Dietary naringenin modulates antioxidant status and hepatic lipid deposition in marine medaka (Oryzias dancena) fed a high-fat diet

Dietary naringenin modulates antioxidant status and hepatic lipid deposition in marine medaka (Oryzias dancena) fed a high-fat diet | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Dietary naringenin modulates antioxidant status and hepatic lipid deposition in marine medaka (Oryzias dancena) fed a high-fat diet Tejas Santosh Tari, Chandrasekar Selvam, A Mariselvammurugan, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8479933/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract High-fat diets (HFDs) are commonly used in aquaculture to enhance growth and reduce feed costs; however, prolonged feeding can induce oxidative stress, disrupt lipid metabolism, and impair physiological homeostasis. The present study evaluated the protective effects of naringenin (NGE) in the marine model fish Oryzias dancena fed a high-fat diet. Fish were fed one of four experimental diets for 45 days: a normal-fat diet (NFD, 8% crude lipid), a high-fat diet (HFD, 15% crude lipid), and HFD supplemented with 0.075% (HFD + N1) or 0.15% (HFD + N2) naringenin. Digestive enzyme activities, antioxidant status, lipid peroxidation, hepatic histology, and the expression of genes related to antioxidant defence, lipid metabolism, and immunity were assessed at the end of the feeding trial. HFD feeding selectively modulated digestive enzyme activities, characterized by increased lipase activity and reduced amylase activity. Muscle superoxide dismutase (SOD) activity was significantly reduced in HFD-fed fish, while catalase (CAT) activity showed no significant change but followed a similar directional trend. In contrast, hepatic expression of sod and gpx was upregulated, indicating tissue-specific oxidative stress responses. Alanine aminotransferase (ALT) activity was significantly reduced in the HFD group, whereas aspartate aminotransferase (AST) activity remained statistically unchanged, although a comparable pattern was observed. SOD activityon with naringenin, particularly at 0.15%, restored muscle SOD activity, enhanced total antioxidant capacity, reduced lipid peroxidation, and partially restored ALT activity. At the molecular level, HFD feeding upregulated pparδ and suppressed fads2 expression, indicative of lipid metabolic stress, which was modestly alleviated by naringenin supplementation. Histological analysis revealed pronounced hepatic lipid accumulation in HFD-fed fish, while naringenin supplementation significantly reduced hepatic vacuolation. Collectively, these findings demonstrate that dietary naringenin, particularly at 0.15%, mitigates HFD-induced oxidative stress and hepatic lipid accumulation in Oryzias dancena by enhancing antioxidant defence and modulating lipid metabolic pathways. Marine model fish High-Fat Diet Naringenin lipid metabolism Antioxidant Defence Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Aquaculture, the fastest growing food sector, plays a crucial role in global food and nutritional security. However, the intensification of aquaculture practices has introduced new challenges in developing nutritionally balanced and sustainable feeds that support fish health and metabolic homeostasis. Feed formulation remains a central focus, as feeds accounts for nearly 70% of total production costs (Macusi et al., 2023; Nayak et al., 2023). Among the major dietary components, lipids are highly energy-dense (~ 9 kcal g⁻¹) and serve as essential sources of fatty acids and phospholipids required for membrane integrity, immunity, and reproduction. Increasing dietary lipid levels in aquafeeds can improve growth performance and feed efficiency through a protein-sparing effect, while reducing nitrogen excretion (Glencross, 2009; Turchini et al., 2009; Tocher, 2010; NRC, 2011). Despite these benefits, prolonged feeding of high-fat diets (HFDs) can induce undesirable metabolic alterations in fish, including excessive lipid deposition, hepatic steatosis, oxidative stress, and inflammation. High dietary lipid levels have been associated with metabolic disorders, oxidative damage, immune dysfunction, and reduced disease resistance in multiple cultured fish species (Naiel et al., 2023; Gora et al. 2023; Wu et al., 2022; Fei et al., 2022). These challenges not only compromise fish health and welfare of farmed fish but also affect the product quality and consumer acceptance (Zhang et al., 2022). ໿The liver, being the primary site for lipid metabolism, is especially susceptible to fat overload, resulting in impaired metabolic homeostasis, elevated hepatic enzymes and endoplasmic reticulum stress (Jia et al., 2020; Nguyen et al., 2008; Qiao et al., 2022). The concomitant overproduction of reactive oxygen species (ROS) accelerates lipid peroxidation and suppresses antioxidant enzyme activities such as superoxide dismutase (SOD) and glutathione peroxidase (GPx) (Abasubong et al., 2023; Zhao et al., 2024). Furthermore, HFDs activate proinflammatory cytokines and alter gut microbiota composition, collectively exacerbating hepatic inflammation and compromising physiological function (Abasubong et al., 2023; Jin et al., 2019; Zhang et al., 2022). To mitigate HFD-induced oxidative and metabolic stress, the use of natural bioactive compounds has gained growing attention. Among these, flavonoids, a diverse group of plant-derived polyphenols, have gained increasing attention for their ability to alleviate oxidative and inflammatory damage through free radical scavenging, metal chelation, and modulation of redox-sensitive signalling pathways, owing largely to their C6-C3-C6 backbone (Panche et al., 2016; Roy et al., 2022). Dietary supplementation of various flavonoids like quercetin, baicalin, resveratrol, and hesperidin has been shown to enhance antioxidant enzyme activities, reduce lipid peroxidation, and improve immune responses in fish (Elshopakey et al., 2023; Ge et al., 2023; Jasim et al., 2022; Jia et al., 2020; Wu et al., 2022). Among flavonoids, naringenin, a citrus-derived flavanone, stands out for its potent antioxidant, lipid-regulatory, and hepatoprotective effects (Cai et al., 2023; Jeon et al., 2007; Salehi et al., 2019; Wang et al., 2018). In mammalian models, naringenin mitigates diet-induced oxidative damage and hepatic steatosis by modulating lipid-metabolic and inflammatory pathways: it regulates nuclear receptors and transcriptional co-activators that control fatty acid oxidation and lipogenesis (PPAR-α/PPAR-γ and LXR-α) (Goldwasser et al., 2010), suppresses inflammasome-mediated NLRP3/NF-κB signalling to reduce hepatic inflammation (Wang et al., 2020) and prevents obesity-associated steatosis and glucose intolerance through the regulation of metabolic genes such as Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1 α (pgc-1α) and Sterol Regulatory Element-Binding Transcription Factor 1 (srebf1) (Assini et al., 2015). However, comparable mechanistic studies in fish remain scarce, and the physiological effects of dietary naringenin under high-fat feeding conditions are largely unexplored. The small euryhaline teleost Oryzias dancena , commonly known as the Indian ricefish or Asian ricefish, possesses remarkable adaptability across a wide range of salinities. Its small body size, transparent embryos, and short reproductive cycle make it an ideal candidate for nutritional and toxicological studies (Ranjan et al., 2022). Sharing the experimental advantages of the zebrafish but adapted to marine and brackish water conditions, O. dancena serves as a promising marine model organism for nutrigenomic and physiological research in marine contexts (Ranjan et al., 2022). To the best of our knowledge, no comprehensive studies have investigated the lipid-regulatory, antioxidant and immunomodulatory effects of dietary naringenin in fish. Therefore, the present study aimed to evaluate whether dietary naringenin could alleviate HFD-induced oxidative stress and lipid metabolic imbalance in O. dancena . We hypothesized that naringenin supplementation would enhance antioxidant defences, attenuate hepatic lipid accumulation, and modulate the expression of key genes involved in lipid metabolism. The findings provide new insights into the mechanistic actions of naringenin and reinforce the potential of O. dancena as a marine model for nutrigenomic investigations. 2. Material and Methods 2.1. Experimental Diets: Four isonitrogenous experimental diets (39% crude protein) with varying lipid levels and naringenin supplementation were formulated to evaluate the effects of dietary naringenin under high-fat feeding conditions (Table 1 ). The normal-fat diet (NFD, 8% crude lipid) served as the basal control, while a high-fat diet (HFD, 15% crude lipid) was formulated to induce lipid accumulation and oxidative stress. Two additional diets, HFD + N1 (15% crude lipid + 0.075% naringenin) and HFD + N2 (15% crude lipid + 0.15% naringenin), were prepared to assess the effects of dietary naringenin supplementation. The lipid content of all high-fat diets (HFD, HFD + N1, and HFD + N2) was maintained at 15%, ensuring that any observed physiological responses among these groups could be attributed specifically to naringenin supplementation rather than differences in dietary lipid levels. Naringenin (C₁₅H₁₂O₅; molecular weight: 272.26; ≥95% purity; SRL Laboratories, India) was incorporated into the feed by replacing an equivalent amount of carboxymethyl cellulose (CMC), which served as an inert binder. This adjustment ensured that all diets remained isonitrogenous, while the HFD-based diets remained isolipidic relative to each other. For the control diets (NFD and HFD), CMC was included at corresponding levels to maintain uniform texture and binding properties. The inclusion levels of naringenin (0.075% and 0.15%) were selected based on previous studies employing dietary flavonoids in fish (Dong et al., 2021; Liu et al., 2020; Zhang et al., 2018). Dry ingredients were thoroughly mixed, followed by the addition of the oil fraction containing dissolved naringenin for the treatment diets. The mixture was homogenized with water to form a dough, extruded using a twin-screw extruder to produce slow-sinking pellets, and air-dried at room temperature. The dried pellets were stored at − 20°C until use. The total phenolic content was measured following (Siddiqui et al., 2017; Singleton et al., 1999) and the proximate composition of all diets was analyzed according to AOAC (2005) procedures. Table 1 Feed Composition and Proximate analysis Ingredients NFD HFD HFD + N1 HFD + N2 Wheat gluten 30 30 30 30 RDGS 85 85 85 85 Meat and bone meal 50 50 50 50 Soya 185 185 185 185 Rice powder 43 43 43 43 Wheat powder 100 100 100 100 Cottonseed meal 70 70 70 70 GNOC 80 80 80 80 Fish meal 155 155 155 155 Fish oil 30 60 60 60 Linseed oil 15 30 30 30 Sunflower oil 15 30 30 30 CMC 1 80 20 19.25 18.5 Vitamin 2 20 20 20 20 Mineral 3 20 20 20 20 Vitamin C 4 5 5 5 5 Methionine 5 5 5 5 Lysine 7 7 7 7 MCP 5 5 5 5 Naringenin 5 0 0 0.75 1.5 Proximate Composition (%) Moisture 3.81 ± 0.16 2.91 ± 0.24 2.15 ± 0.32 2.71 ± 0.22 Protein 39 ± 0.20 39.57 ± 0.35 39.10 ± 0.11 39.75 ± 0.21 Lipid 8.2 ± 0.26 14.64 ± 0.10 14.95 ± 0.14 14.75 ± 0.23 Ash 11.43 ± 0.16 10.4 ± 0.07 9.19 ± 0.86 10.2 ± 0.08 Acid insoluble ash 2.67 ± 0.25 2.57 ± 0.22 2.45 ± 0.21 2.4 ± 0.25 Total Phenolic content (mg GAE/g) 30.90 ± 16.10 34.81 ± 11.48 100.8 ± 7.89 140.9 ± 13.08 1 NICE Chemicals (p) LTD- Kochi, India 2 Vitamin mixture (Supplevite®): composition per 250g: vit. A500000IU,vit.D3–100,000IU,vit.B2–200mg,vit.E-75units,vit.K-100mg, Ca pantothenate- 250mg, Nicotinamide- 100mg, vit. B12–600mg, choline chloride-15,000mg, Ca-75,000mg, Mn-27,500mg, I-100mg, Fe-750mg, Zn1500mg, Cu-200mg, Co-45mg. 3 Mineral mix (Agrimin®): vit-A 7,00,000IU, vit-D3- 70,000, vit-E- 250mg, coabalt-150mg, Copper- 1200mg, iodine- 325mg, iron- 1500mg, manganese-6000mg, pottassium-100mg, sulphur-720mg, zinc-9600mg, DL-methionine-1000mg, calcium-25,500mg and phosphorous- 12,750mg. 4 VitaminC- Ovans cure life science, Gurugram, India. 