinsp;1.79ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.57\u0026thinsp;\u0026plusmn;\u0026thinsp;1.25b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDry weight of underground part (g / plant)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDrying rate %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e26.75\u0026thinsp;\u0026plusmn;\u0026thinsp;4.32a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24.75\u0026thinsp;\u0026plusmn;\u0026thinsp;5.85a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of normal leaves (pieces)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e31.0\u0026thinsp;\u0026plusmn;\u0026thinsp;3.67bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26.0\u0026thinsp;\u0026plusmn;\u0026thinsp;7.87c\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of dead leaves (pieces)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.5\u0026thinsp;\u0026plusmn;\u0026thinsp;3.20b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12.5\u0026thinsp;\u0026plusmn;\u0026thinsp;4.15ab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal number of leaves (pieces)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e38.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.66b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e38.5\u0026thinsp;\u0026plusmn;\u0026thinsp;4.50b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLeaf area (cm\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e217.60\u0026thinsp;\u0026plusmn;\u0026thinsp;37.94b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e183.76\u0026thinsp;\u0026plusmn;\u0026thinsp;47.86b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLeaf length / leaf width\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.33\u0026thinsp;~\u0026thinsp;1.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.22\u0026thinsp;~\u0026thinsp;1.77\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eThe longest root length (cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.45a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14.75\u0026thinsp;\u0026plusmn;\u0026thinsp;2.59b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMain root diameter (cm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of root (article)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.25\u0026thinsp;\u0026plusmn;\u0026thinsp;1.09b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Differences in the physiological indices between continuous cropping and non-continuous cropping groups\u003c/h2\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e3.2.1 Differences in the chlorophyll, soluble sugar, and sucrose contents\u003c/h2\u003e \u003cp\u003eThe contents of chlorophyll a, chlorophyll b, total chlorophyll, and carotenoids in the continuous cropping group decreased by 42.4%, 41.5%, 42.1%, and 37.0%, when compared with those in the non-continuous cropping group, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Furthermore, the contents of soluble sugar, sucrose, glucose, and fructose in the leaves and roots of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e under continuous cropping were lower than those under non-continuous cropping, and the sugar components in the leaves of group L were reduced by 65.4%, 45.0%, 35.4%, and 44.6%, when compared with those in the leaves of group F, respectively (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Besides, the contents of soluble sugar, sucrose, and fructose in the roots of group L decreased by 59.9%, 26.3%, and 31.8%, when compared with those in the roots of group F, respectively.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTable of content of sugar components in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e Note: different lowercase letters in the same column indicate significant differences; * P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003egroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003esoluble sugar(mg/g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003esucrose(mg/g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eglucose(mg/g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003efructose(mg/g)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eF- leaf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.641\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.768\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.754\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.623\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25ab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eL- leaf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.567\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.318\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.487\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.345\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eF- root\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.463\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.994\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026mdash;\u0026mdash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.825\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eL- root\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.987\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.733\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026mdash;\u0026mdash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.458\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11ab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e3.2.2 Difference in the active ingredients content\u003c/h2\u003e \u003cp\u003eIt can be seen from Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e5\u003c/span\u003e that the effect of continuous cropping on the active ingredients content of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e was specific. When compared with non-continuous cropping, continuous cropping increased the content of salvianolic acid B by 28.8% and decreased the content of rosmarinic acid by 51.4%. The contents of tanshinone I, tanshinone IIA, and dihydrotanshinone I decreased by 55.4%, 4.4%, and 100%, respectively, while that of cryptotanshinone increased by 50.0% after continuous cropping, when compared with those following non-continuous cropping. In particular, the content of dihydrotanshinone I was difficult to detect in the roots of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e after continuous cropping. These results revealed that the content of active ingredients in \u003cem\u003eS. miltiorrhiza\u003c/em\u003e significantly decreased after continuous cropping, reducing the overall quality of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe content of effective components in \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e (mg / g) Note: The content of dihydrotanshinone in group L was extremely low and did not reach the lowest value of detection.* is significant at 0.05 level, * * is 0.01 level, * * * is 0.001 level.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eactive principle\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eL\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTanshinoneⅠ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.148\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.066\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0001***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTanshinone Ⅱ\u003csub\u003eA\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.137\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.087\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCryptotanshinone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.008\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.012\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0002**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDihydrotanshinone Ⅰ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.075\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSalvianolic acid B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e12.