PDIA6 promotes immune escape of head and neck squamous cell carcinoma by regulating TIGIT/CD155 axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article PDIA6 promotes immune escape of head and neck squamous cell carcinoma by regulating TIGIT/CD155 axis Weiwei Jiang, Ji Wang, Kai Song, Zhengpeng Gong, Ming Yu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3828950/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract BACKGROUND Protein disulfide isomerases A6 (PDIA6) is a family member of the PDI enzymes. Recently, it was found that PDIA6 is closely associated with a variety of cancers. Here, we studied the role of PDIA6 in pan-cancer and further verified the results in head and neck squamous cell carcinoma (HNSCC) through in vitro experiments. METHODS The TCGA database and GEPIA2 were used to assess PDIA6's potential as a diagnostic and prognostic biomarker in pan-cancer. The cBioPortal database was used to examine the PDIA6 mutation character. PDIA6 function analysis was carried out using the LinkedOmics and CancerSEA databases. The TIMER and TISIDB websites were used to investigate the role of PDIA6 in immunological infiltration.PDIA6 mRNA and protein expression were identified in HNSCC tissues. PDIA6 expression was detected in primary HNSCC tissues and cell lines using RT-qPCR, Western blotting, and immunohistochemistry. Furthermore, PDIA6 deletion and overexpression cell lines were developed to investigate the interaction of PDIA6 and TIGIT/CD155, as well as the influence of PDIA6 on cell proliferation and metastasis in vitro. RESULTS PDIA6 was elevated in the majority of malignancies. In numerous malignancies, the overexpression and mutation of PDIA6 were associated with a poorer prognosis. In the majority of malignancies, the results revealed a strong positive association between PDIA6 and myeloid-derived suppressor cell (MDSC) infiltration and a significant negative correlation between PDIA6 and T-cell natural killer (NK) infiltration. Experiments in vitro revealed that PDIA6 levels were elevated in HNSCC tissues and cell lines. The connection between PDIA6 expression and CD8 + T-cell infiltration was negative. In addition, PDIA6 was found to be co-expressed with immune-related genes and immune-checkpoints. The effect of PDIA6 on immune evasion of head and neck cancers may be mediated by the TIGIT/CD155 signal pathway. CONCLUSION PDIA6 could be a biomarker and an oncogene in HNSCC and other types of cancer. Also, PDIA6 was linked to immune cell infiltration in pan-cancer, which could be a target for immune therapy to treat tumors. head and neck squamous cell carcinoma PDIA6 CD155 TIGIT Immune escape Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 INTRODUCTION Head and neck squamous cell carcinoma (HNSCC) is one of the most frequent head and neck cancers, with a high recurrence rate and a low survival rate. In 2020, there were approximately 931.7 thousand newly diagnosed cases of HNSCC worldwide, and over 467,100 people died from this disease (1–3). The current study confirmed that smoking, alcohol consumption, HPV infection, and immune status are the most important risk factors for HNSCC(4). So far, a number of treatments for HNSCC have been approved, including surgery, radiotherapy, chemotherapy, and immunotherapy. However, there is no significant survival advantage for patients with advanced or recurring illnesses, and the 5-year survival rate remains 40–60%(5, 6). Consequently, HNSCC has an urgent need for novel treatment targets and techniques. Protein Disulfide Isomerase Family A, Member 6 (PDIA6) is a member of the protein disulfide isomerase (PDI) family that is found mostly in the endoplasmic reticulum (ER)(7). PDIA6 can stimulate the production of disulfide bonds, promote protein folding, and prevent unfolded substrate aggregation. Previous research has indicated that PDIA6 plays an important role in cancer progression(8). Evidence from previous research suggests that the response rate to immunotherapy and prognosis in HNSCC patients may be controlled by the overexpression of immunosuppressive molecules and tumor-infiltrating immune cells (TIICs)(9). The level of immune cell infiltration was found to be a sensitive prognostic biomarker and a predictive indication of response to immunotherapy (10). Recent studies have shown that PDIA6 to a poor prognosis in pancreatic cancer (8), non-small cell lung cancer (11), and oral squamous cell carcinoma (12). However, no research has been conducted to determine whether PDIA6 overexpression affects the tumor immune microenvironment in HNSCC. Poliovirus receptor (PVR, CD155), a representative of the nectinlike protein family, has recently been identified as a promising target in immunotherapy for enhancing antitumor responses. The poliovirus receptor is drastically overexpressed in some human malignant tumors, yet it is missing or modest in most healthy tissues(13, 14). CD155 possesses immunomodulatory properties. It is capable of interacting with CD226, TIGIT, and CD96 to provide costimulatory and coinhibitory signals. However, the imbalance in the tumor microenvironment causes tumor cells to evade immune surveillance, resulting in the development of tumors(15). We investigated the potential utility of PDIA6 in cancer diagnosis and prognosis using an exhaustive investigation. In addition, we conducted an enrichment analysis of PDIA6 co-expression genes and investigate their relationship with immune infiltration. Moreover, we confirmed our bioinformatics results using in vitro tests. Our findings indicate that PDIA6 can serve as an oncogene and biomarker for immune infiltration in pan-cancer, particularly HNSCC. Materials and methods Bioinformatic analysis Data Source and Differential Expressions Analysis Gene expression and clinical characteristics of HNSC patients were extracted from The Cancer Genome Atlas (TCGA) database ( https://portal.gdc.cancer.gov/ ). Diagnostic and Prognostic Analysis The potential utility of PDIA6 in cancer diagnosis was identified using a ROC curve and TCGA database data. AUC > 0.85 was considered a significant diagnostic value. overall survival (OS) and disease-free survival (DFS) from the GEPIA2 database(gepia2.cancer-pku.cn/#index) were used to assess the potential role of PDIA6 in cancer prognosis. The Relationship Between PDIA6 and Immune Cell Infiltration in HNSC TME The TIMER 2.0 database's "GENE" module was used to assess the level of immune cell infiltration in 32 cancer types. The TIMER database ( https://cistrome.shinyapps.io/timer/ ) was used to investigate the relationships between HNSC and TIICs. Dendritic cells, B cells, neutrophils, CD4 + T cells, macrophages, and CD8 + T cells were found in the TIICs in TIMER. Following that, we used the ESTIMATE algorithm from the R packages "estimate" and "limma" to compute immune and stromal scores. We used CIBERSORT to estimate the abundance of specific cells in hybrid cell populations using gene expression datasets to analyze tumor purity and stromal/immune cell infiltration in HNSC tissue based on PDIA6 expression data. We then used R packages "ggplot2," "ggpubr," and "ggExtra" to examine the relationship between PDIA6 and TME or immune cell infiltratio. Immune-checkpoint Analysis We analyzed the differences between the immune cells in the two sets of samples using the CIBERSORT algorithm in the Immundeconv package and a heat map to display the results. The horizontal axis represents the subgroup type based on differentially expressed immune-related genes, whereas the vertical axis represents the immune cell type, which demonstrates the distinction. The color represents the expression pattern in the various samples.Using ggplot2 and pheatmap, we analyzed the expression values of the eight immune checkpoint-related genes (SIGLEC15, TIGIT, CD274, HAVCR2, PDCD1, CTLA4, LAG3, and PDCD1LG2) and observed their expression. Wilcoxon's signed-rank test was used to determine the significance of the two sample groups. Identification of OS Prognostic Factors in HNSCC Univariate and multivariate Cox regression analyses were used to evaluate PDIA6 and five major clinical and prognostic factors, including age, gender, stage, grade, and newTumor, in order to determine the appropriate terms for the nomogram. Using the "forestplot" R package, the forest plots displayed the HR, 95% CI, and p-value of every variable. Using R software (version 4.0.2) with the "rms" packages, a nomogram was developed to predict the 1-year, 3-year, and 5-year overall recurrence based on the results of multivariate Cox proportional hazards analysis. Construction of protein–protein interaction (PPI) networks Using the STRING (Search Tool for the Retrieval of Interacting Genes/Proteins database) ( https://string-db.org/ ), the PPI network of DEGs was constructed.The genes with a comprehensive score greater than 0.15 (median confidence) were chosen. Cytohubba, a plugin for Cytoscape, was used to collect and analyze data regarding the PPI network. The network graph may depict the interactions between proteins. According to the betweenness and degree values, genes were ranked. The top 15 genes in each category were considered hub genes. Patients and specimens The subjects were 20 pairs of fresh HNSCC tissues and normal tissues adjacent to cancer collected from the affiliated Hospital of Guizhou Medical University from 2021 to 2022, and 10 of them were extracted for PDIA6 expression detection. All the experiments met the requirements of the Institutional Review Committee of Guizhou Medical University and the Helsinki Declaration (approved ID2021243). Immunohistochemistry and Immunohistochemistry assessment Immunohistochemistry was used to determine the PDIA6 expression level. Sections of tumor microarray (TMA) were deparaffinized in three 7-minute baths of xylene and rehydrated by sequentially incubating with 100, 90, and 80 percent ethanol. Following a 2-minute rinsing with distilled water, the TMA slides were heated with citrate at 95°C for 2.5 minutes in a pressure cooker. The slides were then cooled to room temperature and washed three times for five minutes with 1XPBS. To inhibit endogenous peroxidase activity, the slides were incubated for 20 minutes in a 3% H2O2 solution and then rinsed three times for 5 minutes with 1X PBS. The slices were then incubated for 24 hours. anti-PDIA6 primary antibody (Abcam) at 1:200 dilution. The DAB detection kit (GK600510, Gene tech Shanghai) was utilized in accordance with the manufacturer's instructions following three 5-minute rinses in 1X PBS. After this step, each slide was counterstained with hematoxylin for 10 seconds. After 10 minutes of gentle washing with distilled water, the slides were dehydrated in 80%, 90%, and 100% ethanol and bathed in three different xylenes for 7 minutes each. The slides were subsequently mounted, coverslipped, and air-dried within the fume hood. Both a cytopathologist and a hematologist examined the stained slides. Both the intensity score (IS) and the positive score were used to classify PDIA6 staining (PS). When grading IS, we used four categories: negative (0), weak (1), moderate (2), and strong (3). When grading PS, we used four categories: negative (0), 80% negative (1), weak (2), moderate (3), and strong (4). We then multiplied IS by PS to get the immunoreactive score (IRS). PDIA6 expression levels in the final IRSs were categorized as low (4) or high (> 4). Cell lines and cell culture Human normal oral keratinocytes (HOK) and human HNSCC cell lines CAL27, FADU, SCC9, and SCC25 were obtained from China Center for Type Culture Collection (Shanghai, China). CAL27 was grown in DMEM medium (Gibco). FADU ,SCC25 and SCC9 cells were grown in a DMEM/F12 medium (Gibco). 