5 Sisco Research Laboratories pvt, Ltd- Maharashtra, India. 2.2. Feeding Trial Sixty days old Oryzias dancena were obtained from Vizhinjam Regional Centre and transported to ICAR-CMFRI, Kochi, Wet Laboratory with oxygenated containers and acclimatized for 2 weeks in 1000 L FRP tank. During acclimatization fish were fed CMFRI Varna marine ornamental fish feed (38% protein, 9% fat) three times a day. Before stocking, the fish were starved for 48hrs. Subsequently, a total of 120 healthy individuals having average body weight (0.2 ± 0.035gm) and average length (2 ± 0.15cm) were selected randomly and stocked in twelve 50 L capacity tanks (10 fish/tank) in closed recirculatory system to ensure uniform water quality and aeration across treatments. Fish were fed till satiation ( ad libitum ) with 4 different experimental diets three times a day (9:00, 14:00, 18:00) Water salinity was maintained at 25 ppt throughout the trial period and every day uneaten feed and faecal matter were siphoned out. The trial continued for 45 days after which they were sampled for further analysis. 2.3. Sampling After completion of the 45-day feeding trial, fish were starved for 24 h and anesthetized with clove oil (50 mg L⁻¹; immersion method; HiMedia, India) prior to euthanasia and sampling. A total of nine fish per tank were sacrificed for sample collection. For digestive enzyme analysis, guts from three fish were pooled to form one composite sample, and three pooled samples were collected per dietary group. Muscle samples were collected in triplicate for biochemical analyses. Gut and muscle tissues were homogenized in 10% (w/v) sucrose buffer at a tissue-to-buffer ratio of 1:20 and centrifuged at 8,000 rpm for 10 min at 4°C. The supernatant was collected and stored at − 20°C until further analysis. For gene expression analysis, liver samples were collected in triplicate and preserved in 500 µL of RNAlater® (Invitrogen™, Thermo Fisher Scientific), stored at 4°C for 24 h, and subsequently transferred to − 80°C to maintain RNA integrity until processing. For histological examination, liver samples were collected and fixed in 10% neutral buffered formalin (NBF; Sigma-Aldrich, HT501128) to preserve tissue architecture and stored at room temperature until analysis. Additionally, livers from four fish within the same dietary group were pooled and stored at − 80°C for lipid-related analyses to prevent lipid oxidation. All experimental procedures involving fish, including rearing, handling, and sampling, were reviewed and approved by the Animal Ethics Committee of the Central Marine Fisheries Research Institute (CMFRI), Kochi, India. Every effort was made to minimize fish stress by maintaining optimal rearing and handling conditions. 2.4. Biochemical parameters 2.4.1. Digestive Enzymes Digestive enzyme activities were quantified using gut homogenate supernatants. Protease activity was determined using casein as a substrate; enzyme extracts were incubated with casein solution under standard conditions, and the reaction was terminated with trichloroacetic acid (TCA). The released peptides were quantified by measuring absorbance at 280 nm following Drapeau (1976). Amylase activity was determined by incubating the enzyme extract with starch as a substrate, where the released reducing sugars like glucose reacted with DNS reagent to form a reddish-brown complex measurable at 540 nm (Rick & Stegbauer, 1974). Lipase activity was measured using p-nitrophenyl palmitate (pNPP) as a substrate, with the release of p-nitrophenol quantified spectrophotometrically at 410 nm (Winkler & Stuckmann, 1979). Total protein content was determined using the Lowry method (Lowry et al., 1951). 2.4.2. Antioxidant and metabolic enzymes activity: Various biochemical parameters like antioxidant enzymes metabolic enzymes and lipid peroxidase were measured in fish muscle. Superoxide dismutase (SOD) activity was determined by the epinephrine auto-oxidation method given by Misra & Fridovich, (1977), which measures the enzyme’s ability to inhibit the conversion of epinephrine to adrenochrome in an alkaline medium. The rate of adrenochrome formation was monitored spectrophotometrically (Multiskan™ Skyhigh Microplate Spectrophotometer, Thermo Scientific) at 480 nm. Catalase activity was assayed following method described by (Aebi, 1984) by monitoring the decomposition of hydrogen peroxide (H₂O₂) into water and oxygen. The decrease in absorbance of H₂O₂ was recorded spectrophotometrically at 240 nm, and the rate of decline indicated the level of catalase activity. The total antioxidant capacity of the liver was assessed spectrophotometrically by the phosphomolybdenum method, following the procedure described by Prieto et al. (1999). 2.4.3. Metabolic Enzymes Alanine Aminotransferase (ALT) and Aspartate Aminotransferase (AST) activities was estimated following the International Federation of Clinical Chemistry (IFCC) kinetic UV method, using a commercially available diagnostic kit (Coral Clinical Systems, India). 2.4.4. Lipid Peroxidase: Lipid peroxidase was detected using thiobarbituric acid (TBA) at 532nm following standard methods (Jagannivasan et al., 2024; Ohkawa et al., 1979). 2.5. Gene Expression Total RNA was extracted from liver tissue using RNAiso Plus (Takara, India). The purity and concentration of RNA were assessed using NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). Only samples having purity above 1.8 were used for reverse transcription. The concentration of RNA of selected samples was diluted to100ng/ µl. Reverse transcription was carried out in a volume of 20 µl, containing uniform amounts of RNA (800 µl) using PrimeScript™ 1st strand cDNA Synthesis Kit (6110A, Takara) according to the manufacturer’s instructions, The mRNA expression of Superoxide Dismutase (sod) , Glutathione Peroxidase (gpx) , Fatty Acid Desaturase 2 (fads 2) , Peroxisome Proliferator-Activated Receptor-Delta (ppar-δ), and Complement Component 8 (c8) were quantified by quantitative real-time PCR (qPCR) using β-actin (actb) as a housekeeping gene. The primers used in this study were obtained from previously published literature or designed in-house using the NCBI Primer-BLAST tool. The custom primers were based on conserved regions within the gene across related medaka species (Table 2). Primer efficiency was validated using standard curves generated from serial dilutions of pooled cDNA, and only primers with amplification efficiency between 90–110% were used. The qPCR reactions were performed on an AriaMx Real-Time PCR System (Agilent Technologies, Singapore). Each reaction medium of 10 µl volume containing 5 µl TB Green PREMIX EX Taq™ (RR820A, Takara) 0.5 µl each of forward and reverse primer, 3 µl of nuclease-free water and 1 µl of cDNA template. The amplification program consisted of an initial denaturation at 95°C for 3 min, followed by 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. A melting curve analysis (95°C for 30 s, 60°C for 30 s, 95°C for 30 s) was included to verify the specificity of amplification. For gene expression analysis, raw Ct values were converted into efficiency-corrected relative expression values using the Pfaffl method (Pfaffl, 2001). Expression levels of target genes were normalised against the reference gene β-actin . Table 2 Primers used for real-time quantitative PCR (qPCR) of Oryzias dancena. Gene Sequence 5’ to 3’ Amplicon size Efficiency Accession no. Sod F- AATCAAAGGCCTCACACCAG R- GTCCCCAACGTGTCTTTCTG 148 110 Self-Designed gpx F- CACGACCACCAGGGATTACA R- TGGCCGAACTGATTACAGGG 99 95 Self-Designed fads2 F- GGGTGGATTTGGCGTGGTAT R- CCAGTGACTCTCCAGGAACC 122 107 Mariselvammurugan, 2025 pparδ F- GCAGGTGGAACAGAGTCAGG R- AGTAGAGGGTGGAGCGAGGT 156 102 Mariselvammurugan, 2025 C8 F- ACSCTYTCAGAGCCCATGYTSACCA R- TGGTCCTGRTCCACTTCACCACAGT 155 94 Self-Designed actb F- GGAAATCGTGCGTGACATCA R- TACCAAGGAATGAGGGCTGG 188 110 Mariselvammurugan, 2025 et al Abbreviations: sod - superoxide dismutase, gpx - glutathione peroxidase, fads 2 - fatty acid desaturase ppar-δ- peroxisome proliferator-activated receptor-delta, c8- complement component 8 and β -actin - beta actin 2.7. Histological Examination: The liver samples fixed in 10% NBF were dehydrated through a series of alcohols and then infiltrated with paraffin wax using automatic tissue processor. Sections of 3 μm thickness were cut on the semi- automatic microtome (Leica RM2125 RTS, Germany) then stained with H&E stains with slight modifications and observed under light microscope (40X) (leica) and photomicrographs were captured using a digital camera system. 2.8. Total Phenolic Content The total phenolic content (TPC) in feed was determined by reacting the sample supernatant extracted using 80% ethanol with the Folin–Ciocalteu reagent, neutralizing with sodium carbonate, incubating for 30 minutes for colour development, and measuring absorbance at 765 nm against a standard curve of naringenin following (Siddiqui et al., 2017; Singleton et al., 1999). 