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.082\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.170***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRosmarinic acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e5.383\u0026thinsp;\u0026plusmn;\u0026thinsp;0.045\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.617\u0026thinsp;\u0026plusmn;\u0026thinsp;0.012***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Analysis of amplicon sequencing results\u003c/h2\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e3.3.1 Sequencing data statistics and OTU analysis\u003c/h2\u003e \u003cp\u003eThe original high-throughput sequences of rhizosphere soil genomic DNA of groups F and L were spliced to obtain spliced sequences, and the effective sequences were obtained after filtering the chimeras (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e6\u003c/span\u003e). After continuous cropping of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e, the number of raw tags and effective tags decreased, while those of bacterial and fungal OTUs increased by 3.45% and 3.78%, respectively. Subsequently, cluster analysis was performed on the representative OTU sequences obtained from groups F and L, and the sequences were subjected to species annotation at six different classification levels of phylum, class, order, family, genus, and species. As shown in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e7\u003c/span\u003e, following continuous cropping, the OTU number of the soil bacterial community decreased by 0.3%, 1.67%, and 2.48% at the order, family, and genus levels, respectively, while that of the fungal community increased by 15.38%, 5.45%, and 1.67% at the phylum, order, and family levels, respectively. In addition, the fungi:bacteria ratio in continuous cropping soil showed an increasing trend, when compared with that in non-continuous cropping soil.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequencing data statistics of bacteria and fungi in rhizosphere soil of continuous and non-continuous cropping of \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e Note: Original tags\u0026thinsp;=\u0026thinsp;tag sequences obtained by splicing; effective label\u0026thinsp;=\u0026thinsp;the label sequence finally used for subsequent analysis after filtering the chimera; base\u0026thinsp;=\u0026thinsp;the base of the final valid data; effectiveness (%)\u0026thinsp;=\u0026thinsp;the percentage of the number of valid labels to the number of original PEs; oTUs\u0026thinsp;=\u0026thinsp;the number of operational taxonomic units.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eindex\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eBacteria\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eFungi\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eL group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eL group\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRaw Tags\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e83256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e82089\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e75428\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e74409\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEffective Tags\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e77993\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e76756\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e74600\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e73511\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBase(nt)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e19741183\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e19424898\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e17312674\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e16595521\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEffective (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e92.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e92.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e89.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e86.85\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOTUs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3942\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4078\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e980\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1017\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOTU statistics of bacterial and fungal communities in rhizosphere soil of continuous and non-continuous cropping of \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMicrobial type\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePhylum\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eClass\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eOrder\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFamily\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGenus\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSpecies\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBacteria\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e307\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e420\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e644\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e288\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eL group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e154\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e306\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e413\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e628\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e278\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFungi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e110\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e235\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e381\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e524\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eL group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e116\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e242\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e385\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e528\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e3.3.2 Differences in the influences of α-diversity index\u003c/h2\u003e \u003cp\u003eThe PD-whole-tree of the soil bacterial and fungal communities in groups F and L varied by 5.89% and 4.32%, respectively, indicating that the diversity of rhizosphere microbial communities significantly changed after continuous cropping (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e8\u003c/span\u003e). After continuous cropping, the Shannon index decreased by 9%, whereas the Chao1 index increased by 1.80%, implying that the rhizosphere soil bacterial diversity decreased after continuous cropping. In contrast, the Shannon and Simpson indices of the rhizosphere soil fungal community increased by 8.6% and 3.6%, respectively, after continuous cropping, when compared with those noted after non-continuous cropping, suggesting that the diversity of the soil fungal community increased and the species distribution was more uniform after continuous cropping.