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin were included in every culture medium. At 37°C, cells were cultured in an incubator that was humidified and contained 5% CO2. Cell transfection The human PDIA6 lentivirus targeting to upregulate PDIA6 (OE-PDIA6 ), the negative control (OE-NC), the shRNA lentivirus targeting to knock down PDIA6 (shPDIA6: 5’-GGTCACTGTCAAAGATTAACA-3’), and the shRNA negative control lentivirus (sh-NC) were ordered from GeneChem Co., Ltd (Shanghai, China). Transfection of Lentivirus was conducted in accordance with the manufacturer-recommended methodology. CCK8 assay and colony formation assay Cell proliferation was investigated by Cell counting kit-8 assay. We reseeded cells into a 96-well culture plate at a density of 4×10 3 in the logarithmic growth phase. For CCK-8 detection, cells were treated with CCK-8 (10 µl, Beyotime, Shanghai, China) for 1 h in an incubator at 37°C with 5% CO2. A microplate reader was used to detect the absorbance value at 450nm.Then, to detect the clonogenic ability of the cells, colony-forming assays were performed. Cells were seeded into the 6-well plate at a density of 800 per well. The crystal violet was used to stain the cells following incubation at 37°C in a 5% humidified atmosphere for about 10 days, and the colonies were counted to assess the clonogenic ability of the cells. Wound healing assay SCC25, SCC9, FADU, and CAL27 cells were seeded into six-well plates and grown to 100% confluence for the wound healing assay. Wounds were made in the middle of the cell monolayer and observed using a phase-contrast microscope at the indicated time intervals. The wound width was measured from four different angles. The ratio of the final and initial actual wound widths was used to calculate relative wound width. Cell migration and invasion assays In transwell chambers (Corning Costar, Corning, NY, USA), the migration and invasion of SCC25, SCC9, FADU, and CAL27 cell lines were evaluated. In brief, cells (2×10 4 cells/well) in serum-free medium (0.2 mL) were seeded into the top chamber that was either precoated with (invasion assay) or without (migration assay) Matrigel (Corning,Bedford,MA,USA). In the meantime, DMEM and DMEM/F12 containing 10% FBS (0.7 mL) were added to the lower chamber (as the chemokine). After 24 hours of incubation at 37°C with 5% CO2, nonmigrating and noninvading cells were removed from the top surface of the insert with a cotton swab, and the migrating or invading cells were fixed with 4% paraformaldehyde (Sangon Biotech) for 20 minutes and stained with 0.1% violet solution (Beyotime). The number of migrating or invading cells was determined using a microscope with ×100 magnification (Olympus, Tokyo, Japan). Each experiment was conducted three times. Realtime PCR and western blotting assays Total RNA was extracted from HNSCC tissues and cell lines using Trizol reagent (Invitrogen, Carlsbad, CA, USA) as according to the manufacturer's instructions. A NanoDrop spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc.) was used to measure the concentration. To reverse transcribe total RNA to cDNA, the PrimeScriptTM RT Reagent Kit (TaKaRa Biotechnology, Co., Ltd., Dalian, China) was used. RT-qPCR was then performed using SYBR Green PCR Master Mix (TaKaRa Biotechnology). The 2 − ΔΔCt method was used to calculate the data. The primer sequences are listed in Additional file Table 1 . The HNSCC tissue and cells were lysed in RIPA buffer containing phenylmethylsulphonyl fluoride (Beyotime Institute of Biotechnology, Haimen, China). Protein concentration was determined using the BCA method. Proteins were separated using 10% SDS-PAGE, transferred to PVDF membranes, and immunoblotted with the antibodies listed below: GAPDH (1:1000; CST), PDIA6 (1:1000; Abcam), CD155 (1:1000; Abcam), TIGIT(1:1000; Abcam), IRE1 (1:1000; Proteintech, Rosemont, IL, USA).The membranes were rinsed with TBST before being incubated with an HRP-conjugated secondary antibody, developed with an enhanced chemiluminescence reagent, and visualized using Image Lab software. Table 1 The primers used for qRT-PCR Gene Primer (5′-3′) PDIA6 F: GGCAGAACTGGTGAAGCCATTGTAG R: CGTCTGTCAGCTCAATCACATCCTTC GAPDH F: TATGACAACAGCCTCAAGAT R: AGTCCTTCCACGATACCA Immunoprecipitation assay FADU and CAL27 cells were lysed with IP buffer (1 mg/mL protein concentration) and incubated with anti-PDIA6 (1:100, Abcam) at 4°C overnight, followed by incubation with protein A/G Magbeads (Merck) at 4°C for 6 hours. The proteins were then separated from the Magbeads via a 10-minute treatment at 100°C. Washing the immunoprecipitated complexes was followed by western blot analysis. Flow cytometry Flow cytometry was used to assess the frequency of TIGIT and CD155 cell receptors in both HNSCC patients and the control group, using different monoclonal antibodies for surface markers. Prepare the samples for testing, 100µL of blood was transferred to test tubes. Cell surfaces were stained at room temperature (20°C–25°C) for 20 minutes with Purified anti-human CD3 (Biolegend), Pacific Blue™ anti-human CD8 (Biolegend), FITC anti-human CD4 (Biolegend), PE anti-human CD155 (PVR)(Biolegend), and APC anti-human TIGIT (Biolegend) antibodies to determine the percentage of TIGIT and CD155 on T CD4 + cells and T CD8 + cells.Containing 2 mL of Lysing Solution (BD FACS) for 10 minutes at room temperature (20°C–25°C) and protect the tubes from direct light. Following incubation, the cells were washed twice before being resuspended in FACS solution (phosphate-buffered saline) and examined on the same day in a FACS Calibur (BD Biosciences) flow cytometer. FlowJo V10.8.1 software was used to analyze the data. Statistical Analysis All data are expressed using the formula mean standard deviation. When appropriate, the Student t-test and one-way analysis of variance (ANOVA) were used for statistical analysis. The analysis of correlation was evaluated using Spearman's test. The analysis was conducted using SPSS22.0, and a p-value < 0.05 was regarded as statistically significant. RESULTS PDIA6 Expression Was Enhanced in Multiple Human Cancers To begin investigating PDIA6 expression levels, we used the TIMER 2.0 database to examine PDIA6 expression in TCGA datasets. PDIA6 was found to be upregulated in a large percentage of cancers, including breast invasive cancer (BRCA), bladder urothelial carcinoma (BLCA), cholangiocarcinoma (CHOL), colon adenocarcinoma (COAD), esophageal carcinoma (ESCA),glioblastoma multiforme (GBM), head and neck squamous cell carcinoma (HNSC), kidney chromophobe (KICH), liver hepatocellular carcinoma (LIHC), lung adenocarcinoma (LUAD),lung squamous cell carcinoma (LUSC), skin cutaneous melanoma compared (SKMC)stomach adenocarcinoma(STAD),thyroid carcinoma (THCA),and uterine corpus endometrial carcinoma (UCEC) (Figs. 1 A). The Diagnostic and Prognostic Value of PDIA6 in Pan-Cancer. Then we analyzed the diagnostic value of PDIA6 in various cancers using the ROC curve. As shown in Figs. 1 (B-E) , PDIA6 may act as a perfect diagnostic marker in HNSCC (AUC = 0.877),LGG (AUC = 0.981), LUAD (AUC = 0.8999), CHOL (AUC = 0.914), LUSC (AUC = 0.941),KICH (AUC = 0.978).Furthermore, increased expression of PDIA6 was linked to poor OS in LIHC (p = 0.001), LGG (p = 0.0015),KIRP (p = 0.01), BLCA (p = 0.019), CESC (p = 0.01), and HNSCC (p = 0.019) (Figs. 2 A–F). DFS results suggested that higher PDIA6 expression was correlated with poorer prognosis in LGG (p = 0.019), CESC (p = 0.036),LUAD(p = 0.0084), and PAAD (p = 0.041) (Figs. 2 G–J). Immune infiltration is linked to PDIA6 in Pan-Cancer PDIA6's potential role in immune cell infiltration was investigated using TIMER 2.0. In most tumors, the results indicated a significant positive correlation between myeloid-derived suppressor cell (MDSC) infiltration and PDIA6 expression(Fig. 3 A). The top 10 tumors were ACC (rho = 0.558, p = 2.89e-07), TGCT (rho = 0.546, p = 8.05e-13), UCEC (rho = 0.402, p = 8.13e-13), SKCM-Metastasis (rho = 0.392, p = 1.88e-14), LIHC (rho = 0.38, p = 2.86e-13), SKCM-Primary(rho = 0.359, p = 2.12e-14), PAAD(rho = 0.355, p = 1.88e-16) ,BLCA(rho = 0.338, p = 2.71e-11) ,HNSC (rho = 0.325, p = 1.37e-13) ,and HNSC-HPV- (rho = 0.321, p = 5.22e-11) (Fig. 3 B). Unexpectedly, the findings indicated a negative relationship between T-cell NK infiltration and PDIA6 expression in the majority of tumors(Fig. 3 C); the top 10 tumors were THCA (rho = -0.577, p = 1.01e-44), KICH (rho = -0.465, p = 9.47e-05), UVM (rho = -0.463, p = 2.19e-05), LUAD (rho = -0.459, p = 5.22e-27), SKCM-Primary (rho =-0.417, p = 1.27e-05), and PAAD (rho = -0.413, p = 2.03e-08), PRAD (rho = -0.405, p = 6.79e-18), PCPG (rho = -0.398, p = 1.04e-07), ACC (rho = -0.397, p = 5.02e-04),and CHOL (rho = -0.387, p = 2.17e-02) (Fig. 3 D). Then we investigated the role of PDIA6 in HNSCC immune cell infiltration. We found that there were significant differences in immune cells between the PDIA6 high expression group (G1) and the PDIA6 low expression group (G2) (Fig. 3 E).There was a negative association between PDIA6 and the infiltration level of B cells(rho = − 0.156, p = 5.05e-04), CD8 + T cells (rho = − 0.333, p = 3.40e-14) and a positive association between PDIA6 and the infiltration level of CD4 + T cells (rho = 0.343,p = 4.74e-15) ,Neutrophil(rho = 0.108,p = 1.69e-02) and Macrophage (rho = 0.175, p = 9.58e-05) (Fig. 3 F). Then, using the TISIDB database, we looked into the relationship between PDIA6 and MHCs and chemokine receptors. According to our findings, PDIA6 expression is negatively associated with the majority of MHCs. (Fig. 4 A). As for HNSC ,the top 3 MHCs were HLA-DOA (rho = − 0.193, p = 9.2e-06), HLA-DPB1 (rho = − 0.167, p = 0.000133), HLA-DMB (rho = − 0.164, p = 0.000172). Figure 4 B shows the correlations between PDIA6 expression and 18 kinds of chemokine receptors. The results suggested that PDIA6 was negatively associated with many chemokine receptors in HNSC; the top 3 were CXCR3 (rho = − 0.272, p = 2.9e-10),CCR5 (rho = − 0.254, p = 4.66e-09) , and CXCR6 (rho = − 0.238, p = 3.97e-08). PDIA6 had a positive correlation with some chemokine(receptors) (Figs. 4 E,F).The expression of immune-checkpoints, including CD274,CTLA4,HAVCR2,LAG3,PDCD1,PDCD1LG2,TIGIT,and SIGLEC15, were further investigated in the tumor group and normal group. The results illustrated that CD274 (p = 1.49e-06), HAVCR2 (p = 7.26e-16), PDCD1 (p = 2.90e-10),PDCD1LG2 (p = 4.90e-13), LAG3 (p = 0.001634573), CTLA4 (p = 1.38e-14 ), TIGIT(p = 5.18e-12),and SIGLEC15 (p = 1.31e-12). The findings showed that PDIA6 co-expressed with these immune-checkpoints, implying that PDIA6 could be a potential immunotherapy target. Analysis of the Function of PDIA6 in HNSCC Furthermore, we selected HNSCC to further investigate the biological role of PDIA6 in the LinkedOmics database. Figure 5 A displays the genes that are positively and negatively associated with PDIA6. The top 50 genes are depicted in Figs. 5 D and 5 E. In addition, GO analysis (Biological function) revealed that PDIA6 mostly binds to extracellular structural constituent, collagen binding, unfolded protein binding, etc. (Fig. 5 B). KEGG study revealed enrichment in endoplasmic reticulum protein processing, ECM-receptor interaction, N-Glycan biosynthesis, etc (Fig. 5 C). Figure 5 F depicts a network of PDIA6 and its putative co-expression genes in PDIA6-related DEGs. PDIA6 overexpression in HNSCC tissues. Then, we corroborate our bioinformatics findings using in vitro tests. PDIA6 expression was considerably elevated in HNSCC tissues.We utilized immunohistochemistry to detect PDIA6 expression in 125 cases of HNSCC and 40 cases of paracancerous normal tissues to study the role of PDIA6 in HNSCC. PDIA6 cytoplasmic staining is obviously significant in HNSCC tissues, whereas PDIA6 expression is modest or null in adjacent normal tissues(Fig. 6 ). We gathered 48 pairs of fresh tumor samples, including HNSCC and adjacent normal tissues, to better understand the role of PDIA6 in HNSCC. mRNA was extracted from 48 pairs of tissues, while protein was extracted from 10 pairs of tissues. The RT-qPCR results from 48 HNSCC samples and paired normal tissues showed that PDIA6 mRNA was significantly higher in HNSCC than in corresponding normal tissues (Fig. 6 ). Eight of the ten pairs of HNSCC samples and normal tissues had increased PDIA6 protein levels in tumor tissues (Fig. 6 ). PDIA6 was shown to be more expressed in HNSCC samples than in surrounding normal tissues, both at the mRNA and protein levels. TIGIT expression was increased on CD4 + and CD8 + cells and CD155 expression was increased on CD4 + cells in HNSCC patients. Flow cytometry was used in a separate set of experiments to count TIGIT + CD4 + T cells, TIGIT + CD8 + T cells and CD155 + CD4 + T cells in both groups. When HNSCC patients were compared to controls, there was a significant increase in TIGIT receptor expression on T CD4+ (p < 0.01) and T CD8 + cells (p < 0.001) (Fig. 6 E,F). Our findings also revealed that the proportion of T CD4 + cells expressing CD155 in the peripheral circulation of HNSCC patients was significantly higher than in healthy individuals (p < 0.001) (Fig. 6 E,F). Table 2 shows the percentages of TIGIT and CD155 in the control and HNSCC groups. Table 2 TIGIT, CD155 expression from PBMC in HD and HNSCC HD(n = 14) HNSC(n = 19) P Significance CD4 + TIGIT + T (%) 36.71 ± 5.23 24.14 ± 9.47 < 0.01 ** CD4 + CD155 + T (%) 5.40 ± 2.71 1.35 ± 0.54 < 0.001 *** CD8 + TIGIT + T (%) 65.52 ± 7.53 31.74 ± 10.19 < 0.001 *** PDIA6 in HNSCC promoted tumor growth and metastasis in vitro To further investigate the role of PDIA6 in HNSCC, we generated PDIA6 knockdown and overexpression cell lines and validated the interference at the mRNA and protein levels using real-time PCR and western blotting. As demonstrated in Fig. 7 A, SCC25 and SCC9 cells contained a greater proportion of endogenous PDIA6 than FADU and CAL27 cells. In this study, SCC25 and SCC9 cells were transfected with specific shRNA lentivirus (sh-PDIA6), whereas FADU and CAL27 cells were transfected with PDIA6 overexpression lentivirus (OE-PDIA6). Meanwhile, PDIA6 downregulation was observed to limit cell viability in SCC25 