Shikonin triggers apoptosis in lung adenocarcinoma through FHL2-FOXO1 signaling axis

preprint OA: closed
Full text JSON View at publisher
Full text 145,697 characters · extracted from preprint-html · click to expand
Shikonin triggers apoptosis in lung adenocarcinoma through FHL2-FOXO1 signaling axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Shikonin triggers apoptosis in lung adenocarcinoma through FHL2-FOXO1 signaling axis Shiqun Chen, Meirong Zhou, Wen Zhang, Jiyong Zhong, Wenqian Han, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8119297/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Background: FHL2 is an oncogenic scaffold protein overexpressed in lung LUAD, making it a promising therapeutic target. SHK a natural naphthoquinone, exhibits anti-tumor activity, but its molecular mechanism in LUAD, particularly its relationship with FHL2, remains unclear. Aim of the study: The present study aimed to define the effects of SHK on NSCLC and identify the potential molecular mechanisms. Methods: The anti-tumor effects of SHK were evaluated in LUAD cell lines (A549, H1299) and a patient-derived xenograft (PDX) model using CCK-8, colony formation, Transwell, and flow cytometry assays. Integrated proteomics, bioinformatics, molecular docking, and cellular thermal shift assay (CETSA) were employed to identify SHK's direct target. The underlying mechanism was investigated through co-immunoprecipitation (Co-IP), Western blot, qRT-PCR, cycloheximide (CHX) chase assay, and immunofluorescence/immunohistochemistry (IF/IHC). Results: In both in vitro and PDX models, SHK potently inhibited LUAD growth, metastasis, and induced cell death. At the molecular level, FHL2 was identified as a direct target of SHK. Direct binding of SHK to FHL2 promoted its proteasomal degradation, thereby disrupting the FHL2-FOXO1 complex. The dissociation of this complex enhanced FOXO1 acetylation and promoted its nuclear translocation, leading to the subsequent activation of the caspase cascade and apoptosis. Conclusion: Our findings elucidate a novel signaling pathway through which SHK inhibits LUAD: by directly targeting FHL2 for degradation, SHK disrupts the FHL2-FOXO1 complex, which activates FOXO1-mediated transcription and triggers apoptosis. This study not only provides mechanistic insight into SHK's anti-tumor function but also nominates the FHL2-FOXO1 axis as a potential therapeutic target for LUAD. SHK FHL2 FOXO1 Lung adenocarcinoma Apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Lung cancer persists as the leading cause of cancer-related morbidity and mortality worldwide. Although recent advances in low-dose computed tomography (LDCT) screening, immune checkpoint inhibitors (ICIs), and targeted therapies have modestly improved five-year survival rates, patients with advanced lung cancer continue to face inevitable challenges of drug resistance and disease recurrence 1 . Histologically, lung cancer is broadly categorized into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), with the latter comprising adenocarcinoma, squamous cell carcinoma, large cell carcinoma, and other subtypes 2 . As the most prevalent histological form of NSCLC, lung adenocarcinoma (LUAD) presents considerable clinical challenges attributable to its marked tumor heterogeneity and unfavorable prognosis 3 . Deepened understanding of LUAD pathogenesis and the widespread clinical application of small-molecule targeted agents and programmed cell death protein 1/programmed death-ligand 1 (PD-1/PD-L1) inhibitors have contributed to progressively improved patient outcomes 4 , 5 . Nonetheless, therapeutic success remains constrained by the emergence of drug resistance and apoptotic evasion, often leading to suboptimal clinical responses. Metastasis, relapse, treatment resistance, and drug-related toxicities continue to pose major hurdles in the management of advanced LUAD 6 . Hence, there is a pressing need to develop novel diagnostic approaches and innovative small-molecule therapeutics. A deeper mechanistic understanding of LUAD progression and the discovery of molecular-level therapeutic targets are critically needed. FHL2 is a key member of the LIM-only protein family, characterized by possessing four full LIM domains and one N-terminal half-LIM domain 7 . FHL2 exhibits context-dependent and cell type-specific functions 8 , participating in processes such as muscle, bone ,and cardiac development, and serving as a biomarker for idiopathic pulmonary fibrosis (IPF) 9 – 12 . Notably, FHL2 plays a dual role in tumorigenesis, acting as either an oncoprotein or a tumor suppressor depending on the cancer type; its expression is downregulated in breast cancer and liver cancer where it suppresses tumor growth, whereas it is upregulated in lung cancer, gastric cancer, colorectal cancer, pancreatic cancer, prostate cancer, cervical cancer, and ovarian cancer, promoting tumor cell proliferation, invasion, and metastasis 13 . FHL2 lacks intrinsic DNA-binding activity, shuttles between the cytoplasm and nucleus, and regulates multiple cellular signaling pathways through interactions with various transcription factors 14 . In non-small cell lung cancer (NSCLC), studies have confirmed that FHL2 activates the Wnt/β-catenin signaling pathway, promotes epithelial-mesenchymal transition (EMT) to regulate proliferation and apoptosis, and enhances vascular permeability via the VEGFA/Akt/mTOR pathway 15 , 16 . Furthermore, FHL2 overexpression in cancer-associated fibroblasts (CAFs) promotes cancer cell migration and invasion capabilities, as well as in vitro angiogenic potential and in vivo metastatic dissemination 17 . Given its significant roles, FHL2 is increasingly recognized as a potential diagnostic and prognostic biomarker for lung cancer and a promising novel therapeutic target. Shikonin (SHK), a bioactive naphthoquinone derived from Lithospermum erythrorhizon 18 , exhibits potent antitumor activity in various cancers, including breast, gastric, and colon cancer 19 – 21 . Studies demonstrate that SHK inhibits tumor growth, progression, and metastasis through multiple pathways, such as modulating cancer cell proliferation, apoptosis, autophagy, necroptosis, and inducing immunogenic cell death (ICD) 22 , 23 . Furthermore, SHK modulates the immunosuppressive tumor microenvironment by inhibiting tumor cell glycolysis and repolarizing tumor-associated macrophages (TAMs) 24 , 25 . However, the precise molecular mechanisms underlying SHK's role in the treatment of lung adenocarcinoma (LUAD) remain incompletely defined, Particularly, the induction of apoptosis via the FHL2-FOXO1 signaling axis has rarely been reported. By integrating cellular assays with patient-derived xenograft (PDX) models, we elucidated the molecular mechanism underlying SHK-mediated suppression of LUAD. SHK exerted dose-dependent inhibitory effects on proliferation and migration, and promoted apoptosis in LUAD cells. Crucially, we identified FHL2 as the direct target of SHK through molecular docking and cellular thermal shift assay (CETSA) validation. The core mechanism involves SHK-induced disruption of the FHL2-FOXO1 interaction, resulting in increased FOXO1 acetylation and nuclear accumulation. Our study is the first to conclusively demonstrate that SHK specifically induces LUAD cell apoptosis by targeting the FHL2-FOXO1 axis, providing a strong rationale for targeting FHL2 as a novel therapeutic strategy. 2. Materials and methods 2.1. Cell culture The human NSCLC cell lines A549, NCI-H1299, NCI-H827, and NCI-H322 and BEAS-2B, HEK293T were obtained from American Type Culture Collection (ATCC). The cell culture and passage were less than 30 generations. The cell lines were cultured using ATCC recommended media. HEK293T and BEAS-2B cells were cultured in DMEM Medium with 10% FBS (Gibco), A549 cells were cultured in F-12K Medium (Hyclone) supplemented with 10% FBS (Gibco) ,NCI-H1299, NCI-H827, NCI -H358, and NCI-H322 cells were cultured in RPMI1640 Medium supplemented with 10% FBS (Gibco). Cells were maintained in a humidified atmo­sphere of 5% CO2 at 37°C. 2.2. Cell Counting Kit-8 (CCK8) assay Cells in the logarithmic growth phase were actively proliferated and seeded into a 96-well plate at a density of 5,000 cells per well to ensure consistent cell density for subsequent experiments. Subsequent to cell attachment, the cells were stimulated with varying concentrations of SHK (0, 0.5, 1.0, 2.0, 4.0, 8.0 µM) Shikonin (SHK; JOT-11729, >98%) was purchased from Chengdu Pufei De Biotech Co., Ltd (China), and dissolved in DMSO to produce a 5 mM stock solution.for 24 or 48 hours. To assess cell viability, a solution containing 10% Cell Counting Kit-8 (CCK-8) was added to each well, followed by an additional 2-hour incubation. The optical density was then measured at 450 nm using a microplate reader (PerkinElmer, Waltham, MA, USA). 2.3. Cell colony formation assay The anti-proliferative effect of SHK on lung adenocarcinoma cells was assessed using a standardized colony formation assay. Logarithmically growing A549 and H1299 cells were seeded into 6-well plates at a density of 500 cells. After 12 hours of adherence, cells were treated with SHK for 24 hours. Following treatment, the drug-containing medium was aspirated, and cells were gently washed twice with PBS before replenishing with 2 mL of drug-free complete medium. Plates were incubated for 10–14 days at 37°C under 5% CO₂ to allow colony formation. Colonies were fixed with 4% paraformaldehyde (PFA, Sigma-Aldrich) for 30 minutes, and stained with 0.1% crystal violet (Beyotime Biotechnology) for 1 hour at room temperature. photographed with an ordinary camera. 2.4. Transwell assay Transwell migration assays were conducted using Corning chambers. A549 and H1299 cells were subjected to 6-hour serum starvation and subsequently seeded at a density of 1×10⁵ cells/200 µL into the upper chambers, which contained graded concentrations of SHK. The lower chambers were loaded with 600 µL of medium supplemented with 10% FBS to serve as a chemoattractant. After 48 hours of incubation at 37°C in a 5% CO₂ atmosphere, cells that had traversed the membrane were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. Microscopic images were obtained at 10× magnification, and cell migration was quantified by measuring the area of crystal violet staining. 2.5. Western blot assay Treated cells or tissues were lysed using RIPA lysis buffer (Beyotime Biotechnology Co., Ltd., Shanghai, China) supplemented with protease inhibitor PMSF and phosphatase inhibitor cocktail, followed by centrifugation to collect the supernatant for protein quantification using a Bicinchoninic Acid (BCA) Protein Assay Kit (Beyotime Biotechnology Co., Ltd.). Proteins were separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). Membranes were blocked with 5% skim milk for 1 hour, then incubated with primary antibodies at 4°C overnight, followed by 1-hour incubation with secondary antibodies at room temperature. After TBST washing, protein signals were detected using Western Bright ECL substrate (Tanon Science and Technology Co., Ltd., Shanghai, China), e protein levels were determined using Image J software. Antibodies used in this study were as follows: MMP9 (60600-1-Ig Proteintech 1:1000), PCNA (10205-2-AP Proteintech 1:2000), cleaved-PARP (60555-1-lg Proteintech 1:2000 ), cleaved caspase-3 (25128-1-AP Proteintech 1:1000),Bcl-2 (60178-1-Ig Proteintech 1:1000), BAX (50599-2-Ig Proteintech 1:1000), FOXO1 (HUABIO ET1608-25 1:2000) ,FHL2 ( abcam ab202584 1:1000),Secondary antibody was used: Anti-mouse or Anti-rabbit IgG, 1:5000 dilution. 2.6. Quantitative RT‑PCR Total RNA was extracted from [Specify tissue/cell type] with TRIzol reagent (Hunan Aikerui Bioengineering Co., Ltd., China) according to the manufacturer's instructions. Complementary DNA (cDNA) was then synthesized from the RNA samples using the RevertAid First Strand cDNA Synthesis Kit (MonAmp, China). Quantitative real-time PCR (qRT-PCR) analyses were conducted on a CFX 96 Real-Time PCR Detection System (Bio-Rad, USA) using Power SYBR Green Master Mix (MonAmp, China) to quantify mRNA expression levels. All data were normalized to the expression of β-actin as an internal reference, and the relative gene expression was calculated using the 2^(−ΔΔCT) method. The primers were as follows: FHL2-F, CTGGAGACTAGGCTGGCATT; FHL2-R, CCGTGGTGATGGGCTTTTTG; FOXO1-F, AGGGTTAGTGAGCAGGTTACAC; FOXO1-R, CTGCCCCAAATACCTGTGGT. 2.7. Flow cytometry assay Apoptotic cell proportions were assessed using flow cytometry with instruments supplied by BD Biosciences (Shanghai, China). To evaluate apoptotic rates, A549 and H1299 cells treated with various concentrations of SHK were harvested using EDTA-free trypsinization, stained with Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI), and quantitatively analyzed by flow cytometry. The Annexin V-FITC/PI Apoptosis Detection Kit (KGA 108) was purchased from KeyGEN BioTECH Co., Ltd. (Nanjing, Jiangsu Province, China).It was detected and analyzed by by flow cytometry (BD)software. 2.8.siRNA interference assay A549 and H1299 cells were seeded in 6-well plates and transfected at 50–60% confluence. Prior to transfection, Lipofectamine™ 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA) was mixed with 5 µL siRNA. The mixture was added dropwise to target cells. After 6 hours, the transfection medium was replaced with complete growth medium supplemented with 10% fetal bovine serum (FBS). Cells were harvested at 48 hours post-transfection for mRNA expression analysis by quantitative reverse transcription PCR (RT-qPCR) and protein detection by Western blotting.The siRNA sequences used in this study were: Sense: 5′-GCAGCCAAUUGGAACCAAGTT-3′ Antisense: 5′-CUUGGUUCCAAUUGGCUGCTT-3′. 2.9. Transient Transfection and Establishment of stable cell lines. 293T cells were seeded in 10-cm dishes for 24 h. Prior to transfection, medium was replaced with serum-free DMEM. Recombinant plasmids encoding Flag-FHL2 or FOXO1-HA were transfected using polyethylenimine (PEI, Polysciences, Warrington, PA) at a DNA:PEI ratio of 1:3. After 8-h incubation, medium was replaced with complete medium containing 10% FBS. Cells were cultured for an additional 48 h and harvested for target protein validation by Western blotting. For stable cell line establishment, lentiviral packaging was performed by co-transfecting 293T cells with the recombinant plasmid along with packaging plasmids psPAX2 (Addgene, Cambridge, MA) and pMD2.G (Addgene) using polyethylenimine (PEI). Following 48-hour transfection, viral supernatants were harvested, filtered through 0.45-µm membranes, and used to infect A549 and H1299 cells with 50% (v/v) viral supernatant-containing medium supplemented with 8 µg/mL polybrene for 24 hours; stable clones were subsequently selected with puromycin-containing medium (pre-optimized concentration 2–5 µg/mL) for 10–14 days with medium replenishment every 48 hours. 2.10. CHX assays Cells were pretreated with SHK at a final concentration of 1 µM for 24 h. CHX was added to the culture medium at a concentration of 50 µg/mL, and cells were collected at 0, 3, 6, and 9 h. The samples were centrifuged at 4°C. The supernatants were mixed with loading buffer and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blotting. 2.11. CETSA A549 cell lysates were collected and equally divided into two aliquots, which were treated with DMSO or SHK, respectively, followed by incubation at room temperature for 2 h. The suspensions were aliquoted, heated in a PCR machine at specified temperatures (39–60°C) for 4 min, and then cooled at room temperature for 5 min. The samples were centrifuged at 20,000 × *g* for 15 min at 4°C. The supernatants were mixed with loading buffer and separated by SDS-PAGE for subsequent immunoblotting analysis of FHL2. 