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 8\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of continuous cropping on the alfa diversity index of bacteria and fungi in rhizosphere soil of \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMicrobial\u003c/p\u003e \u003cp\u003etype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eShannon\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSimpson\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChao1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGoods-\u003c/p\u003e \u003cp\u003ecoverage\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePD-whole-tree\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBacteria\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.997\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4298.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.9904\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e241.0228\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eL group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e9.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.993\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4376.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.9912\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e255.2186\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFungi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.896\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1237.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.9936\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e507.4566\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eL group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.932\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1254.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.9940\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e485.54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eNote: Shannon: The total number of categories in the sample and their proportions. The higher the community diversity, the more uniform the species distribution, and the larger the Shannon index. Chao1: Estimation of the total number of species in community samples. Coverage of goods: Coverage. The higher the coverage of the sort, the larger the index. PD whole tree: the genetic relationship of species in the community. Simpson: Diversity and uniformity of species distribution in a community. The analysis used the Simpson diversity index (1-D). The better the species evenness, the greater the Simpson index.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e3.3.3 Differences in the effects of β-diversity index\u003c/h2\u003e \u003cp\u003eThe bacterial composition significantly varied between continuous and non-continuous cropping soils. Principal coordinate analysis showed the differences in the soil bacterial communities between groups F and L (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The first and second principal component axes (contribution: 22.67% and 12.71%, respectively) distinguished the soil bacterial communities between continuous cropping and non-continuous cropping groups. In addition, the first and second principal component axes (contribution: 44.01% and 28.54%, respectively) also exhibited differences in the soil fungal community composition between groups F and L (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e3.3.4 Analysis of the rhizosphere soil bacterial community structure after continuous cropping\u003c/h2\u003e \u003cp\u003eThe soil bacterial community OTUs derived from the non-continuous cropping and continuous cropping groups were analyzed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The Venn diagram showed that the number of OTUs shared by the two groups was 5747. The number of unique OTUs in the non-continuous cropping and continuous cropping groups were 1099 and 1297, respectively. With the increase in the duration of continuous cropping, some specific bacterial strains disappeared and some new strains were enriched, indicating change in the structure and composition of the soil bacterial community. There was no significant difference in the relative abundance of each dominant phylum, class, and order of the soil bacterial community in groups F and L. The dominant phyla in groups F and L were Firmicutes (17.2% and 18.1%, respectively), Proteobacteria (24.1% and 24.3%, respectively), Acinetobacter (7.2% and 7.5%, respectively), Actinobacteria (4.8% and 4.4%, respectively), and Bacteroidetes (4.9% and 4.8%, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The dominant classes in groups F and L were Clostridium (10.2% and 8.0%, respectively), Bacillus (6.3% and 9.2%, respectively), γ-Proteobacteria (13.8% and 14.2%, respectively), α-Proteobacteria (10.3% and 10.1%, respectively), and Bacteroidia (4.8% and 4.8%, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The dominant orders in groups F and L were Leptospirales (5.3% and 3.3%, respectively), Oscillospirales (3.1% and 1.8%, respectively), Lactobacillus (2.2% and 2.3%, respectively), and Rhizopus (4.2% and 4.2%, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSimper (Similarity percentage) was used to break down the Bray-Curtis difference index to quantify the contribution of each species to the difference between the continuous cropping and non-continuous cropping groups. At the family level (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), the relative abundance of Lachnospiracea and Nitrosopharacea, both of which exhibit soil nitrogen cycle function, decreased by 38.32% and 22.75%, respectively, in the rhizosphere soil of the continuous cropping group. Furthermore, the relative abundance of Erysipelotrichaceae and Ruminococcaceae decreased by 42.49% and 40.82%, respectively, while those of Staphylococcaceae, Peptostreptococcaceae, Lactobacillaceae, and Acidithiobacillaceae decreased at varying degrees in the rhizosphere soil of the continuous cropping group. At the genus level (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), the relative abundance of the dominant genera of the rhizosphere soil bacterial community in groups F and L showed significant variation after continuous cropping. In particular, the relative abundances of \u003cem\u003eStaphylococcus\u003c/em\u003e (0.3% and 2.2%, respectively), \u003cem\u003eRomboutsia\u003c/em\u003e (0.6% and 2.1%, respectively), \u003cem\u003eAcidithiobacillus\u003c/em\u003e (0.006% and 1.1%, respectively), \u003cem\u003eLeptospirillum\u003c/em\u003e (0.0006% and 1.0%, respectively), \u003cem\u003eAllobaculum\u003c/em\u003e (0.9% and 0.5%, respectively), \u003cem\u003eBlautia\u003c/em\u003e (1.3% and 0.8%, respectively), \u003cem\u003eLactobacillus\u003c/em\u003e (0.6% and 0.8%, respectively), \u003cem\u003ePseudomonas\u003c/em\u003e (1.4% and 1.0%, respectively), \u003cem\u003eRuminococcus\u003c/em\u003e (0.9% and 0.4%, respectively), and \u003cem\u003eBacillus\u003c/em\u003e (0.8% and 1.6%, respectively) significantly differed between groups F and L.