2.9. In vitro Antioxidant Assay The in vitro antioxidant activity of naringenin (≥95% purity; SRL Laboratories, India) was evaluated using DPPH (2,2-diphenyl-1-picrylhydrazyl) and ABTS ABTS (2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) radical scavenging assays. Naringenin was dissolved in methanol to prepare different test concentrations (25 - 250 µM). Ascorbic acid was used as the standard reference antioxidant. All assays were performed in triplicate, and results are expressed as mean ± SEM. 2.9.1 DPPH Radical Scavenging Activity: The DPPH (2,2-diphenyl-1-picrylhydrazyl) assay was performed according to Brand-Williams et al. (1995) with slight modifications. A 0.1 mM DPPH solution in methanol was freshly prepared. Equal volumes (1 mL each) of naringenin solution at different concentrations (10–250 µM) or Trolox standard were mixed with the DPPH solution and incubated in the dark at room temperature for 30 min. Absorbance was recorded at 517 nm using a UV–Vis spectrophotometer (Shimadzu, Japan). The percentage of radical scavenging activity was calculated as: Scavenging activity (%) = (Ac−As/Ac) ×100 where Ac is the absorbance of the control (DPPH solution without sample) and As is the absorbance of the sample. IC₅₀ values were determined by nonlinear regression. 2.9.2. ABTS Radical Scavenging Activity: The ABTS (2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) assay was performed following Re et al. (1999) with modifications. ABTS⁺ radicals were generated by mixing 7 mM ABTS with 2.45 mM potassium persulfate and allowing the reaction to stand in the dark for 16 h. The ABTS⁺ solution was diluted with ethanol to an absorbance of 0.70 ± 0.02 at 734 nm. Equal volumes (1 mL) of naringenin solution or ascorbic acid standard were mixed with 1 mL of ABTS⁺ solution, incubated in the dark for 6 min, and absorbance was recorded at 734 nm. Inhibition was calculated using the same formula as above. 2.10. Statistical Analysis All the statistical analyses were performed using the software GraphPad Prism version 8.4.2 (Graphpad Software Inc., San Diago, CA, USA). All data were checked for normality and homogeneity of variance using Kolmogorov-Smirnov and Levene’s tests, respectively. Data were analysed using one-way analysis of variance (ANOVA) to determine significant difference among treatment groups followed by Tukey’s post-hoc test for multiple comparisons to identify pairwise differences between group means. Results were considered statistically significant at p < 0.05. All data are shown as the mean ± SEM (Standard Error of the Mean). 3. Results 3.1. Effect on digestive enzymes: The Effect of dietary fat levels and naringenin supplementation on digestive enzymes of O. dancena were presented in Figure 1 . Lipase activity was significantly elevated in all groups receiving high-fat diets (HFD, HFD+N1, HFD+N2) compared to NFD ( P < 0.05). Conversely, amylase activity was significantly higher in NFD-fed fish compared to all HFD groups ( P < 0.05). Protease activity showed no statistically significant difference among treatments, although fish fed NFD had slightly higher protease activity compared to HFD fed groups. No significant effect of naringenin supplementation at either 0.075% or 0.15% was observed on activities of protease, lipase, and amylase ( P> 0.05) beyond those induced by dietary lipid level. 3.2. Effect on Antioxidant enzymes in muscle: Antioxidant responses (SOD, CAT, and total antioxidant capacity (TAC)) in muscle of O. dancena fed with diets containing varying lipid levels and naringenin are presented in Figure 2. SOD activity was significantly reduced in fish fed HFD compared to NFD (p < 0.05). Supplementation with 0.075% naringenin produced a modest improvement, while 0.15% naringenin (HFD+N2) restored SOD activity to levels comparable to NFD. CAT activity was found to be lowest in HFD fed group though the difference among treatments were not statistically significant. Total antioxidant capacity (TAC) increased with NGE supplementation, with both HFD+N1 and HFD+N2 groups showing significantly higher TAC than NFD and HFD groups (p < 0.05). 3.3. Effect on Metabolic enzymes in muscle Muscle ALT and AST activities in O. dancena under different dietary treatments are shown in Figure 3. ALT activity was significantly reduced in fish fed the HFD compared to the NFD group (p < 0.05). Fish receiving naringenin supplementation (HFD+N1 and HFD+N2) showed ALT activity values closer to those of NFD-fed fish. AST activity showed a similar directional trend, with lower values in HFD-fed fish; however, the differences among treatments were not statistically significant (p > 0.05). 3.4. Lipid Peroxidation levels The muscle lipid peroxidation value of O. dancena fed with diets containing varying lipid levels and naringenin are presented in Figure 4 . Lipid peroxidation, measured as thiobarbituric acid reactive substances (TBARS), was significantly higher in the muscle of fish fed the HFD compared to the NFD group (p 0.05). 3.5. Gene Expression The hepatic mRNA expression of genes related to antioxidant ( sod , gpx ), lipid metabolism ( fads2, ppar-δ ), immune marker c8 of O. dancena fed with diets containing varying lipid levels and naringenin are presented in Figure 5 . Fish fed HFD exhibited significantly higher mRNA expression of sod and gpx compared to NFD (p < 0.05). NGE supplementation reduced expression of these genes, with levels in HFD+N2 approaching those of NFD-fed fish. pparδ expression was markedly upregulated in HFD-fed fish relative to NFD (p < 0.05), but declined progressively in NGE-supplemented groups, with the lowest expression in HFD+N2. By contrast, fads2 expression was lowest in HFD-fed fish, while both NGE-supplemented groups showed partial restoration, with HFD+N2 showing the highest levels. Expression of the immune-related gene c8 did not differ significantly among treatments ( P > 0.05). 3.6. Histology Histopathological examination of hepatic tissues revealed marked lipid accumulation in fish fed the high-fat diet (HFD), characterized by prominent cytoplasmic vacuolation and displacement of hepatocyte nuclei toward the periphery, indicative of microvesicular steatosis (Figure 6). In contrast, hepatocytes in the normal-fat diet (NFD) group exhibited normal architecture with centrally located nuclei and minimal lipid vacuolation. Fish fed naringenin-supplemented diets (HFD + N1 and HFD + N2) exhibited reduced hepatic lipid vacuolation compared to the HFD group, with histological features consistent with mild to moderate microvesicular steatosis, indicating a protective effect of naringenin against lipid-induced hepatic alterations. 3.7. Invitro Antioxidant assays Naringenin exhibited a concentration-dependent increase in antioxidant activity in both DPPH and ABTS assays (Figure 7). In the DPPH assay, the radical scavenging activity of naringenin increased progressively with concentration, ranging from approximately 25 % at 50 µM to 70 % at 250 µM, whereas ascorbic acid exhibited higher scavenging efficiency across all tested concentrations. A similar trend was observed in the ABTS assay, where naringenin demonstrated increasing radical-quenching activity with concentration, from 15 % at 50 µM to nearly 35 % at 250 µM, while ascorbic acid showed significantly greater inhibition. These results confirm that naringenin possesses intrinsic radical-scavenging potential, capable of neutralizing both DPPH and ABTS radicals. 4. Discussion High-fat diets (HFDs) are known to induce hepatic steatosis, oxidative stress, and metabolic disturbances that collectively impair growth and physiological performance in fish. Therefore, exploring natural bioactive compounds capable of alleviating these adverse effects has gained considerable attention in aquaculture nutrition research. In the present study, the effects of dietary high fat intake on metabolic and oxidative parameters were evaluated, along with the potential of naringenin, a flavonoid with recognized antioxidant and lipid-lowering properties, to mitigate HFD-induced alterations. Dietary lipid levels influenced the activity of digestive enzymes in Oryzias dancena . Lipase activity was significantly higher in fish receiving higher dietary lipid levels compared to NFD. This was in response to higher lipid levels as lipase secretion increases to facilitate better lipid hydrolysis (Lu et al., 2024; Ma et al., 2020). Conversely, amylase activity was significantly lower in fish fed HFDs indicating metabolic shift away from carbohydrate utilization. Such reciprocal regulation between amylase and lipase has also been observed in other fish species like yellow croaker ( Larimichthys crocea ) (Cai et al., 2016) and Nile tilapia ( Oreochromis niloticus ) (Yuan et al., 2025) reflecting dietary adaptation and digestive plasticity. Protease activity was found to be slightly higher in NFD compared to other groups. This reduced protease activity in HFDs is in consistent with previous studies which demonstrate increased protease activity in fish with lower lipid intake (Ma et al., 2020). External factors like protein-lipid ratio are known to affect the significance of variation of protease activity in response to change in lipid intake (Nogueda Torres & Lazo, 2024; Trenzado et al., 2018). The lack of significant contrasting trend in protease activity between NFD and HFD, HFD+N1 and HFD+N2 fed groups may be because of lower stocking density and higher protein to lipid ratio. Unlike other flavonoids like resveratrol (Afzali-Kordmahalleh & Meshkini, 2023) and curcumin (Eissa et al., 2024) dietary supplementation of naringenin did not show any influence on digestive enzyme modulation. The hepatic mRNA expression of sod and gpx was significantly upregulated in fish fed HFD compared to NFD which is an indication of an oxidative stress–induced adaptive response previously reported in rainbow trout ( Oncorhynchus mykiss ), Golden Pompano ( Trachinotus ovatus ) and tilapia ( Oreochromis niloticus ) (Chen et al., 2022; Jia et al., 2020; Vranković et al., 2021). This transcriptional upregulation is indicative of an oxidative stress–induced adaptive response, since excess dietary lipids promote mitochondrial β-oxidation, peroxisomal lipid catabolism, and NADPH oxidase activity, collectively leading to elevated reactive oxygen species (ROS) production (Chen et al., 2022; Jia et al., 2020). Liver, being the primary site of lipid metabolism, responds to this increased oxidative load by enhancing the transcription of antioxidant related genes. Interestingly, while hepatic antioxidant gene transcription was elevated in response to HFD, the muscle exhibited the opposite trend showing lowest enzymatic activity of SOD and CAT, highlighting tissue-specific responses to oxidative stress. Similar suppression of antioxidant enzyme activity in response to HFD has been reported in zebrafish (Jafari et al., 2025) and largemouth bass Micropterus salmoides (Zhou et al., 2020). This mismatch