and SCC9 cells by CCK8 assay (Fig. 7 C,D), and PDIA6 overexpression boosted cell proliferation in FADU and CAL27 cells (Fig. 7 E,F). Cell viability was reduced when PDIA6 was knocked out. Furthermore, the number of colonies formed by SCC25 and SCC9 cells was much lower than that of FADU and CAL27 (Fig. 8 A). In the wound healing experiment, the migration of the PDIA6 knockdown group in SCC25 and SCC9 cell lines was significantly slower than that of the negative control group (Fig. 8 D).Furthermore, transwell experiments revealed that PDIA6 downregulation significantly reduced migratory and invasive capacity in SCC25 and SCC9 cell lines (Fig. 8 G,H,I), whereas PDIA6 overexpression significantly increased migratory and invasive ability in FADU and CAL27 cell line(Fig. 8 G,J,K). PDIA6 was found to increase HNSCC cell proliferation and metastasis in vitro. PDIA6 promoted UPR and activated CD155 signaling pathway in HNSCC cells The morphological and functional results induced by PDIA6 suggested PDIA6 may be an important facilitator of in HNSCC. PDIA6 expression in tumor cells may be associated with immunity. Herein, we determined UPR-related markers expression through western blotting, real-time PCR and immunoprecipitation assays after PDIA6 silencing and overexpression. As shown in Fig. 9 A, after PDIA6 was knocked down in SCC25 and SCC9 cells, the UPR marker IRE1 was elevated and CD155 descended at both protein and mRNA levels (Fig. 9 C, 9 D). As expected, PDIA6 overexpression exerted the opposite effects in FADU and CAL27 cells (Fig. 9 C, 9 D). Both real-time PCR and western blotting analysis validated this result. Furthermore, immunoprecipitation assays confirmed the expression level of the CD155 protein correspondingly increased or reduced following PDIA6 overexpression or knockdown. These results implied that PDIA6 may interact and bind with CD155 in HNSCC cells. The endogenous interaction between PDIA6 and CD155 was confirmed by the IP assay (Fig. 9 B). Discussion Located primarily in the endoplasmic reticulum, protein disulfide isomerase family 6 (PDIA6) is a member of the protein disulfide bond isomerase family. It aids in protein folding and prevents the aggregation of substrates that are unfolded and acts as an oxidoreductase to catalyze the formation of disulfide bonds (16). PDIA6 is the first selective UPR modulator that acts from the lumen of the endoplasmic reticulum (ER), where even the stress signal is generated. PDIA6 was discovered to be considerably elevated in numerous malignancies, and ROC curve analysis revealed that PDIA6 might be used as a diagnostic biomarker. Increased PDIA6 was associated with a poorer OS in LIHC, LGG, KIRP, HNSCC, BLCA and CESC, according to the prognostic analysis. We discovered that PDIA6 was highly elevated in HNSCC. The HNSCC was chosen to validate our bioinformatics result. PDIA6 was highly elevated in HNSCC tissues and cell lines throughout in vitro investigations. The tumor microenvironment (TME) is a crucial factor in cancer's persistence and resistance to treatment (17).TME immune cells are linked to immunotherapy efficacy, and they include CD4 + T cells, CD8 + T cells, MDSCs, and NKT cells (18–20). PDIA6 was associated with protein processing in the endoplasmic reticulum, extracellular matrix structural, collagen binding, and ECM-receptor interaction, according to GO and KEGG analyses.ER stress and UPR signaling play a functional role in HNSCC through regulating essential tumor biology processes, such as disease progression and therapeutic resistance. It is widely recognized that the UPR can exert positive selection on solid tumor cancer cells (21–23). The UPR is a signaling network that is activated by pathological and physiological circumstances. Researchers have investigated the connection between UPR activation indicators and cancer prognosis (24, 25). In addition, accumulating evidence suggests that the UPR signaling system and ER stress regulate essential tumor biological processes in HNSCC, such as progression and therapeutic resistance (23, 25). Three ER signaling pathways, ATF6, IRE1 and PERK, mediate the UPR (26). Different UPR signaling pathways may influence the expression levels of proteins involved in the biology of cancer cells. UPR signaling within physiologically reasonable range by binding a specific cysteine in the luminal domain of activated IRE1.Research has shown that PDIA6 terminates IRE1 signaling. PDIA6 encourages the inactivation of IRE1 by decreasing its oligomers. PDIA6 influences IRE1 (and PERK) directly, limiting its activation and aiding in its inactivation. PDIA6 regulates IRE1 signal degradation via disulfide-dependent association(27). CD155, which is highly expressed on a variety of tumor types, is linked to poor patient outcomes(28). CD155 is now recognized as a potent immune ligand with multiple exogenous cellular functions, in addition to its cell-intrinsic roles in tumor progression and metastasis. CD155's signaling on immune cells is mediated by interactions with the co-stimulatory immune receptor CD226 as well as the inhibitory checkpoint receptors TIGIT and CD96, which have opposing regulatory effects on NK cells and T cells at the cell surface(29). Solid tumors and blood tumors with higher levels of CD155 on their surfaces are more susceptible to NK cell-mediated CD226-dependent elimination (30, 31).In hepatoma cells, the ATF6 and IRE1 signaling pathways were engaged in the regulation of CD155 expression. During the UPR, knockdown of either of these two master regulators can restore CD155 expression and boost the cytotoxic activity of NK cells against hepatoma cells (32). Immune therapies are considered to be low-toxicity treatment options because of their high-affinity, targeted, and specific nature. These therapies can harness the activity of the host's immune system to prevent tumor escape(35). HNSCC cancer has been treated with immunotherapy drugs that aim to modulate anti-tumor immune response. Immunotherapy, however, is not as widely used as surgery, chemotherapy, or radiation therapy, and the more efficacious immunotherapy strategy for HNSCC is still being researched (33, 34). PDIA6 is a candidate biomarker and oncogene in pan-cancer, particularly HNSCC. PDIA6 was also discovered to be associated with immune cell infiltration in pan-cancer, indicating that it may be a valuable therapeutic target for immune-based tumor immunotherapies. The expression of PDIA6 was positively associated with HNSCC invasion and negatively associated with T cell NK invasion. CD8 + T cells, CD4 + T cells, T cell NK, and B cells were negatively correlated with myeloid dendritic cell infiltration in HNSCC. Blood flow analysis revealed that the expression of CD4 + TIGIT + T, CD4 + CD155 + T, and CD8 + TIGIT + T in the peripheral blood of patients with head and neck tumor was significantly greater than that of normal controls. PDIA6 can interact with IRE1 to influence CD155 expression. In addition, there is an interaction between PDIA6 and CD155, but its mechanism is unclear and requires further investigation. Declarations Acknowledgements Not applicable. Authors ’ contributions WWJ and JW caried out most of the experiments and drafted the manuscript.KS did parts of the experiments and performed the statistical analysis: MY and ZPG conceived of hte study and revised the manuscript. All authors read and approved hte final manuscript. Funding This study was supported by the Basic of Guizhou Science -zk [2022] General 411. Availability of data and materials All data generated or analyzed during this study are included in this published article. Declarations Ethics approval and consent to participate The written informed consents were signed by every patient. The current study involving human samples and animal experiment has got the approval of the ethics committee of Guizhou Medical University (No. 2001221). Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Kanazawa T, Misawa K, Shinmura K, Misawa Y, Kusaka G, Maruta M , et al. Promoter methylation of galanin receptors as epigenetic biomarkers for head and neck squamous cell carcinomas. Expert Rev Mol Diagn (2019) 19:(2):137-48. doi:10.1080/14737159.2019.1567334 von Witzleben A, Wang C, Laban S, Savelyeva N and Ottensmeier C H. HNSCC: Tumour Antigens and Their Targeting by Immunotherapy. Cells (2020) 9:(9):doi:10.3390/cells9092103 Sung H, Ferlay J, Siegel R L, Laversanne M, Soerjomataram I, Jemal A , et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin (2021) 71:(3):209-49. doi:10.3322/caac.21660 McDermott J D and Bowles D W. Epidemiology of Head and Neck Squamous Cell Carcinomas: Impact on Staging and Prevention Strategies. Curr Treat Options Oncol (2019) 20:(5):43. doi:10.1007/s11864-019-0650-5 Lala M, Chirovsky D, Cheng J D and Mayawala K. Clinical outcomes with therapies for previously treated recurrent/metastatic head-and-neck squamous cell carcinoma (R/M HNSCC): A systematic literature review. Oral Oncol (2018) 84:(108-20. doi:10.1016/j.oraloncology.2018.07.005 Bray F, Ferlay J, Soerjomataram I, Siegel R L, Torre L A and Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin (2018) 68:(6):394-424. doi:10.3322/caac.21492 Kikuchi M, Doi E, Tsujimoto I, Horibe T and Tsujimoto Y. Functional analysis of human P5, a protein disulfide isomerase homologue. J Biochem (2002) 132:(3):451-5. doi:10.1093/oxfordjournals.jbchem.a003242 Ma Y, Xia P, Wang Z, Xu J, Zhang L and Jiang Y. PDIA6 promotes pancreatic cancer progression and immune escape through CSN5-mediated deubiquitination of β-catenin and PD-L1. Neoplasia (2021) 23:(9):912-28. doi:10.1016/j.neo.2021.07.004 Zhang X, Shi M, Chen T and Zhang B. Characterization of the Immune Cell Infiltration Landscape in Head and Neck Squamous Cell Carcinoma to Aid Immunotherapy. Mol Ther Nucleic Acids (2020) 22:(298-309. doi:10.1016/j.omtn.2020.08.030 Guo Y, Pan W K, Wang Z W, Su W H, Xu K, Jia H , et al. Identification of Novel Biomarkers for Predicting Prognosis and Immunotherapy Response in Head and Neck Squamous Cell Carcinoma Based on ceRNA Network and Immune Infiltration Analysis. Biomed Res Int (2021) 2021:(4532438. doi:10.1155/2021/4532438 Bai Y, Liu X, Qi X, Liu X, Peng F, Li H , et al. PDIA6 modulates apoptosis and autophagy of non-small cell lung cancer cells via the MAP4K1/JNK signaling pathway. EBioMedicine (2019) 42:(311-25. doi:10.1016/j.ebiom.2019.03.045 Mao L, Wu X, Gong Z, Yu M and Huang Z. PDIA6 contributes to aerobic glycolysis and cancer progression in oral squamous cell carcinoma. World J Surg Oncol (2021) 19:(1):88. doi:10.1186/s12957-021-02190-w Pende D, Spaggiari G M, Marcenaro S, Martini S, Rivera P, Capobianco A , et al. Analysis of the receptor-ligand interactions in the natural killer-mediated lysis of freshly isolated myeloid or lymphoblastic leukemias: evidence for the involvement of the Poliovirus receptor (CD155) and Nectin-2 (CD112). Blood (2005) 105:(5):2066-73. doi:10.1182/blood-2004-09-3548 Ma B, Duan X, Zhou Q, Liu J, Yang X, Zhang D , et al. Use of aspirin in the prevention of colorectal cancer through TIGIT-CD155 pathway. J Cell Mol Med (2019) 23:(7):4514-22. doi:10.1111/jcmm.14332 Liu L, You X, Han S, Sun Y, Zhang J and Zhang Y. CD155/TIGIT, a novel immune checkpoint in human cancers (Review). Oncol Rep (2021) 45:(3):835-45. doi:10.3892/or.2021.7943 Okumura M, Kadokura H and Inaba K. Structures and functions of protein disulfide isomerase family members involved in proteostasis in the endoplasmic reticulum. Free Radic Biol Med (2015) 83:(314-22. doi:10.1016/j.freeradbiomed.2015.02.010 Hinshaw D C and Shevde L A. The Tumor Microenvironment Innately Modulates Cancer Progression. Cancer Res (2019) 79:(18):4557-66. doi:10.1158/0008-5472.Can-18-3962 Raskov H, Orhan A, Christensen J P and Gögenur I. Cytotoxic CD8(+) T cells in cancer and cancer immunotherapy. Br J Cancer (2021) 124:(2):359-67. doi:10.1038/s41416-020-01048-4 Borst J, Ahrends T, Bąbała N, Melief C J M and Kastenmüller W. CD4(+) T cell help in cancer immunology and immunotherapy. Nat Rev Immunol (2018) 18:(10):635-47. doi:10.1038/s41577-018-0044-0 Li T, Liu T, Zhu W, Xie S, Zhao Z, Feng B , et al. Targeting MDSC for Immune-Checkpoint Blockade in Cancer Immunotherapy: Current Progress and New Prospects. Clin Med Insights Oncol (2021) 15:(11795549211035540. doi:10.1177/11795549211035540 Chevet E, Hetz C and Samali A. Endoplasmic reticulum stress-activated cell reprogramming in oncogenesis. Cancer Discov (2015) 5:(6):586-97. doi:10.1158/2159-8290.Cd-14-1490 Dufey E, Sepúlveda D, Rojas-Rivera D and Hetz C. Cellular mechanisms of endoplasmic reticulum stress signaling in health and disease. 