2.12. Co-immunoprecipitation (CO-IP) assay For immunoprecipitation, 600 µg of total protein was diluted to 500 µL using binding buffer. Experimental samples were incubated with 2 µg of anti-Flag, anti-HA, or anti-FOXO1 antibodies, while control samples received 2 µg species-matched IgG. Following 1-h vortexing at 4°C, 15 µL of pre-washed Protein G magnetic beads were added, and incubation was continued overnight with gentle agitation. Magnetic separation was subsequently performed: supernatants were discarded and beads were washed thrice with 500 µL ice-cold binding buffer. Bound proteins were eluted in 50 µL 2× Laemmli buffer through boiling at 95°C for 10 min. Eluates were collected after final magnetic separation for Western blot analysis. 2.13. Immunofluorescence (IF) and Immunohistochemistry (IHC) . Place A549 and NCI-H1299 cells in the logarithmic growth phase on glass slides. After the cells have adhered, treat them with SHK for 48 hours. Wash the cells with phosphate-buffered saline (PBS) to remove residual culture medium. Fix the cells with paraformaldehyde, then wash with PBS three times. Treat the cells with 0.1% Triton X-100 for 30 minutes, followed by blocking with 5% bovine serum albumin (BSA) at room temperature for 1 hour. Incubate with anti-FHL2 primary antibody (1:300) and anti-FOXO1 primary antibody (1:100) overnight at 4°C. Incubate with Alexa Fluor 594-labeled secondary antibody (1:200) at room temperature for 1 hour, followed by DAPI staining. Finally, capture images using a fluorescence microscope. Immunohistochemical analysis was performed on 4–6 µm paraffin-embedded sections. Tissue sections were dewaxed in xylene and rehydrated through a graded ethanol series. Endogenous peroxidase activity was blocked by 20-min incubation with 3% hydrogen peroxide at room temperature. Antigen retrieval was subsequently conducted in 10 mM citrate buffer (pH 6.0) using microwave irradiation for 20 min. Sections were incubated overnight at 4°C with primary antibodies in a humidified chamber. Following PBS washes, specimens were treated with species-appropriate biotinylated secondary antibodies for 1 h at room temperature. Visualization was achieved using the ABC Elite Kit with DAB chromogen. Counterstaining was performed with Mayer's hematoxylin for 45 sec, followed by dehydration through ascending ethanol concentrations and xylene clearance. Slides were permanently mounted with resinous mounting medium. Images were acquired using bright-field microscopy (Nikon Eclipse E200, 20× objective). 2.14. Molecular Docking analysis The X-ray crystallographic structures of FHL2 (PDB ID: 2MIU) and ID1 (PDB ID: 2P57) were retrieved from the Protein Data Bank (PDB, https://www.rcsb.org ). The three-dimensional structure of SHK was obtained from the PubChem database ( https://pubchem.ncbi.nlm.nih.gov ) and converted to Mol2 format using OpenBabel GUI (version 3.1.1). Protein structures were preprocessed with PyMOL (version 2.60) by removing water molecules, metal ions, and bound ligands. Hydrogen atoms and Gasteiger charges were added to both proteins and SHK using AutoDockTools (version 1.5.7). Grid parameters were defined to encompass the putative binding sites, with grid box dimensions set to 60 × 60 × 60 Å and a spacing of 0.375 Å.Molecular docking was performed using the Lamarckian genetic algorithm (LGA) with default parameters (energy evaluations:50). The resulting docking poses were visualized and analyzed in PyMOL to evaluate binding modes, hydrogen bonding, and hydrophobic interactions. 2.15. Develop a PDX model to assess the therapeutic effectiveness of SHK Patient-derived tumor tissues were obtained from The First Affiliated Hospital of Dalian Medical University with written informed consent. All procedures involving human specimens were approved by the Institutional Ethics Committee (Approval No. PJ-KS-KY-2025-431) and were conducted in strict compliance with the Declaration of Helsinki. Fresh lung adenocarcinoma specimens were subcutaneously implanted into the axillary region of 6-week-old male NYG mice (Vital River Laboratories, Beijing, China) within 2 hours after resection under specific pathogen-free (SPF) conditions. All animal experiments were approved by the Animal Ethics Committee of Dalian Medical University (Approval No. XL250619069). Tumor growth was monitored weekly using caliper measurements. When tumor dimensions reached approximately 1.5 × 1.5 cm, the mice were euthanized by cervical dislocation under isoflurane anesthesia. Harvested tumors were subsequently passaged into secondary BALB/c nude mice (6-week-old). Tumors that achieved successful engraftment (volume > 200 mm³) were randomly assigned (n = 5 per group) to receive either SHK (2.5 or 5 mg/kg) or vehicle control (saline), administered intraperitoneally every other day for 14 consecutive days. Tumor volume was calculated using the formula: V = (length × width²)/2. Humane endpoints were strictly observed, and mice were euthanized either when the tumor volume exceeded 1,800 mm³ or upon reaching the predefined experimental endpoint. All excised tumor tissues were processed for immunohistochemical analysis. 2.16 .Data analysis GraphPad Prism software (version 9.5.1; GraphPad Software, USA) was utilized for all statistical analyses. All experiments included at least three independent biological replicates, and data are reported as mean ± SEM. For comparisons between two groups, a two-tailed Student's t-test was applied; for comparisons across multiple groups, one-way ANOVA was employed. Statistical significance was assigned according to the following thresholds: *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001. 3. Results 3.1. SHK Inhibits LUAD Cell Proliferation and Migration in Cellular and PDX Models The effects of SHK on the viability of LUAD cell lines (A549, H322, H827, H1299) and normal bronchial epithelial cells (BEAS-2B) were evaluated using the CCK-8 assay. SHK was found to significantly inhibit the survival of LUAD cells in a dose- and time- dependent manner, with tumor cells exhibiting greater sensitivity than BEAS-2B cells (Fig. 1A). Based on drug sensitivity analysis, H1299 and A549 cells were selected for further investigation. Similarly, colony formation assays demonstrated that SHK reduced both colony number and diameters compared to the control (Fig. 1B). Transwell invasion assays further revealed a concentration-dependent decrease in Matrigel-invading cells upon SHK treatment (Fig. 1C). Furthermore, western blot analysis also confirmed that SHK downregulated the proliferation marker PCNA and the metastasis-associated protein MMP-9 in a concentration-dependent manner (Fig. 1D-E). In addition, to evaluate SHK’s efficacy in vivo, a PDX model was established using tumor tissue from a stage IIB (pT2N1M0) LUAD patient (UICC 9th edition TNM staging). Following intraperitoneal SHK administration (2.5 or 5 mg/kg every other day for 14 days), tumor volume and weight were significantly reduced compared to controls (Fig. 1F–I), without affecting mouse body weight (Fig. 1J). Western blot and immunohistochemical (IHC) analyses of PDX tissues showed decreased expression of the proliferation markers (PCNA and Ki-67), and the migration marker MMP-9 in SHK-treated groups (Fig. 1K–L), aligning with in vitro findings. Collectively, these data demonstrate that SHK exhibits potent anti-LUAD effects in both cellular and animal models, with minimal toxicity. 3.2. SHK Promotes Apoptosis in LUAD Cells In Vitro and In Vivo To identify potential targets of SHK, we performed thermal proteome profiling (TPP) 26 and stable isotope labeling (SIP) 27 , screening 22 candidate proteins(Figs. 2.1A-B). GO enrichment analysis of biological process showed significant enrichment in the "negative regulation of apoptotic process (relative gene: PRDX5, ID1, FHL2, PDE3A, and SQSTM1)" (P < 0.01) (Fig. 2.1C), indicating that SHK may exert its anti-LUAD effects primarily through modulation of apoptotic pathways. This was further supported by experimental evidence: (1) Flow cytometry demonstrated SHK treatment (48 h) induced concentration-dependent apoptosis in A549 and H1299 cells (Fig. 2.1D-E); (2) Western blot analysis showed SHK upregulated pro-apoptotic proteins (cleaved-PARP, cleaved caspase-3, BAX) while downregulating anti-apoptotic proteins (Pro-PARP, Pro-caspase-3, Bcl-2) in both A549 cells and PDX tumors (Fig. 2.1F-H); (3) Quantitative analysis of TUNEL staining revealed a significant increase in apoptotic cell death in the SHK-treated group(Fig. 2.2A) ;and (4) Quantitative IHC confirmed increased BAX and decreased Bcl-2 expression in high-dose SHK-treated PDX tissues (Fig. 2.2B). These consistent findings across cellular and animal models demonstrate that SHK induces LUAD cell apoptosis through coordinated regulation of apoptotic networks. 3.3. FHL2 is the principal target mediating SHK's pro-apoptotic effects in LUAD To further investigate the molecular mechanism of SHK-triggered apoptosis, we analyzed the relationship between the potential target protein (PRDX5, FHL2, ID1, PDE3A and SQSTM1) and the prognosis of patients using the TCGA database ( https://portal.gdc.cancer.gov/ ). Expression profiling demonstrated that FHL2 and SQSTM1 levels were significantly elevated in LUAD tissues relative to adjacent normal tissues. In contrast, PRDX5 and ID1 expression was markedly downregulated, while PDE3A levels remained unaltered (Fig. 3A). Prognostic analysis via GEPIA2 ( http://gepia2.cancer-pku.cn/ ) demonstrated that only ID1 and FHL2 was significantly associated with patients’ outcomes (Fig. 3B). Given that SHK mediates apoptosis by regulating genes that negatively regulate apoptosis (Fig. 2A), while the paradoxical role of ID1 in NSCLC and its inconclusive function in regulating therapeutic responses to anticancer agents have been established 28 – 30 , elevated FHL2 expression predicts adverse clinical outcomes 31 . These findings indicate that FHL2 may serve as a novel therapeutic target for SHK to trigger caspase-dependent apoptosis in LUAD. Clinical sample validation further revealed that both FHL2 mRNA and protein levels were significantly elevated in LUAD tissues compared to adjacent normal tissues (Fig. 3C-D). Flow cytometry analysis revealed that either FHL2 silencing alone or SHK treatment significantly induced apoptosis in A549 and H1299 cells (Fig. 3E-J). However, the combined intervention did not further enhance the apoptotic rate, suggesting that SHK-mediated tumor cell apoptosis is dependent on FHL2. 3.4. SHK targets the FHL2 protein and promotes FHL2 degradation. To further elucidate the molecular mechanism through which SHK induces apoptosis in LUAD via FHL2, we next examined SHK's effect on FHL2 expression. Treatment of A549 and H1299 cells with increasing SHK concentrations resulted in a dose-dependent reduction in FHL2 protein levels (Fig. 4A-B). Further reduction of intracellular FHL2 protein expression by SHK was confirmed by IF (Fig. 4C-D), while FHL2 mRNA expression remained unaffected (Fig. 4E-F). These in vitro findings were corroborated in the LUAD PDX model, where SHK treatment significantly decreased FHL2 protein expression and IHC staining intensity without altering FHL2 mRNA levels (Fig. 4H-I). The results indicated that SHK might promote FHL2 protein degradation. To validate this hypothesis, we treated H1299 cells with cycloheximide (CHX), a protein synthesis inhibitor. Strikingly, SHK treatment markedly accelerated FHL2 protein degradation in CHX-treated cells, consistent with decreased protein instability (Fig. 4J). The TPP and SIP results implied a physical interaction between SHK and FHL2 (shown in Fig. 2A). CETSA analysis further confirmed that SHK treatment markedly changed the thermal stability of FHL2 protein in A549 cell lysates (Fig. 4K), suggesting a potential interaction between SHK and FHL2. Based on these experimental findings, we performed computational modeling to predict the structural basis of their molecular interaction. The molecular docking predicted that SHK was bound to the FHL2 protein with a binding energy of – 7.16 kcal/mol, with hydrogen bond interactions formed with Glu41, Trp61, Lys83, and Gln86 (Fig. 4L). Collectively, these results demonstrate that SHK promotes lung adenocarcinoma cell apoptosis by modulating FHL2 protein stability rather than its transcriptional regulation. 3.5. SHK reduces the interaction between FOXO1 and FHL2 Due to its unique structural characteristics, the FHL2 protein participates in cellular processes by interacting with various proteins (including transcription factors), and exhibits specific environment-dependent effects in different cancers. To explore whether SHK influences FHL2 stability—potentially by disrupting its interactions with other proteins—we first employed the STRING database ( https://string-db.org ) and the GeneMANIA platform ( https://genemania.org ) to predict FHL2-interacting proteins. Notably, the intersection of both analyses identified FOXO1 and SIRT1 as key candidates (Figs. 5A-C). However, the database prediction revealed a direct interaction between FHL2 and FOXO1, while FHL2 and SIRT1 had an indirect interaction due to FOXO1 (Fig. 5D). Therefore, we hypothesize that SHK may disrupt the FHL2-FOXO1 interaction, thereby destabilizing the FHL2 protein and subsequently inducing cell apoptosis. To test this hypothesis, we established Flag-FHL2-overexpressing A549 and H1299 cell lines. Co-immunoprecipitation (Co-IP) assays confirmed a robust interaction between FHL2 and FOXO1, which was significantly attenuated by SHK treatment (Figs. 5E-F). Furthermore, in HEK293T cells co-expressing Flag-FHL2 and HA-FOXO1, Co-IP experiments again demonstrated the FHL2-FOXO1 interaction and its inhibition by SHK (Fig. 5G). Collectively, these results demonstrate that SHK interferes with FHL2-FOXO1 complex formation, ultimately promoting apoptotic cell death. To further elucidate the molecular mechanism by which SHK disrupts the FHL2/FOXO1 complex, we expressed Flag-FHL2 and HA-FOXO1 separately in HEK293T cells. After pre-incubating SHK with Flag-FHL2, we continued to incubate with HA-FOXO1. The immunoprecipitation results showed that SHK significantly reduced the interaction between FHL2 and FOXO1. Conversely, after pre-incubating SHK with HA-FOXO1 and then incubating with Flag-FHL2, the immunoprecipitation results indicated that the inhibitory effect of SHK on the interaction between FHL2 and FOXO1 disappeared (Figs. 5H-I). These results collectively demonstrate that SHK specifically targets FHL2 protein, thereby effectively disrupting the formation of the FHL2-FOXO1 complex. 3.6. SHK Up-regulates FOXO1 Expression and Induces Apoptosis in Lung Adenocarcinoma FOXO1, a critical member of the FOXO transcription factor family, plays a pivotal role in maintaining cellular homeostasis by regulating the balance between cell proliferation and apoptosis. Dysregulation of FOXO1 has been strongly implicated in tumorigenesis. To investigate the potential involvement of FOXO1 in SHK’s anti-cancer effects, we examined its expression following SHK treatment. As shown in (Figures 6A–B), SHK treatment did not significantly alter FOXO1 mRNA levels in A549 and H1299 cells. However, Western blot analysis revealed a dose-dependent increase in FOXO1 protein expression with rising SHK concentrations (Figs. 6C–D). Consistent with these findings, qPCR analysis of PDX model mouse tissues showed no notable change in FOXO1 mRNA expression (Fig. 6E). In contrast, both Western blot and immunohistochemical (IHC) staining demonstrated elevated FOXO1 protein levels in SHK-treated tumor tissues compared to controls (Figs. 6F–G). These results suggest that SHK suppresses lung cancer growth by upregulating FOXO1 at the protein level, rather than through transcriptional regulation. Previous studies indicate that the FHL2/FOXO1 complex formation attenuates FOXO1 acetylation and reduced intracellular level of FOXO1, ultimately suppressing apoptosis in cancer cells 32 , 33 . In non-small cell lung cancer (NSCLC), reduced nuclear translocation of FOXO1 has been shown to alleviate tumor cell apoptosis 34 . Our present data demonstrate that SHK effectively disrupted the formation of the FHL2-FOXO1 complex. To investigate the functional outcomes of SHK-mediated complex disruption, we examined the molecular and phenotypic changes in FOXO1 following SHK treatment. We next assessed FOXO1 acetylation levels. As shown in ( Figs. 6H-I ) SHK treatment significantly enhanced FOXO1 acetylation. Nuclear fractionation assays demonstrated markedly increased FOXO1 nuclear translocation following SHK treatment (Figs. 6J-K. These findings were further corroborated by immunofluorescence analysis (Figs. 6L-M). Together, these results demonstrate that SHK disrupts the FHL2-FOXO1 complex, elevates FOXO1 acetylation, promotes its nuclear translocation, and consequently induces apoptosis to inhibit lung cancer growth. 