between hepatic transcript levels and muscle enzyme activity may be due to tissue-specific regulation of oxidative stress, post-translational modifications, or oxidative inactivation of enzymes (Kim et al., 2018; Selvam et al., 2022). Increased dietary fat increases ROS production which in turn can lead to oxidative modification and inactivation of antioxidant proteins, depletion of cofactors, any of which would reduce measurable activity despite elevated transcription (Kwon et al., 2000; Miyamoto et al., 2003). Lipid peroxidation–derived aldehydes such as 4-hydroxynonenal (4-HNE) and malondialdehyde (MDA) are known to covalently modify key amino acid residues in antioxidant enzymes, leading to conformational changes and catalytic impairment (Kim et al., 2018). Consistent with this mechanism, higher levels of lipid peroxidation products were observed in the muscle of HFD-fed fish, indicating enhanced oxidative damage in this tissue. Naringenin supplementation effectively stabilized the antioxidant defence system. Hepatic sod and gpx mRNA expression in the HFD + naringenin group remained close to NFD levels, indicating reduced oxidative stress. Furthermore, naringenin preserved SOD and CAT activity in muscle, suggesting protection against oxidative inactivation. This protective effect can be attributed to both its radical scavenging properties and its ability to modulate Nrf2-mediated transcriptional pathways (Mehranfard et al., 2023; Rashmi et al., 2018). The elevated total antioxidant capacity (TAC) in naringenin-supplemented fish further supports its role in sustaining antioxidant equilibrium. Moreover, naringenin supplementation attenuated muscle lipid peroxidation relative to the HFD group, although values remained marginally higher than those in NFD-fed fish. This suggests that naringenin primarily acts to preserve and stabilize antioxidant defences under oxidative challenge, rather than completely reversing pre-existing lipid peroxidation. A further study with time series sampling to provide both transcriptional and post-translational aspects of antioxidant defence, as tissue-specific oxidative stress can lead to discrepancies between gene expression and enzyme activity. Transaminase activities, ALT and AST are commonly used as indicators of hepatic health and metabolic status, with elevated levels generally reflecting hepatocellular damage (Bojarski et al., 2025). Interestingly, ALT activity was significantly lower in HFD-fed group compared to NFD-fed group, while AST showed a similar but non-significant trend. Restoration of both enzymes to near-control levels in NGE-supplemented groups suggests improved metabolic balance. This decrease in ALT and AST levels in response to lipid-rich diets has been reported in rohu, Labeo rohita , butter catfish, Ompok bimaculatus and Rainbow Trout Oncorhynchus mykis (Chen et al., 2023; Paul et al., 2021; Siddiqua & Khan, 2022) and it’s generally interpreted as a reduction in protein catabolism owing to increased reliance on dietary lipids as energy substrates. The ability of naringenin to normalise transaminase activity likely reflects its protective effects against oxidative inactivation and its role in maintaining metabolic homeostasis. At the transcriptional level, HFD feeding significantly elevated ppar-δ expression while suppressing fads2 , with naringenin supplementation exerting opposite. The elevated ppar-δ expression under HFD likely reflects a compensatory response to lipid overload, promoting fatty acid oxidation to mitigate lipotoxicity. Similar trends have been reported in fish and mammalian models, where excess dietary lipid load induces PPAR signalling to regulate lipid transport and oxidation (Inoue et al., 2005; Zhou et al., 2024). Naringenin supplementation reduces the ppar-δ expression in a dose-dependent manner, consistent with the alleviation of hepatic lipid accumulation and oxidative stress, thereby lowering the requirement for compensatory activation (Gao et al., 2024). Furthermore, the elevated expression of ppar-δ in HFD-fed fish may not only represent a compensatory mechanism for lipid overload but also reflect its role as a signalling mediator in inflammation (Wang et al., 2019). As HFD feeding induces oxidative and inflammatory stress (Jia et al., 2020; Shen et al., 2023), both may contribute to elevated ppar-δ expression. The attenuation of HFD-induced changes in gene expression by naringenin reflects its broader antioxidant and anti-inflammatory actions. Interestingly, the expression of c8 , a terminal complement component, did not differ significantly among dietary treatments. This is likely because activation of the complement system under metabolic stress primarily involves early pathway components such as c3 and c4 , which mediate recognition of altered-self signals, lipid accumulation, and inflammation (Xin et al., 2018; Jin et al., 2018). In contrast, c8 participates in the late stage of complement activation, forming part of the membrane attack complex (MAC), which is typically triggered during pathogen invasion rather than sterile metabolic stress (Sikorski et al., 2021). Thus, the lack of a significant response in c8 expression suggests that while HFD induced oxidative and lipid metabolic stress, it may not have been sufficient to trigger terminal complement activation in the absence of infection Histological analysis further supported biochemical and molecular findings. HFD-fed fish exhibited severe hepatic steatosis, characterized by the presence of large vacuoles indicative of lipid overload. Naringenin supplementation reduced lipid vacuolization in a dose-dependent manner, with livers of the higher-supplemented group displaying near-normal architecture. In agreement with our results, few studies in mammalian systems where naringenin ameliorates steatosis through regulation of lipid metabolism and oxidative stress (Hua et al., 2021; Mulvihill et al., 2010; Wang et al., 2020) in contrast, the suppression of fads2 expression under HFD may reflect feedback inhibition of endogenous fatty acid biosynthesis. The transformation of essential fatty acids into long-chain polyunsaturated fatty acids (LC-PUFAs) depends on fads2 enzymes (Δ5 and Δ6 desaturases), and when dietary lipid intake is high, particularly with high LC-PUFAs in the diet, transcriptional regulation typically downregulates fads2 to limit redundant de novo synthesis (Ampong et al., 2022; Jump, 2002; Nakamura & Nara, 2004). The partial restoration of fads2 expression in naringenin supplemented groups suggests that it may mitigate this feedback suppression, thereby supporting endogenous LC-PUFA biosynthesis and maintaining lipid homeostasis. In addition to the in vivo antioxidant responses, the in vitro assays further confirmed the radical-scavenging potential of naringenin. Both DPPH and ABTS assays showed a dose-dependent increase in scavenging activity, although ascorbic acid exhibited higher efficacy across the tested concentrations. These results demonstrate that naringenin possesses intrinsic hydrogen- or electron-donating capacity to neutralize free radicals, consistent with previous reports highlighting its redox-active flavonoid structure (Cavia-Saiz et al., 2010; Kumar & Pandey, 2013). The observed in vitro antioxidant capacity is consistent with the in vivo biochemical responses, where naringenin supplementation enhanced TAC and upregulated enzymatic antioxidants such as SOD and CAT. This coherence suggests that naringenin maintains oxidative balance through both direct radical-scavenging and indirect modulation of antioxidant defences. Similar protective mechanisms have been reported in mammalian models, where naringenin reduced ROS generation and lipid peroxidation via combined chemical and enzymatic pathways (Salehi et al., 2019; Wang et al., 2020). Collectively, these results suggests that naringenin effectively counters HFD-induced oxidative stress and lipid accumulation in O. dancena through coordinated regulation of antioxidant defences, metabolic enzyme activity, gene expression, and hepatic architecture. Importantly, this study demonstrates the utility of O. dancena as a marine model fish for mechanistic nutriphysiological studies. Much like zebrafish in freshwater systems, O. dancena provides a tractable model where, mechanistic endpoints, rather than growth performance, can be investigated in detail. This positions O. dancena as a valuable tool for exploring dietary strategies and functional bio-actives in marine contexts. Declarations Ethics Statement This study involving animals was approved by ICAR-CMFRI, Kochi, India, under the project Nutrition and Nutri-genomics Research in Mariculture and Marine Fisheries (MBT/NGM/24). All procedures were carried out in compliance with institutional guidelines and local legislation. Author contribution TST: Writing-original draft, Investigation, Formal analysis. CS: Writing-original draft, Conceptualization, Data curation, Supervision, Project Administration, Funding Acquisition. MA: Writing- review & editing, formal analysis. SH: Writing- review & editing, formal analysis. LP: Writing- review & editing, Project Administration. SE: Writing- review & editing. AHG: Writing- review & editing, Validation. NAS: Writing- review & editing, Formal Analysis. APG: Writing- review & editing. CP: Writing- review & editing. KC: Writing- review & editing, Resources. Acknowledgments This research was supported by the Indian Council of Agricultural Research (ICAR), Department of Agricultural Research and Education, Government of India. The authors express their sincere gratitude to the Director, ICAR–Central Marine Fisheries Research Institute (CMFRI), Kochi, for providing the necessary facilities to carry out this work. The study was conducted under the institute project (MBT/NGM/24) funded by ICAR-Central Marine Fisheries Research Institute, which is gratefully acknowledged. The first author also acknowledges the Kerala University of Fisheries and Ocean Studies (KUFOS) for the award of master’s degree fellowship. Funding The author(s) declare that financial support was received for the research, authorship and/or publication of this article. The work was performed under the project “ Nutrition and Nutri-genomics Research in Mariculture and Marine Fisheries (MBT/NGM/24)” funded by ICAR-Central Marine Fisheries Research Institute. Conflict of Interest The authors declare that this research was conducted without any commercial or financial relationships that could be construed as potential conflicts of interest. References Abasubong, K. P., Jiang, G.-Z., Guo, H., Wang, X., Li, X.