1. An overview. Am J Physiol Cell Physiol (2014) 307:(7):C582-94. doi:10.1152/ajpcell.00258.2014 Pluquet O and Galmiche A. Impact and Relevance of the Unfolded Protein Response in HNSCC. Int J Mol Sci (2019) 20:(11):doi:10.3390/ijms20112654 Patel A, Oshi M, Yan L, Matsuyama R, Endo I and Takabe K. The Unfolded Protein Response Is Associated with Cancer Proliferation and Worse Survival in Hepatocellular Carcinoma. Cancers (Basel) (2021) 13:(17):doi:10.3390/cancers13174443 Yan X, Chen M, Xiao C, Fu J, Sun X, Hu Z , et al. Effect of unfolded protein response on the immune infiltration and prognosis of transitional cell bladder cancer. Ann Med (2021) 53:(1):1048-58. doi:10.1080/07853890.2021.1918346 Walter P and Ron D. The unfolded protein response: from stress pathway to homeostatic regulation. Science (2011) 334:(6059):1081-6. doi:10.1126/science.1209038 Eletto D, Eletto D, Boyle S and Argon Y. PDIA6 regulates insulin secretion by selectively inhibiting the RIDD activity of IRE1. Faseb j (2016) 30:(2):653-65. doi:10.1096/fj.15-275883 O'Donnell J S, Madore J, Li X Y and Smyth M J. Tumor intrinsic and extrinsic immune functions of CD155. Semin Cancer Biol (2020) 65:(189-96. doi:10.1016/j.semcancer.2019.11.013 Zhang J, Zhou L, Xiang J D, Jin C S, Li M Q and He Y Y. Artesunate-induced ATG5-related autophagy enhances the cytotoxicity of NK92 cells on endometrial cancer cells via interactions between CD155 and CD226/TIGIT. Int Immunopharmacol (2021) 97:(107705. doi:10.1016/j.intimp.2021.107705 Szereday L, Nagy D U, Csiszar B, Kevey D, Feik T and Meggyes M. Examination of the TIGIT, CD226, CD112, and CD155 Immune Checkpoint Molecules in Peripheral Blood Mononuclear Cells in Women Diagnosed with Early-Onset Preeclampsia. Biomedicines (2021) 9:(11):doi:10.3390/biomedicines9111608 Tahara-Hanaoka S, Shibuya K, Kai H, Miyamoto A, Morikawa Y, Ohkochi N , et al. Tumor rejection by the poliovirus receptor family ligands of the DNAM-1 (CD226) receptor. Blood (2006) 107:(4):1491-6. doi:10.1182/blood-2005-04-1684 Gong J, Fang L, Liu R, Wang Y, Xing J, Chen Y , et al. UPR decreases CD226 ligand CD155 expression and sensitivity to NK cell-mediated cytotoxicity in hepatoma cells. Eur J Immunol (2014) 44:(12):3758-67. doi:10.1002/eji.201444574 Cohen E E W, Bell R B, Bifulco C B, Burtness B, Gillison M L, Harrington K J , et al. The Society for Immunotherapy of Cancer consensus statement on immunotherapy for the treatment of squamous cell carcinoma of the head and neck (HNSCC). J Immunother Cancer (2019) 7:(1):184. doi:10.1186/s40425-019-0662-5 Yu M, Qian X X, Li G, Cheng Z and Lin Z. Prognostic biomarker IL17A correlated with immune infiltrates in head and neck cancer. World J Surg Oncol (2022) 20:(1):243. doi:10.1186/s12957-022-02703-1 Quan H, Shan Z, Liu Z, Liu S, Yang L, Fang X , et al. The repertoire of tumor-infiltrating lymphocytes within the microenvironment of oral squamous cell carcinoma reveals immune dysfunction. Cancer Immunol Immunother (2020) 69:(3):465-76. doi:10.1007/s00262-020-02479-x Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3828950","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":264968544,"identity":"6e528eb8-1552-42d4-ac61-15cef840ecf9","order_by":0,"name":"Weiwei Jiang","email":"","orcid":"","institution":"Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Weiwei","middleName":"","lastName":"Jiang","suffix":""},{"id":264968545,"identity":"f1ab65cb-c4a7-47c1-abfd-74c64619de80","order_by":1,"name":"Ji Wang","email":"","orcid":"","institution":"Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ji","middleName":"","lastName":"Wang","suffix":""},{"id":264968546,"identity":"676b56c3-e845-4ac9-8ee8-da3aaa065eff","order_by":2,"name":"Kai Song","email":"","orcid":"","institution":"Affiliated Hospital of Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"Song","suffix":""},{"id":264968547,"identity":"44f4494a-1eeb-4032-a02b-4a556bb77428","order_by":3,"name":"Zhengpeng Gong","email":"","orcid":"","institution":"Guizhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhengpeng","middleName":"","lastName":"Gong","suffix":""},{"id":264968548,"identity":"6b69363d-9d47-4154-9397-8136575faa4d","order_by":4,"name":"Ming Yu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYJCCAwwM/+XsjzcfOPDhB/FamI0ZzhxLPDizh3iLmBMbbuQYH+ZgI0KtwY3sxMMFv9gYGxtyPhxm4GGQ5xc7QEhL7obDM/t4mJkZzm44XGDBYDhzdgIRWnh7JNjYGHs3HJ7Bw5BgcJs4LQY8PMw8Dw7zsBGrhedHgoQEGw8DcVokz7wF2tJwwMCAh80AGMgShP3Cdzx382eePwfqN8g/fvzhww8beX5pAloUDgAJxjY4XwK/chCQbwCRfwgrHAWjYBSMghEMACXJTf3yl6fVAAAAAElFTkSuQmCC","orcid":"","institution":"Guizhou Medical University","correspondingAuthor":true,"prefix":"","firstName":"Ming","middleName":"","lastName":"Yu","suffix":""}],"badges":[],"createdAt":"2024-01-02 08:29:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3828950/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3828950/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49233029,"identity":"d7e43db7-121c-433d-89c5-b41439e38982","added_by":"auto","created_at":"2024-01-05 17:02:03","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":190637,"visible":true,"origin":"","legend":"\u003cp\u003e(A) The expression of PDIA6 in the TIMER 2.0 database. The diagnostic value of PDIA6 in pan-cancer (B–E). The ROC curves of PDIA6 in HNSC, LGG,LUAD, CHOL, LUSC, KICH.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3828950/v1/8df7aa3654630347ce7b56b9.jpeg"},{"id":49233030,"identity":"c874e9fe-ed13-4c99-a552-5764c8282fdb","added_by":"auto","created_at":"2024-01-05 17:02:03","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":352593,"visible":true,"origin":"","legend":"\u003cp\u003e(A–G) Analysis using Kaplan–Meier of the correlation between PDIA6 expression and OS. (H–M) Analysis by Kaplan–Meier of the correlation between PDIA6 expression and DFS.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3828950/v1/1106311696395c96c828e221.jpeg"},{"id":49233034,"identity":"90fcfe16-ecfd-4746-a2ec-e700c8cbc81d","added_by":"auto","created_at":"2024-01-05 17:02:03","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":202798,"visible":true,"origin":"","legend":"\u003cp\u003ePDIA6 expression is correlated with MDSC invasion in pan-cancer (A, B). PDIA6 expression is inversely correlated with NKT cell infiltration in pan-cancer (C, D). (E)Immune cells between the PDIA6 high expression (G1) and low expression (G2) groups.(F) PDIA6 expression is inversely correlated with the infiltration level of B cells and CD8+ T cells, while it is positively correlated with the infiltration level of CD4+ T cells, Neutrophils, and Macrophages.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3828950/v1/ba26cf126f9f0f7fe1d45100.jpeg"},{"id":49233031,"identity":"d88ec260-7af0-4ab2-bb45-c602eb51ea0b","added_by":"auto","created_at":"2024-01-05 17:02:03","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":138874,"visible":true,"origin":"","legend":"\u003cp\u003ePDIA6 expression is adversely related with the majority of major histocompatibility complexes (MHCs) in pan-cancer, according to the TISIDB database(A). (B) In pan-cancer, the expression of PDIA6 is adversely correlated with the majority of chemokine receptors. (E,F)The expression of immunological checkpoints differs between the tumor group and the normal group.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3828950/v1/9a0d2063a9c920e9d31f12fa.jpeg"},{"id":49233413,"identity":"f21c7ccc-3df6-47b7-ad1f-821d867bb1a3","added_by":"auto","created_at":"2024-01-05 17:10:03","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":58296,"visible":true,"origin":"","legend":"\u003cp\u003eAn investigation of the enrichment of PDIA6 co-expressed genes in HNSC. (A) The co-expressed PDIA6 genes in HNSCC. (B, C) The top 50 genes with the strongest positive and negative correlations to PDIA6. GO and KEGG analyses of co-expressed PDIA6 genes within the HNSCC cohort.(F)Network of PDIA6 and its potential co-expression genes in PDIA6-related DEGs.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3828950/v1/2676ea5a5fdd553e13b46635.jpeg"},{"id":49233035,"identity":"9de82f67-3ba8-4b5f-83da-2db741e57f85","added_by":"auto","created_at":"2024-01-05 17:02:03","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":275454,"visible":true,"origin":"","legend":"\u003cp\u003eIn HNSCC, PDIA6 is overexpressed. (A)qRT-PCR was used to assess the relative expression of PDIA6 mRNA in 58 freshly acquired HNSCC samples and paired neighboring non-tumor tissues.(B)PDIA6 protein expression in six HNSCC tumors matched that of surrounding normal tissues. (C)PDIA6 expression is high in HNSCC tumor tissues (200×).(D)Low PDIA6 expression in normal tissues(200×).(E,F) TIGIT expression in CD4+ and CD8+ T cells and CD155 expression in CD4+T cells from PBMCs of HNSCC patients and HCs was analyzed by flow cytometry.*p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3828950/v1/163d1249ca8e1bb488d8a59a.jpeg"},{"id":49233036,"identity":"05ec7dcd-c722-4618-a4f6-dd92e13ee4f4","added_by":"auto","created_at":"2024-01-05 17:02:03","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":262931,"visible":true,"origin":"","legend":"\u003cp\u003e(A,B) PDIA6 protein expression in HOK and HNSCC cell lines.(C,D)PDIA6 knockdown decreases cell growth and metastasis in SCC25 and SCC9 cells.(E,F)Overexpression of PDIA6 in CAL27 and FADU cells stimulates cell proliferation and metastasis.(G)PDIA6 expression in SCC25 and SCC9 cell lines as determined by western blotting after sh-PDIA6 transfection. Western blot analysis of PDIA6 expression in CAL27 and FADU cells treated with OE-PDIA6.CCK8 proliferation assays in SC25 \u0026nbsp;and SCC9 cells transfected with sh-PDIA6 and proliferation assays in CAL27 and FADU cells transfected with OE-PDIA6. Data represent the Mean±SD; *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3828950/v1/f1d444788bd1c0a6d009cc46.jpeg"},{"id":49233033,"identity":"8d7c1bbe-5c5b-4fae-85fc-18337f0cf978","added_by":"auto","created_at":"2024-01-05 17:02:03","extension":"jpeg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":413052,"visible":true,"origin":"","legend":"\u003cp\u003eCell migration abilities and invasive potential were determined in response to PDIA6 knockdown or overexpression.(D,E)The wound-healing assays of SCC25 and SCC9 cells transfected with sh-PDIA6 (100×) and CAL27 and FADU cells transfected with OE-PDIA6.(G)Transwell experiments measuring migration and invasion in SCC25 and SCC9 cells transfected with sh-PDIA6 and CAL27 and FADU cells transfected with OE-PDIA6(200×). Data represent the mean±SD; *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3828950/v1/f54de9020164fd8298c07757.jpeg"},{"id":49233037,"identity":"8ada3164-a030-4503-8682-6d94fc827623","added_by":"auto","created_at":"2024-01-05 17:02:03","extension":"jpeg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":160922,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of IRE1 in the sh-PDIA6 group was higher than that of the sh-NC group, whereas the expression of IRE1 in the OE-PDIA6 group was lower than in the OE-NC group (B). The expression of CD155 in the sh-PDIA6 group was lower than in the sh-NC group, and the expression of CD155 in the OE-PDIA6 group was higher than in the OE-NC group (C). The co-immunoprecipitation experiment suggested that there was a interaction between PDIA6 and CD155 in OE-PDIA6(D). (*P\u0026lt;0.05,**P\u0026lt;0.01,***P\u0026lt;0.001).\u003c/p\u003e","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3828950/v1/c28abe5317f2f9f136944c59.jpeg"},{"id":49301783,"identity":"44627ccb-f574-4cb1-93a9-422be000d664","added_by":"auto","created_at":"2024-01-08 09:52:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1758426,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3828950/v1/9271c7f6-0e69-4b66-9693-6a7b0af20ec9.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"PDIA6 promotes immune escape of head and neck squamous cell carcinoma by regulating TIGIT/CD155 axis","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eHead and neck squamous cell carcinoma (HNSCC) is one of the most frequent head and neck cancers, with a high recurrence rate and a low survival rate. In 2020, there were approximately 931.7 thousand newly diagnosed cases of HNSCC worldwide, and over 467,100 people died from this disease (1\u0026ndash;3). The current study confirmed that smoking, alcohol consumption, HPV infection, and immune status are the most important risk factors for HNSCC(4). So far, a number of treatments for HNSCC have been approved, including surgery, radiotherapy, chemotherapy, and immunotherapy. However, there is no significant survival advantage for patients with advanced or recurring illnesses, and the 5-year survival rate remains 40\u0026ndash;60%(5, 6). Consequently, HNSCC has an urgent need for novel treatment targets and techniques.\u003c/p\u003e \u003cp\u003eProtein Disulfide Isomerase Family A, Member 6 (PDIA6) is a member of the protein disulfide isomerase (PDI) family that is found mostly in the endoplasmic reticulum (ER)(7). PDIA6 can stimulate the production of disulfide bonds, promote protein folding, and prevent unfolded substrate aggregation. Previous research has indicated that PDIA6 plays an important role in cancer progression(8).