4. Discussion Traditional Chinese Medicine (TCM) has demonstrated favorable efficacy in treating cardiovascular, cerebrovascular, digestive, and respiratory system diseases, as exemplified by the application of artemisinin for malaria treatment 35 ; consequently, the active constituents derived from natural products are receiving increasing attention, rendering it imperative to thoroughly explore their pharmacological mechanisms. SHK, a compound derived from the Lithospermum erythrorhizon has been primarily investigated for its effects on inflammation and cancer 18 , with its potent anti-cancer activity having been validated across a broad spectrum of malignancies, where it exerts anti-tumor effects through mechanisms including modulation of reactive oxygen species (ROS) levels 36 , inhibition of the NF-κB signaling pathway 21 , or activation of p53-dependent apoptotic pathways 37 . In this study, it was demonstrated that SHK induces apoptosis in lung adenocarcinoma cells both in vitro and in vivo by targeting FHL2, thereby influencing the formation of the FHL2-FOXO1 complex and enhancing the acetylation level of FOXO1. In malignant tumors, the inhibition of apoptotic pathways confers a survival advantage to cancer cells, representing a key mechanism underlying tumor resistance and recurrence 38 , 39 . Conventional cancer therapies, such as chemotherapy and radiotherapy, aim to induce cancer cell apoptosis. However, many cancer cells exhibit intrinsic or acquired resistance to these treatments or harbor defects in apoptotic pathways. Apoptosis, a programmed cell death process, primarily occurs through two pathways: the mitochondria-mediated intrinsic pathway and the death receptor-mediated extrinsic pathway. The intrinsic pathway is predominantly regulated by the Bcl-2 protein family, where the interaction between the anti-apoptotic member Bcl-2 and the pro-apoptotic member Bax modulates mitochondrial outer membrane permeabilization (MOMP), leading to the release of cytochrome c (Cyto c) into the cytosol. Released Cyto c activates caspase-9, which subsequently cleaves and activates the downstream effector caspase-3 40,41 . The extrinsic pathway is initiated by the binding of death receptors to their ligands, ultimately also resulting in caspase-3 activation and execution of apoptosis. Poly(ADP-ribose) polymerase (PARP) exhibits a unique biphasic role in apoptosis regulation. Under conditions of mild DNA damage, PARP promotes cell survival by initiating the base excision repair pathway 42 . Conversely, when DNA damage exceeds cellular repair capacity, hyperactivation of PARP triggers the apoptotic program 43 . In this study, flow cytometry initially confirmed that SHK significantly promotes tumor cell apoptosis. Further validation using Western blot and IHC demonstrated that SHK upregulates the expression levels of key pro-apoptotic proteins. These findings collectively indicate that SHK exerts its anti-tumor activity by inducing tumor cell apoptosis. Building on previous work where TPP and SIP were used to identify SHK target proteins, bioinformatics analysis and molecular docking were employed to screen FHL2 as the target mediating SHK-induced apoptosis ( Figs. 2A-C). In LUAD patients, FHL2 protein expression was found to be significantly higher than in normal tissues, and its expression level was negatively correlated with patient survival time 17 , 31 , 44 , consistent with the results obtained from our clinical samples (Figs. 3C-D). Previous research has utilized in vitro FHL2 knockdown to inhibit cancer cell migration, invasion, and angiogenesis, and to induce apoptosis, as well as to suppress metastatic dissemination in vivo 15 . However, the clinical application of this genetic approach remains largely unexplored. Targeting FHL2 protein expression pharmacologically, particularly in combination with TCM-based therapies like SHK, represents a novel avenue for LUAD treatment and holds profound significance for discovering new molecularly targeted therapies. In this study, Western blot analysis revealed that FHL2 protein expression was significantly downregulated following SHK treatment both in vitro and in vivo, whereas no alteration was observed at the transcriptional level. The promotion of FHL2 protein degradation by SHK was further confirmed by CHX chase assays(Figs. 4 ). Knockdown of FHL2 was found to promote tumor cell apoptosis; however, no additive apoptotic effect was observed when SHK was administered to FHL2-knockdown cells (Figs. 3I-G). Collectively, these results establish FHL2 as the critical direct binding target through which SHK-mediated apoptosis and tumor growth suppression are exerted. A limitation of this study is that the specific pathway responsible for FHL2 degradation was not further explored. The LIM domain, a cysteine-rich zinc finger motif, facilitates protein-protein interactions 45 . FHL2, through interactions with other cellular proteins, participates in regulating vital cellular functions, including gene expression, signal transduction, cell adhesion, proliferation, and survival 46 . Within the prostate, FHL2 suppresses FOXO1 activity in prostate cancer cells by facilitating the deacetylation of FOXO1 through enhancement of the interaction between SIRT1 and FOXO1, thereby inhibiting tumor cell apoptosis 32 . Furthermore, FOXO1 deacetylation has been associated with increased ubiquitination and subsequent decreased expression within the cell, conversely, suppression of deacetylation promotes its nuclear accumulation 34 , 47 . Knockdown of the FHL2 gene has been reported to increase FOXO1 expression within the nucleus 48 .Therefore, reducing FHL2-FOXO1 complex formation may represent a novel therapeutic strategy for improving survival outcomes in LUAD patients. In this study, Co-IP assays confirmed that SHK disrupts FHL2-FOXO1 complex formation in vitro (Figs. 5E-I). Nuclear accumulation of FOXO1 was observed, and subcellular fractionation assays confirmed that FOXO1 expression in the nucleus was increased by SHK treatment, We speculate that the apoptotic mechanism of SHK in the treatment of lung adenocarcinoma is as follows (Fig. 7).FOXO1, a crucial member of the FOXO family, acts as a transcription factor. Its dysregulation disrupts the balance between cell proliferation and death and is closely associated with tumorigenesis. FOXO1 undergoes diverse post-translational modifications, including phosphorylation, methylation, acetylation, and ubiquitination, and interacts with multiple signaling pathways such as PI3K/Akt, EZH2/STAT3, JAK/STAT3, MAPK/ERK, Wnt/β-catenin, and NF-κB/Snail, thereby regulating tumor cell proliferation, apoptosis, and progression 49 . Recent reports highlight FOXO1's role in limiting CAR T cell exhaustion and enhancing anti-tumor activity 50 , 51 . Multiple studies have found decreased FOXO1 expression in various solid tumors 52 , FOXO1 can induce apoptosis in human LUAD cells by upregulating its target gene Bim via the PI3K/Akt pathway 53 , Cinobufagin induces FOXO1-regulated apoptosis,by inhibiting G9a in non-small-cell lung cancer A549 cells 52 . Consequently, elevating FOXO1 expression in tumor cells can inhibit proliferation. FHL2 is aberrantly overexpressed in LUAD and correlates with poor prognosis, while low FOXO1 expression is associated with reduced 5-year survival rates, suggesting that their reciprocal expression pattern may serve as a novel prognostic biomarker. This study confirmed the FHL2-FOXO1 interaction and demonstrated that SHK reduces complex formation. FOXO1 protein expression decreased in cells overexpressing FHL2 but increased upon SHK treatment. Immunofluorescence assays further confirmed increased nuclear accumulation of FOXO1. The elevated expression of FOXO1 protein promoted tumor cell apoptosis, which was validated in this study. 5. Conclusion In conclusion, our study demonstrates that SHK significantly inhibits lung adenocarcinoma (LUAD) growth both in vitro and in vivo. Mechanistically, SHK targets FHL2 to disrupt FHL2-FOXO1 complex formation, promoting FHL2 degradation while enhancing FOXO1 acetylation and nuclear translocation. These changes activate the downstream caspase signaling cascade, inducing cellular apoptosis and ultimately suppressing tumor growth. Our findings elucidate the molecular mechanism of SHK-mediated LUAD inhibition through the FHL2-FOXO1 signaling axis, not only providing a novel theoretical foundation for its clinical application but also offering new perspectives for developing therapeutic drugs targeting this pathway in LUAD treatment. Declarations Declaration of Competing Interest The author declares no conflict of interest. Author contributions Shiqun Chen : Writing - original draft, Investigation. Meirong Zhou : Data curation. Wen Zhang : Methodology, Formal analysis. Jiyong Zhong : Formal analysis. Wenqian Han : Software,Methodology. Zhaoxuan Wang : Methodology, Software. Shiqing Wang : Resources, Project administration. Chundong Gu : Data curation, Conceptualization. Zhenlong Yu : Writing e review & editing, Supervision. Shilei Zhao : Writing - review & editing, Supervision, Funding acquisition. Acknowledgments This study was supported by the Liaoning Provincial Science and Technology Program Joint Plan (Natural Science Foundation-General Program, Grant No. 2024-MSLH-087), the Dalian Science and Technology Innovation Fund Project (Grant No. 2022DF040), and the Postdoctoral Fellowship Program of CPSF (Grant No. GZB20250895). Data Availability All relevant data are presented in the manuscript and its Supplementary Information. The source data underlying the figures, including raw values for statistical analyses, are provided as a Source Data file. Uncropped scans of all blots and original microscopy images have been included as part of the Supplementary Information. Full datasets are permanently archived and available from the corresponding author upon request. References Leiter A, Veluswamy RR, Wisnivesky JP. The global burden of lung cancer: current status and future trends. Nat Rev Clin Oncol. 2023;20:624–39. Hendriks LEL, et al. Non-small-cell lung cancer. Nat Rev Dis Primers. 2024;10:71. Wang M, Herbst RS, Boshoff C. Toward personalized treatment approaches for non-small-cell lung cancer. Nat Med. 2021;27:1345–56. Suresh K, Naidoo J, Lin CT, Danoff S. Immune Checkpoint Immunotherapy for Non-Small Cell Lung Cancer: Benefits and Pulmonary Toxicities. Chest. 2018;154:1416–23. Tan AC, Tan DS. W. Targeted Therapies for Lung Cancer Patients With Oncogenic Driver Molecular Alterations. J Clin Oncol. 2022;40:611–25. Shu J, Jiang J, Zhao G. Identification of novel gene signature for lung adenocarcinoma by machine learning to predict immunotherapy and prognosis. Front Immunol. 2023;14:1177847. Verset L, Feys L, Trépant A-L, De Wever O, Demetter P. FHL2: a scaffold protein of carcinogenesis, tumour-stroma interactions and treatment response. Histol Histopathol. 2016;31:469–78. Wixler V, et al. The LIM-only protein DRAL/FHL2 binds to the cytoplasmic domain of several alpha and beta integrin chains and is recruited to adhesion complexes. J Biol Chem. 2000;275:33669–78. Liu Z, et al. The LIM-Only Protein FHL2 is involved in Autophagy to Regulate the Development of Skeletal Muscle Cell. Int J Biol Sci. 2019;15:838–46. Lai C-F, et al. Four and half lim protein 2 (FHL2) stimulates osteoblast differentiation. J Bone Min Res. 2006;21:17–28. Jiang T, Zeng Q, Wang J. Unlocking the secrets of Cardiac development and function: the critical role of FHL2. Mol Cell Biochem. 2025;480:2143–57. Liu X, et al. Identification of CFH and FHL2 as biomarkers for idiopathic pulmonary fibrosis. Front Med (Lausanne). 2024;11:1363643. Zhang J, Zeng Q, She M. The roles of FHL2 in cancer. Clin Exp Med. 2023;23:3113–24. Bai S, Zha J, Zhao H, Ross FP, Teitelbaum SL. Tumor necrosis factor receptor-associated factor 6 is an intranuclear transcriptional coactivator in osteoclasts. J Biol Chem. 2008;283:30861–7. Li N, Xu L, Zhang J, Liu Y. High level of FHL2 exacerbates the outcome of non-small cell lung cancer (NSCLC) patients and the malignant phenotype in NSCLC cells. Int J Exp Pathol. 2022;103:90–101. Chen T, et al. Promotion of non-small cell lung cancer tumor growth by FHL2 via inducing angiogenesis and vascular permeability. J Thorac Dis. 2024;16:1424–37. Kanzaki R, et al. FHL2 expression by cancer-associated fibroblasts promotes metastasis and angiogenesis in lung adenocarcinoma. Int J Cancer. 2025;156:431–46. Mollaei S, Khanehbarndaz O, Gerami-Khashal Z, Ebadi M. Molecular identification and phytochemical screening of endophytic fungi isolated from Lithospermum officinale L. roots: A new source of shikonin. Phytochemistry. 2019;168:112116. Iranzadeh S, Dalil D, Kohansal S, Isakhani M. Shikonin in breast cancer treatment: a comprehensive review of molecular pathways and innovative strategies. J Pharm Pharmacol. 2024;76:967–82. Wang Y, et al. Induction of Ferroptosis by Shikonin in Gastric Cancer via the DLEU1/mTOR/GPX4 Axis. Cell Biol Int. 2025;49:757–71. Yu Z, et al. Characterization of a small-molecule inhibitor targeting NEMO/IKKβ to suppress colorectal cancer growth. Signal Transduct Target Ther. 2022;7:71. Sun Q, et al. Shikonin, a naphthalene ingredient: Therapeutic actions, pharmacokinetics, toxicology, clinical trials and pharmaceutical researches. Phytomedicine. 2022;94:153805. Liang J, et al. Shikonin and chitosan-silver nanoparticles synergize against triple-negative breast cancer through RIPK3-triggered necroptotic immunogenic cell death. Biomaterials. 2024;309:122608. Lu B, et al. RIP1 and RIP3 contribute to shikonin-induced glycolysis suppression in glioma cells via increase of intracellular hydrogen peroxide. Cancer Lett. 2018;425:31–42. Tang L, et al. Extracellular Vesicles-Derived Hybrid Nanoplatforms for Amplified CD47 Blockade-Based Cancer Immunotherapy. Adv Mater. 2023;35:e2303835. H F et al. Thermal proteome profiling for unbiased identification of direct and indirect drug targets using multiplexed quantitative mass spectrometry. Nat Protoc 10, (2015). X Z et al. Solvent-Induced Protein Precipitation for Drug Target Discovery on the Proteomic Scale. Anal Chem 92, (2020). Cheng Y-J, et al. High Id1 expression, a generally negative prognostic factor, paradoxically predicts a favorable prognosis for adjuvant paclitaxel plus cisplatin therapy in surgically treated lung cancer patients. Oncotarget. 2014;5:11564–75. Ponz-Sarvisé M, et al. Inhibitor of differentiation-1 as a novel prognostic factor in NSCLC patients with adenocarcinoma histology and its potential contribution to therapy resistance. Clin Cancer Res. 2011;17:4155–66. Tan H-Y, et al. ID1 overexpression increases gefitinib sensitivity in non-small cell lung cancer by activating RIP3/MLKL-dependent necroptosis. Cancer Lett. 2020;475:109–18. J X et al. A single-cell characterised signature integrating heterogeneity and microenvironment of lung adenocarcinoma for prognostic stratification. EBioMedicine 102, (2024). Y Y, Em HH, Sv H, N., W B. Suppression of FOXO1 activity by FHL2 through SIRT1-mediated deacetylation. EMBO J 24, (2005). Kitamura YI, et al. FoxO1 protects against pancreatic beta cell failure through NeuroD and MafA induction. Cell Metab. 