-F., Yan-zou, D., Liu, W., & Desouky, H. Eed. (2023). High-fat diet alters intestinal microbiota and induces endoplasmic reticulum stress via the activation of apoptosis and inflammation in blunt snout bream. Fish Physiology and Biochemistry , 49 (6), 1079–1095. https://doi.org/10.1007/s10695-023-01240-2 Aebi, H. (1984). Catalase in vitro. Methods in Enzymology , 105 , 121–126. https://doi.org/10.1016/s0076-6879(84)05016-3 Afzali-Kordmahalleh, A., & Meshkini, S. (2023). Effects of dietary resveratrol supplementation on digestive enzymes activities and serum biochemistry of rainbow trout ( Oncorhynchus mykiss ). Veterinary Research Forum , 14 (11), 625–630. https://doi.org/10.30466/vrf.2023.560224.3650 Ampong, I., John Ikwuobe, O., Brown, J. E. P., Bailey, C. J., Gao, D., Gutierrez-Merino, J., & Griffiths, H. R. (2022). Odd chain fatty acid metabolism in mice after a high fat diet. The International Journal of Biochemistry & Cell Biology , 143 , 106135. https://doi.org/10.1016/j.biocel.2021.106135 Assini, J. M., Mulvihill, E. E., Burke, A. C., Sutherland, B. G., Telford, D. E., Chhoker, S. S., Sawyez, C. G., Drangova, M., Adams, A. C., Kharitonenkov, A., Pin, C. L., & Huff, M. W. (n.d.). Naringenin Prevents Obesity, Hepatic Steatosis, and Glucose Intolerance in Male Mice Independent of Fibroblast Growth Factor 21 . Retrieved October 16, 2015, from https://dx.doi.org/10.1210/en.2014-2003 Bojarski, B., Witeska, M., & Kondera, E. (2025). Blood Biochemical Biomarkers in Fish Toxicology—A Review. Animals , 15 (7), 965. https://doi.org/10.3390/ani15070965 Brand-Williams, W., Cuvelier, M. E., & Berset, C. (1995). Use of a free radical method to evaluate antioxidant activity. LWT - Food Science and Technology , 28 (1), 25–30. https://doi.org/10.1016/S0023-6438(95)80008-5 Cai, J., Wen, H., Zhou, H., Zhang, D., Lan, D., Liu, S., Li, C., Dai, X., Song, T., Wang, X., He, Y., He, Z., Tan, J., & Zhang, J. (2023). Naringenin: A flavanone with anti-inflammatory and anti-infective properties. Biomedicine & Pharmacotherapy , 164 , 114990. https://doi.org/10.1016/j.biopha.2023.114990 Cai, Z., Feng, S., Xiang, X., Mai, K., & Ai, Q. (2016). Effects of dietary phospholipid on lipase activity, antioxidant capacity and lipid metabolism-related gene expression in large yellow croaker larvae ( Larimichthys crocea ). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology , 201 , 46–52. https://doi.org/10.1016/j.cbpb.2016.06.007 Cavia-Saiz, M., Busto, M. D., Pilar-Izquierdo, M. C., Ortega, N., Perez-Mateos, M., & Muñiz, P. (2010). Antioxidant properties, radical scavenging activity and biomolecule protection capacity of flavonoid naringenin and its glycoside naringin: A comparative study. Journal of the Science of Food and Agriculture , 90 (7), 1238–1244. https://doi.org/10.1002/jsfa.3959 Chen, X., Niu, J., Wang, J., & Zhao, W. (2022). Effects of L-carnitine Supplementation in High-Fat Diet on Growth, Antioxidant Capacity and Lipid Metabolism of Golden Pompano (Trachinotus ovatus). Frontiers in Marine Science , 9 . https://doi.org/10.3389/fmars.2022.831153 Chen, Y.-F., Cao, K.-L., Huang, H.-F., Li, X.-Q., & Leng, X.-J. (2023). Dietary Effects of Lipid and Protein Levels on Growth, Feed Utilization, Lipid Metabolism, and Antioxidant Capacity of Triploid Rainbow Trout ( Oncorhynchus mykiss ). Aquaculture Nutrition , 2023 , 8325440. https://doi.org/10.1155/2023/8325440 Dong, Y.-Z., Xia, T., Lin, J.-B., Wang, L., Song, K., & Zhang, C.-X. (2021). Quercetin Attenuates High-Fat Diet-Induced Excessive Fat Deposition of Spotted Seabass ( Lateolabrax maculatus ) Through the Regulatory for Mitochondria and Endoplasmic Reticulum. Frontiers in Marine Science , 8 . https://doi.org/10.3389/fmars.2021.746811 Drapeau, G. R. (1976). Protease from Staphyloccus aureus . Methods in Enzymology , 45 , 469–475. https://doi.org/10.1016/s0076-6879(76)45041-3 Eissa, E.-S. H., Khattab, M. S., Elbahnaswy, S., Elshopakey, G. E., Alamoudi, M. O., Aljàrari, R. M., Munir, M. B., Kari, Z. A., & Naiel, M. A. E. (2024). The effects of dietary Spirulina platensis or curcumin nanoparticles on performance, body chemical composition, blood biochemical, digestive enzyme, antioxidant and immune activities of Oreochromis niloticus fingerlings. BMC Veterinary Research , 20 (1), 215. https://doi.org/10.1186/s12917-024-04058-z Elshopakey, G. E., Mahboub, H. H., Sheraiba, N. I., Abduljabbar, M. H., Mahmoud, Y. K., Abomughaid, M. M., & Ismail, A. K. (2023). Ammonia toxicity in Nile tilapia: Potential role of dietary baicalin on biochemical profile, antioxidant status and inflammatory gene expression. Aquaculture Reports , 28 , 101434. https://doi.org/10.1016/j.aqrep.2022.101434 Fei, S., Xia, Y., Chen, Z., Liu, C., Liu, H., Han, D., ... & Xie, S. (2022). A high-fat diet alters lipid accumulation and oxidative stress and reduces the disease resistance of overwintering hybrid yellow catfish ( Pelteobagrus fulvidraco ♀× P. vachelli ♂). Aquaculture Reports , 23 , 101043. Gao, J., Yuan, L., Jiang, H., Li, G., Zhang, Y., Zhou, R., Xian, W., Zou, Y., Du, Q., & Zhou, X. (2024). Naringenin modulates oxidative stress and lipid metabolism: Insights from network pharmacology, mendelian randomization, and molecular docking. Frontiers in Pharmacology , 15 , 1448308. https://doi.org/10.3389/fphar.2024.1448308 Ge, Y., Zhang, L., Chen, W., Sun, M., Liu, W., & Li, X. (2023). Resveratrol Modulates the Redox Response and Bile Acid Metabolism to Maintain the Cholesterol Homeostasis in Fish Megalobrama amblycephala Offered a High-Carbohydrate Diet. Antioxidants , 12 (1), Article 1. https://doi.org/10.3390/antiox12010121 Glencross, B. D. (2009). Exploring the nutritional demand for essential fatty acids by aquaculture species. Reviews in aquaculture , 1 (2), 71–124. Goldwasser, J., Cohen, P. Y., Yang, E., Balaguer, P., Yarmush, M. L., & Nahmias, Y. (2010). Transcriptional Regulation of Human and Rat Hepatic Lipid Metabolism by the Grapefruit Flavonoid Naringenin: Role of PPARα, PPARγ and LXRα. PLOS ONE , 5 (8), e12399. https://doi.org/10.1371/journal.pone.0012399 Gora, A. H., Rehman, S., Dias, J., Fernandes, J. M., Olsvik, P. A., Sørensen, M., & Kiron, V. (2023). Protective mechanisms of a microbial oil against hypercholesterolemia: evidence from a zebrafish model. Frontiers in Nutrition , 10 , 1161119. Hua, Y. Q., Zeng, Y., Xu, J., & Xu, X. L. (2021). Naringenin alleviates nonalcoholic steatohepatitis in middle-aged Apoe-/-mice: Role of SIRT1. Phytomedicine: International Journal of Phytotherapy and Phytopharmacology , 81 , 153412. https://doi.org/10.1016/j.phymed.2020.153412 Inoue, M., Ohtake, T., Motomura, W., Takahashi, N., Hosoki, Y., Miyoshi, S., Suzuki, Y., Saito, H., Kohgo, Y., & Okumura, T. (2005). Increased expression of PPARgamma in high fat diet-induced liver steatosis in mice. Biochemical and Biophysical Research Communications , 336 (1), 215–222. https://doi.org/10.1016/j.bbrc.2005.08.070 Jafari, S., Akhavan-Bahabadi, M., Shekarabi, S. P. H., Mehrgan, M. S., Lowen, E., Lotfi, K., & Azari, A. (2025). Astaxanthin-rich Nannochloropsis oculata mitigates high-fat diet-induced liver dysfunction in zebrafish by modulating lipid metabolism and oxidative stress. Scientific Reports , 15 (1), 28862. https://doi.org/10.1038/s41598-025-13642-8 Jagannivasan, A., Gopakumar, S. T., Sharma S R, K., Suresh, G., Raveendranathan, D. N., Peter, R., Gop, A. P., & Achamveetil, G. (2024). Profiling the antioxidant biomarkers in marine fish larvae: A comparative assessment of different storage conditions to select the optimal strategy. Fish Physiology and Biochemistry , 50 (2), 557–574. https://doi.org/10.1007/s10695-023-01290-6 Jasim, S. A., Al-Mosawi, R. H., Khalikov, K., Abdelbasset, W. K., Ahmad, I., Shoukat, S., Jawad, M. A., Hafsan, H., Mustafa, Y. F., & Norbakhsh, M. (2022). Dietary quercetin improved growth, body composition, haematology, immunity and resistance to Aeromonas hydrophila infection in common carp (Cyprinus carpio). Aquaculture Research , 53 (18), 6910–6920. https://doi.org/10.1111/are.16156 Jeon, S.-M., Kim, H. K., Kim, H.-J., Do, G.-M., Jeong, T.-S., Park, Y. B., & Choi, M.-S. (2007). Hypocholesterolemic and antioxidative effects of naringenin and its two metabolites in high-cholesterol fed rats. Translational Research , 149 (1), 15–21. https://doi.org/10.1016/j.trsl.2006.08.001 Jia, R., Cao, L.-P., Du, J.-L., He, Q., Gu, Z.-Y., Jeney, G., Xu, P., & Yin, G.-J. (2020). Effects of high-fat diet on antioxidative status, apoptosis and inflammation in liver of tilapia ( Oreochromis niloticus ) via Nrf2, TLRs and JNK pathways. Fish & Shellfish Immunology , 104 , 391–401. https://doi.org/10.1016/j.fsi.2020.06.025 Jin, H., Yan, C., Xiao, T., Yan, N., Xu, J., Zhou, L., Zhou, X., Shao, Q., & Xia, S. (2018). High fish oil diet promotes liver inflammation and activates the complement system. Molecular Medicine Reports , 17 (5), 6852–6858. https://doi.org/10.3892/mmr.2018.8687 Jin, M., Pan, T., Tocher, D. R., Betancor, M. B., Monroig, Ó., Shen, Y., Zhu, T., Sun, P., Jiao, L., & Zhou, Q. (2019). Dietary choline supplementation attenuated high-fat diet-induced inflammation through regulation of lipid metabolism and suppression of NFκB activation in juvenile black seabream ( Acanthopagrus schlegelii ). Journal of Nutritional Science , 8 , e38. https://doi.org/10.1017/jns.2019.34 Jump, D. B. (2002). The Biochemistry of n-3 Polyunsaturated Fatty Acids. Journal of Biological Chemistry , 277 (11), 8755–8758. https://doi.org/10.1074/jbc.R100062200 Kim, J. M., Kim, H. G., & Son, C. G. (2018). Tissue-Specific Profiling of Oxidative Stress-Associated Transcriptome in a Healthy Mouse Model. International Journal of Molecular Sciences , 19 (10), 3174. https://doi.org/10.3390/ijms19103174 Kumar, S., & Pandey, A. K. (2013). Chemistry and Biological Activities of Flavonoids: An Overview. The Scientific World Journal , 2013 (1), 162750. https://doi.org/10.1155/2013/162750 Kwon, H. Y., Choi, S. Y., Won, M. H., Kang, T., & Kang, J. H. (2000). Oxidative modification and inactivation of Cu, Zn-superoxide dismutase by 2,2’-azobis(2-amidinopropane) dihydrochloride. Biochimica Et Biophysica Acta , 1543 (1), 69–76. https://doi.org/10.1016/s0167-4838(00)00197-7 Liu, F., Qu, Y.-K., Geng, C., Wang, A.-M., Zhang, J.-H., Chen, K.-J., Liu, B., Tian, H.-Y., Yang, W.-P., & Yu, Y.