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e3.3.5 Analysis of the rhizosphere soil fungal community structure after continuous cropping\u003c/h2\u003e \u003cp\u003eThe soil fungal community OTUs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) derived from the non-continuous cropping and continuous cropping groups were analyzed. The Venn diagram showed that the number of OTUs shared between groups F and L was 1356. The number of unique OTUs in the non-continuous cropping and continuous cropping groups were 968 and 1007, respectively. Furthermore, significant differences in the soil fungal community at the phylum level were observed between the groups F and L (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), and the relative abundances of the top 10 dominant phyla, including Mortiellomycota, Chytridillomycota, Zoopagomycota, Aphelidiomycota, Mucoromycota, Glomeromycota, and Blastocladiomycota, increased by 127.5%, 325.0%, 32.4%, 253.1%, 265.7%, 14.0%, and 1230.8%, respectively, while those of Ascomycota, Basidiomycota, and Rozellomycota decreased by 19.42%, 90.6%, and 30.9%, respectively, after continuous cropping.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, the dominant fungal classes in groups F and L were Sordariomycetes (37.2% and 38.7%, respectively), Mortierellomycetes (9.1% and 20.7%, respectively), Agaricomycetes (5.8% and 4.4%, respectively), Orbiliomycetes (10.4% and 6.1%, respectively), Dothideomycetes (10.2% and 4.0%, respectively), Eurotiomycetes (7.4% and 4.9%, respectively), Leotiomycetes (2.3% and 1.2%, respectively), and Tremellomycetes (1.7% and 2.6%, respectively). Furthermore, the dominant fungal orders in groups F and L were Pyrrophyta (23.7% and 16.6%, respectively), Mortierela (9.1% and 20.7%, respectively), Thesephorales (4.6% and 0.08%, respectively), Orbiliales (10.4% and 6.1%, respectively), Microscales (3.0% and 9.2%, respectively), Capnodiales (8.0% and 1.1%, respectively), Eurotiales (8.0% and 1.1%, respectively), Pleospores (7.0% and 4.6%, respectively), and Sordariales (2.0% and 2.7%, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). The cluster heatmap of species abundance (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC) revealed significant differences in species richness and composition at the family level between groups F and L. The proportion of \u003cem\u003eConiochaetacaeae\u003c/em\u003e and \u003cem\u003eConiochaetacaeae\u003c/em\u003e in the rhizosphere fungal community of continuous cropping \u003cem\u003eS. miltiorrhiza\u003c/em\u003e increased, while the proportion of \u003cem\u003eConiochaetacaeae\u003c/em\u003e and \u003cem\u003eConiochaetacaeae\u003c/em\u003e decreased.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWith the increase in the duration of continuous cropping, the structure and composition of the soil fungal community changed, and some common soil-borne pathogenic fungi, such as \u003cem\u003eLeptosphaeria turcica\u003c/em\u003e, some \u003cem\u003eCladosporium\u003c/em\u003e spp., some subspecies of \u003cem\u003eAlternaria\u003c/em\u003e, \u003cem\u003eFusarium solani\u003c/em\u003e, and other subspecies of \u003cem\u003eFusarium\u003c/em\u003e, were enriched. Based on LEfSe (LDA Effect Size) analysis, the relationship between continuous cropping and non-continuous cropping soils was further explored. The results revealed that the abundance of the microbial species in the \u003cem\u003eS. miltiorrhiza\u003c/em\u003e soil was significantly different before and after continuous cropping. A total of 30 biomarkers with LDA score\u0026thinsp;\u0026gt;\u0026thinsp;4 were enriched in the two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA), with the abundance of \u003cem\u003eMortierella\u003c/em\u003e, \u003cem\u003eLophotrichus\u003c/em\u003e, \u003cem\u003eConocybe\u003c/em\u003e, \u003cem\u003eAspergillus\u003c/em\u003e, \u003cem\u003eArthrobotrys\u003c/em\u003e, and \u003cem\u003eCladosporium\u003c/em\u003e being statistically different in the two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). \u003cem\u003eMortierella polycephala\u003c/em\u003e, \u003cem\u003eLophotrichus\u003c/em\u003e sp., \u003cem\u003eMortierella stylospora\u003c/em\u003e, and \u003cem\u003eConocybe pubescens\u003c/em\u003e were the biomarkers in the continuous cropping soil, while \u003cem\u003eMortierella alpina\u003c/em\u003e, \u003cem\u003eArthrobotrys amerospora\u003c/em\u003e, and \u003cem\u003eCladosporium\u003c/em\u003e sp. were the biomarkers in the non-continuous cropping soil.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e3.3.6 Function prediction analysis\u003c/h2\u003e \u003cp\u003eBased on the FunGuild tool, the corresponding categories of microbial ecological functions were annotated, and the statistical results are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA and B. In the soil bacterial community, plant and animal pathological nutrition functions were relatively predominant. The abundance of saprophytic bacteria was relatively low and presented only slight variation between groups F and L. These results suggested that the function of bacteria in the rhizosphere soil of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e before and after continuous cropping was similar. The abundance of internal parasitic nutritional fungi in the soil fungal community decreased, while that of saprophytic nutritional fungi significantly increased after continuous cropping. Subsequently, principal component analysis was performed on the abundance statistics results based on the database functional annotations (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC). The soil fungal functional abundance showed good separation. The first and second principal component axes (contribution: 24.3% and 18.76%, respectively) distinguished the soil fungal composition between groups F and L. In contrast, the soil bacterial functional abundance between the two groups did not exhibit good separation (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD). Therefore, it can be concluded that continuous cropping changed the function of the rhizosphere soil fungi, and that long-term continuous cropping caused the enrichment of some pathogenic fungi that gradually became the dominant groups.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e3.3.7 Correlation analysis between soil microbial species abundance and \u003cem\u003eS. miltiorrhiza\u003c/em\u003e growth index\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eS. miltiorrhiza\u003c/em\u003e root morphology and root bioaccumulation were significantly positively correlated with the relative abundances of \u003cem\u003eLecythophora\u003c/em\u003e, \u003cem\u003eAspergillus\u003c/em\u003e, \u003cem\u003eAlternaria\u003c/em\u003e, \u003cem\u003eEurotium\u003c/em\u003e, and other fungi, and the bacterium \u003cem\u003ePseudomonas\u003c/em\u003e, and were negatively correlated with \u003cem\u003eRhizophlycti\u003c/em\u003e and \u003cem\u003ePapulaspora\u003c/em\u003e. The contents of chlorophyll a, chlorophyll b, and carotenoids in \u003cem\u003eS. miltiorrhiza\u003c/em\u003e were significantly positively correlated with the relative abundances of \u003cem\u003eEurotium\u003c/em\u003e, \u003cem\u003eMacroventuria\u003c/em\u003e, \u003cem\u003eGibberella\u003c/em\u003e, \u003cem\u003eGeomyces\u003c/em\u003e, \u003cem\u003eAspergillus\u003c/em\u003e, \u003cem\u003eCladosporium\u003c/em\u003e, \u003cem\u003eArthrobotrys\u003c/em\u003e, \u003cem\u003eSolirubrobacter\u003c/em\u003e, \u003cem\u003eClostridium innocuum\u003c/em\u003e, \u003cem\u003eLysobacter\u003c/em\u003e, and \u003cem\u003eGaiella\u003c/em\u003e, but significantly negatively correlated with the relative abundances of fungi such as \u003cem\u003ePapulaspora\u003c/em\u003e, \u003cem\u003eFusicolla\u003c/em\u003e, \u003cem\u003eChaetomium\u003c/em\u003e, \u003cem\u003eSolicoccozyma\u003c/em\u003e, and \u003cem\u003eMortierella\u003c/em\u003e, and some bacteria such as \u003cem\u003eOhtaekwangia\u003c/em\u003e, \u003cem\u003eStreptomyces\u003c/em\u003e, \u003cem\u003eBacillus\u003c/em\u003e, and \u003cem\u003eLeptospirillum\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA and \u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB). In general, the microbial species abundance and community structure were significantly correlated with the root morphological accumulation and photosynthetic intensity of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"4.Discussion","content":"\u003cp\u003eContinuous cropping can significantly influence the morphological and physiological indices of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e. The development degree of roots and leaves, carbohydrate content, and active ingredients content are important indices to detect the growth and development ability of plants. The number of leaves and leaf area are related to the photosynthesis of plants and the yield of photosynthetic crops. The morphology and vitality of roots directly affect the absorption of nutrients by host plants and transport efficiency of photosynthetic products, thus affecting the growth and development of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e. Accordingly, in the present study, pot experiment with \u003cem\u003eS. miltiorrhiza\u003c/em\u003e was performed, and the results showed that the biomass of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e decreased, aboveground leaves dried up, effective leaf area decreased, and underground main roots became shorter with lower diameter after continuous cropping. The effects of continuous cropping on the physiological indices of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e included decrease in the total chlorophyll content, significant decrease in the accumulation of soluble sugar, sucrose, glucose, and fructose, increase in the content of salvianolic acid B in the water-soluble components of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e, and significant decrease in the content of rosmarinic acid. Furthermore, except cryptotanshinone, the contents of tanshinone I, tanshinone IIA, and dihydrotanshinone I decreased after continuous cropping. Furthermore, the pot experiment demonstrated that the rhizosphere soil bacterial and fungal community compositions altered after continuous cropping. The diversity of the rhizosphere soil bacterial community decreased, while that of the rhizosphere soil fungal community increased following continuous cropping. Besides, continuous cropping led to a downward trend in the soil bacteria:fungi ratio, enrichment of strong pathogenic fungi such as \u003cem\u003eAlternaria\u003c/em\u003e subspecies and \u003cem\u003eF. solani\u003c/em\u003e, and an obvious transformation of the soil into \u0026ldquo;fungal type.\u0026rdquo; The results of Spearman analysis showed a significant correlation between the rhizosphere microbial population structure and root development degree and photosynthesis intensity of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e under continuous cropping, implying that the change in the microbial population could significantly alter the nutrients transport, growth, and development of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eAfter continuous cropping of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e, the relative abundance of Actinobacteria and Bacteroidetes decreased to varying degrees, while that of Firmicutes and other oligotrophic bacteria increased, indicating that the continuous cropping system altered the rhizosphere soil environment, causing some soil microorganisms to modify their survival strategies to adapt to this change. Previous studies have shown that \u003cem\u003eMortierella\u003c/em\u003e can infect plants and cause large-scale crop infections. In the present study, at the family level, the abundance of Nitrosophaeraceae involved in soil nitrogen cycle decreased, while that of pathogenic Mortierellaceae and Cystaceae increased. These results further confirmed that the abundance and structure of soil bacterial community were affected by the continuous cropping system. The change in the soil bacterial community diversity after continuous cropping could be attributed to the decrease in the abundance of environment-friendly bacteria and increase in the abundance of pathogenic bacteria, leading to the dysfunction of rhizosphere soil microflora and more serious problem of continuous cropping obstacle. The results of the present study on the growth and physiology of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e before and after continuous cropping also confirmed this viewpoint. Furthermore, the changes in the soil fungal community composition and structure before and after continuous cropping were analyzed by ITS sequencing, and the findings showed that the continuous cropping system had significant influence on the relative abundance of the rhizosphere soil fungi at the phylum, class, order, and genus levels. The diversity index analysis showed that the soil fungal community structure significantly changed and the fungal richness and diversity significantly increased after continuous cropping. The results of cluster analysis at the genus level revealed that the abundances of \u003cem\u003eAlternaria\u003c/em\u003e (an important plant pathogenic fungus) and \u003cem\u003eFusarium\u003c/em\u003e significantly increased, and pathogenic fungi such as \u003cem\u003eF. solani\u003c/em\u003e were enriched in the rhizosphere soil of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e under continuous cropping, which may be related to the aggravation of disease after continuous cropping of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e. The increase in the abundance of pathogenic fungi to gradually become the dominant group can destroy the balance of the rhizosphere soil microecology and cause deterioration of its growth environment.\u003c/p\u003e \u003cp\u003eRhizosphere is a micro-soil area close to plant roots. As an organic combination of plant-soil-microorganisms, the micro-ecosystem formed by rhizosphere is an important part of plant-environment interaction and function \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e, which is closely related to the occurrence of continuous cropping obstacles. It is generally believed that the changes in soil nutrients, root allelochemicals, and microbial community evolution in the rhizosphere soil micro-ecological system are the main causes of continuous cropping obstacles \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. In particular, the richness and diversity of soil microorganisms can comprehensively reflect the overall changes in the soil microflora and indicate the health status of soil, especially the bacteria:fungi ratio, which is the most important feature of soil function and can be used as a key indicator to assess the process of rhizosphere micro-ecosystem \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Many studies have reported that the soil bacteria:fungi ratio is significantly affected by the cropping system \u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. For instance, Wu \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e found that the rhizosphere microflora of \u003cem\u003ePseudostellaria heterophylla\u003c/em\u003e was prone to imbalance and structural disorder under continuous monoculture conditions, which may be caused by the intervention of phenolic acids. Similarly, Yu \u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e also demonstrated that the abundance of harmful microorganisms in the rhizosphere soil increased after continuous cropping of \u003cem\u003eAsarum\u003c/em\u003e, disturbing the balance between beneficial and harmful bacteria. In general, the microbial community stability and resistance to environmental interference enhance with the increasing richness of the soil microbial diversity. Therefore, the decrease in rhizosphere bacterial richness and diversity and the increase in harmful fungal abundance may be one of the factors responsible for the poor growth of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e, and the results of the present study also confirmed this notion.