2005;2:153–63. Y Z et al. S-nitrosylation of the Peroxiredoxin-2 promotes S-nitrosoglutathione-mediated lung cancer cells apoptosis via AMPK-SIRT1 pathway. Cell Death Dis 10, (2019). Jp D, A, M., N K. Diagnosis, Treatment, and Prevention of Malaria in the US: A Review. JAMA 328, (2022). C L et al. Shikonin induces ferroptosis in osteosarcomas through the mitochondrial ROS-regulated HIF-1α/HO-1 axis. Phytomedicine: Int J phytotherapy phytopharmacology 135, (2024). J P et al. Up-Regulation of p53/miR-628-3p Pathway, a Novel Mechanism of Shikonin on Inhibiting Proliferation and Inducing Apoptosis of A549 and PC-9 Non-Small Cell Lung Cancer Cell Lines. Frontiers in pharmacology 12, (2021). W G, X, W., Y, Z., X, W., Y Y. Autophagy, ferroptosis, pyroptosis, and necroptosis in tumor immunotherapy. Signal transduction and targeted therapy 7, (2022). X H et al. Tumor-derived apoptotic extracellular vesicle-mediated intercellular communication promotes metastasis and stemness of lung adenocarcinoma. Bioactive Mater 36, (2024). N R, Jb FS-R, P., G B. Modulation of Ca2 + signaling by antiapoptotic Bcl-2 versus Bcl-xL: From molecular mechanisms to relevance for cancer cell survival. Biochim et Biophys acta Reviews cancer 1877, (2022). E E, Cj E. Paradoxical roles of caspase-3 in regulating cell survival, proliferation, and tumorigenesis. J Cell Biol 221, (2022). Z Z, Ł O, E G. Methods of PARP-1 Determination and its Importance in Living Organisms. Protein Pept Lett 29, (2022). V S-B, T, A., A S-K. Apoptotic proteins with non-apoptotic activity: expression and function in cancer. Apoptosis: an international journal on programmed cell death 28, (2023). Wang S, et al. FHL2 promotes the aggressiveness of lung adenocarcinoma by inhibiting autophagy via activation of the PI3K/AKT/mTOR pathway. Thorac Cancer. 2024;15:630–41. M J, U SMTH. M. & M, V. G. The multifunctional roles of the four-and-a-half-LIM only protein FHL2. Cell Mol Life Sci 63, (2006). Cy C, Sw M, Vw C, Sk T. The FHL2 regulation in the transcriptional circuitry of human cancers. Gene 572, (2015). Y Y et al. Acetylation of FoxO1 activates Bim expression to induce apoptosis in response to histone deacetylase inhibitor depsipeptide treatment. Neoplasia (New York N Y) 11, (2009). Jj H et al. Glucose-mediated insulin secretion is improved in FHL2-deficient mice and elevated FHL2 expression in humans is associated with type 2 diabetes. Diabetologia 65, (2022). M E et al. FOXO1, a tiny protein with intricate interactions: Promising therapeutic candidate in lung cancer. Biomed pharmacotherapy = Biomedecine pharmacotherapie 169, (2023). Jd C et al. FOXO1 enhances CAR T cell stemness, metabolic fitness and efficacy. Nature 629, (2024). Ae D et al. FOXO1 is a master regulator of memory programming in CAR T cells. Nature 629, (2024). Y C et al. CircHERC1 promotes non-small cell lung cancer cell progression by sequestering FOXO1 in the cytoplasm and regulating the miR-142-3p-HMGB1 axis. Mol Cancer 22, (2023). R D et al. SYUNZ-16, a newly synthesized alkannin derivative, induces tumor cells apoptosis and suppresses tumor growth through inhibition of PKB/AKT kinase activity and blockade of AKT/FOXO signal pathway. Int J Cancer 127, (2010). Supplementary Files AnimalEthics.pdf HumanMaterialEthic.pdf OriginalWesternBlots.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 02 Dec, 2025 Reviewers invited by journal 01 Dec, 2025 Editor assigned by journal 26 Nov, 2025 First submitted to journal 25 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8119297","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":553287765,"identity":"c75e2bbd-878a-4148-9e3e-cb9bf16c1e5d","order_by":0,"name":"Shiqun Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxklEQVRIiWNgGAWjYBACNvaGxAcSFRLM/OwNRGrh4znw2MDijA27ZM8BIrXISTg+E6hsS+M3uJFArMMkmNMYbrAdlja4+XjjDYYam2jCWqTb0h7O4DlsLHk7rdiC4VhabgNBLTJn0o0lJA4n893OMZNgbDhMhBaJ/G/SfwwO1zfcPEO0loQ0CSBmFrjBQ6wWngPJBhIHbJgle4B+SSDGL/LtwKiU/AeKysMbb3yosSGsBRkYSCSQohyihVQdo2AUjIJRMDIAAG1xP0D/w+2OAAAAAElFTkSuQmCC","orcid":"","institution":"Medical College of Dalian University: Dalian Medical University","correspondingAuthor":true,"prefix":"","firstName":"Shiqun","middleName":"","lastName":"Chen","suffix":""},{"id":553287767,"identity":"7e177a8f-86f3-40d0-9b45-a9ddb07423f9","order_by":1,"name":"Meirong Zhou","email":"","orcid":"","institution":"The Second Hospital of Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Meirong","middleName":"","lastName":"Zhou","suffix":""},{"id":553287768,"identity":"1148b81b-c5de-41c1-9e96-6498f1df7e4b","order_by":2,"name":"Wen Zhang","email":"","orcid":"","institution":"The Second Hospital of Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wen","middleName":"","lastName":"Zhang","suffix":""},{"id":553287770,"identity":"aac2ec19-873b-47fa-beb7-b97ea56093a9","order_by":3,"name":"Jiyong Zhong","email":"","orcid":"","institution":"First Affiliated Hospital of Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jiyong","middleName":"","lastName":"Zhong","suffix":""},{"id":553287772,"identity":"51009956-5f59-4e6c-8119-8c5f5b838124","order_by":4,"name":"Wenqian Han","email":"","orcid":"","institution":"First Affiliated Hospital of Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wenqian","middleName":"","lastName":"Han","suffix":""},{"id":553287775,"identity":"4d17fe23-1840-4cf1-a212-a925147720ac","order_by":5,"name":"Zhaoxuan Wang","email":"","orcid":"","institution":"First Affiliated Hospital of Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhaoxuan","middleName":"","lastName":"Wang","suffix":""},{"id":553287777,"identity":"c4ca62f8-7704-475b-bff5-d3b651de5d12","order_by":6,"name":"Shiqing Wang","email":"","orcid":"","institution":"First Affiliated Hospital of Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shiqing","middleName":"","lastName":"Wang","suffix":""},{"id":553287779,"identity":"f47bb605-f981-4b9d-a015-89f9d7349eb5","order_by":7,"name":"Chundong Gu","email":"","orcid":"","institution":"First Affiliated Hospital of Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chundong","middleName":"","lastName":"Gu","suffix":""},{"id":553287782,"identity":"8ce76bf1-3f0e-4f6c-9fcb-a5387ce9ffac","order_by":8,"name":"Zhenlong Yu","email":"","orcid":"","institution":"Dalian Medical University College of Pharmacy","correspondingAuthor":false,"prefix":"","firstName":"Zhenlong","middleName":"","lastName":"Yu","suffix":""},{"id":553287788,"identity":"d403c3e9-1df4-471a-9972-d5bc396564a4","order_by":9,"name":"Shilei Zhao","email":"","orcid":"","institution":"First Affiliated Hospital of Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shilei","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2025-11-15 04:36:58","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8119297/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8119297/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97652708,"identity":"d342887d-1875-41b8-a9ad-6ce5eb69ee62","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6098596,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/c1b6a69006a3731a922a69ed.tif"},{"id":97652715,"identity":"c320a963-221f-4980-a4aa-d2bbf44f41be","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4090008,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/9b67d5304d85e29488900e6e.tif"},{"id":97674382,"identity":"57b07328-b18a-404d-81a7-a54dae6c2588","added_by":"auto","created_at":"2025-12-08 09:43:11","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4730076,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2.2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/b3438b6103a6fff1b70b864a.tif"},{"id":97652712,"identity":"407e3e38-a97d-456a-aab8-5c03fcd527d0","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4032386,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/5bd592b94c26c534318a2ed8.tif"},{"id":97674034,"identity":"78b0edf7-0f2a-458d-97f3-fdfb9fe2ed94","added_by":"auto","created_at":"2025-12-08 09:42:13","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4660068,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/4eccd3c414ac341962904a77.tif"},{"id":97652719,"identity":"90772aae-af34-4bd1-9d15-d31f54cb8a03","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1974112,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/cd88f3aa6bf1327f44f6ece1.tif"},{"id":97652725,"identity":"6dc695b0-b75f-431f-94ad-f2c4fc0a0e7a","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5120202,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.6.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/b0cf28a55f499bb811ba8b9c.tif"},{"id":97672323,"identity":"0b4a445f-fe42-41d8-9add-0b68d0ac6604","added_by":"auto","created_at":"2025-12-08 09:36:08","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2047892,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.7.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/5bcbeff41bdaaed05cca47b9.tif"},{"id":97652713,"identity":"ee67c750-f870-421a-ace2-64b603d827d6","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15291,"visible":true,"origin":"","legend":"","description":"","filename":"jtrmJTRMD2520216.xml","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/9381b81f38b1af7bda84a225.xml"},{"id":97674038,"identity":"295a704b-06f1-41c2-8abf-374cf812d579","added_by":"auto","created_at":"2025-12-08 09:42:15","extension":"xml","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1355,"visible":true,"origin":"","legend":"","description":"","filename":"JTRMD2520216157512.go.xml","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/1359ccbee4fb656c82bd73ca.xml"},{"id":97652723,"identity":"cfab3a94-1afb-4074-8a3c-396c5b777aef","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"xml","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":882,"visible":true,"origin":"","legend":"","description":"","filename":"JTRMD2520216Import.xml","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/d3f5e9d00ebceeb43f76bfee.xml"},{"id":97674429,"identity":"2495f1c9-aaad-4e41-9f1e-9bc7d15f22ea","added_by":"auto","created_at":"2025-12-08 09:43:15","extension":"xml","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":120624,"visible":true,"origin":"","legend":"","description":"","filename":"JTRMD25202160enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/7c82f500d3b1f04c8c57fa79.xml"},{"id":97652737,"identity":"8c60520d-376e-42f7-b298-8b222aa4c28f","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6098596,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/3c5ff46cd3aba8833ac41074.tif"},{"id":97672812,"identity":"be8a2abf-dc6b-40ca-894d-72d11cc4fe43","added_by":"auto","created_at":"2025-12-08 09:38:51","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4090008,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/36937904fbddfe1e73664e62.tif"},{"id":97652732,"identity":"7bd5451d-f900-4777-a910-144337a5a3da","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4730076,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2.2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/1f7901a3203e3ee737d03787.tif"},{"id":97652720,"identity":"51837290-ab75-4092-a2bb-dc9bd35ca0c7","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"tif","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4032386,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/8cc7904c97faa7b71c4323d1.tif"},{"id":97674243,"identity":"7dcb269d-ca1b-47c4-9b19-0bb557a80c38","added_by":"auto","created_at":"2025-12-08 09:42:46","extension":"tif","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4660068,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/99dca7c74a834526db40cfe8.tif"},{"id":97652728,"identity":"25381d2b-abd4-458b-b18a-a88ad6734f72","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"tif","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1974112,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/45186ba68ed2446e328ec131.tif"},{"id":97674950,"identity":"295a7a54-de7f-4abe-933b-42090a5c528c","added_by":"auto","created_at":"2025-12-08 09:44:57","extension":"tif","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5120202,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.6.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/747e8f48a150bc847b9e54fa.tif"},{"id":97652741,"identity":"8caf5c16-c333-4f4a-b147-4628f0d6a0da","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"tif","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2047892,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.7.tif","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/926d1b9b119a6feb1175140e.tif"},{"id":97652746,"identity":"df911b21-962f-4946-8e8c-cbcd191ed244","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":767939,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/a37a1f95c5a713f1952f1c0a.png"},{"id":97674931,"identity":"89e7b7b2-0309-4015-a928-533132778450","added_by":"auto","created_at":"2025-12-08 09:44:53","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":336294,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.2.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/c2feacbd05a1a78220d00e85.png"},{"id":97674844,"identity":"42717d8f-ad28-409a-8e53-3973ea0ff30c","added_by":"auto","created_at":"2025-12-08 09:44:25","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":599772,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.2.2.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/6b7f00c96f577ee9ac476f63.png"},{"id":97652735,"identity":"189c973d-5948-4c25-8a0c-5a30ceefdb05","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":291975,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/4583d912514080a92ecffe5f.png"},{"id":97652721,"identity":"257af35c-1eb8-405c-a48a-8711061b85ac","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":421293,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/24b2ff31263a2d063bb7e280.png"},{"id":97652745,"identity":"ef7eb24b-5b8b-41a2-b18c-e7906a6ce9d1","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":173053,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/e38c9a3083989ecc7b455717.png"},{"id":97652739,"identity":"8c663b0a-ee44-40c4-a6b7-c43da338a174","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":467293,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/18105a7aca142770391101e0.png"},{"id":97652738,"identity":"26043435-5903-4b6d-bf7d-ae242b63d1a5","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":169418,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/74d2d6cd18e90d1cb5ae1c2e.png"},{"id":97652734,"identity":"5da8edcb-2d7a-483b-a3c0-40edb54c63c6","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"xml","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":118179,"visible":true,"origin":"","legend":"","description":"","filename":"JTRMD25202160structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/eb26beb9d1c67f2da0d9ee91.xml"},{"id":97652744,"identity":"2bc357b6-ff44-4ce8-b915-40985d1da74b","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"html","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":131697,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/1dacffbdbb6d46fe4034b1f9.html"},{"id":97674762,"identity":"6e0ecd65-ef46-4c55-8b40-f1a8e60a87eb","added_by":"auto","created_at":"2025-12-08 09:44:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":20824678,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/e2545cb6f6c16871f0dccce2.png"},{"id":97652706,"identity":"ff390075-d5fc-4043-90ae-9fb50840c8a1","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":9022597,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig.2.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/ea96adfa010d5857128d3683.png"},{"id":97652714,"identity":"98cf0e19-9130-4224-8f4b-8e8edd7a3022","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":17654595,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig.2.2.