\u003c/p\u003e \u003cp\u003eEvidence from previous research suggests that the response rate to immunotherapy and prognosis in HNSCC patients may be controlled by the overexpression of immunosuppressive molecules and tumor-infiltrating immune cells (TIICs)(9). The level of immune cell infiltration was found to be a sensitive prognostic biomarker and a predictive indication of response to immunotherapy (10). Recent studies have shown that PDIA6 to a poor prognosis in pancreatic cancer (8), non-small cell lung cancer (11), and oral squamous cell carcinoma (12). However, no research has been conducted to determine whether PDIA6 overexpression affects the tumor immune microenvironment in HNSCC.\u003c/p\u003e \u003cp\u003ePoliovirus receptor (PVR, CD155), a representative of the nectinlike protein family, has recently been identified as a promising target in immunotherapy for enhancing antitumor responses. The poliovirus receptor is drastically overexpressed in some human malignant tumors, yet it is missing or modest in most healthy tissues(13, 14). CD155 possesses immunomodulatory properties. It is capable of interacting with CD226, TIGIT, and CD96 to provide costimulatory and coinhibitory signals. However, the imbalance in the tumor microenvironment causes tumor cells to evade immune surveillance, resulting in the development of tumors(15).\u003c/p\u003e \u003cp\u003eWe investigated the potential utility of PDIA6 in cancer diagnosis and prognosis using an exhaustive investigation. In addition, we conducted an enrichment analysis of PDIA6 co-expression genes and investigate their relationship with immune infiltration. Moreover, we confirmed our bioinformatics results using in vitro tests. Our findings indicate that PDIA6 can serve as an oncogene and biomarker for immune infiltration in pan-cancer, particularly HNSCC.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic analysis\u003c/h2\u003e \u003cdiv id=\"Sec4\" class=\"Section3\"\u003e \u003ch2\u003eData Source and Differential Expressions Analysis\u003c/h2\u003e \u003cp\u003eGene expression and clinical characteristics of HNSC patients were extracted from The Cancer Genome Atlas (TCGA) database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://portal.gdc.cancer.gov/\u003c/span\u003e\u003cspan address=\"https://portal.gdc.cancer.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eDiagnostic and Prognostic Analysis\u003c/h2\u003e \u003cp\u003eThe potential utility of PDIA6 in cancer diagnosis was identified using a ROC curve and TCGA database data. AUC\u0026thinsp;\u0026gt;\u0026thinsp;0.85 was considered a significant diagnostic value. overall survival (OS) and disease-free survival (DFS) from the GEPIA2 database(gepia2.cancer-pku.cn/#index) were used to assess the potential role of PDIA6 in cancer prognosis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eThe Relationship Between PDIA6 and Immune Cell Infiltration in HNSC TME\u003c/h2\u003e \u003cp\u003eThe TIMER 2.0 database's \"GENE\" module was used to assess the level of immune cell infiltration in 32 cancer types. The TIMER database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cistrome.shinyapps.io/timer/\u003c/span\u003e\u003cspan address=\"https://cistrome.shinyapps.io/timer/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to investigate the relationships between HNSC and TIICs. Dendritic cells, B cells, neutrophils, CD4\u0026thinsp;+\u0026thinsp;T cells, macrophages, and CD8\u0026thinsp;+\u0026thinsp;T cells were found in the TIICs in TIMER. Following that, we used the ESTIMATE algorithm from the R packages \"estimate\" and \"limma\" to compute immune and stromal scores. We used CIBERSORT to estimate the abundance of specific cells in hybrid cell populations using gene expression datasets to analyze tumor purity and stromal/immune cell infiltration in HNSC tissue based on PDIA6 expression data. We then used R packages \"ggplot2,\" \"ggpubr,\" and \"ggExtra\" to examine the relationship between PDIA6 and TME or immune cell infiltratio.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eImmune-checkpoint Analysis\u003c/h2\u003e \u003cp\u003eWe analyzed the differences between the immune cells in the two sets of samples using the CIBERSORT algorithm in the Immundeconv package and a heat map to display the results. The horizontal axis represents the subgroup type based on differentially expressed immune-related genes, whereas the vertical axis represents the immune cell type, which demonstrates the distinction. The color represents the expression pattern in the various samples.Using ggplot2 and pheatmap, we analyzed the expression values of the eight immune checkpoint-related genes (SIGLEC15, TIGIT, CD274, HAVCR2, PDCD1, CTLA4, LAG3, and PDCD1LG2) and observed their expression. Wilcoxon's signed-rank test was used to determine the significance of the two sample groups.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of OS Prognostic Factors in HNSCC\u003c/h2\u003e \u003cp\u003eUnivariate and multivariate Cox regression analyses were used to evaluate PDIA6 and five major clinical and prognostic factors, including age, gender, stage, grade, and newTumor, in order to determine the appropriate terms for the nomogram. Using the \"forestplot\" R package, the forest plots displayed the HR, 95% CI, and p-value of every variable. Using R software (version 4.0.2) with the \"rms\" packages, a nomogram was developed to predict the 1-year, 3-year, and 5-year overall recurrence based on the results of multivariate Cox proportional hazards analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of protein\u0026ndash;protein interaction (PPI) networks\u003c/h2\u003e \u003cp\u003eUsing the STRING (Search Tool for the Retrieval of Interacting Genes/Proteins database) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://string-db.org/\u003c/span\u003e\u003cspan address=\"https://string-db.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), the PPI network of DEGs was constructed.The genes with a comprehensive score greater than 0.15 (median confidence) were chosen. Cytohubba, a plugin for Cytoscape, was used to collect and analyze data regarding the PPI network. The network graph may depict the interactions between proteins. According to the betweenness and degree values, genes were ranked. The top 15 genes in each category were considered hub genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003ePatients and specimens\u003c/h2\u003e \u003cp\u003eThe subjects were 20 pairs of fresh HNSCC tissues and normal tissues adjacent to cancer collected from the affiliated Hospital of Guizhou Medical University from 2021 to 2022, and 10 of them were extracted for PDIA6 expression detection. All the experiments met the requirements of the Institutional Review Committee of Guizhou Medical University and the Helsinki Declaration (approved ID2021243).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry and Immunohistochemistry assessment\u003c/h2\u003e \u003cp\u003eImmunohistochemistry was used to determine the PDIA6 expression level. Sections of tumor microarray (TMA) were deparaffinized in three 7-minute baths of xylene and rehydrated by sequentially incubating with 100, 90, and 80 percent ethanol. Following a 2-minute rinsing with distilled water, the TMA slides were heated with citrate at 95\u0026deg;C for 2.5 minutes in a pressure cooker. The slides were then cooled to room temperature and washed three times for five minutes with 1XPBS. To inhibit endogenous peroxidase activity, the slides were incubated for 20 minutes in a 3% H2O2 solution and then rinsed three times for 5 minutes with 1X PBS. The slices were then incubated for 24 hours.\u003c/p\u003e \u003cp\u003eanti-PDIA6 primary antibody (Abcam) at 1:200 dilution. The DAB detection kit (GK600510, Gene tech Shanghai) was utilized in accordance with the manufacturer's instructions following three 5-minute rinses in 1X PBS. After this step, each slide was counterstained with hematoxylin for 10 seconds. After 10 minutes of gentle washing with distilled water, the slides were dehydrated in 80%, 90%, and 100% ethanol and bathed in three different xylenes for 7 minutes each. The slides were subsequently mounted, coverslipped, and air-dried within the fume hood. Both a cytopathologist and a hematologist examined the stained slides. Both the intensity score (IS) and the positive score were used to classify PDIA6 staining (PS). When grading IS, we used four categories: negative (0), weak (1), moderate (2), and strong (3). When grading PS, we used four categories: negative (0), 80% negative (1), weak (2), moderate (3), and strong (4). We then multiplied IS by PS to get the immunoreactive score (IRS). PDIA6 expression levels in the final IRSs were categorized as low (4) or high (\u0026gt;\u0026thinsp;4).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eCell lines and cell culture\u003c/h2\u003e \u003cp\u003eHuman normal oral keratinocytes (HOK) and human HNSCC cell lines CAL27, FADU, SCC9, and SCC25 were obtained from China Center for Type Culture Collection (Shanghai, China). CAL27 was grown in DMEM medium (Gibco). FADU ,SCC25 and SCC9 cells were grown in a DMEM/F12 medium (Gibco). 10% fetal bovine serum (FBS, Gibco) and 1% penicillin/streptomycin were included in every culture medium. At 37\u0026deg;C, cells were cultured in an incubator that was humidified and contained 5% CO2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCell transfection\u003c/h2\u003e \u003cp\u003eThe human PDIA6 lentivirus targeting to upregulate PDIA6 (OE-PDIA6 ), the negative control (OE-NC), the shRNA lentivirus targeting to knock down PDIA6 (shPDIA6: 5\u0026rsquo;-GGTCACTGTCAAAGATTAACA-3\u0026rsquo;), and the shRNA negative control lentivirus (sh-NC) were ordered from GeneChem Co., Ltd (Shanghai, China). Transfection of Lentivirus was conducted in accordance with the manufacturer-recommended methodology.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCCK8 assay and colony formation assay\u003c/h2\u003e \u003cp\u003eCell proliferation was investigated by Cell counting kit-8 assay. We reseeded cells into a 96-well culture plate at a density of 4\u0026times;10\u003csup\u003e3\u003c/sup\u003e in the logarithmic growth phase. For CCK-8 detection, cells were treated with CCK-8 (10 \u0026micro;l, Beyotime, Shanghai, China) for 1 h in an incubator at 37\u0026deg;C with 5% CO2. A microplate reader was used to detect the absorbance value at 450nm.Then, to detect the clonogenic ability of the cells, colony-forming assays were performed. Cells were seeded into the 6-well plate at a density of 800 per well. The crystal violet was used to stain the cells following incubation at 37\u0026deg;C in a 5% humidified atmosphere for about 10 days, and the colonies were counted to assess the clonogenic ability of the cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eWound healing assay\u003c/h2\u003e \u003cp\u003eSCC25, SCC9, FADU, and CAL27 cells were seeded into six-well plates and grown to 100% confluence for the wound healing assay. Wounds were made in the middle of the cell monolayer and observed using a phase-contrast microscope at the indicated time intervals. The wound width was measured from four different angles. The ratio of the final and initial actual wound widths was used to calculate relative wound width.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eCell migration and invasion assays\u003c/h2\u003e \u003cp\u003eIn transwell chambers (Corning Costar, Corning, NY, USA), the migration and invasion of SCC25, SCC9, FADU, and CAL27 cell lines were evaluated. In brief, cells (2\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/well) in serum-free medium (0.2 mL) were seeded into the top chamber that was either precoated with (invasion assay) or without (migration assay) Matrigel (Corning,Bedford,MA,USA). In the meantime, DMEM and DMEM/F12 containing 10% FBS (0.7 mL) were added to the lower chamber (as the chemokine). After 24 hours of incubation at 37\u0026deg;C with 5% CO2, nonmigrating and noninvading cells were removed from the top surface of the insert with a cotton swab, and the migrating or invading cells were fixed with 4% paraformaldehyde (Sangon Biotech) for 20 minutes and stained with 0.1% violet solution (Beyotime). The number of migrating or invading cells was determined using a microscope with \u0026times;100 magnification (Olympus, Tokyo, Japan). Each experiment was conducted three times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eRealtime PCR and western blotting assays\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from HNSCC tissues and cell lines using Trizol reagent (Invitrogen, Carlsbad, CA, USA) as according to the manufacturer's instructions. A NanoDrop spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc.) was used to measure the concentration. To reverse transcribe total RNA to cDNA, the PrimeScriptTM RT Reagent Kit (TaKaRa Biotechnology, Co., Ltd., Dalian, China) was used. RT-qPCR was then performed using SYBR Green PCR Master Mix (TaKaRa Biotechnology). The 2\u003csup\u003e\u0026minus; ΔΔCt\u003c/sup\u003e method was used to calculate the data. The primer sequences are listed in Additional file Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003eThe HNSCC tissue and cells were lysed in RIPA buffer containing phenylmethylsulphonyl fluoride (Beyotime Institute of Biotechnology, Haimen, China). Protein concentration was determined using the BCA method. Proteins were separated using 10% SDS-PAGE, transferred to PVDF membranes, and immunoblotted with the antibodies listed below: GAPDH (1:1000; CST), PDIA6 (1:1000; Abcam), CD155 (1:1000; Abcam), TIGIT(1:1000; Abcam), IRE1 (1:1000; Proteintech, Rosemont, IL, USA).The membranes were rinsed with TBST before being incubated with an HRP-conjugated secondary antibody, developed with an enhanced chemiluminescence reagent, and visualized using Image Lab software.