-B. (2020). Effects of hesperidin on the growth performance, antioxidant capacity, immune responses and disease resistance of red swamp crayfish ( Procambarus clarkii ). Fish & Shellfish Immunology , 99 , 154–166. https://doi.org/10.1016/j.fsi.2020.02.014 Lowry, OliverH., Rosebrough, NiraJ., Farr, A. L., & Randall, RoseJ. (1951). Protein measurement with the folin phenol reagent. Journal of Biological Chemistry , 193 (1), 265–275. https://doi.org/10.1016/S0021-9258(19)52451-6 Lu, S., Wang, C., Liu, Y., Liu, B., Zhang, Y., Shi, H., Xu, G., Han, S., & Liu, H. (2024). Effects of Dietary Fish Oil Levels on Growth Performance, Lipid Metabolism, Hepatic Health, Nonspecific Immune Response, and Intestinal Microbial Community of Juvenile Amur Grayling ( Thymallus grubii ). Aquaculture Nutrition , 2024 (1), 8587410. https://doi.org/10.1155/anu/8587410 Macusi, E. D., Cayacay, M. A., Borazon, E. Q., Sales, A. C., Habib, A., Fadli, N., & Santos, M. D. (2023). Protein Fishmeal Replacement in Aquaculture: A Systematic Review and Implications on Growth and Adoption Viability. Sustainability , 15 (16), Article 16. https://doi.org/10.3390/su151612500 Mariselvammurugan, A. (2025). Effects of salinity variation on hepatic lipid morphology, muscle fatty acid profile, and expression of metabolic and osmoregulatory genes in Indian ricefish, Oryzias dancena (Master’s thesis). Kerala University of Fisheries and Ocean Studies (KUFOS), Kerala, India. Mehranfard, N., Ghasemi, M., Rajabian, A., & Ansari, L. (2023). Protective potential of naringenin and its nanoformulations in redox mechanisms of injury and disease. Heliyon , 9 (12), e22820. https://doi.org/10.1016/j.heliyon.2023.e22820 Misra, H. P., & Fridovich, I. (1977). Superoxide dismutase: A photochemical augmentation assay. Archives of Biochemistry and Biophysics , 181 (1), 308–312. https://doi.org/10.1016/0003-9861(77)90509-4 Miyamoto, Y., Koh, Y. H., Park, Y. S., Fujiwara, N., Sakiyama, H., Misonou, Y., Ookawara, T., Suzuki, K., Honke, K., & Taniguchi, N. (2003). Oxidative stress caused by inactivation of glutathione peroxidase and adaptive responses. Biological Chemistry , 384 (4), 567–574. https://doi.org/10.1515/BC.2003.064 Mulvihill, E. E., Assini, J. M., Sutherland, B. G., DiMattia, A. S., Khami, M., Koppes, J. B., Sawyez, C. G., Whitman, S. C., & Huff, M. W. (2010). Naringenin decreases progression of atherosclerosis by improving dyslipidemia in high-fat-fed low-density lipoprotein receptor-null mice. Arteriosclerosis, Thrombosis, and Vascular Biology , 30 (4), 742–748. https://doi.org/10.1161/ATVBAHA.109.201095 Naiel, M. A. E., Negm, S. S., Ghazanfar, S., Shukry, M., & Abdelnour, S. A. (2023). The risk assessment of high-fat diet in farmed fish and its mitigation approaches: A review. Journal of Animal Physiology and Animal Nutrition , 107 (3), 948–969. https://doi.org/10.1111/jpn.13759 Nakamura, M. T., & Nara, T. Y. (2004). Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases. Annual Review of Nutrition , 24 , 345–376. https://doi.org/10.1146/annurev.nutr.24.121803.063211 National Research Council, Division on Earth, Life Studies, Committee on the Nutrient Requirements of Fish, & Shrimp. (2011). Nutrient requirements of fish and shrimp . National academies press. Nayak, S., Yogev, U., Kpordzaxor, Y., Zhu, Z., Gur, N., Gross, A., & Zilberg, D. (2023). From fish excretions to high-protein dietary ingredient: Feeding intensively cultured barramundi ( Lates calcarifer ) a diet containing microbial biomass (biofloc) from effluent of an aquaculture system. Aquaculture , 562 , 738780. https://doi.org/10.1016/j.aquaculture.2022.738780 Nguyen, P., Leray, V., Diez, M., Serisier, S., Le Bloc’h, J., Siliart, B., & Dumon, H. (2008). Liver lipid metabolism. Journal of Animal Physiology and Animal Nutrition , 92 (3), 272–283. https://doi.org/10.1111/j.1439-0396.2007.00752.x Nogueda Torres, E., & Lazo, J. P. (2024). The effect of protein to lipid ratios on growth, digestibility, and feed utilization of striped bass ( Morone saxatilis ) raised in seawater at 21°C. Aquaculture International , 32 (7), 9853–9872. https://doi.org/10.1007/s10499-024-01639-5 Ohkawa, H., Ohishi, N., & Yagi, K. (1979). Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Analytical Biochemistry , 95 (2), 351–358. https://doi.org/10.1016/0003-2697(79)90738-3 Panche, A. N., Diwan, A. D., & Chandra, S. R. (2016). Flavonoids: An overview. Journal of Nutritional Science , 5 , e47. https://doi.org/10.1017/jns.2016.41 Paul, B. N., Chowdhury, D., Das, A., Mandal, R. N., Singh, P., Adhikari, S., Chakrabarti, P. P., Giri, S. S., & Ghosh, K. (2021). Effect of dietary lipid levels on growth, body composition, and enzyme activities of larvae of butter catfish, Ompok bimaculatus (Actinopterygii: Siluriformes: Siluridae). Acta Ichthyologica et Piscatoria , 51 , 289–298. https://doi.org/10.3897/aiep.51.67079 Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT–PCR. Nucleic acids research, 29(9), e45-e45. Prieto, P., Pineda, M., & Aguilar, M. (1999). Spectrophotometric quantitation of antioxidant capacity through the formation of a phosphomolybdenum complex: Specific application to the determination of vitamin E. Analytical Biochemistry , 269 (2), 337–341. https://doi.org/10.1006/abio.1999.4019 Qiao, L., Men, L., Yu, S., Yao, J., Li, Y., Wang, M., Yu, Y., Wang, N., Ran, L., Wu, Y., & Du, J. (2022). Hepatic deficiency of selenoprotein S exacerbates hepatic steatosis and insulin resistance. Cell Death & Disease , 13 (3), 275. https://doi.org/10.1038/s41419-022-04716-w Ranjan, R., Anil, M. K., Ambarish, G. P., Megarajan, S., Xavier, B., Ghosh, S., Gomathi, P., Raju, B., Anand, V., & Gopalakrishnan, A. (2022). Protocol developed for the hatchery production of marine model fish Oryzias dancena (Hamilton, 1822). Marine Fisheries Information Service; Technical and Extension Series , 254 , 32–35. Rashmi, R., Bojan Magesh, S., Mohanram Ramkumar, K., Suryanarayanan, S., & Venkata SubbaRao, M. (2018). Antioxidant Potential of Naringenin Helps to Protect Liver Tissue from Streptozotocin-Induced Damage. Reports of Biochemistry & Molecular Biology , 7 (1), 76–84. Re, R., Pellegrini, N., Proteggente, A., Pannala, A., Yang, M., & Rice-Evans, C. (1999). Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free Radical Biology & Medicine , 26 (9–10), 1231–1237. https://doi.org/10.1016/s0891-5849(98)00315-3 Rick, W., & Stegbauer, H. P. (1974). α-Amylase Measurement of Reducing Groups. In H. U. Bergmeyer (Ed.), Methods of Enzymatic Analysis (Second Edition) (pp. 885–890). Academic Press. https://doi.org/10.1016/B978-0-12-091302-2.50074-8 Roy, A., Khan, A., Ahmad, I., Alghamdi, S., Rajab, B. S., Babalghith, A. O., Alshahrani, M. Y., Islam, S., & Islam, M. R. (2022). Flavonoids a Bioactive Compound from Medicinal Plants and Its Therapeutic Applications. BioMed Research International , 2022 , 5445291. https://doi.org/10.1155/2022/5445291 Salehi, B., Fokou, P. V. T., Sharifi-Rad, M., Zucca, P., Pezzani, R., Martins, N., & Sharifi-Rad, J. (2019). The Therapeutic Potential of Naringenin: A Review of Clinical Trials. Pharmaceuticals (Basel, Switzerland) , 12 (1), 11. https://doi.org/10.3390/ph12010011 Selvam, C., Saito, T., Sissener, N. H., Philip, A. J. P., & Sæle, Ø. (2022). Intracellular trafficking of fatty acids in the fish intestinal epithelial cell line RTgutGC. Frontiers in Marine Science , 9 . https://doi.org/10.3389/fmars.2022.954773 Shen, Y., Zhao, W., Monroig, Ó., Bao, Y., Zhu, T., Jiao, L., ... & Jin, M. (2023). High-fat-diet induced inflammation and apoptosis via activation of Ire1α in liver and hepatocytes of black seabream ( Acanthopagrus schlegelii ). Fish & Shellfish Immunology , 143 , 109212. Siddiqua, K. S., & Khan, M. A. (2022). Effects of dietary lipid levels on growth, feed utilization, RNA/DNA ratio, digestive tract enzyme activity, non-specific immune response and optimum inclusion in feeds for fingerlings of rohu, Labeo rohita (Hamilton). Aquaculture , 554 , 738114. https://doi.org/10.1016/j.aquaculture.2022.738114 Siddiqui, N., Rauf, A., Latif, A., & Mahmood, Z. (2017). Spectrophotometric determination of the total phenolic content, spectral and fluorescence study of the herbal Unani drug Gul-e-Zoofa ( Nepeta bracteata Benth). Journal of Taibah University Medical Sciences , 12 (4), 360–363. https://doi.org/10.1016/j.jtumed.2016.11.006 Sikorski, P. M., Commodaro, A. G., & Grigg, M. E. (2021). A Protective and Pathogenic Role for Complement During Acute Toxoplasma gondii Infection. Frontiers in Cellular and Infection Microbiology , 11 . https://doi.org/10.3389/fcimb.2021.634610 Singleton, V. L., Orthofer, R., & Lamuela-Raventós, R. M. (1999). [14] Analysis of total phenols and other oxidation substrates and antioxidants by means of folin-ciocalteu reagent. In Methods in Enzymology (Vol. 299, pp. 152–178). Academic Press. https://doi.org/10.1016/S0076-6879(99)99017-1 Tocher, D. R. (2010). Fatty acid requirements in ontogeny of marine and freshwater fish. Aquaculture research , 41 (5), 717–732. Trenzado, C. E., Carmona, R., Merino, R., García-Gallego, M., Furné, M., Domezain, A., & Sanz, A. (2018). Effect of dietary lipid content and stocking density on digestive enzymes profile and intestinal histology of rainbow trout ( Oncorhynchus mykiss ). Aquaculture , 497 , 10–16. https://doi.org/10.1016/j.aquaculture.2018.07.031 Turchini, G. M., Torstensen, B. E., & Ng, W. K. (2009). Fish oil replacement in finfish nutrition. Reviews in aquaculture , 1 (1), 10–57. Vranković, J. S., Stanković, M. B., & Marković, Z. Z. (2021). Levels of antioxidant enzyme activities in cultured rainbow trout ( Oncorhynchus mykiss ) fed with different diet compositions. Bulletin of the European Association of Fish Pathologists , 41 (4), 135–145. https://doi.org/10.48045/001c.31752 Wang, L.-H., Zeng, X.-A., Wang, M.