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/a27d3fbbc8fd16faac96c7f8.png"},{"id":97674448,"identity":"34257e3f-9fe2-4271-b2b5-7e4945e910e8","added_by":"auto","created_at":"2025-12-08 09:43:18","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":8893658,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/f1d453eb9e97e64a01471b46.png"},{"id":97652710,"identity":"c5063101-c340-4c12-b78a-d1a8eeda7be8","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":13696058,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/f9bb43512ddbaa12284862a1.png"},{"id":97652705,"identity":"b448e826-3372-4582-9f29-c54b5172ddf2","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":5061533,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/670c9f52f7bc99ba1d114653.png"},{"id":97672816,"identity":"fae8a5ea-eebe-4c20-aaae-24a778995b1e","added_by":"auto","created_at":"2025-12-08 09:38:51","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":15405409,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/88f1b0cc4b2ac66a1b409b08.png"},{"id":97652716,"identity":"96d47d0f-1d9b-450e-adb6-4e4e515cc5ae","added_by":"auto","created_at":"2025-12-08 06:44:22","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":5921629,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/9d5cb11b63523cf05a2f8147.png"},{"id":97893950,"identity":"02610db8-b8bc-4868-8b78-cf45c953f10b","added_by":"auto","created_at":"2025-12-10 15:31:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":90334750,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/74faed50-a5f4-4f49-8734-74ef32a2d6e8.pdf"},{"id":97652736,"identity":"0438fd3a-7a26-4bf1-b294-916e94839f0b","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"pdf","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":27207,"visible":true,"origin":"","legend":"","description":"","filename":"AnimalEthics.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/ac6fe3ef65fcf2da24bcd42d.pdf"},{"id":97674548,"identity":"7dd62d9a-2963-4562-8756-67cf07c857bf","added_by":"auto","created_at":"2025-12-08 09:43:36","extension":"pdf","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":2703377,"visible":true,"origin":"","legend":"","description":"","filename":"HumanMaterialEthic.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/813f3a0d4994152112acd874.pdf"},{"id":97652730,"identity":"cabbe3cb-fa07-49e7-b70e-6725bdf7599f","added_by":"auto","created_at":"2025-12-08 06:44:23","extension":"pdf","order_by":15,"title":"","display":"","copyAsset":false,"role":"supplement","size":1426731,"visible":true,"origin":"","legend":"","description":"","filename":"OriginalWesternBlots.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8119297/v1/d4c887b3fdf7f49395ab49d0.pdf"}],"financialInterests":"","formattedTitle":"Shikonin triggers apoptosis in lung adenocarcinoma through FHL2-FOXO1 signaling axis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eLung cancer persists as the leading cause of cancer-related morbidity and mortality worldwide. Although recent advances in low-dose computed tomography (LDCT) screening, immune checkpoint inhibitors (ICIs), and targeted therapies have modestly improved five-year survival rates, patients with advanced lung cancer continue to face inevitable challenges of drug resistance and disease recurrence\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Histologically, lung cancer is broadly categorized into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), with the latter comprising adenocarcinoma, squamous cell carcinoma, large cell carcinoma, and other subtypes \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. As the most prevalent histological form of NSCLC, lung adenocarcinoma (LUAD) presents considerable clinical challenges attributable to its marked tumor heterogeneity and unfavorable prognosis \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Deepened understanding of LUAD pathogenesis and the widespread clinical application of small-molecule targeted agents and programmed cell death protein 1/programmed death-ligand 1 (PD-1/PD-L1) inhibitors have contributed to progressively improved patient outcomes\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Nonetheless, therapeutic success remains constrained by the emergence of drug resistance and apoptotic evasion, often leading to suboptimal clinical responses. Metastasis, relapse, treatment resistance, and drug-related toxicities continue to pose major hurdles in the management of advanced LUAD \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Hence, there is a pressing need to develop novel diagnostic approaches and innovative small-molecule therapeutics. A deeper mechanistic understanding of LUAD progression and the discovery of molecular-level therapeutic targets are critically needed.\u003c/p\u003e\u003cp\u003eFHL2 is a key member of the LIM-only protein family, characterized by possessing four full LIM domains and one N-terminal half-LIM domain\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. FHL2 exhibits context-dependent and cell type-specific functions\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e, participating in processes such as muscle, bone ,and cardiac development, and serving as a biomarker for idiopathic pulmonary fibrosis (IPF)\u003csup\u003e\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Notably, FHL2 plays a dual role in tumorigenesis, acting as either an oncoprotein or a tumor suppressor depending on the cancer type; its expression is downregulated in breast cancer and liver cancer where it suppresses tumor growth, whereas it is upregulated in lung cancer, gastric cancer, colorectal cancer, pancreatic cancer, prostate cancer, cervical cancer, and ovarian cancer, promoting tumor cell proliferation, invasion, and metastasis\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. FHL2 lacks intrinsic DNA-binding activity, shuttles between the cytoplasm and nucleus, and regulates multiple cellular signaling pathways through interactions with various transcription factors\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. In non-small cell lung cancer (NSCLC), studies have confirmed that FHL2 activates the Wnt/β-catenin signaling pathway, promotes epithelial-mesenchymal transition (EMT) to regulate proliferation and apoptosis, and enhances vascular permeability via the VEGFA/Akt/mTOR pathway\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Furthermore, FHL2 overexpression in cancer-associated fibroblasts (CAFs) promotes cancer cell migration and invasion capabilities, as well as in vitro angiogenic potential and in vivo metastatic dissemination\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Given its significant roles, FHL2 is increasingly recognized as a potential diagnostic and prognostic biomarker for lung cancer and a promising novel therapeutic target.\u003c/p\u003e\u003cp\u003eShikonin (SHK), a bioactive naphthoquinone derived from Lithospermum erythrorhizon\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e, exhibits potent antitumor activity in various cancers, including breast, gastric, and colon cancer\u003csup\u003e\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Studies demonstrate that SHK inhibits tumor growth, progression, and metastasis through multiple pathways, such as modulating cancer cell proliferation, apoptosis, autophagy, necroptosis, and inducing immunogenic cell death (ICD)\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Furthermore, SHK modulates the immunosuppressive tumor microenvironment by inhibiting tumor cell glycolysis and repolarizing tumor-associated macrophages (TAMs)\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. However, the precise molecular mechanisms underlying SHK's role in the treatment of lung adenocarcinoma (LUAD) remain incompletely defined, Particularly, the induction of apoptosis via the FHL2-FOXO1 signaling axis has rarely been reported.\u003c/p\u003e\u003cp\u003eBy integrating cellular assays with patient-derived xenograft (PDX) models, we elucidated the molecular mechanism underlying SHK-mediated suppression of LUAD. SHK exerted dose-dependent inhibitory effects on proliferation and migration, and promoted apoptosis in LUAD cells. Crucially, we identified FHL2 as the direct target of SHK through molecular docking and cellular thermal shift assay (CETSA) validation. The core mechanism involves SHK-induced disruption of the FHL2-FOXO1 interaction, resulting in increased FOXO1 acetylation and nuclear accumulation. Our study is the first to conclusively demonstrate that SHK specifically induces LUAD cell apoptosis by targeting the FHL2-FOXO1 axis, providing a strong rationale for targeting FHL2 as a novel therapeutic strategy.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e\u003cb\u003e2.1. Cell culture\u003c/b\u003e\u003c/h2\u003e\u003cp\u003eThe human NSCLC cell lines A549, NCI-H1299, NCI-H827, and NCI-H322 and BEAS-2B, HEK293T were obtained from American Type Culture Collection (ATCC). The cell culture and passage were less than 30 generations. The cell lines were cultured using ATCC recommended media. HEK293T and BEAS-2B cells were cultured in DMEM Medium with 10% FBS (Gibco), A549 cells were cultured in F-12K Medium (Hyclone) supplemented with 10% FBS (Gibco) ,NCI-H1299, NCI-H827, NCI -H358, and NCI-H322 cells were cultured in RPMI1640 Medium supplemented with 10% FBS (Gibco). Cells were maintained in a humidified atmo\u0026shy;sphere of 5% CO2 at 37\u0026deg;C.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Cell Counting Kit-8 (CCK8) assay\u003c/h2\u003e\u003cp\u003eCells in the logarithmic growth phase were actively proliferated and seeded into a 96-well plate at a density of 5,000 cells per well to ensure consistent cell density for subsequent experiments. Subsequent to cell attachment, the cells were stimulated with varying concentrations of SHK (0, 0.5, 1.0, 2.0, 4.0, 8.0 \u0026micro;M) Shikonin (SHK; JOT-11729, \u0026gt;98%) was purchased from Chengdu Pufei De Biotech Co., Ltd (China), and dissolved in DMSO to produce a 5 mM stock solution.for 24 or 48 hours. To assess cell viability, a solution containing 10% Cell Counting Kit-8 (CCK-8) was added to each well, followed by an additional 2-hour incubation. The optical density was then measured at 450 nm using a microplate reader (PerkinElmer, Waltham, MA, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Cell colony formation assay\u003c/h2\u003e\u003cp\u003eThe anti-proliferative effect of SHK on lung adenocarcinoma cells was assessed using a standardized colony formation assay. Logarithmically growing A549 and H1299 cells were seeded into 6-well plates at a density of 500 cells. After 12 hours of adherence, cells were treated with SHK for 24 hours. Following treatment, the drug-containing medium was aspirated, and cells were gently washed twice with PBS before replenishing with 2 mL of drug-free complete medium. Plates were incubated for 10\u0026ndash;14 days at 37\u0026deg;C under 5% CO₂ to allow colony formation. Colonies were fixed with 4% paraformaldehyde (PFA, Sigma-Aldrich) for 30 minutes, and stained with 0.1% crystal violet (Beyotime Biotechnology) for 1 hour at room temperature. photographed with an ordinary camera.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. Transwell assay\u003c/h2\u003e\u003cp\u003eTranswell migration assays were conducted using Corning chambers. A549 and H1299 cells were subjected to 6-hour serum starvation and subsequently seeded at a density of 1\u0026times;10⁵ cells/200 \u0026micro;L into the upper chambers, which contained graded concentrations of SHK. The lower chambers were loaded with 600 \u0026micro;L of medium supplemented with 10% FBS to serve as a chemoattractant. After 48 hours of incubation at 37\u0026deg;C in a 5% CO₂ atmosphere, cells that had traversed the membrane were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. Microscopic images were obtained at 10\u0026times; magnification, and cell migration was quantified by measuring the area of crystal violet staining.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Western blot assay\u003c/h2\u003e\u003cp\u003eTreated cells or tissues were lysed using RIPA lysis buffer (Beyotime Biotechnology Co., Ltd., Shanghai, China) supplemented with protease inhibitor PMSF and phosphatase inhibitor cocktail, followed by centrifugation to collect the supernatant for protein quantification using a Bicinchoninic Acid (BCA) Protein Assay Kit (Beyotime Biotechnology Co., Ltd.). Proteins were separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). Membranes were blocked with 5% skim milk for 1 hour, then incubated with primary antibodies at 4\u0026deg;C overnight, followed by 1-hour incubation with secondary antibodies at room temperature. After TBST washing, protein signals were detected using Western Bright ECL substrate (Tanon Science and Technology Co., Ltd., Shanghai, China), e protein levels were determined using Image J software. Antibodies used in this study were as follows: MMP9 (60600-1-Ig Proteintech 1:1000), PCNA (10205-2-AP Proteintech 1:2000), cleaved-PARP (60555-1-lg Proteintech 1:2000 ), cleaved caspase-3 (25128-1-AP Proteintech 1:1000),Bcl-2 (60178-1-Ig Proteintech 1:1000), BAX (50599-2-Ig Proteintech 1:1000), FOXO1 (HUABIO ET1608-25 1:2000) ,FHL2 ( abcam ab202584 1:1000),Secondary antibody was used: Anti-mouse or Anti-rabbit IgG, 1:5000 dilution.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. Quantitative RT‑PCR\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from [Specify tissue/cell type] with TRIzol reagent (Hunan Aikerui Bioengineering Co., Ltd., China) according to the manufacturer's instructions. Complementary DNA (cDNA) was then synthesized from the RNA samples using the RevertAid First Strand cDNA Synthesis Kit (MonAmp, China). Quantitative real-time PCR (qRT-PCR) analyses were conducted on a CFX 96 Real-Time PCR Detection System (Bio-Rad, USA) using Power SYBR Green Master Mix (MonAmp, China) to quantify mRNA expression levels. All data were normalized to the expression of β-actin as an internal reference, and the relative gene expression was calculated using the 2^(\u0026minus;ΔΔCT) method. The primers were as follows: FHL2-F, CTGGAGACTAGGCTGGCATT; FHL2-R, CCGTGGTGATGGGCTTTTTG; FOXO1-F, AGGGTTAGTGAGCAGGTTACAC; FOXO1-R, CTGCCCCAAATACCTGTGGT.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7. Flow cytometry assay\u003c/h2\u003e\u003cp\u003eApoptotic cell proportions were assessed using flow cytometry with instruments supplied by BD Biosciences (Shanghai, China). To evaluate apoptotic rates, A549 and H1299 cells treated with various concentrations of SHK were harvested using EDTA-free trypsinization, stained with Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI), and quantitatively analyzed by flow cytometry. The Annexin V-FITC/PI Apoptosis Detection Kit (KGA 108) was purchased from KeyGEN BioTECH Co., Ltd. (Nanjing, Jiangsu Province, China).It was detected and analyzed by by flow cytometry (BD)software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8.siRNA interference assay\u003c/h2\u003e\u003cp\u003eA549 and H1299 cells were seeded in 6-well plates and transfected at 50\u0026ndash;60% confluence. Prior to transfection, Lipofectamine\u0026trade; 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA) was mixed with 5 \u0026micro;L siRNA. The mixture was added dropwise to target cells. After 6 hours, the transfection medium was replaced with complete growth medium supplemented with 10% fetal bovine serum (FBS). Cells were harvested at 48 hours post-transfection for mRNA expression analysis by quantitative reverse transcription PCR (RT-qPCR) and protein detection by Western blotting.The siRNA sequences used in this study were:\u003c/p\u003e\u003cp\u003eSense: 5\u0026prime;-GCAGCCAAUUGGAACCAAGTT-3\u0026prime;\u003c/p\u003e\u003cp\u003eAntisense: 5\u0026prime;-CUUGGUUCCAAUUGGCUGCTT-3\u0026prime;.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9. Transient Transfection and Establishment of stable cell lines.\u003c/h2\u003e\u003cp\u003e293T cells were seeded in 10-cm dishes for 24 h. Prior to transfection, medium was replaced with serum-free DMEM. Recombinant plasmids encoding Flag-FHL2 or FOXO1-HA were transfected using polyethylenimine (PEI, Polysciences, Warrington, PA) at a DNA:PEI ratio of 1:3. After 8-h incubation, medium was replaced with complete medium containing 10% FBS. Cells were cultured for an additional 48 h and harvested for target protein validation by Western blotting. For stable cell line establishment, lentiviral packaging was performed by co-transfecting 293T cells with the recombinant plasmid along with packaging plasmids psPAX2 (Addgene, Cambridge, MA) and pMD2.G (Addgene) using polyethylenimine (PEI). Following 48-hour transfection, viral supernatants were harvested, filtered through 0.45-\u0026micro;m membranes, and used to infect A549 and H1299 cells with 50% (v/v) viral supernatant-containing medium supplemented with 8 \u0026micro;g/mL polybrene for 24 hours; stable clones were subsequently selected with puromycin-containing medium (pre-optimized concentration 2\u0026ndash;5 \u0026micro;g/mL) for 10\u0026ndash;14 days with medium replenishment every 48 hours.