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primers used for qRT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePDIA6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGCAGAACTGGTGAAGCCATTGTAG\u003c/p\u003e \u003cp\u003eR: CGTCTGTCAGCTCAATCACATCCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TATGACAACAGCCTCAAGAT\u003c/p\u003e \u003cp\u003eR: AGTCCTTCCACGATACCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eImmunoprecipitation assay\u003c/h2\u003e \u003cp\u003eFADU and CAL27 cells were lysed with IP buffer (1 mg/mL protein concentration) and incubated with anti-PDIA6 (1:100, Abcam) at 4\u0026deg;C overnight, followed by incubation with protein A/G Magbeads (Merck) at 4\u0026deg;C for 6 hours. The proteins were then separated from the Magbeads via a 10-minute treatment at 100\u0026deg;C. Washing the immunoprecipitated complexes was followed by western blot analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eFlow cytometry was used to assess the frequency of TIGIT and CD155 cell receptors in both HNSCC patients and the control group, using different monoclonal antibodies for surface markers. Prepare the samples for testing, 100\u0026micro;L of blood was transferred to test tubes. Cell surfaces were stained at room temperature (20\u0026deg;C\u0026ndash;25\u0026deg;C) for 20 minutes with Purified anti-human CD3 (Biolegend), Pacific Blue\u0026trade; anti-human CD8 (Biolegend), FITC anti-human CD4 (Biolegend), PE anti-human CD155 (PVR)(Biolegend), and APC anti-human TIGIT (Biolegend) antibodies to determine the percentage of TIGIT and CD155 on T CD4\u0026thinsp;+\u0026thinsp;cells and T CD8\u0026thinsp;+\u0026thinsp;cells.Containing 2 mL of Lysing Solution (BD FACS) for 10 minutes at room temperature (20\u0026deg;C\u0026ndash;25\u0026deg;C) and protect the tubes from direct light. Following incubation, the cells were washed twice before being resuspended in FACS solution (phosphate-buffered saline) and examined on the same day in a FACS Calibur (BD Biosciences) flow cytometer. FlowJo V10.8.1 software was used to analyze the data.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eAll data are expressed using the formula mean standard deviation. When appropriate, the Student t-test and one-way analysis of variance (ANOVA) were used for statistical analysis. The analysis of correlation was evaluated using Spearman's test. The analysis was conducted using SPSS22.0, and a p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was regarded as statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003ePDIA6 Expression Was Enhanced in Multiple Human Cancers\u003c/h2\u003e \u003cp\u003eTo begin investigating PDIA6 expression levels, we used the TIMER 2.0 database to examine PDIA6 expression in TCGA datasets. PDIA6 was found to be upregulated in a large percentage of cancers, including breast invasive cancer (BRCA), bladder urothelial carcinoma (BLCA), cholangiocarcinoma (CHOL), colon adenocarcinoma (COAD), esophageal carcinoma (ESCA),glioblastoma multiforme (GBM), head and neck squamous cell carcinoma (HNSC), kidney chromophobe (KICH), liver hepatocellular carcinoma (LIHC), lung adenocarcinoma (LUAD),lung squamous cell carcinoma (LUSC), skin cutaneous melanoma compared (SKMC)stomach adenocarcinoma(STAD),thyroid carcinoma (THCA),and uterine corpus endometrial carcinoma (UCEC) (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe Diagnostic and Prognostic Value of PDIA6 in Pan-Cancer.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThen we analyzed the diagnostic value of PDIA6 in various cancers using the ROC curve. As shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e(B-E)\u003c/b\u003e, PDIA6 may act as a perfect diagnostic marker in HNSCC (AUC\u0026thinsp;=\u0026thinsp;0.877),LGG (AUC\u0026thinsp;=\u0026thinsp;0.981), LUAD (AUC\u0026thinsp;=\u0026thinsp;0.8999), CHOL (AUC\u0026thinsp;=\u0026thinsp;0.914), LUSC (AUC\u0026thinsp;=\u0026thinsp;0.941),KICH (AUC\u0026thinsp;=\u0026thinsp;0.978).Furthermore, increased expression of PDIA6 was linked to poor OS in LIHC (p\u0026thinsp;=\u0026thinsp;0.001), LGG (p\u0026thinsp;=\u0026thinsp;0.0015),KIRP (p\u0026thinsp;=\u0026thinsp;0.01), BLCA (p\u0026thinsp;=\u0026thinsp;0.019), CESC (p\u0026thinsp;=\u0026thinsp;0.01), and HNSCC (p\u0026thinsp;=\u0026thinsp;0.019) (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u0026ndash;F). DFS results suggested that higher PDIA6 expression was correlated with poorer prognosis in LGG (p\u0026thinsp;=\u0026thinsp;0.019), CESC (p\u0026thinsp;=\u0026thinsp;0.036),LUAD(p\u0026thinsp;=\u0026thinsp;0.0084), and\u003c/p\u003e \u003cp\u003ePAAD (p\u0026thinsp;=\u0026thinsp;0.041) (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG\u0026ndash;J).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eImmune infiltration is linked to PDIA6 in Pan-Cancer\u003c/h2\u003e \u003cp\u003ePDIA6's potential role in immune cell infiltration was investigated using TIMER 2.0. In most tumors, the results indicated a significant positive correlation between myeloid-derived suppressor cell (MDSC) infiltration and PDIA6 expression(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The top 10 tumors were ACC (rho\u0026thinsp;=\u0026thinsp;0.558, p\u0026thinsp;=\u0026thinsp;2.89e-07), TGCT (rho\u0026thinsp;=\u0026thinsp;0.546, p\u0026thinsp;=\u0026thinsp;8.05e-13), UCEC (rho\u0026thinsp;=\u0026thinsp;0.402, p\u0026thinsp;=\u0026thinsp;8.13e-13), SKCM-Metastasis (rho\u0026thinsp;=\u0026thinsp;0.392, p\u0026thinsp;=\u0026thinsp;1.88e-14), LIHC (rho\u0026thinsp;=\u0026thinsp;0.38, p\u0026thinsp;=\u0026thinsp;2.86e-13), SKCM-Primary(rho\u0026thinsp;=\u0026thinsp;0.359, p\u0026thinsp;=\u0026thinsp;2.12e-14), PAAD(rho\u0026thinsp;=\u0026thinsp;0.355, p\u0026thinsp;=\u0026thinsp;1.88e-16) ,BLCA(rho\u0026thinsp;=\u0026thinsp;0.338, p\u0026thinsp;=\u0026thinsp;2.71e-11) ,HNSC (rho\u0026thinsp;=\u0026thinsp;0.325, p\u0026thinsp;=\u0026thinsp;1.37e-13) ,and HNSC-HPV- (rho\u0026thinsp;=\u0026thinsp;0.321, p\u0026thinsp;=\u0026thinsp;5.22e-11) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Unexpectedly, the findings indicated a negative relationship between T-cell NK infiltration and PDIA6 expression in the majority of tumors(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC); the top 10 tumors were THCA (rho = -0.577, p\u0026thinsp;=\u0026thinsp;1.01e-44), KICH (rho = -0.465, p\u0026thinsp;=\u0026thinsp;9.47e-05), UVM (rho = -0.463, p\u0026thinsp;=\u0026thinsp;2.19e-05), LUAD (rho = -0.459, p\u0026thinsp;=\u0026thinsp;5.22e-27), SKCM-Primary (rho =-0.417, p\u0026thinsp;=\u0026thinsp;1.27e-05), and PAAD (rho = -0.413, p\u0026thinsp;=\u0026thinsp;2.03e-08), PRAD (rho = -0.405, p\u0026thinsp;=\u0026thinsp;6.79e-18), PCPG (rho = -0.398, p\u0026thinsp;=\u0026thinsp;1.04e-07), ACC (rho = -0.397, p\u0026thinsp;=\u0026thinsp;5.02e-04),and CHOL (rho = -0.387, p\u0026thinsp;=\u0026thinsp;2.17e-02) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eThen we investigated the role of PDIA6 in HNSCC immune cell infiltration. We found that there were significant differences in immune cells between the PDIA6 high expression group (G1) and the PDIA6 low expression group (G2) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE).There was a negative association between PDIA6 and the infiltration level of B cells(rho\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;0.156, p\u0026thinsp;=\u0026thinsp;5.05e-04), CD8\u0026thinsp;+\u0026thinsp;T cells (rho\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;0.333, p\u0026thinsp;=\u0026thinsp;3.40e-14) and a positive association between PDIA6 and the infiltration level of CD4\u0026thinsp;+\u0026thinsp;T cells (rho\u0026thinsp;=\u0026thinsp;0.343,p\u0026thinsp;=\u0026thinsp;4.74e-15) ,Neutrophil(rho\u0026thinsp;=\u0026thinsp;0.108,p\u0026thinsp;=\u0026thinsp;1.69e-02) and Macrophage (rho\u0026thinsp;=\u0026thinsp;0.175, p\u0026thinsp;=\u0026thinsp;9.58e-05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThen, using the TISIDB database, we looked into the relationship between PDIA6 and MHCs and chemokine receptors. According to our findings, PDIA6 expression is negatively associated with the majority of MHCs. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). As for HNSC ,the top 3 MHCs were HLA-DOA (rho\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;0.193, p\u0026thinsp;=\u0026thinsp;9.2e-06), HLA-DPB1 (rho\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;0.167, p\u0026thinsp;=\u0026thinsp;0.000133), HLA-DMB (rho\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;0.164, p\u0026thinsp;=\u0026thinsp;0.000172). Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB shows the correlations between PDIA6 expression and 18 kinds of chemokine receptors. The results suggested that PDIA6 was negatively associated with many chemokine receptors in HNSC; the top 3 were CXCR3 (rho\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;0.272, p\u0026thinsp;=\u0026thinsp;2.9e-10),CCR5 (rho\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;0.254, p\u0026thinsp;=\u0026thinsp;4.66e-09)\u003c/p\u003e \u003cp\u003e, and CXCR6 (rho\u0026thinsp;=\u0026thinsp;\u0026minus;\u0026thinsp;0.238, p\u0026thinsp;=\u0026thinsp;3.97e-08). PDIA6 had a positive correlation with some chemokine(receptors) (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE,F).The expression of immune-checkpoints, including CD274,CTLA4,HAVCR2,LAG3,PDCD1,PDCD1LG2,TIGIT,and SIGLEC15, were further investigated in the tumor group and normal group. The results illustrated that CD274 (p\u0026thinsp;=\u0026thinsp;1.49e-06), HAVCR2 (p\u0026thinsp;=\u0026thinsp;7.26e-16), PDCD1 (p\u0026thinsp;=\u0026thinsp;2.90e-10),PDCD1LG2 (p\u0026thinsp;=\u0026thinsp;4.90e-13), LAG3 (p\u0026thinsp;=\u0026thinsp;0.001634573), CTLA4 (p\u0026thinsp;=\u0026thinsp;1.38e-14\u003c/p\u003e \u003cp\u003e), TIGIT(p\u0026thinsp;=\u0026thinsp;5.18e-12),and SIGLEC15 (p\u0026thinsp;=\u0026thinsp;1.31e-12). The findings showed that PDIA6 co-expressed with these immune-checkpoints, implying that PDIA6 could be a potential immunotherapy target.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of the Function of PDIA6 in HNSCC\u003c/h2\u003e \u003cp\u003eFurthermore, we selected HNSCC to further investigate the biological role of PDIA6 in the LinkedOmics database. Figure\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA displays the genes that are positively and negatively associated with PDIA6. The top 50 genes are depicted in Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE. In addition, GO analysis (Biological function) revealed that PDIA6 mostly binds to extracellular structural constituent, collagen binding, unfolded protein binding, etc. (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). KEGG study revealed enrichment in endoplasmic reticulum protein processing, ECM-receptor interaction, N-Glycan biosynthesis, etc (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Figure\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF depicts a network of PDIA6 and its putative co-expression genes in PDIA6-related DEGs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePDIA6 overexpression in HNSCC tissues.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThen, we corroborate our bioinformatics findings using in vitro tests. PDIA6 expression was considerably elevated in HNSCC tissues.We utilized immunohistochemistry to detect PDIA6 expression in 125 cases of HNSCC and 40 cases of paracancerous normal tissues to study the role of PDIA6 in HNSCC. PDIA6 cytoplasmic staining is obviously significant in HNSCC tissues, whereas PDIA6 expression is modest or null in adjacent normal tissues(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). We gathered 48 pairs of fresh tumor samples, including HNSCC and adjacent normal tissues, to better understand the role of PDIA6 in HNSCC. mRNA was extracted from 48 pairs of tissues, while protein was extracted from 10 pairs of tissues. The RT-qPCR results from 48 HNSCC samples and paired normal tissues showed that PDIA6 mRNA was significantly higher in HNSCC than in corresponding normal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Eight of the ten pairs of HNSCC samples and normal tissues had increased PDIA6 protein levels in tumor tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). PDIA6 was shown to be more expressed in HNSCC samples than in surrounding normal tissues, both at the mRNA and protein levels.