\u003c/p\u003e \u003cp\u003eAt present, studies on continuous cropping obstacles of medicinal plants mainly focus on the deterioration of soil environment, allelopathic autotoxicity, rhizosphere microecological imbalance, and frequent soil-borne diseases. The dynamic changes and functional analysis of rhizosphere microbial communities of medicinal plants have become crucial for understanding the phenomenon of continuous cropping obstacles of medicinal plants. On the one hand, functional microorganisms and pathogenic fungi aggressively compete for rhizosphere ecological sites under the mediation of root exudates, and their abundance ratio can negatively affect the growth and metabolism of medicinal plants after breaking a balance point \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. On the other hand, long-term single cultivation of medicinal plants can cause continuous accumulation of the acid root exudates. Chemokines such as phenolic acids and coumarins can attract pathogenic fungi to the rhizosphere. It has been confirmed that components such as coumaric acid, benzoic acid, and saponins secreted by the roots of \u003cem\u003ePanax notoginseng\u003c/em\u003e and \u003cem\u003ePanax ginseng\u003c/em\u003e exhibit strong chemotaxis to pathogens, resulting in an increase in pathogen abundance in the rhizosphere soil with the increase in the duration of continuous cropping \u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Moreover, the acidified soil environment is more conducive to the colonization and development of the soil fungal community. Consequently, continuous cropping soil gradually transforms from the bacterial type to fungal type, and this constant imbalance of the microflora negatively affects the host plant, causing abnormal growth and development \u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. However, current research, including the present study, on the challenges related to continuous cropping of medicinal plants has mainly focused on the unilateral changes in plants and rhizosphere microenvironment after continuous cropping, ignoring the interaction among plants, root exudates, and rhizosphere microorganisms and the subsequent dynamic correlation. Hence, future studies should explore the material transformation between plant and soil rhizosphere microorganisms and clarify the factors driving the formation of rhizosphere soil microbial communities.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, the continuous cropping system significantly affected the appearance, physiological activity, and biological accumulation of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e, causing changes in the bacterial and fungal community structure and metabolic function in the rhizosphere soil. When compared with non-continuous cropping soil, the bacterial diversity decreased and the fungal diversity increased in continuous cropping soil. At the same time, the composition of bacterial and fungal communities in the rhizosphere soil under continuous cropping of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e also changed, and pathogenic fungi such as \u003cem\u003eF. solani\u003c/em\u003e were enriched. These changes might lead to further deterioration of the quality of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e. In summary, the present study systematically elucidated the effects of continuous cropping system on the growth and development of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e and rhizosphere microflora, and discussed the mechanism of continuous cropping obstacles and quality decline of Chinese medicinal materials based on rhizosphere microorganisms. The results obtained are crucial for regulating rhizosphere soil microecology and improving the cultivation of Chinese medicinal materials.\u003c/p\u003e"},{"header":"Declarations","content":" \u003ch2\u003eConflict of Interest\u003c/h2\u003e \u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e \u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by National Natural Science Foundation of China (Grant No. 82173917), National key research and development plan (2023YFC3503801) and Qilu University of Technology (Shandong Academy of Sciences) Science, Education and Industry Integration In-novation Pilot Project (Grant Nos. 2023PYI004).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eJ.J. and W.L. designed the experiments. J.J.、B.Z.、Y.M. and X.F. carried out sample collection, data analysis, and wrote the manuscript. X.W. and L.G. analyzed data. J.J., B.Z., G.Y. and W.L .assisted the experiments. All authors approved the final manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eSequence data that support the findings of this study have been deposited in the NCBl ShortRead Archive database (accession number: PRJNA1129673, PRJNA1129675).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eChang, C. C., Chang, Y. C., Hu, W. L., \u0026amp; Hung, Y. C. (2016). Oxidative Stress and \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e in Aging-Associated Cardiovascular Diseases. Oxidative medicine and cellular longevity, 2016, 4797102. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2016/4797102\u003c/span\u003e\u003cspan address=\"10.1155/2016/4797102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, H., Niu, M., Zhu, S., Zhang, F., Liu, Q., Liu, Y., Liu, R., \u0026amp; Zhang, Y. (2020). Effect Study of Continuous Monoculture on the Quality of \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e Bge Roots. BioMed research international, 2020, 4284385. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2020/4284385\u003c/span\u003e\u003cspan address=\"10.1155/2020/4284385\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, L., Wang, J., Huang, W., Wu, H., Chen, J., Yang, Y., Zhang, Z., \u0026amp; Lin, W. (2015). Plant-microbe rhizosphere interactions mediated by Rehmannia glutinosa root exudates under consecutive monoculture. Scientific reports, 5, 15871. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep15871\u003c/span\u003e\u003cspan address=\"10.1038/srep15871\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, Y., Dai, S., Wang, B., Jiang, Y., Ma, Y., Pan, L., Wu, K., Huang, X., Zhang, J., Cai, Z., \u0026amp; Zhao, J. (2020). Autotoxic Ginsenoside Disrupts Soil Fungal Microbiomes by Stimulating Potentially Pathogenic Microbes. Applied and environmental microbiology, 86(9), e00130-20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/AEM.00130-20\u003c/span\u003e\u003cspan address=\"10.1128/AEM.00130-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, H., Qin, X., Wang, J., Wu, L., Chen, J., Fan, J., Zheng, L., Tangtai, H., Arafat, Y., Lin, W., Luo, X., Lin, S., Lin, W. (2019). Rhizosphere responses to environmental conditions in radix pseudostellariae under continuous monoculture regimes. Agriculture Ecosystems \u0026amp; Environment, 270, 19\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.agee.2018.10.014\u003c/span\u003e\u003cspan address=\"10.1016/j.agee.2018.10.