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10. CHX assays\u003c/h2\u003e\u003cp\u003eCells were pretreated with SHK at a final concentration of 1 \u0026micro;M for 24 h. CHX was added to the culture medium at a concentration of 50 \u0026micro;g/mL, and cells were collected at 0, 3, 6, and 9 h. The samples were centrifuged at 4\u0026deg;C. The supernatants were mixed with loading buffer and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blotting.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11. CETSA\u003c/h2\u003e\u003cp\u003eA549 cell lysates were collected and equally divided into two aliquots, which were treated with DMSO or SHK, respectively, followed by incubation at room temperature for 2 h. The suspensions were aliquoted, heated in a PCR machine at specified temperatures (39\u0026ndash;60\u0026deg;C) for 4 min, and then cooled at room temperature for 5 min. The samples were centrifuged at 20,000 \u0026times; *g* for 15 min at 4\u0026deg;C. The supernatants were mixed with loading buffer and separated by SDS-PAGE for subsequent immunoblotting analysis of FHL2.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.12. Co-immunoprecipitation (CO-IP) assay\u003c/h2\u003e\u003cp\u003eFor immunoprecipitation, 600 \u0026micro;g of total protein was diluted to 500 \u0026micro;L using binding buffer. Experimental samples were incubated with 2 \u0026micro;g of anti-Flag, anti-HA, or anti-FOXO1 antibodies, while control samples received 2 \u0026micro;g species-matched IgG. Following 1-h vortexing at 4\u0026deg;C, 15 \u0026micro;L of pre-washed Protein G magnetic beads were added, and incubation was continued overnight with gentle agitation. Magnetic separation was subsequently performed: supernatants were discarded and beads were washed thrice with 500 \u0026micro;L ice-cold binding buffer. Bound proteins were eluted in 50 \u0026micro;L 2\u0026times; Laemmli buffer through boiling at 95\u0026deg;C for 10 min. Eluates were collected after final magnetic separation for Western blot analysis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e2.13. Immunofluorescence (IF) and Immunohistochemistry (IHC) .\u003c/h2\u003e\u003cp\u003ePlace A549 and NCI-H1299 cells in the logarithmic growth phase on glass slides. After the cells have adhered, treat them with SHK for 48 hours. Wash the cells with phosphate-buffered saline (PBS) to remove residual culture medium. Fix the cells with paraformaldehyde, then wash with PBS three times. Treat the cells with 0.1% Triton X-100 for 30 minutes, followed by blocking with 5% bovine serum albumin (BSA) at room temperature for 1 hour. Incubate with anti-FHL2 primary antibody (1:300) and anti-FOXO1 primary antibody (1:100) overnight at 4\u0026deg;C. Incubate with Alexa Fluor 594-labeled secondary antibody (1:200) at room temperature for 1 hour, followed by DAPI staining. Finally, capture images using a fluorescence microscope. Immunohistochemical analysis was performed on 4\u0026ndash;6 \u0026micro;m paraffin-embedded sections. Tissue sections were dewaxed in xylene and rehydrated through a graded ethanol series. Endogenous peroxidase activity was blocked by 20-min incubation with 3% hydrogen peroxide at room temperature. Antigen retrieval was subsequently conducted in 10 mM citrate buffer (pH 6.0) using microwave irradiation for 20 min. Sections were incubated overnight at 4\u0026deg;C with primary antibodies in a humidified chamber. Following PBS washes, specimens were treated with species-appropriate biotinylated secondary antibodies for 1 h at room temperature. Visualization was achieved using the ABC Elite Kit with DAB chromogen. Counterstaining was performed with Mayer's hematoxylin for 45 sec, followed by dehydration through ascending ethanol concentrations and xylene clearance. Slides were permanently mounted with resinous mounting medium. Images were acquired using bright-field microscopy (Nikon Eclipse E200, 20\u0026times; objective).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e2.14. Molecular Docking analysis\u003c/h2\u003e\u003cp\u003eThe X-ray crystallographic structures of FHL2 (PDB ID: 2MIU) and ID1 (PDB ID: 2P57) were retrieved from the Protein Data Bank (PDB, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.rcsb.org\u003c/span\u003e\u003cspan address=\"https://www.rcsb.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The three-dimensional structure of SHK was obtained from the PubChem database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubchem.ncbi.nlm.nih.gov\u003c/span\u003e\u003cspan address=\"https://pubchem.ncbi.nlm.nih.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and converted to Mol2 format using OpenBabel GUI (version 3.1.1). Protein structures were preprocessed with PyMOL (version 2.60) by removing water molecules, metal ions, and bound ligands. Hydrogen atoms and Gasteiger charges were added to both proteins and SHK using AutoDockTools (version 1.5.7). Grid parameters were defined to encompass the putative binding sites, with grid box dimensions set to 60 \u0026times; 60 \u0026times; 60 \u0026Aring; and a spacing of 0.375 \u0026Aring;.Molecular docking was performed using the Lamarckian genetic algorithm (LGA) with default parameters (energy evaluations:50). The resulting docking poses were visualized and analyzed in PyMOL to evaluate binding modes, hydrogen bonding, and hydrophobic interactions.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e2.15. Develop a PDX model to assess the therapeutic effectiveness of SHK\u003c/h2\u003e\u003cp\u003ePatient-derived tumor tissues were obtained from The First Affiliated Hospital of Dalian Medical University with written informed consent. All procedures involving human specimens were approved by the Institutional Ethics Committee (Approval No. PJ-KS-KY-2025-431) and were conducted in strict compliance with the Declaration of Helsinki. Fresh lung adenocarcinoma specimens were subcutaneously implanted into the axillary region of 6-week-old male NYG mice (Vital River Laboratories, Beijing, China) within 2 hours after resection under specific pathogen-free (SPF) conditions. All animal experiments were approved by the Animal Ethics Committee of Dalian Medical University (Approval No. XL250619069). Tumor growth was monitored weekly using caliper measurements. When tumor dimensions reached approximately 1.5 \u0026times; 1.5 cm, the mice were euthanized by cervical dislocation under isoflurane anesthesia. Harvested tumors were subsequently passaged into secondary BALB/c nude mice (6-week-old). Tumors that achieved successful engraftment (volume\u0026thinsp;\u0026gt;\u0026thinsp;200 mm\u0026sup3;) were randomly assigned (n\u0026thinsp;=\u0026thinsp;5 per group) to receive either SHK (2.5 or 5 mg/kg) or vehicle control (saline), administered intraperitoneally every other day for 14 consecutive days. Tumor volume was calculated using the formula: V = (length \u0026times; width\u0026sup2;)/2. Humane endpoints were strictly observed, and mice were euthanized either when the tumor volume exceeded 1,800 mm\u0026sup3; or upon reaching the predefined experimental endpoint. All excised tumor tissues were processed for immunohistochemical analysis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e2.16 .Data analysis\u003c/h2\u003e\u003cp\u003eGraphPad Prism software (version 9.5.1; GraphPad Software, USA) was utilized for all statistical analyses. All experiments included at least three independent biological replicates, and data are reported as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. For comparisons between two groups, a two-tailed Student's t-test was applied; for comparisons across multiple groups, one-way ANOVA was employed. Statistical significance was assigned according to the following thresholds: *P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, and ****P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e3.1. SHK Inhibits LUAD Cell Proliferation and Migration in Cellular and PDX Models\u003c/h2\u003e\u003cp\u003eThe effects of SHK on the viability of LUAD cell lines (A549, H322, H827, H1299) and normal bronchial epithelial cells (BEAS-2B) were evaluated using the CCK-8 assay. SHK was found to significantly inhibit the survival of LUAD cells in a dose- and time- dependent manner, with tumor cells exhibiting greater sensitivity than BEAS-2B cells (Fig.\u0026nbsp;1A). Based on drug sensitivity analysis, H1299 and A549 cells were selected for further investigation. Similarly, colony formation assays demonstrated that SHK reduced both colony number and diameters compared to the control (Fig.\u0026nbsp;1B). Transwell invasion assays further revealed a concentration-dependent decrease in Matrigel-invading cells upon SHK treatment (Fig.\u0026nbsp;1C). Furthermore, western blot analysis also confirmed that SHK downregulated the proliferation marker PCNA and the metastasis-associated protein MMP-9 in a concentration-dependent manner (Fig.\u0026nbsp;1D-E).\u003c/p\u003e\u003cp\u003eIn addition, to evaluate SHK\u0026rsquo;s efficacy in vivo, a PDX model was established using tumor tissue from a stage IIB (pT2N1M0) LUAD patient (UICC 9th edition TNM staging). Following intraperitoneal SHK administration (2.5 or 5 mg/kg every other day for 14 days), tumor volume and weight were significantly reduced compared to controls (Fig.\u0026nbsp;1F\u0026ndash;I), without affecting mouse body weight (Fig.\u0026nbsp;1J). Western blot and immunohistochemical (IHC) analyses of PDX tissues showed decreased expression of the proliferation markers (PCNA and Ki-67), and the migration marker MMP-9 in SHK-treated groups (Fig.\u0026nbsp;1K\u0026ndash;L), aligning with \u003cem\u003ein vitro\u003c/em\u003e findings. Collectively, these data demonstrate that SHK exhibits potent anti-LUAD effects in both cellular and animal models, with minimal toxicity.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e3.2. SHK Promotes Apoptosis in LUAD Cells In Vitro and In Vivo\u003c/h2\u003e\u003cp\u003eTo identify potential targets of SHK, we performed thermal proteome profiling (TPP)\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e and stable isotope labeling (SIP)\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, screening 22 candidate proteins(Figs.\u0026nbsp;2.1A-B). GO enrichment analysis of biological process showed significant enrichment in the \"negative regulation of apoptotic process (relative gene: PRDX5, ID1, FHL2, PDE3A, and SQSTM1)\" (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;2.1C), indicating that SHK may exert its anti-LUAD effects primarily through modulation of apoptotic pathways. This was further supported by experimental evidence: (1) Flow cytometry demonstrated SHK treatment (48 h) induced concentration-dependent apoptosis in A549 and H1299 cells (Fig.\u0026nbsp;2.1D-E); (2) Western blot analysis showed SHK upregulated pro-apoptotic proteins (cleaved-PARP, cleaved caspase-3, BAX) while downregulating anti-apoptotic proteins (Pro-PARP, Pro-caspase-3, Bcl-2) in both A549 cells and PDX tumors (Fig.\u0026nbsp;2.1F-H); (3) Quantitative analysis of TUNEL staining revealed a significant increase in apoptotic cell death in the SHK-treated group(Fig.\u0026nbsp;2.2A) ;and (4) Quantitative IHC confirmed increased BAX and decreased Bcl-2 expression in high-dose SHK-treated PDX tissues (Fig.\u0026nbsp;2.2B). These consistent findings across cellular and animal models demonstrate that SHK induces LUAD cell apoptosis through coordinated regulation of apoptotic networks.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003e3.3. FHL2 is the principal target mediating SHK's pro-apoptotic effects in LUAD\u003c/h2\u003e\u003cp\u003eTo further investigate the molecular mechanism of SHK-triggered apoptosis, we analyzed the relationship between the potential target protein (PRDX5, FHL2, ID1, PDE3A and SQSTM1) and the prognosis of patients using the TCGA database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://portal.gdc.cancer.gov/\u003c/span\u003e\u003cspan address=\"https://portal.gdc.cancer.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Expression profiling demonstrated that FHL2 and SQSTM1 levels were significantly elevated in LUAD tissues relative to adjacent normal tissues. In contrast, PRDX5 and ID1 expression was markedly downregulated, while PDE3A levels remained unaltered (Fig.\u0026nbsp;3A). Prognostic analysis via GEPIA2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gepia2.cancer-pku.cn/\u003c/span\u003e\u003cspan address=\"http://gepia2.cancer-pku.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e ) demonstrated that only ID1 and FHL2 was significantly associated with patients\u0026rsquo; outcomes (Fig.\u0026nbsp;3B). Given that SHK mediates apoptosis by regulating genes that negatively regulate apoptosis (Fig.\u0026nbsp;2A), while the paradoxical role of ID1 in NSCLC and its inconclusive function in regulating therapeutic responses to anticancer agents have been established\u003csup\u003e\u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e, elevated FHL2 expression predicts adverse clinical outcomes\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. These findings indicate that FHL2 may serve as a novel therapeutic target for SHK to trigger caspase-dependent apoptosis in LUAD. Clinical sample validation further revealed that both FHL2 mRNA and protein levels were significantly elevated in LUAD tissues compared to adjacent normal tissues (Fig.\u0026nbsp;3C-D). Flow cytometry analysis revealed that either FHL2 silencing alone or SHK treatment significantly induced apoptosis in A549 and H1299 cells (Fig.\u0026nbsp;3E-J). However, the combined intervention did not further enhance the apoptotic rate, suggesting that SHK-mediated tumor cell apoptosis is dependent on FHL2.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\u003ch2\u003e3.4. SHK targets the FHL2 protein and promotes FHL2 degradation.\u003c/h2\u003e\u003cp\u003eTo further elucidate the molecular mechanism through which SHK induces apoptosis in LUAD via FHL2, we next examined SHK's effect on FHL2 expression. Treatment of A549 and H1299 cells with increasing SHK concentrations resulted in a dose-dependent reduction in FHL2 protein levels (Fig.\u0026nbsp;4A-B). Further reduction of intracellular FHL2 protein expression by SHK was confirmed by IF (Fig.\u0026nbsp;4C-D), while FHL2 mRNA expression remained unaffected (Fig.\u0026nbsp;4E-F). These \u003cem\u003ein vitro\u003c/em\u003e findings were corroborated in the LUAD PDX model, where SHK treatment significantly decreased FHL2 protein expression and IHC staining intensity without altering FHL2 mRNA levels (Fig.\u0026nbsp;4H-I). The results indicated that SHK might promote FHL2 protein degradation. To validate this hypothesis, we treated H1299 cells with cycloheximide (CHX), a protein synthesis inhibitor. Strikingly, SHK treatment markedly accelerated FHL2 protein degradation in CHX-treated cells, consistent with decreased protein instability (Fig.\u0026nbsp;4J). The TPP and SIP results implied a physical interaction between SHK and FHL2 (shown in Fig.\u0026nbsp;2A). CETSA analysis further confirmed that SHK treatment markedly changed the thermal stability of FHL2 protein in A549 cell lysates (Fig.\u0026nbsp;4K), suggesting a potential interaction between SHK and FHL2. Based on these experimental findings, we performed computational modeling to predict the structural basis of their molecular interaction. The molecular docking predicted that SHK was bound to the FHL2 protein with a binding energy of \u0026ndash; 7.16 kcal/mol, with hydrogen bond interactions formed with Glu41, Trp61, Lys83, and Gln86 (Fig.