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTIGIT expression was increased on CD4\u0026thinsp;+\u0026thinsp;and CD8\u0026thinsp;+\u0026thinsp;cells and CD155 expression was increased on CD4\u0026thinsp;+\u0026thinsp;cells in HNSCC patients.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFlow cytometry was used in a separate set of experiments to count TIGIT\u0026thinsp;+\u0026thinsp;CD4\u0026thinsp;+\u0026thinsp;T cells, TIGIT\u0026thinsp;+\u0026thinsp;CD8\u0026thinsp;+\u0026thinsp;T cells and CD155\u0026thinsp;+\u0026thinsp;CD4\u0026thinsp;+\u0026thinsp;T cells in both groups. When HNSCC patients were compared to controls, there was a significant increase in TIGIT receptor expression on T CD4+ (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and T CD8\u0026thinsp;+\u0026thinsp;cells (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE,F). Our findings also revealed that the proportion of T CD4\u0026thinsp;+\u0026thinsp;cells expressing CD155 in the peripheral circulation of HNSCC patients was significantly higher than in healthy individuals (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE,F). Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e shows the percentages of TIGIT and CD155 in the control and HNSCC groups.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTIGIT, CD155 expression from PBMC in HD and HNSCC\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHD(n\u0026thinsp;=\u0026thinsp;14)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHNSC(n\u0026thinsp;=\u0026thinsp;19)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSignificance\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD4\u0026thinsp;+\u0026thinsp;TIGIT\u0026thinsp;+\u0026thinsp;T (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e36.71\u0026thinsp;\u0026plusmn;\u0026thinsp;5.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e24.14\u0026thinsp;\u0026plusmn;\u0026thinsp;9.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD4\u0026thinsp;+\u0026thinsp;CD155\u0026thinsp;+\u0026thinsp;T (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e5.40\u0026thinsp;\u0026plusmn;\u0026thinsp;2.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD8\u0026thinsp;+\u0026thinsp;TIGIT\u0026thinsp;+\u0026thinsp;T (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e65.52\u0026thinsp;\u0026plusmn;\u0026thinsp;7.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e31.74\u0026thinsp;\u0026plusmn;\u0026thinsp;10.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003ePDIA6 in HNSCC promoted tumor growth and metastasis in vitro\u003c/h2\u003e \u003cp\u003eTo further investigate the role of PDIA6 in HNSCC, we generated PDIA6 knockdown and overexpression cell lines and validated the interference at the mRNA and protein levels using real-time PCR and western blotting. As demonstrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, SCC25 and SCC9 cells contained a greater proportion of endogenous PDIA6 than FADU and CAL27 cells. In this study, SCC25 and SCC9 cells were transfected with specific shRNA lentivirus (sh-PDIA6), whereas FADU and CAL27 cells were transfected with PDIA6 overexpression lentivirus (OE-PDIA6). Meanwhile, PDIA6 downregulation was observed to limit cell viability in SCC25 and SCC9 cells by CCK8 assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC,D), and PDIA6 overexpression boosted cell proliferation in FADU and CAL27 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE,F). Cell viability was reduced when PDIA6 was knocked out. Furthermore, the number of colonies formed by SCC25 and SCC9 cells was much lower than that of FADU and CAL27 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). In the wound healing experiment, the migration of the PDIA6 knockdown group in SCC25 and SCC9 cell lines was significantly slower than that of the negative control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD).Furthermore, transwell experiments revealed that PDIA6 downregulation significantly reduced migratory and invasive capacity in SCC25 and SCC9 cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG,H,I), whereas PDIA6 overexpression significantly increased migratory and invasive ability in FADU and CAL27 cell line(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG,J,K). PDIA6 was found to increase HNSCC cell proliferation and metastasis in vitro.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003ePDIA6 promoted UPR and activated CD155 signaling pathway in HNSCC cells\u003c/h2\u003e \u003cp\u003eThe morphological and functional results induced by PDIA6 suggested PDIA6 may be an important facilitator of in HNSCC. PDIA6 expression in tumor cells may be associated with immunity. Herein, we determined UPR-related markers expression through western blotting, real-time PCR and immunoprecipitation assays after PDIA6 silencing and overexpression. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA, after PDIA6 was knocked down in SCC25 and SCC9 cells, the UPR marker IRE1 was elevated and CD155 descended at both protein and mRNA levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC,\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD). As expected, PDIA6 overexpression exerted the opposite effects in FADU and CAL27 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC,\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD). Both real-time PCR and western blotting analysis validated this result. Furthermore, immunoprecipitation assays confirmed the expression level of the CD155 protein correspondingly increased or reduced following PDIA6 overexpression or knockdown. These results implied that PDIA6 may interact and bind with CD155 in HNSCC cells. The endogenous interaction between PDIA6 and CD155 was confirmed by the IP assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eLocated primarily in the endoplasmic reticulum, protein disulfide isomerase family 6 (PDIA6) is a member of the protein disulfide bond isomerase family. It aids in protein folding and prevents the aggregation of substrates that are unfolded and acts as an oxidoreductase to catalyze the formation of disulfide bonds (16). PDIA6 is the first selective UPR modulator that acts from the lumen of the endoplasmic reticulum (ER), where even the stress signal is generated. PDIA6 was discovered to be considerably elevated in numerous malignancies, and ROC curve analysis revealed that PDIA6 might be used as a diagnostic biomarker. Increased PDIA6 was associated with a poorer OS in LIHC, LGG, KIRP, HNSCC, BLCA and CESC, according to the prognostic analysis. We discovered that PDIA6 was highly elevated in HNSCC. The HNSCC was chosen to validate our bioinformatics result. PDIA6 was highly elevated in HNSCC tissues and cell lines throughout in vitro investigations. The tumor microenvironment (TME) is a crucial factor in cancer's persistence and resistance to treatment (17).TME immune cells are linked to immunotherapy efficacy, and they include CD4\u0026thinsp;+\u0026thinsp;T cells, CD8\u0026thinsp;+\u0026thinsp;T cells, MDSCs, and NKT cells (18\u0026ndash;20).\u003c/p\u003e \u003cp\u003ePDIA6 was associated with protein processing in the endoplasmic reticulum, extracellular matrix structural, collagen binding, and ECM-receptor interaction, according to GO and KEGG analyses.ER stress and UPR signaling play a functional role in HNSCC through regulating essential tumor biology processes, such as disease progression and therapeutic resistance. It is widely recognized that the UPR can exert positive selection on solid tumor cancer cells (21\u0026ndash;23).\u003c/p\u003e \u003cp\u003eThe UPR is a signaling network that is activated by pathological and physiological circumstances. Researchers have investigated the connection between UPR activation indicators and cancer prognosis (24, 25). In addition, accumulating evidence suggests that the UPR signaling system and ER stress regulate essential tumor biological processes in HNSCC, such as progression and therapeutic resistance (23, 25).\u003c/p\u003e \u003cp\u003eThree ER signaling pathways, ATF6, IRE1 and PERK, mediate the UPR (26). Different UPR signaling pathways may influence the expression levels of proteins involved in the biology of cancer cells. UPR signaling within physiologically reasonable range by binding a specific cysteine in the luminal domain of activated IRE1.Research has shown that PDIA6 terminates IRE1 signaling. PDIA6 encourages the inactivation of IRE1 by decreasing its oligomers. PDIA6 influences IRE1 (and PERK) directly, limiting its activation and aiding in its inactivation. PDIA6 regulates IRE1 signal degradation via disulfide-dependent association(27).\u003c/p\u003e \u003cp\u003eCD155, which is highly expressed on a variety of tumor types, is linked to poor patient outcomes(28). CD155 is now recognized as a potent immune ligand with multiple exogenous cellular functions, in addition to its cell-intrinsic roles in tumor progression and metastasis. CD155's signaling on immune cells is mediated by interactions with the co-stimulatory immune receptor CD226 as well as the inhibitory checkpoint receptors TIGIT and CD96, which have opposing regulatory effects on NK cells and T cells at the cell surface(29). Solid tumors and blood tumors with higher levels of CD155 on their surfaces are more susceptible to NK cell-mediated CD226-dependent elimination (30, 31).In hepatoma cells, the ATF6 and IRE1 signaling pathways were engaged in the regulation of CD155 expression. During the UPR, knockdown of either of these two master regulators can restore CD155 expression and boost the cytotoxic activity of NK cells against hepatoma cells (32).\u003c/p\u003e \u003cp\u003eImmune therapies are considered to be low-toxicity treatment options because of their high-affinity, targeted, and specific nature. These therapies can harness the activity of the host's immune system to prevent tumor escape(35). HNSCC cancer has been treated with immunotherapy drugs that aim to modulate anti-tumor immune response. Immunotherapy, however, is not as widely used as surgery, chemotherapy, or radiation therapy, and the more efficacious immunotherapy strategy for HNSCC is still being researched (33, 34).\u003c/p\u003e \u003cp\u003ePDIA6 is a candidate biomarker and oncogene in pan-cancer, particularly HNSCC. PDIA6 was also discovered to be associated with immune cell infiltration in pan-cancer, indicating that it may be a valuable therapeutic target for immune-based tumor immunotherapies.\u003c/p\u003e \u003cp\u003eThe expression of PDIA6 was positively associated with HNSCC invasion and negatively associated with T cell NK invasion. CD8\u0026thinsp;+\u0026thinsp;T cells, CD4\u0026thinsp;+\u0026thinsp;T cells, T cell NK, and B cells were negatively correlated with myeloid dendritic cell infiltration in HNSCC. Blood flow analysis revealed that the expression of CD4\u0026thinsp;+\u0026thinsp;TIGIT\u0026thinsp;+\u0026thinsp;T, CD4\u0026thinsp;+\u0026thinsp;CD155\u0026thinsp;+\u0026thinsp;T, and CD8\u0026thinsp;+\u0026thinsp;TIGIT\u0026thinsp;+\u0026thinsp;T in the peripheral blood of patients with head and neck tumor was significantly greater than that of normal controls. PDIA6 can interact with IRE1 to influence CD155 expression. In addition, there is an interaction between PDIA6 and CD155, but its mechanism is unclear and requires further investigation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u003c/strong\u003e\u003cstrong\u003e\u0026rsquo;\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWWJ and JW caried out most of the experiments and drafted the manuscript.KS did parts of the experiments and performed the statistical analysis: MY and ZPG conceived of hte study and revised the manuscript. All authors read and approved hte final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Basic of Guizhou Science -zk [2022] General 411.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eThe written informed consents were signed by every patient. The current study involving human samples and animal experiment has got the approval of the ethics committee of Guizhou Medical University (No. 2001221).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKanazawa T, Misawa K, Shinmura K, Misawa Y, Kusaka G, Maruta M\u003cem\u003e, et al.\u003c/em\u003e Promoter methylation of galanin receptors as epigenetic biomarkers for head and neck squamous cell carcinomas. \u003cem\u003eExpert Rev Mol Diagn\u003c/em\u003e (2019) 19:(2):137-48. doi:10.1080/14737159.2019.1567334\u003c/li\u003e\n\u003cli\u003evon Witzleben A, Wang C, Laban S, Savelyeva N and Ottensmeier C H. HNSCC: Tumour Antigens and Their Targeting by Immunotherapy. \u003cem\u003eCells\u003c/em\u003e (2020) 9:(9):doi:10.3390/cells9092103\u003c/li\u003e\n\u003cli\u003eSung H, Ferlay J, Siegel R L, Laversanne M, Soerjomataram I, Jemal A\u003cem\u003e, et al.