-S., Brennan, C. S., & Gong, D. (2018). Modification of membrane properties and fatty acids biosynthesis-related genes in Escherichia coli and Staphylococcus aureus : Implications for the antibacterial mechanism of naringenin. Biochimica et Biophysica Acta (BBA) - Biomembranes , 1860 (2), 481–490. https://doi.org/10.1016/j.bbamem.2017.11.007 Wang, Q., Ou, Y., Hu, G., Wen, C., Yue, S., Chen, C., Xu, L., Xie, J., Dai, H., Xiao, H., Zhang, Y., & Qi, R. (2020). Naringenin attenuates non-alcoholic fatty liver disease by down-regulating the NLRP3/NF-κB pathway in mice. British Journal of Pharmacology , 177 (8), 1806–1821. https://doi.org/10.1111/bph.14938 Wang, Y., Yu, Y., Wang, Q., Wei, S., Wang, S., Qin, Q., & Yang, M. (2019). PPAR-δ of orange-spotted grouper exerts antiviral activity against fish virus and regulates interferon signaling and inflammatory factors. Fish & Shellfish Immunology , 94 , 38–49. https://doi.org/10.1016/j.fsi.2019.08.068 Winkler, U. K., & Stuckmann, M. (1979). Glycogen, hyaluronate, and some other polysaccharides greatly enhance the formation of exolipase by Serratia marcescens . Journal of Bacteriology , 138 (3), 663–670. https://doi.org/10.1128/jb.138.3.663-670.1979 Wu, D., Li, J., Fan, Z., Wang, L., & Zheng, X. (2022). Resveratrol ameliorates oxidative stress, inflammatory response and lipid metabolism in common carp ( Cyprinus carpio ) fed with high-fat diet. Frontiers in Immunology , 13 . https://doi.org/10.3389/fimmu.2022.965954 Wu, D., Li, J., Fan, Z., Wang, L., & Zheng, X. (2022). Resveratrol ameliorates oxidative stress, inflammatory response and lipid metabolism in common carp ( Cyprinus carpio ) fed with high-fat diet. Frontiers in Immunology , 13 , 965954. Xin, Y., Hertle, E., van der Kallen, C. J. H., Schalkwijk, C. G., Stehouwer, C. D. A., & van Greevenbroek, M. M. J. (2018). Complement C3 and C4, but not their regulators or activated products, are associated with incident metabolic syndrome: The CODAM study. Endocrine , 62 (3), 617–627. https://doi.org/10.1007/s12020-018-1712-3 Yuan, Y., Omar, A. A., Emam, W., & Mohamed, R. A. (2025). Impact of dietary inclusion of bile acid and fat percent on growth, intestinal histomorphology, immune-physiological and transcriptomic responses of Nile tilapia ( Oreochromis niloticus ). Open Veterinary Journal , 15 (1), 222–243. https://doi.org/10.5455/OVJ.2025.v15.i1.21 Zhang, D., Yan, Y., Tian, H., Jiang, G., Li, X., & Liu, W. (2018). Resveratrol supplementation improves lipid and glucose metabolism in high-fat diet-fed blunt snout bream. Fish Physiology and Biochemistry , 44 (1), 163–173. https://doi.org/10.1007/s10695-017-0421-9 Zhang, Z.-Y., Limbu, S. M., Zhao, S.-H., Chen, L.-Q., Luo, Y., Zhang, M.-L., Qiao, F., & Du, Z.-Y. (2022). Dietary l-carnitine supplementation recovers the increased pH and hardness in fillets caused by high-fat diet in Nile tilapia ( Oreochromis niloticus ). Food Chemistry , 382 , 132367. https://doi.org/10.1016/j.foodchem.2022.132367 Zhao, X., Chen, W., Zhang, Y., Gao, X., Huang, Y., Ren, H., Chang, K., Sun, P., & Gao, S. (2024). Dietary guar gum supplementation reduces the adverse effects of high-fat diets on the growth performance, antioxidant capacity, inflammation, and apoptosis of juvenile largemouth bass ( Micropterus salmoides ). Animal Feed Science and Technology , 308 , 115881. https://doi.org/10.1016/j.anifeedsci.2024.115881 Zhou, J., Feng, P., Li, Y., Ji, H., & Gisbert, E. (2024). Effects of dietary lipid levels on lipid accumulation and health status of adult Onychostoma macrolepis . Aquaculture and Fisheries , 9 (5), 795–803. https://doi.org/10.1016/j.aaf.2023.07.008 Zhou, Y.-L., Guo, J.-L., Tang, R.-J., Ma, H.-J., Chen, Y.-J., & Lin, S.-M. (2020). High dietary lipid level alters the growth, hepatic metabolism enzyme, and anti-oxidative capacity in juvenile largemouth bass Micropterus salmoides . Fish Physiology and Biochemistry , 46 (1), 125–134. https://doi.org/10.1007/s10695-019-00705-7 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 08 May, 2026 Reviews received at journal 02 Apr, 2026 Reviewers agreed at journal 31 Jan, 2026 Reviewers invited by journal 29 Jan, 2026 Editor assigned by journal 27 Jan, 2026 Submission checks completed at journal 31 Dec, 2025 First submitted to journal 30 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8479933","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":583652830,"identity":"45576b14-d1b0-4b3f-82cc-4fb20b74b292","order_by":0,"name":"Tejas Santosh Tari","email":"","orcid":"","institution":"ICAR-Central Marine Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Tejas","middleName":"Santosh","lastName":"Tari","suffix":""},{"id":583652831,"identity":"4484cdad-b1dc-4435-aa63-7fbd140f48ea","order_by":1,"name":"Chandrasekar Selvam","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA30lEQVRIiWNgGAWjYBAC9mYGNiB1AIiTQYSEDEEtPIfhWtISQFp4CGs5ANeSYwAWIKyFnf3Zgw81d+TN2XM+v7pRY8HDwH746Aa8Wph5zA1nHHtmuLPn7TbrnGNAh/Gkpd3Ap8WemYdNmrfhMOOGG7nbjHPYgFokeMzwauFhZn8G0mK/4UbOM+Ocf0RpYTADaUkEamF+nNtGlBYeM8kZxw4nbzjzzIw5t0+Ch42QX3j4jz+T+FBz2HbD8eTHn3O+1cnxsx8+hlcLMmCTAJPEKgcB5g+kqB4Fo2AUjIKRAwAHTUca5vcGDAAAAABJRU5ErkJggg==","orcid":"","institution":"ICAR-Central Marine Fisheries Research Institute","correspondingAuthor":true,"prefix":"","firstName":"Chandrasekar","middleName":"","lastName":"Selvam","suffix":""},{"id":583652832,"identity":"31b738a7-92ad-49cc-bba5-32a113aa4722","order_by":2,"name":"A Mariselvammurugan","email":"","orcid":"","institution":"ICAR-Central Marine Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"A","middleName":"","lastName":"Mariselvammurugan","suffix":""},{"id":583652833,"identity":"77cbfbda-962b-4ed7-9265-a659d408f795","order_by":3,"name":"Smruthi Hareendran","email":"","orcid":"","institution":"ICAR-Central Marine Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Smruthi","middleName":"","lastName":"Hareendran","suffix":""},{"id":583652834,"identity":"a6b6d1ed-be33-49bc-aaf7-403e8ebd00f4","order_by":4,"name":"Nayan Thara","email":"","orcid":"","institution":"ICAR-Central Marine Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Nayan","middleName":"","lastName":"Thara","suffix":""},{"id":583652835,"identity":"9f789785-269f-42f5-89f0-69d05479a7e0","order_by":5,"name":"Linga Prabu","email":"","orcid":"","institution":"Tuticorin Regional Station of ICAR-Central Marine Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Linga","middleName":"","lastName":"Prabu","suffix":""},{"id":583652836,"identity":"dd3a0456-55a7-473e-971e-bce55c8582e6","order_by":6,"name":"Sanal Ebeneezar","email":"","orcid":"","institution":"ICAR-Central Marine Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Sanal","middleName":"","lastName":"Ebeneezar","suffix":""},{"id":583652838,"identity":"2f495168-f6b9-4313-8492-2c0545e8f9db","order_by":7,"name":"Adnan H. Gora","email":"","orcid":"","institution":"ICAR-Central Marine Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Adnan","middleName":"H.","lastName":"Gora","suffix":""},{"id":583652840,"identity":"30bc8be1-bf69-47a8-9a36-67625d6481f0","order_by":8,"name":"Ambarish P. Gop","email":"","orcid":"","institution":"Vizhinjam Regional Centre of ICAR-Central Marine Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Ambarish","middleName":"P.","lastName":"Gop","suffix":""},{"id":583652841,"identity":"b300d2b4-70f7-47cb-839b-03d4dbea825e","order_by":9,"name":"Chiranjiv Pradhan","email":"","orcid":"","institution":"Kerala University of Fisheries and Ocean Studies","correspondingAuthor":false,"prefix":"","firstName":"Chiranjiv","middleName":"","lastName":"Pradhan","suffix":""},{"id":583652842,"identity":"889bf0d8-6229-47de-a9f3-3fdfa1272bcc","order_by":10,"name":"Kajal Chakraborty","email":"","orcid":"","institution":"ICAR-National Bureau of Fish Genetic Resources","correspondingAuthor":false,"prefix":"","firstName":"Kajal","middleName":"","lastName":"Chakraborty","suffix":""}],"badges":[],"createdAt":"2025-12-30 09:53:51","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8479933/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8479933/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":101658337,"identity":"da2d86d6-86ed-4b59-87a9-9c2f9c97d065","added_by":"auto","created_at":"2026-02-02 10:27:20","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":78977,"visible":true,"origin":"","legend":"\u003cp\u003eDigestive enzyme activities in \u003cem\u003eOryzias dancena\u003c/em\u003e fed diets with varying lipid levels and naringenin supplementation. (A) Protease, (B) Amylase, and (C) Lipase activities were measured after a 45-day feeding trial with four experimental diets: Normal Fat Diet (NFD, control), High Fat Diet (HFD, 15% lipid), HFD + 0.075% naringenin (HFD + N1), and HFD + 0.15% naringenin (HFD + N2). Data are presented as mean ± SEM (n = 3). Bars with different letters indicate statistically significant differences among treatments, as determined by one-way ANOVA followed by Tukey’s post hoc test (p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8479933/v1/b5dbc45d538fe4b70852f663.jpg"},{"id":101658079,"identity":"4cca069c-7f54-459b-9516-da188fd509bf","added_by":"auto","created_at":"2026-02-02 10:26:21","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":74601,"visible":true,"origin":"","legend":"\u003cp\u003eAntioxidant enzyme activities in the muscle of \u003cem\u003eOryzias dancena\u003c/em\u003e fed diets containing varying lipid levels and naringenin supplementation. (A) Superoxide dismutase (SOD), (B) Catalase (CAT), and (C) Total antioxidant capacity (TAC) were measured after a 45-day feeding trial with four experimental diets: Normal Fat Diet (NFD, control), High Fat Diet (HFD, 15% lipid), HFD + 0.075% naringenin (HFD + N1), and HFD + 0.15% naringenin (HFD + N2). Bars with different letters indicate statistically significant differences among treatments, as determined by one-way ANOVA followed by Tukey’s post hoc test (p \u0026lt; 0.05). Data are presented as mean ± SEM (n = 3).\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8479933/v1/90f3ae2bf1694a516504a247.jpg"},{"id":101658123,"identity":"8eddb0be-5553-4e1c-9b78-81c021be5654","added_by":"auto","created_at":"2026-02-02 10:26:27","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":60282,"visible":true,"origin":"","legend":"\u003cp\u003eActivities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the muscle of \u003cem\u003eOryzias dancena\u003c/em\u003e fed diets containing varying lipid levels and naringenin supplementation. (A) ALT and (B) AST activities were measured after a 45-day feeding trial with four experimental diets: Normal Fat Diet (NFD, control), High Fat Diet (HFD, 15% lipid), HFD + 0.075% naringenin (HFD + N1), and HFD + 0.15% naringenin (HFD + N2). Bars with different letters indicate statistically significant differences among treatments, as determined by one-way ANOVA followed by Tukey’s post hoc test (p \u0026lt; 0.05). Data are presented as mean ± SEM (n = 3).\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8479933/v1/51595461f77551c1022050b5.jpg"},{"id":101658189,"identity":"af1be59d-6888-487a-a296-0e9ce3f3727d","added_by":"auto","created_at":"2026-02-02 10:26:42","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":30953,"visible":true,"origin":"","legend":"\u003cp\u003eLipid peroxidase levels in the muscle \u003cem\u003eOryzias dancena\u003c/em\u003e fed with diets containing varying lipid levels and naringenin supplementation. Lipid peroxidation levels were measured after 45-days feeding trial with four experimental diets: Normal Fat Diet (NFD, control), High Fat Diet (HFD, 15% lipid), HFD + 0.075% naringenin (HFD + N1), and HFD + 0.15% naringenin (HFD + N2). Data are presented as mean ± SEM (n = 3). Bars with different letters indicate statistically significant differences among treatments, as determined by one-way ANOVA followed by Tukey’s post hoc test (p \u0026lt; 0.05). Data are presented as mean ± SEM (n = 3).