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, Z., Yang, L., Wang, R., Zhang, Y., Shang, Q., Wang, L., Ren, Q., \u0026amp; Xie, Z. (2015). In vitro study of the growth, development and pathogenicity responses of Fusarium oxysporum to phthalic acid, an autotoxin from Lanzhou lily. World journal of microbiology \u0026amp; biotechnology, 31(8), 1227\u0026ndash;1234. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11274-015-1872-8\u003c/span\u003e\u003cspan address=\"10.1007/s11274-015-1872-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCorato, U. D. (2020). Towards new soil management strategies for improving soil quality and ecosystem services in sustainable agriculture: editorial overview. Sustainability, 12(22), 9398. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/su12229398\u003c/span\u003e\u003cspan address=\"10.3390/su12229398\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePervaiz, Z. H., Iqbal, J., Zhang, Q., Chen, D., \u0026amp; Saleem, M. (2020). Continuous cropping alters multiple biotic and abiotic indicators of soil health. Soil Systems, 4(4), 59. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/soilsystems4040059\u003c/span\u003e\u003cspan address=\"10.3390/soilsystems4040059\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Q., Sun, H., Li, M., Xu, C., \u0026amp; Zhang, Y. (2020). Different Age-Induced Changes in Rhizosphere Microbial Composition and Function of Panax ginseng in Transplantation Mode. Frontiers in plant science, 11, 563240. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2020.563240\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2020.563240\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRousk, J., B\u0026aring;\u0026aring;th, E., Brookes, P. C., Lauber, C. L., Lozupone, C., Caporaso, J. G., Knight, R., \u0026amp; Fierer, N. (2010). Soil bacterial and fungal communities across a pH gradient in an arable soil. The ISME journal, 4(10), 1340\u0026ndash;1351. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ismej.2010.58\u003c/span\u003e\u003cspan address=\"10.1038/ismej.2010.58\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, W., Sun, D., Fu, J., Zhao, H., Wang, R., \u0026amp; An, Y. (2019). Effects of Continuous Sugar Beet Cropping on Rhizospheric Microbial Communities. Genes, 11(1), 13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/genes11010013\u003c/span\u003e\u003cspan address=\"10.3390/genes11010013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo, L., Guo, C., Wang, L., Zhang, J., Deng, L., Luo, K., Huang, H., Liu, Y., Mei, X., Zhu, S., \u0026amp; Yang, M. (2019). Negative Plant-Soil Feedback Driven by Re-assemblage of the Rhizosphere Microbiome with the Growth of Panax notoginseng. Frontiers in microbiology, 10, 1597. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2019.01597\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2019.01597\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, S., Wang, Z. Y., Niu, J. F., Dang, K. K., Zhang, S. K., Wang, S. Q., Wang, Z. Z. (2021). Changes in physicochemical properties, enzymatic activities, and the microbial community of soil significantly influence the continuous cropping of Panax quinquefolius L. (American ginseng). Plant Soil, 463, 427\u0026ndash;446. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11104-021-04911-2\u003c/span\u003e\u003cspan address=\"10.1007/s11104-021-04911-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao, J., Liu, J., Liang, H., Huang, J., Chen, Z., Nie, Y., Wang, C., \u0026amp; Wang, Y. (2018). Manipulation of the rhizosphere microbial community through application of a new bio-organic fertilizer improves watermelon quality and health. PloS one, 13(2), e0192967. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0192967\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0192967\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXin, AY., Li, XZ., Jin, H., Yang, XY., Zhao, RM., Liu, JK., Qin, B. (2018). The accumulation of reactive oxygen species in root tips caused by autotoxic allelochemicals \u0026ndash; A significant factor for replant problem of Angelica sinensis (Oliv.) Diels[J]. Ind Crop Prod, 138, 111432. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.indcrop.2019.05.081\u003c/span\u003e\u003cspan address=\"10.1016/j.indcrop.2019.05.081\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNa, XF., Ma, SL., Ma, CX., Liu, ZY., Xu, PX., Zhu, HB., Liang, WY., Kardol, P. (2021). Lycium barbarum L. (goji berry) monocropping causes microbial diversity loss and induces Fusarium spp. enrichment at distinct soil layers[J]. Appl Soil Ecol, 168, 104107. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.apsoil.2021.104107\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2021.104107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan, G., Liu, Y., Peng, S., Yin, H., Meng, D., Tao, J., Gu, Y., Li, J., Yang, S., Xiao, N., Liu, D., Xiang, X., \u0026amp; Zhou, Z. (2021). Soil potentials to resist continuous cropping obstacle: Three field cases. Environmental research, 200, 111319. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.envres.2021.111319\u003c/span\u003e\u003cspan address=\"10.1016/j.envres.2021.111319\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, Y., Chi, J., Ao, J., Gao, X., Liu, X., Sun, Y., \u0026amp; Zhu, W. (2021). Effects of Different Continuous Cropping Years on Bacterial Community and Diversity of Cucumber Rhizosphere Soil in Solar-Greenhouse. Current microbiology, 78(6), 2380\u0026ndash;2390. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00284-021-02485-x\u003c/span\u003e\u003cspan address=\"10.1007/s00284-021-02485-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuypers, M. M. M., Marchant, H. K., \u0026amp; Kartal, B. (2018). The microbial nitrogen-cycling network. Nature reviews. Microbiology, 16(5), 263\u0026ndash;276. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrmicro.2018.9\u003c/span\u003e\u003cspan address=\"10.1038/nrmicro.2018.9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBakker, P. A. H. M., Pieterse, C. M. J., de Jonge, R., \u0026amp; Berendsen, R. L. (2018). The Soil-Borne Legacy. Cell, 172(6), 1178\u0026ndash;1180. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2018.02.024\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2018.02.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin, X., Wu, H., Chen, J., Wu, L., Lin, S., Khan, M. U., Boorboori, M. R., \u0026amp; Lin, W. (2017). Transcriptome analysis of Pseudostellaria heterophylla in response to the infection of pathogenic Fusarium oxysporum. BMC plant biology, 17(1), 155. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12870-017-1106-3\u003c/span\u003e\u003cspan address=\"10.1186/s12870-017-1106-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLauber, C. L., Strickland, M. S., Bradford, M. A., \u0026amp; Fiererg, N. (2008). The influence of soil properties on the structure of bacterial and fungal communities across land-use types. Soil Biology and Biochemistry, 40(9), 2407\u0026ndash;2415. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.soilbio.2008.05.021\u003c/span\u003e\u003cspan address=\"10.1016/j.soilbio.2008.05.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePereira e Silva, M. C., Dias, A. C., van Elsas, J. D., \u0026amp; Salles, J. F. (2012). Spatial and temporal variation of archaeal, bacterial and fungal communities in agricultural soils. PloS one, 7(12), e51554. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0051554\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0051554\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, H., Xu, J., Wang, J., Qin, X., Wu, L., Li, Z., Lin, S., Lin, W., Zhu, Q., Khan, M. U., \u0026amp; Lin, W. (2017). Insights into the Mechanism of Proliferation on the Special Microbes Mediated by Phenolic Acids in the Radix pseudostellariae Rhizosphere under Continuous Monoculture Regimes. Frontiers in plant science, 8, 659. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2017.00659\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2017.00659\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu, CL., Gao, S., Sun, WS. (2022). Effects of continuous cropping on soil physical and chemical properties and rhizosphere microbial community characteristics of Asarum sibiricum. Jiangsu Agricultural Science, 50(14), 250\u0026ndash;258. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.15889/j.issn.1002-1302.2022.14.036\u003c/span\u003e\u003cspan address=\"10.15889/j.issn.1002-1302.2022.14.036\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong, LL., Niu, WH., Wang, R., Xu, J., Zhang, LJ., Zhang, J., Chen, SL. (2017). Variation of rhizosphere fungal community diversity and composition in ginseng [J]. China journal of Chinese Materia Medica, 42(3): 443\u0026ndash;449. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.19540/j.cnki.cjcmm.20161222.032\u003c/span\u003e\u003cspan address=\"10.19540/j.cnki.cjcmm.20161222.032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, B., Xia, Q., Li, Y., Zhao, J., \u0026amp; Cai, Z. (2021). Root rot-infected sanqi ginseng rhizosphere harbors dynamically pathogenic microbiotas driven by the shift of phenolic acids. Plant and Soil, 465(1\u0026ndash;2), 385\u0026ndash;402. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11104-021-05034-4\u003c/span\u003e\u003cspan address=\"10.1007/s11104-021-05034-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong, LinlinXu, JiangLi, YongFang, HailanNiu, WeihaoLi, XiwenZhang, YujunDing, WanlongChen, Shilin. (2018). Manipulation of microbial community in the rhizosphere alleviates the replanting issues in panax ginseng. Soil Biology \u0026amp; Biochemistry, 125, 64\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.soilbio.2018.06.028\u003c/span\u003e\u003cspan address=\"10.1016/j.soilbio.2018.06.028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin, X., Wu, F., \u0026amp; Zhou, X. (2020). Different toxic effects of ferulic and p-hydroxybenzoic acids on cucumber seedling growth were related to their different influences on rhizosphere microbial composition. Biology and Fertility of Soils, 56(1), 125\u0026ndash;136. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00374-019-01408-0\u003c/span\u003e\u003cspan address=\"10.1007/s00374-019-01408-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHontoria, C., Garc\u0026iacute;a-Gonz\u0026aacute;lez, I., Quemada, M., Rold\u0026aacute;n, A., \u0026amp; Alguacil, M. M. (2019). The cover crop determines the AMF community composition in soil and in roots of maize after a ten-year continuous crop rotation. The Science of the total environment, 660, 913\u0026ndash;922. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.scitotenv.2019.01.095\u003c/span\u003e\u003cspan address=\"10.1016/j.scitotenv.2019.01.095\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo, Y., Lv, J., Zhao, Q., Dong, Y., \u0026amp; Dong, K. (2020). Cinnamic Acid Increased the Incidence of Fusarium Wilt by Increasing the Pathogenicity of \u003cem\u003eFusarium oxysporum\u003c/em\u003e and Reducing the Physiological and Biochemical Resistance of Faba Bean, Which Was Alleviated by Intercropping with Wheat. Frontiers in plant science, 11, 608389. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2020.608389\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2020.608389\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Salvia miltiorrhiza, rhizosphere microorganisms, continuous cropping obstacle, high-throughput sequencing technology","lastPublishedDoi":"10.21203/rs.3.rs-4565313/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4565313/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eContinuous cropping has restricted the development of high-quality and high-yield \u003cem\u003eSalvia miltiorrhiza\u003c/em\u003e, which has become an urgent problem to be addressed. The evolution of microbial rhizosphere communities is closely related to plant growth, which may be a key factor that is aggravating obstacles to continuous cropping. Therefore, this study explored the effects of continuous cropping on the microbial rhizosphere community of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e. Methods: The effects of continuous cropping on the physiological and morphological indices of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e were evaluated by pot experiments. The V4 region of the rhizosphere bacterial 16S rDNA gene and ITS1 region of the fungal gene were sequenced by NovaSeq platform high-throughput sequencing technology to explore the effects of continuous cropping on the bacterial and fungal community structure in the rhizosphere of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e. Results: After continuous cropping, the biomass of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e decreased, the plant wilted and dwarfed, and the effective leaf area, main root length, and diameter significantly decreased. The accumulation of total chlorophyll, carbohydrates, and effective components was significantly reduced, and photosynthesis was reduced. The bacterial and fungal community composition and function in the rhizosphere soil altered significantly. The bacterial diversity in continuous cropping soil decreased, while the fungal community diversity increased, along with the emergence of pathogenic fungi such as \u003cem\u003eFusarium solani\u003c/em\u003e. Conclusion: Continuous cropping led to morphological changes, weak physiological activity, and reduced bioaccumulation of \u003cem\u003eS. miltiorrhiza\u003c/em\u003e, and affected the composition of the microbial rhizosphere community. This may be a key factor that aggravates obstacles in continuous cropping.\u003c/p\u003e","manuscriptTitle":"Effects of continuous cropping on growth and rhizosphere soil microbial community structure of Salvia miltiorrhiza Bge","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-24 12:00:58","doi":"10.21203/rs.3.rs-4565313/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"259b5eba-ebec-41a4-b459-2ee70d357098","owner":[],"postedDate":"July 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":34933763,"name":"Biological sciences/Plant sciences/Plant physiology"},{"id":34933764,"name":"Biological sciences/Plant sciences/Plant stress responses"}],"tags":[],"updatedAt":"2025-03-12T11:38:18+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-24 12:00:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4565313","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4565313","identity":"rs-4565313","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}