\u003c/em\u003e Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e (2021) 71:(3):209-49. doi:10.3322/caac.21660\u003c/li\u003e\n\u003cli\u003eMcDermott J D and Bowles D W. Epidemiology of Head and Neck Squamous Cell Carcinomas: Impact on Staging and Prevention Strategies. \u003cem\u003eCurr Treat Options Oncol\u003c/em\u003e (2019) 20:(5):43. doi:10.1007/s11864-019-0650-5\u003c/li\u003e\n\u003cli\u003eLala M, Chirovsky D, Cheng J D and Mayawala K. Clinical outcomes with therapies for previously treated recurrent/metastatic head-and-neck squamous cell carcinoma (R/M HNSCC): A systematic literature review. \u003cem\u003eOral Oncol\u003c/em\u003e (2018) 84:(108-20. doi:10.1016/j.oraloncology.2018.07.005\u003c/li\u003e\n\u003cli\u003eBray F, Ferlay J, Soerjomataram I, Siegel R L, Torre L A and Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e (2018) 68:(6):394-424. doi:10.3322/caac.21492\u003c/li\u003e\n\u003cli\u003eKikuchi M, Doi E, Tsujimoto I, Horibe T and Tsujimoto Y. Functional analysis of human P5, a protein disulfide isomerase homologue. \u003cem\u003eJ Biochem\u003c/em\u003e (2002) 132:(3):451-5. doi:10.1093/oxfordjournals.jbchem.a003242\u003c/li\u003e\n\u003cli\u003eMa Y, Xia P, Wang Z, Xu J, Zhang L and Jiang Y. PDIA6 promotes pancreatic cancer progression and immune escape through CSN5-mediated deubiquitination of \u0026beta;-catenin and PD-L1. \u003cem\u003eNeoplasia\u003c/em\u003e (2021) 23:(9):912-28. doi:10.1016/j.neo.2021.07.004\u003c/li\u003e\n\u003cli\u003eZhang X, Shi M, Chen T and Zhang B. Characterization of the Immune Cell Infiltration Landscape in Head and Neck Squamous Cell Carcinoma to Aid Immunotherapy. \u003cem\u003eMol Ther Nucleic Acids\u003c/em\u003e (2020) 22:(298-309. doi:10.1016/j.omtn.2020.08.030\u003c/li\u003e\n\u003cli\u003eGuo Y, Pan W K, Wang Z W, Su W H, Xu K, Jia H\u003cem\u003e, et al.\u003c/em\u003e Identification of Novel Biomarkers for Predicting Prognosis and Immunotherapy Response in Head and Neck Squamous Cell Carcinoma Based on ceRNA Network and Immune Infiltration Analysis. \u003cem\u003eBiomed Res Int\u003c/em\u003e (2021) 2021:(4532438. doi:10.1155/2021/4532438\u003c/li\u003e\n\u003cli\u003eBai Y, Liu X, Qi X, Liu X, Peng F, Li H\u003cem\u003e, et al.\u003c/em\u003e PDIA6 modulates apoptosis and autophagy of non-small cell lung cancer cells via the MAP4K1/JNK signaling pathway. \u003cem\u003eEBioMedicine\u003c/em\u003e (2019) 42:(311-25. doi:10.1016/j.ebiom.2019.03.045\u003c/li\u003e\n\u003cli\u003eMao L, Wu X, Gong Z, Yu M and Huang Z. PDIA6 contributes to aerobic glycolysis and cancer progression in oral squamous cell carcinoma. \u003cem\u003eWorld J Surg Oncol\u003c/em\u003e (2021) 19:(1):88. doi:10.1186/s12957-021-02190-w\u003c/li\u003e\n\u003cli\u003ePende D, Spaggiari G M, Marcenaro S, Martini S, Rivera P, Capobianco A\u003cem\u003e, et al.\u003c/em\u003e Analysis of the receptor-ligand interactions in the natural killer-mediated lysis of freshly isolated myeloid or lymphoblastic leukemias: evidence for the involvement of the Poliovirus receptor (CD155) and Nectin-2 (CD112). \u003cem\u003eBlood\u003c/em\u003e (2005) 105:(5):2066-73. doi:10.1182/blood-2004-09-3548\u003c/li\u003e\n\u003cli\u003eMa B, Duan X, Zhou Q, Liu J, Yang X, Zhang D\u003cem\u003e, et al.\u003c/em\u003e Use of aspirin in the prevention of colorectal cancer through TIGIT-CD155 pathway. \u003cem\u003eJ Cell Mol Med\u003c/em\u003e (2019) 23:(7):4514-22. doi:10.1111/jcmm.14332\u003c/li\u003e\n\u003cli\u003eLiu L, You X, Han S, Sun Y, Zhang J and Zhang Y. CD155/TIGIT, a novel immune checkpoint in human cancers (Review). \u003cem\u003eOncol Rep\u003c/em\u003e (2021) 45:(3):835-45. doi:10.3892/or.2021.7943\u003c/li\u003e\n\u003cli\u003eOkumura M, Kadokura H and Inaba K. Structures and functions of protein disulfide isomerase family members involved in proteostasis in the endoplasmic reticulum. \u003cem\u003eFree Radic Biol Med\u003c/em\u003e (2015) 83:(314-22. doi:10.1016/j.freeradbiomed.2015.02.010\u003c/li\u003e\n\u003cli\u003eHinshaw D C and Shevde L A. The Tumor Microenvironment Innately Modulates Cancer Progression. \u003cem\u003eCancer Res\u003c/em\u003e (2019) 79:(18):4557-66. doi:10.1158/0008-5472.Can-18-3962\u003c/li\u003e\n\u003cli\u003eRaskov H, Orhan A, Christensen J P and G\u0026ouml;genur I. Cytotoxic CD8(+) T cells in cancer and cancer immunotherapy. \u003cem\u003eBr J Cancer\u003c/em\u003e (2021) 124:(2):359-67. doi:10.1038/s41416-020-01048-4\u003c/li\u003e\n\u003cli\u003eBorst J, Ahrends T, Bąbała N, Melief C J M and Kastenm\u0026uuml;ller W. CD4(+) T cell help in cancer immunology and immunotherapy. \u003cem\u003eNat Rev Immunol\u003c/em\u003e (2018) 18:(10):635-47. doi:10.1038/s41577-018-0044-0\u003c/li\u003e\n\u003cli\u003eLi T, Liu T, Zhu W, Xie S, Zhao Z, Feng B\u003cem\u003e, et al.\u003c/em\u003e Targeting MDSC for Immune-Checkpoint Blockade in Cancer Immunotherapy: Current Progress and New Prospects. \u003cem\u003eClin Med Insights Oncol\u003c/em\u003e (2021) 15:(11795549211035540. doi:10.1177/11795549211035540\u003c/li\u003e\n\u003cli\u003eChevet E, Hetz C and Samali A. Endoplasmic reticulum stress-activated cell reprogramming in oncogenesis. \u003cem\u003eCancer Discov\u003c/em\u003e (2015) 5:(6):586-97. doi:10.1158/2159-8290.Cd-14-1490\u003c/li\u003e\n\u003cli\u003eDufey E, Sep\u0026uacute;lveda D, Rojas-Rivera D and Hetz C. Cellular mechanisms of endoplasmic reticulum stress signaling in health and disease. 1. An overview. \u003cem\u003eAm J Physiol Cell Physiol\u003c/em\u003e (2014) 307:(7):C582-94. doi:10.1152/ajpcell.00258.2014\u003c/li\u003e\n\u003cli\u003ePluquet O and Galmiche A. Impact and Relevance of the Unfolded Protein Response in HNSCC. \u003cem\u003eInt J Mol Sci\u003c/em\u003e (2019) 20:(11):doi:10.3390/ijms20112654\u003c/li\u003e\n\u003cli\u003ePatel A, Oshi M, Yan L, Matsuyama R, Endo I and Takabe K. The Unfolded Protein Response Is Associated with Cancer Proliferation and Worse Survival in Hepatocellular Carcinoma. \u003cem\u003eCancers (Basel)\u003c/em\u003e (2021) 13:(17):doi:10.3390/cancers13174443\u003c/li\u003e\n\u003cli\u003eYan X, Chen M, Xiao C, Fu J, Sun X, Hu Z\u003cem\u003e, et al.\u003c/em\u003e Effect of unfolded protein response on the immune infiltration and prognosis of transitional cell bladder cancer. \u003cem\u003eAnn Med\u003c/em\u003e (2021) 53:(1):1048-58. doi:10.1080/07853890.2021.1918346\u003c/li\u003e\n\u003cli\u003eWalter P and Ron D. The unfolded protein response: from stress pathway to homeostatic regulation. \u003cem\u003eScience\u003c/em\u003e (2011) 334:(6059):1081-6. doi:10.1126/science.1209038\u003c/li\u003e\n\u003cli\u003eEletto D, Eletto D, Boyle S and Argon Y. PDIA6 regulates insulin secretion by selectively inhibiting the RIDD activity of IRE1. \u003cem\u003eFaseb j\u003c/em\u003e (2016) 30:(2):653-65. doi:10.1096/fj.15-275883\u003c/li\u003e\n\u003cli\u003eO'Donnell J S, Madore J, Li X Y and Smyth M J. Tumor intrinsic and extrinsic immune functions of CD155. \u003cem\u003eSemin Cancer Biol\u003c/em\u003e (2020) 65:(189-96. doi:10.1016/j.semcancer.2019.11.013\u003c/li\u003e\n\u003cli\u003eZhang J, Zhou L, Xiang J D, Jin C S, Li M Q and He Y Y. Artesunate-induced ATG5-related autophagy enhances the cytotoxicity of NK92 cells on endometrial cancer cells via interactions between CD155 and CD226/TIGIT. \u003cem\u003eInt Immunopharmacol\u003c/em\u003e (2021) 97:(107705. doi:10.1016/j.intimp.2021.107705\u003c/li\u003e\n\u003cli\u003eSzereday L, Nagy D U, Csiszar B, Kevey D, Feik T and Meggyes M. Examination of the TIGIT, CD226, CD112, and CD155 Immune Checkpoint Molecules in Peripheral Blood Mononuclear Cells in Women Diagnosed with Early-Onset Preeclampsia. \u003cem\u003eBiomedicines\u003c/em\u003e (2021) 9:(11):doi:10.3390/biomedicines9111608\u003c/li\u003e\n\u003cli\u003eTahara-Hanaoka S, Shibuya K, Kai H, Miyamoto A, Morikawa Y, Ohkochi N\u003cem\u003e, et al.\u003c/em\u003e Tumor rejection by the poliovirus receptor family ligands of the DNAM-1 (CD226) receptor. \u003cem\u003eBlood\u003c/em\u003e (2006) 107:(4):1491-6. doi:10.1182/blood-2005-04-1684\u003c/li\u003e\n\u003cli\u003eGong J, Fang L, Liu R, Wang Y, Xing J, Chen Y\u003cem\u003e, et al.\u003c/em\u003e UPR decreases CD226 ligand CD155 expression and sensitivity to NK cell-mediated cytotoxicity in hepatoma cells. \u003cem\u003eEur J Immunol\u003c/em\u003e (2014) 44:(12):3758-67. doi:10.1002/eji.201444574\u003c/li\u003e\n\u003cli\u003eCohen E E W, Bell R B, Bifulco C B, Burtness B, Gillison M L, Harrington K J\u003cem\u003e, et al.\u003c/em\u003e The Society for Immunotherapy of Cancer consensus statement on immunotherapy for the treatment of squamous cell carcinoma of the head and neck (HNSCC). \u003cem\u003eJ Immunother Cancer\u003c/em\u003e (2019) 7:(1):184. doi:10.1186/s40425-019-0662-5\u003c/li\u003e\n\u003cli\u003eYu M, Qian X X, Li G, Cheng Z and Lin Z. Prognostic biomarker IL17A correlated with immune infiltrates in head and neck cancer. \u003cem\u003eWorld J Surg Oncol\u003c/em\u003e (2022) 20:(1):243. doi:10.1186/s12957-022-02703-1\u003c/li\u003e\n\u003cli\u003eQuan H, Shan Z, Liu Z, Liu S, Yang L, Fang X\u003cem\u003e, et al.\u003c/em\u003e The repertoire of tumor-infiltrating lymphocytes within the microenvironment of oral squamous cell carcinoma reveals immune dysfunction. \u003cem\u003eCancer Immunol Immunother\u003c/em\u003e (2020) 69:(3):465-76. doi:10.1007/s00262-020-02479-x\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"head and neck squamous cell carcinoma, PDIA6, CD155, TIGIT, Immune escape","lastPublishedDoi":"10.21203/rs.3.rs-3828950/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3828950/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBACKGROUND\u003c/h2\u003e \u003cp\u003eProtein disulfide isomerases A6 (PDIA6) is a family member of the PDI enzymes. Recently, it was found that PDIA6 is closely associated with a variety of cancers. Here, we studied the role of PDIA6 in pan-cancer and further verified the results in head and neck squamous cell carcinoma (HNSCC) through in vitro experiments.\u003c/p\u003e\u003ch2\u003eMETHODS\u003c/h2\u003e \u003cp\u003eThe TCGA database and GEPIA2 were used to assess PDIA6's potential as a diagnostic and prognostic biomarker in pan-cancer. The cBioPortal database was used to examine the PDIA6 mutation character. PDIA6 function analysis was carried out using the LinkedOmics and CancerSEA databases. The TIMER and TISIDB websites were used to investigate the role of PDIA6 in immunological infiltration.PDIA6 mRNA and protein expression were identified in HNSCC tissues. PDIA6 expression was detected in primary HNSCC tissues and cell lines using RT-qPCR, Western blotting, and immunohistochemistry. Furthermore, PDIA6 deletion and overexpression cell lines were developed to investigate the interaction of PDIA6 and TIGIT/CD155, as well as the influence of PDIA6 on cell proliferation and metastasis in vitro.\u003c/p\u003e\u003ch2\u003eRESULTS\u003c/h2\u003e \u003cp\u003ePDIA6 was elevated in the majority of malignancies. In numerous malignancies, the overexpression and mutation of PDIA6 were associated with a poorer prognosis. In the majority of malignancies, the results revealed a strong positive association between PDIA6 and myeloid-derived suppressor cell (MDSC) infiltration and a significant negative correlation between PDIA6 and T-cell natural killer (NK) infiltration. Experiments in vitro revealed that PDIA6 levels were elevated in HNSCC tissues and cell lines. The connection between PDIA6 expression and CD8\u0026thinsp;+\u0026thinsp;T-cell infiltration was negative. In addition, PDIA6 was found to be co-expressed with immune-related genes and immune-checkpoints. The effect of PDIA6 on immune evasion of head and neck cancers may be mediated by the TIGIT/CD155 signal pathway.\u003c/p\u003e\u003ch2\u003eCONCLUSION\u003c/h2\u003e \u003cp\u003ePDIA6 could be a biomarker and an oncogene in HNSCC and other types of cancer. Also, PDIA6 was linked to immune cell infiltration in pan-cancer, which could be a target for immune therapy to treat tumors.\u003c/p\u003e","manuscriptTitle":"PDIA6 promotes immune escape of head and neck squamous cell carcinoma by regulating TIGIT/CD155 axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-05 17:01:58","doi":"10.21203/rs.3.rs-3828950/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8678c28b-8f5a-40d3-b2d6-fdf1e2f3cd10","owner":[],"postedDate":"January 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-02-03T04:44:46+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-05 17:01:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3828950","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3828950","identity":"rs-3828950","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.