\u0026nbsp;4L). Collectively, these results demonstrate that SHK promotes lung adenocarcinoma cell apoptosis by modulating FHL2 protein stability rather than its transcriptional regulation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003e3.5. SHK reduces the interaction between FOXO1 and FHL2\u003c/h2\u003e\u003cp\u003eDue to its unique structural characteristics, the FHL2 protein participates in cellular processes by interacting with various proteins (including transcription factors), and exhibits specific environment-dependent effects in different cancers. To explore whether SHK influences FHL2 stability\u0026mdash;potentially by disrupting its interactions with other proteins\u0026mdash;we first employed the STRING database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://string-db.org\u003c/span\u003e\u003cspan address=\"https://string-db.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and the GeneMANIA platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://genemania.org\u003c/span\u003e\u003cspan address=\"https://genemania.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to predict FHL2-interacting proteins. Notably, the intersection of both analyses identified FOXO1 and SIRT1 as key candidates (Figs.\u0026nbsp;5A-C). However, the database prediction revealed a direct interaction between FHL2 and FOXO1, while FHL2 and SIRT1 had an indirect interaction due to FOXO1 (Fig.\u0026nbsp;5D). Therefore, we hypothesize that SHK may disrupt the FHL2-FOXO1 interaction, thereby destabilizing the FHL2 protein and subsequently inducing cell apoptosis. To test this hypothesis, we established Flag-FHL2-overexpressing A549 and H1299 cell lines. Co-immunoprecipitation (Co-IP) assays confirmed a robust interaction between FHL2 and FOXO1, which was significantly attenuated by SHK treatment (Figs.\u0026nbsp;5E-F). Furthermore, in HEK293T cells co-expressing Flag-FHL2 and HA-FOXO1, Co-IP experiments again demonstrated the FHL2-FOXO1 interaction and its inhibition by SHK (Fig.\u0026nbsp;5G). Collectively, these results demonstrate that SHK interferes with FHL2-FOXO1 complex formation, ultimately promoting apoptotic cell death.\u003c/p\u003e\u003cp\u003eTo further elucidate the molecular mechanism by which SHK disrupts the FHL2/FOXO1 complex, we expressed Flag-FHL2 and HA-FOXO1 separately in HEK293T cells. After pre-incubating SHK with Flag-FHL2, we continued to incubate with HA-FOXO1. The immunoprecipitation results showed that SHK significantly reduced the interaction between FHL2 and FOXO1. Conversely, after pre-incubating SHK with HA-FOXO1 and then incubating with Flag-FHL2, the immunoprecipitation results indicated that the inhibitory effect of SHK on the interaction between FHL2 and FOXO1 disappeared (Figs.\u0026nbsp;5H-I). These results collectively demonstrate that SHK specifically targets FHL2 protein, thereby effectively disrupting the formation of the FHL2-FOXO1 complex.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003e3.6. SHK Up-regulates FOXO1 Expression and Induces Apoptosis in Lung Adenocarcinoma\u003c/h2\u003e\u003cp\u003eFOXO1, a critical member of the FOXO transcription factor family, plays a pivotal role in maintaining cellular homeostasis by regulating the balance between cell proliferation and apoptosis. Dysregulation of FOXO1 has been strongly implicated in tumorigenesis. To investigate the potential involvement of FOXO1 in SHK\u0026rsquo;s anti-cancer effects, we examined its expression following SHK treatment. As shown in (Figures 6A\u0026ndash;B), SHK treatment did not significantly alter FOXO1 mRNA levels in A549 and H1299 cells. However, Western blot analysis revealed a dose-dependent increase in FOXO1 protein expression with rising SHK concentrations (Figs.\u0026nbsp;6C\u0026ndash;D). Consistent with these findings, qPCR analysis of PDX model mouse tissues showed no notable change in FOXO1 mRNA expression (Fig.\u0026nbsp;6E). In contrast, both Western blot and immunohistochemical (IHC) staining demonstrated elevated FOXO1 protein levels in SHK-treated tumor tissues compared to controls (Figs.\u0026nbsp;6F\u0026ndash;G). These results suggest that SHK suppresses lung cancer growth by upregulating FOXO1 at the protein level, rather than through transcriptional regulation.\u003c/p\u003e\u003cp\u003ePrevious studies indicate that the FHL2/FOXO1 complex formation attenuates FOXO1 acetylation and reduced intracellular level of FOXO1, ultimately suppressing apoptosis in cancer cells\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. In non-small cell lung cancer (NSCLC), reduced nuclear translocation of FOXO1 has been shown to alleviate tumor cell apoptosis\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Our present data demonstrate that SHK effectively disrupted the formation of the FHL2-FOXO1 complex. To investigate the functional outcomes of SHK-mediated complex disruption, we examined the molecular and phenotypic changes in FOXO1 following SHK treatment. We next assessed FOXO1 acetylation levels. As shown in ( Figs.\u0026nbsp;6H-I ) SHK treatment significantly enhanced FOXO1 acetylation. Nuclear fractionation assays demonstrated markedly increased FOXO1 nuclear translocation following SHK treatment (Figs.\u0026nbsp;6J-K. These findings were further corroborated by immunofluorescence analysis (Figs.\u0026nbsp;6L-M). Together, these results demonstrate that SHK disrupts the FHL2-FOXO1 complex, elevates FOXO1 acetylation, promotes its nuclear translocation, and consequently induces apoptosis to inhibit lung cancer growth.\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eTraditional Chinese Medicine (TCM) has demonstrated favorable efficacy in treating cardiovascular, cerebrovascular, digestive, and respiratory system diseases, as exemplified by the application of artemisinin for malaria treatment\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e; consequently, the active constituents derived from natural products are receiving increasing attention, rendering it imperative to thoroughly explore their pharmacological mechanisms. SHK, a compound derived from the Lithospermum erythrorhizon has been primarily investigated for its effects on inflammation and cancer\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e, with its potent anti-cancer activity having been validated across a broad spectrum of malignancies, where it exerts anti-tumor effects through mechanisms including modulation of reactive oxygen species (ROS) levels\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, inhibition of the NF-κB signaling pathway\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, or activation of p53-dependent apoptotic pathways\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. In this study, it was demonstrated that SHK induces apoptosis in lung adenocarcinoma cells both in vitro and in vivo by targeting FHL2, thereby influencing the formation of the FHL2-FOXO1 complex and enhancing the acetylation level of FOXO1.\u003c/p\u003e\u003cp\u003eIn malignant tumors, the inhibition of apoptotic pathways confers a survival advantage to cancer cells, representing a key mechanism underlying tumor resistance and recurrence\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Conventional cancer therapies, such as chemotherapy and radiotherapy, aim to induce cancer cell apoptosis. However, many cancer cells exhibit intrinsic or acquired resistance to these treatments or harbor defects in apoptotic pathways. Apoptosis, a programmed cell death process, primarily occurs through two pathways: the mitochondria-mediated intrinsic pathway and the death receptor-mediated extrinsic pathway. The intrinsic pathway is predominantly regulated by the Bcl-2 protein family, where the interaction between the anti-apoptotic member Bcl-2 and the pro-apoptotic member Bax modulates mitochondrial outer membrane permeabilization (MOMP), leading to the release of cytochrome c (Cyto c) into the cytosol. Released Cyto c activates caspase-9, which subsequently cleaves and activates the downstream effector caspase-3\u003csup\u003e40,41\u003c/sup\u003e. The extrinsic pathway is initiated by the binding of death receptors to their ligands, ultimately also resulting in caspase-3 activation and execution of apoptosis. Poly(ADP-ribose) polymerase (PARP) exhibits a unique biphasic role in apoptosis regulation. Under conditions of mild DNA damage, PARP promotes cell survival by initiating the base excision repair pathway\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Conversely, when DNA damage exceeds cellular repair capacity, hyperactivation of PARP triggers the apoptotic program\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. In this study, flow cytometry initially confirmed that SHK significantly promotes tumor cell apoptosis. Further validation using Western blot and IHC demonstrated that SHK upregulates the expression levels of key pro-apoptotic proteins. These findings collectively indicate that SHK exerts its anti-tumor activity by inducing tumor cell apoptosis.\u003c/p\u003e\u003cp\u003eBuilding on previous work where TPP and SIP were used to identify SHK target proteins, bioinformatics analysis and molecular docking were employed to screen FHL2 as the target mediating SHK-induced apoptosis ( Figs.\u0026nbsp;2A-C). In LUAD patients, FHL2 protein expression was found to be significantly higher than in normal tissues, and its expression level was negatively correlated with patient survival time\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e,\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e, consistent with the results obtained from our clinical samples (Figs.\u0026nbsp;3C-D). Previous research has utilized in vitro FHL2 knockdown to inhibit cancer cell migration, invasion, and angiogenesis, and to induce apoptosis, as well as to suppress metastatic dissemination in vivo\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. However, the clinical application of this genetic approach remains largely unexplored. Targeting FHL2 protein expression pharmacologically, particularly in combination with TCM-based therapies like SHK, represents a novel avenue for LUAD treatment and holds profound significance for discovering new molecularly targeted therapies. In this study, Western blot analysis revealed that FHL2 protein expression was significantly downregulated following SHK treatment both in vitro and in vivo, whereas no alteration was observed at the transcriptional level. The promotion of FHL2 protein degradation by SHK was further confirmed by CHX chase assays(Figs.\u0026nbsp;4 ). Knockdown of FHL2 was found to promote tumor cell apoptosis; however, no additive apoptotic effect was observed when SHK was administered to FHL2-knockdown cells (Figs.\u0026nbsp;3I-G). Collectively, these results establish FHL2 as the critical direct binding target through which SHK-mediated apoptosis and tumor growth suppression are exerted. A limitation of this study is that the specific pathway responsible for FHL2 degradation was not further explored.\u003c/p\u003e\u003cp\u003eThe LIM domain, a cysteine-rich zinc finger motif, facilitates protein-protein interactions\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. FHL2, through interactions with other cellular proteins, participates in regulating vital cellular functions, including gene expression, signal transduction, cell adhesion, proliferation, and survival\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Within the prostate, FHL2 suppresses FOXO1 activity in prostate cancer cells by facilitating the deacetylation of FOXO1 through enhancement of the interaction between SIRT1 and FOXO1, thereby inhibiting tumor cell apoptosis\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Furthermore, FOXO1 deacetylation has been associated with increased ubiquitination and subsequent decreased expression within the cell, conversely, suppression of deacetylation promotes its nuclear accumulation\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e,\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. Knockdown of the FHL2 gene has been reported to increase FOXO1 expression within the nucleus\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e.Therefore, reducing FHL2-FOXO1 complex formation may represent a novel therapeutic strategy for improving survival outcomes in LUAD patients. In this study, Co-IP assays confirmed that SHK disrupts FHL2-FOXO1 complex formation in vitro (Figs.\u0026nbsp;5E-I). Nuclear accumulation of FOXO1 was observed, and subcellular fractionation assays confirmed that FOXO1 expression in the nucleus was increased by SHK treatment, We speculate that the apoptotic mechanism of SHK in the treatment of lung adenocarcinoma is as follows (Fig.\u0026nbsp;7).FOXO1, a crucial member of the FOXO family, acts as a transcription factor. Its dysregulation disrupts the balance between cell proliferation and death and is closely associated with tumorigenesis. FOXO1 undergoes diverse post-translational modifications, including phosphorylation, methylation, acetylation, and ubiquitination, and interacts with multiple signaling pathways such as PI3K/Akt, EZH2/STAT3, JAK/STAT3, MAPK/ERK, Wnt/β-catenin, and NF-κB/Snail, thereby regulating tumor cell proliferation, apoptosis, and progression\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Recent reports highlight FOXO1's role in limiting CAR T cell exhaustion and enhancing anti-tumor activity\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e,\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. Multiple studies have found decreased FOXO1 expression in various solid tumors\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e, FOXO1 can induce apoptosis in human LUAD cells by upregulating its target gene Bim via the PI3K/Akt pathway\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e, Cinobufagin induces FOXO1-regulated apoptosis,by inhibiting G9a in non-small-cell lung cancer A549 cells\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. Consequently, elevating FOXO1 expression in tumor cells can inhibit proliferation. FHL2 is aberrantly overexpressed in LUAD and correlates with poor prognosis, while low FOXO1 expression is associated with reduced 5-year survival rates, suggesting that their reciprocal expression pattern may serve as a novel prognostic biomarker. This study confirmed the FHL2-FOXO1 interaction and demonstrated that SHK reduces complex formation. FOXO1 protein expression decreased in cells overexpressing FHL2 but increased upon SHK treatment. Immunofluorescence assays further confirmed increased nuclear accumulation of FOXO1. The elevated expression of FOXO1 protein promoted tumor cell apoptosis, which was validated in this study.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn conclusion, our study demonstrates that SHK significantly inhibits lung adenocarcinoma (LUAD) growth both in vitro and in vivo. Mechanistically, SHK targets FHL2 to disrupt FHL2-FOXO1 complex formation, promoting FHL2 degradation while enhancing FOXO1 acetylation and nuclear translocation. These changes activate the downstream caspase signaling cascade, inducing cellular apoptosis and ultimately suppressing tumor growth. Our findings elucidate the molecular mechanism of SHK-mediated LUAD inhibition through the FHL2-FOXO1 signaling axis, not only providing a novel theoretical foundation for its clinical application but also offering new perspectives for developing therapeutic drugs targeting this pathway in LUAD treatment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eDeclaration of Competing Interest\u003c/h2\u003e\u003cp\u003eThe author declares no conflict of interest.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e\u003cp\u003e\u003cb\u003eShiqun Chen\u003c/b\u003e: Writing - original draft, Investigation. \u003cb\u003eMeirong Zhou\u003c/b\u003e: Data curation. \u003cb\u003eWen Zhang\u003c/b\u003e: Methodology, Formal analysis.\u003cb\u003eJiyong Zhong\u003c/b\u003e: Formal analysis. \u003cb\u003eWenqian Han\u003c/b\u003e: Software,Methodology.\u003cb\u003eZhaoxuan Wang\u003c/b\u003e: Methodology, Software. \u003cb\u003eShiqing Wang\u003c/b\u003e: Resources, Project administration. \u003cb\u003eChundong Gu\u003c/b\u003e: Data curation, Conceptualization. \u003cb\u003eZhenlong Yu\u003c/b\u003e: Writing e review \u0026amp; editing, Supervision. \u003cb\u003eShilei Zhao\u003c/b\u003e: Writing - review \u0026amp; editing, Supervision, Funding acquisition.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e\u003cp\u003eThis study was supported by the Liaoning Provincial Science and Technology Program Joint Plan (Natural Science Foundation-General Program, Grant No. 2024-MSLH-087), the Dalian Science and Technology Innovation Fund Project (Grant No. 2022DF040), and the Postdoctoral Fellowship Program of CPSF (Grant No. GZB20250895).\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll relevant data are presented in the manuscript and its Supplementary Information. The source data underlying the figures, including raw values for statistical analyses, are provided as a Source Data file. Uncropped scans of all blots and original microscopy images have been included as part of the Supplementary Information. Full datasets are permanently archived and available from the corresponding author upon request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLeiter A, Veluswamy RR, Wisnivesky JP. The global burden of lung cancer: current status and future trends. Nat Rev Clin Oncol. 2023;20:624\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHendriks LEL, et al. Non-small-cell lung cancer. Nat Rev Dis Primers. 2024;10:71.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang M, Herbst RS, Boshoff C. Toward personalized treatment approaches for non-small-cell lung cancer. Nat Med. 2021;27:1345\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSuresh K, Naidoo J, Lin CT, Danoff S. Immune Checkpoint Immunotherapy for Non-Small Cell Lung Cancer: Benefits and Pulmonary Toxicities. Chest. 2018;154:1416\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTan AC, Tan DS. W. Targeted Therapies for Lung Cancer Patients With Oncogenic Driver Molecular Alterations. J Clin Oncol. 2022;40:611\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShu J, Jiang J, Zhao G. Identification of novel gene signature for lung adenocarcinoma by machine learning to predict immunotherapy and prognosis. Front Immunol. 2023;14:1177847.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVerset L, Feys L, Tr\u0026eacute;pant A-L, De Wever O, Demetter P. FHL2: a scaffold protein of carcinogenesis, tumour-stroma interactions and treatment response. Histol Histopathol. 2016;31:469\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWixler V, et al. The LIM-only protein DRAL/FHL2 binds to the cytoplasmic domain of several alpha and beta integrin chains and is recruited to adhesion complexes. J Biol Chem. 2000;275:33669\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Z, et al. The LIM-Only Protein FHL2 is involved in Autophagy to Regulate the Development of Skeletal Muscle Cell. Int J Biol Sci. 2019;15:838\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLai C-F, et al. Four and half lim protein 2 (FHL2) stimulates osteoblast differentiation. J Bone Min Res. 2006;21:17\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang T, Zeng Q, Wang J. Unlocking the secrets of Cardiac development and function: the critical role of FHL2. Mol Cell Biochem. 2025;480:2143\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu X, et al. Identification of CFH and FHL2 as biomarkers for idiopathic pulmonary fibrosis. Front Med (Lausanne). 2024;11:1363643.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang J, Zeng Q, She M. The roles of FHL2 in cancer. Clin Exp Med. 2023;23:3113\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBai S, Zha J, Zhao H, Ross FP, Teitelbaum SL. Tumor necrosis factor receptor-associated factor 6 is an intranuclear transcriptional coactivator in osteoclasts. J Biol Chem. 2008;283:30861\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi N, Xu L, Zhang J, Liu Y. High level of FHL2 exacerbates the outcome of non-small cell lung cancer (NSCLC) patients and the malignant phenotype in NSCLC cells. Int J Exp Pathol. 2022;103:90\u0026ndash;101.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen T, et al. Promotion of non-small cell lung cancer tumor growth by FHL2 via inducing angiogenesis and vascular permeability. J Thorac Dis. 2024;16:1424\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKanzaki R, et al. FHL2 expression by cancer-associated fibroblasts promotes metastasis and angiogenesis in lung adenocarcinoma. Int J Cancer. 2025;156:431\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMollaei S, Khanehbarndaz O, Gerami-Khashal Z, Ebadi M. Molecular identification and phytochemical screening of endophytic fungi isolated from Lithospermum officinale L. roots: A new source of shikonin. Phytochemistry. 2019;168:112116.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIranzadeh S, Dalil D, Kohansal S, Isakhani M. Shikonin in breast cancer treatment: a comprehensive review of molecular pathways and innovative strategies. J Pharm Pharmacol. 2024;76:967\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Y, et al. Induction of Ferroptosis by Shikonin in Gastric Cancer via the DLEU1/mTOR/GPX4 Axis. Cell Biol Int. 2025;49:757\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYu Z, et al. Characterization of a small-molecule inhibitor targeting NEMO/IKKβ to suppress colorectal cancer growth. Signal Transduct Target Ther. 2022;7:71.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun Q, et al. Shikonin, a naphthalene ingredient: Therapeutic actions, pharmacokinetics, toxicology, clinical trials and pharmaceutical researches. Phytomedicine. 2022;94:153805.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiang J, et al. Shikonin and chitosan-silver nanoparticles synergize against triple-negative breast cancer through RIPK3-triggered necroptotic immunogenic cell death. Biomaterials. 2024;309:122608.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu B, et al. RIP1 and RIP3 contribute to shikonin-induced glycolysis suppression in glioma cells via increase of intracellular hydrogen peroxide. Cancer Lett. 2018;425:31\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang L, et al. Extracellular Vesicles-Derived Hybrid Nanoplatforms for Amplified CD47 Blockade-Based Cancer Immunotherapy. Adv Mater. 2023;35:e2303835.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH F et al. Thermal proteome profiling for unbiased identification of direct and indirect drug targets using multiplexed quantitative mass spectrometry. Nat Protoc 10, (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eX Z et al. Solvent-Induced Protein Precipitation for Drug Target Discovery on the Proteomic Scale. Anal Chem 92, (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheng Y-J, et al. High Id1 expression, a generally negative prognostic factor, paradoxically predicts a favorable prognosis for adjuvant paclitaxel plus cisplatin therapy in surgically treated lung cancer patients. Oncotarget. 2014;5:11564\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePonz-Sarvis\u0026eacute; M, et al. Inhibitor of differentiation-1 as a novel prognostic factor in NSCLC patients with adenocarcinoma histology and its potential contribution to therapy resistance. Clin Cancer Res. 2011;17:4155\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTan H-Y, et al. ID1 overexpression increases gefitinib sensitivity in non-small cell lung cancer by activating RIP3/MLKL-dependent necroptosis. Cancer Lett. 2020;475:109\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ X et al. A single-cell characterised signature integrating heterogeneity and microenvironment of lung adenocarcinoma for prognostic stratification. \u003cem\u003eEBioMedicine\u003c/em\u003e 102, (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eY Y, Em HH, Sv H, N., W B. Suppression of FOXO1 activity by FHL2 through SIRT1-mediated deacetylation. EMBO J 24, (2005).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKitamura YI, et al. FoxO1 protects against pancreatic beta cell failure through NeuroD and MafA induction. Cell Metab. 2005;2:153\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eY Z et al. S-nitrosylation of the Peroxiredoxin-2 promotes S-nitrosoglutathione-mediated lung cancer cells apoptosis via AMPK-SIRT1 pathway. Cell Death Dis 10, (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJp D, A, M., N K. Diagnosis, Treatment, and Prevention of Malaria in the US: A Review. JAMA 328, (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eC L et al. Shikonin induces ferroptosis in osteosarcomas through the mitochondrial ROS-regulated HIF-1α/HO-1 axis. Phytomedicine: Int J phytotherapy phytopharmacology 135, (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJ P et al. Up-Regulation of p53/miR-628-3p Pathway, a Novel Mechanism of Shikonin on Inhibiting Proliferation and Inducing Apoptosis of A549 and PC-9 Non-Small Cell Lung Cancer Cell Lines. \u003cem\u003eFrontiers in pharmacology\u003c/em\u003e 12, (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eW G, X, W., Y, Z., X, W., Y Y. Autophagy, ferroptosis, pyroptosis, and necroptosis in tumor immunotherapy. \u003cem\u003eSignal transduction and targeted therapy\u003c/em\u003e 7, (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eX H et al. Tumor-derived apoptotic extracellular vesicle-mediated intercellular communication promotes metastasis and stemness of lung adenocarcinoma. Bioactive Mater 36, (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eN R, Jb FS-R, P., G B. Modulation of Ca2\u0026thinsp;+\u0026thinsp;signaling by antiapoptotic Bcl-2 versus Bcl-xL: From molecular mechanisms to relevance for cancer cell survival. Biochim et Biophys acta Reviews cancer 1877, (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eE E, Cj E. Paradoxical roles of caspase-3 in regulating cell survival, proliferation, and tumorigenesis. J Cell Biol 221, (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZ Z, Ł O, E G. Methods of PARP-1 Determination and its Importance in Living Organisms. Protein Pept Lett 29, (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eV S-B, T, A., A S-K. Apoptotic proteins with non-apoptotic activity: expression and function in cancer. \u003cem\u003eApoptosis: an international journal on programmed cell death\u003c/em\u003e 28, (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang S, et al. FHL2 promotes the aggressiveness of lung adenocarcinoma by inhibiting autophagy via activation of the PI3K/AKT/mTOR pathway. Thorac Cancer. 2024;15:630\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM J, U SMTH. M. \u0026amp; M, V. G. The multifunctional roles of the four-and-a-half-LIM only protein FHL2. Cell Mol Life Sci 63, (2006).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCy C, Sw M, Vw C, Sk T. The FHL2 regulation in the transcriptional circuitry of human cancers. Gene 572, (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eY Y et al. Acetylation of FoxO1 activates Bim expression to induce apoptosis in response to histone deacetylase inhibitor depsipeptide treatment. Neoplasia (New York N Y) 11, (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJj H et al. Glucose-mediated insulin secretion is improved in FHL2-deficient mice and elevated FHL2 expression in humans is associated with type 2 diabetes. Diabetologia 65, (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM E et al. FOXO1, a tiny protein with intricate interactions: Promising therapeutic candidate in lung cancer. Biomed pharmacotherapy = Biomedecine pharmacotherapie 169, (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJd C et al. FOXO1 enhances CAR T cell stemness, metabolic fitness and efficacy. Nature 629, (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAe D et al. FOXO1 is a master regulator of memory programming in CAR T cells. Nature 629, (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eY C et al. CircHERC1 promotes non-small cell lung cancer cell progression by sequestering FOXO1 in the cytoplasm and regulating the miR-142-3p-HMGB1 axis. Mol Cancer 22, (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR D et al. SYUNZ-16, a newly synthesized alkannin derivative, induces tumor cells apoptosis and suppresses tumor growth through inhibition of PKB/AKT kinase activity and blockade of AKT/FOXO signal pathway. Int J Cancer 127, (2010).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-translational-medicine","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtrm","sideBox":"Learn more about [Journal of Translational Medicine](http://translational-medicine.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/jtrm/default.aspx","title":"Journal of Translational Medicine","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"SHK, FHL2, FOXO1, Lung adenocarcinoma, Apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-8119297/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8119297/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: FHL2 is an oncogenic scaffold protein overexpressed in lung LUAD, making it a promising therapeutic target. SHK a natural naphthoquinone, exhibits anti-tumor activity, but its molecular mechanism in LUAD, particularly its relationship with FHL2, remains unclear.\u003c/p\u003e\n\u003cp\u003eAim of the study: The present study aimed to define the effects of SHK on NSCLC and identify the potential molecular mechanisms.\u003c/p\u003e\n\u003cp\u003eMethods: The anti-tumor effects of SHK were evaluated in LUAD cell lines (A549, H1299) and a patient-derived xenograft (PDX) model using CCK-8, colony formation, Transwell, and flow cytometry assays. Integrated proteomics, bioinformatics, molecular docking, and cellular thermal shift assay (CETSA) were employed to identify SHK's direct target. The underlying mechanism was investigated through co-immunoprecipitation (Co-IP), Western blot, qRT-PCR, cycloheximide (CHX) chase assay, and immunofluorescence/immunohistochemistry (IF/IHC).\u003c/p\u003e\n\u003cp\u003eResults: In both in vitro and PDX models, SHK potently inhibited LUAD growth, metastasis, and induced cell death. At the molecular level, FHL2 was identified as a direct target of SHK. Direct binding of SHK to FHL2 promoted its proteasomal degradation, thereby disrupting the FHL2-FOXO1 complex. The dissociation of this complex enhanced FOXO1 acetylation and promoted its nuclear translocation, leading to the subsequent activation of the caspase cascade and apoptosis.\u003c/p\u003e\n\u003cp\u003eConclusion: Our findings elucidate a novel signaling pathway through which SHK inhibits LUAD: by directly targeting FHL2 for degradation, SHK disrupts the FHL2-FOXO1 complex, which activates FOXO1-mediated transcription and triggers apoptosis. This study not only provides mechanistic insight into SHK's anti-tumor function but also nominates the FHL2-FOXO1 axis as a potential therapeutic target for LUAD.\u003c/p\u003e","manuscriptTitle":"Shikonin triggers apoptosis in lung adenocarcinoma through FHL2-FOXO1 signaling axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-08 06:44:17","doi":"10.21203/rs.3.rs-8119297/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-12-02T06:21:53+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-01T09:34:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-26T10:22:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Translational Medicine","date":"2025-11-25T10:36:06+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-translational-medicine","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jtrm","sideBox":"Learn more about [Journal of Translational Medicine](http://translational-medicine.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/jtrm/default.aspx","title":"Journal of Translational Medicine","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"11e006d4-6fa8-425f-9c63-e5538b20fabc","owner":[],"postedDate":"December 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-06T10:51:45+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-08 06:44:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8119297","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8119297","identity":"rs-8119297","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00