\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8479933/v1/37943ff6b87a4b983d8050cc.jpg"},{"id":101658153,"identity":"6eae6831-47d0-4d22-878f-6a6e2bf59769","added_by":"auto","created_at":"2026-02-02 10:26:36","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":72996,"visible":true,"origin":"","legend":"\u003cp\u003eRelative hepatic gene expression in \u003cem\u003eOryzias dancena\u003c/em\u003e fed diets with varying lipid levels and naringenin supplementation\u003cem\u003e. \u003c/em\u003eRelative mRNA expression levels of (A) superoxide dismutase (\u003cem\u003esod\u003c/em\u003e), (B) glutathione peroxidase (\u003cem\u003egpx\u003c/em\u003e), (C) peroxisome proliferator-activated receptor-delta (\u003cem\u003eppar-δ\u003c/em\u003e), (D) fatty acid desaturase-2 (\u003cem\u003efads2\u003c/em\u003e), and (E) complement component 8 (\u003cem\u003ec8\u003c/em\u003e) were quantified after a 45-day feeding trial with four diets: NFD, HFD, HFD+N1 (0.075% naringenin), and HFD+N2 (0.15% naringenin). Expression levels were normalized to β-actin and calculated using the Pfaffl method. Bars with different letters indicate statistically significant differences among treatments, as determined by one-way ANOVA followed by Tukey’s post hoc test (p \u0026lt; 0.05). Data are presented as mean ± SEM (n = 3).\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8479933/v1/184a4e09a06383ccbca5b8a0.jpg"},{"id":101657976,"identity":"c437e1bf-b2d8-4598-bcb1-a8ed471dc441","added_by":"auto","created_at":"2026-02-02 10:25:41","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":378127,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eHepatic histological changes in Oryzias dancena fed with diets containing varying lipid levels and naringenin. (A)NFD, (B) HFD, (C) HFD+N1, (D) HFD+N2 were analysed after a 45-day feeding trial with four diets: Normal fat diet (NFD), high-fat diet (HFD), HFD + 0.075% naringenin (HFD+N1), and HFD + 0.15% naringenin (HFD+N2) for 45 days. Images were taken at 40X.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eNote: VAC- Showing vacuolation\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8479933/v1/51fcd812d593a51db78db690.jpg"},{"id":101658136,"identity":"7ec85cf5-394b-4604-817a-5dd0b655b220","added_by":"auto","created_at":"2026-02-02 10:26:30","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":268889,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIn vitro antioxidant activity of naringenin measured by (A) DPPH and (B) ABTS radical scavenging assays, compared with ascorbic acid as standard.\u003c/em\u003e Data are presented as mean ± SEM (n = 3).\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8479933/v1/c869ac7b87f2635ec7315877.jpg"},{"id":101658458,"identity":"a30da66e-2135-4ea0-8817-75c3e182fdac","added_by":"auto","created_at":"2026-02-02 10:28:00","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":28051,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version\u003c/p\u003e","description":"","filename":"Figure8A.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8479933/v1/80242369f7df7645d3d05ffc.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Dietary naringenin modulates antioxidant status and hepatic lipid deposition in marine medaka (Oryzias dancena) fed a high-fat diet","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAquaculture, the fastest growing food sector, plays a crucial role in global food and nutritional security. However, the intensification of aquaculture practices has introduced new challenges in developing nutritionally balanced and sustainable feeds that support fish health and metabolic homeostasis. Feed formulation remains a central focus, as feeds accounts for nearly 70% of total production costs (Macusi et al., 2023; Nayak et al., 2023). Among the major dietary components, lipids are highly energy-dense (~\u0026thinsp;9 kcal g⁻\u0026sup1;) and serve as essential sources of fatty acids and phospholipids required for membrane integrity, immunity, and reproduction. Increasing dietary lipid levels in aquafeeds can improve growth performance and feed efficiency through a protein-sparing effect, while reducing nitrogen excretion (Glencross, 2009; Turchini et al., 2009; Tocher, 2010; NRC, 2011).\u003c/p\u003e \u003cp\u003eDespite these benefits, prolonged feeding of high-fat diets (HFDs) can induce undesirable metabolic alterations in fish, including excessive lipid deposition, hepatic steatosis, oxidative stress, and inflammation. High dietary lipid levels have been associated with metabolic disorders, oxidative damage, immune dysfunction, and reduced disease resistance in multiple cultured fish species (Naiel et al., 2023; Gora et al. 2023; Wu et al., 2022; Fei et al., 2022). These challenges not only compromise fish health and welfare of farmed fish but also affect the product quality and consumer acceptance (Zhang et al., 2022). ໿The liver, being the primary site for lipid metabolism, is especially susceptible to fat overload, resulting in impaired metabolic homeostasis, elevated hepatic enzymes and endoplasmic reticulum stress (Jia et al., 2020; Nguyen et al., 2008; Qiao et al., 2022). The concomitant overproduction of reactive oxygen species (ROS) accelerates lipid peroxidation and suppresses antioxidant enzyme activities such as superoxide dismutase (SOD) and glutathione peroxidase (GPx) (Abasubong et al., 2023; Zhao et al., 2024). Furthermore, HFDs activate proinflammatory cytokines and alter gut microbiota composition, collectively exacerbating hepatic inflammation and compromising physiological function (Abasubong et al., 2023; Jin et al., 2019; Zhang et al., 2022).\u003c/p\u003e \u003cp\u003eTo mitigate HFD-induced oxidative and metabolic stress, the use of natural bioactive compounds has gained growing attention. Among these, flavonoids, a diverse group of plant-derived polyphenols, have gained increasing attention for their ability to alleviate oxidative and inflammatory damage through free radical scavenging, metal chelation, and modulation of redox-sensitive signalling pathways, owing largely to their C6-C3-C6 backbone (Panche et al., 2016; Roy et al., 2022). Dietary supplementation of various flavonoids like quercetin, baicalin, resveratrol, and hesperidin has been shown to enhance antioxidant enzyme activities, reduce lipid peroxidation, and improve immune responses in fish (Elshopakey et al., 2023; Ge et al., 2023; Jasim et al., 2022; Jia et al., 2020; Wu et al., 2022). Among flavonoids, naringenin, a citrus-derived flavanone, stands out for its potent antioxidant, lipid-regulatory, and hepatoprotective effects (Cai et al., 2023; Jeon et al., 2007; Salehi et al., 2019; Wang et al., 2018). In mammalian models, naringenin mitigates diet-induced oxidative damage and hepatic steatosis by modulating lipid-metabolic and inflammatory pathways: it regulates nuclear receptors and transcriptional co-activators that control fatty acid oxidation and lipogenesis (PPAR-α/PPAR-γ and LXR-α) (Goldwasser et al., 2010), suppresses inflammasome-mediated NLRP3/NF-κB signalling to reduce hepatic inflammation (Wang et al., 2020) and prevents obesity-associated steatosis and glucose intolerance through the regulation of metabolic genes such as Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1 \u003cem\u003eα (pgc-1α)\u003c/em\u003e and Sterol Regulatory Element-Binding Transcription Factor 1 \u003cem\u003e(srebf1)\u003c/em\u003e (Assini et al., 2015). However, comparable mechanistic studies in fish remain scarce, and the physiological effects of dietary naringenin under high-fat feeding conditions are largely unexplored.\u003c/p\u003e \u003cp\u003eThe small euryhaline teleost \u003cem\u003eOryzias dancena\u003c/em\u003e, commonly known as the Indian ricefish or Asian ricefish, possesses remarkable adaptability across a wide range of salinities. Its small body size, transparent embryos, and short reproductive cycle make it an ideal candidate for nutritional and toxicological studies (Ranjan et al., 2022). Sharing the experimental advantages of the zebrafish but adapted to marine and brackish water conditions, \u003cem\u003eO. dancena\u003c/em\u003e serves as a promising marine model organism for nutrigenomic and physiological research in marine contexts (Ranjan et al., 2022). To the best of our knowledge, no comprehensive studies have investigated the lipid-regulatory, antioxidant and immunomodulatory effects of dietary naringenin in fish. Therefore, the present study aimed to evaluate whether dietary naringenin could alleviate HFD-induced oxidative stress and lipid metabolic imbalance in \u003cem\u003eO. dancena\u003c/em\u003e. We hypothesized that naringenin supplementation would enhance antioxidant defences, attenuate hepatic lipid accumulation, and modulate the expression of key genes involved in lipid metabolism. The findings provide new insights into the mechanistic actions of naringenin and reinforce the potential of \u003cem\u003eO. dancena\u003c/em\u003e as a marine model for nutrigenomic investigations.\u003c/p\u003e"},{"header":"2. Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Experimental Diets:\u003c/h2\u003e \u003cp\u003eFour isonitrogenous experimental diets (39% crude protein) with varying lipid levels and naringenin supplementation were formulated to evaluate the effects of dietary naringenin under high-fat feeding conditions (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The normal-fat diet (NFD, 8% crude lipid) served as the basal control, while a high-fat diet (HFD, 15% crude lipid) was formulated to induce lipid accumulation and oxidative stress. Two additional diets, HFD\u0026thinsp;+\u0026thinsp;N1 (15% crude lipid\u0026thinsp;+\u0026thinsp;0.075% naringenin) and HFD\u0026thinsp;+\u0026thinsp;N2 (15% crude lipid\u0026thinsp;+\u0026thinsp;0.15% naringenin), were prepared to assess the effects of dietary naringenin supplementation. The lipid content of all high-fat diets (HFD, HFD\u0026thinsp;+\u0026thinsp;N1, and HFD\u0026thinsp;+\u0026thinsp;N2) was maintained at 15%, ensuring that any observed physiological responses among these groups could be attributed specifically to naringenin supplementation rather than differences in dietary lipid levels.\u003c/p\u003e \u003cp\u003eNaringenin (C₁₅H₁₂O₅; molecular weight: 272.26; \u0026ge;95% purity; SRL Laboratories, India) was incorporated into the feed by replacing an equivalent amount of carboxymethyl cellulose (CMC), which served as an inert binder. This adjustment ensured that all diets remained isonitrogenous, while the HFD-based diets remained isolipidic relative to each other. For the control diets (NFD and HFD), CMC was included at corresponding levels to maintain uniform texture and binding properties. The inclusion levels of naringenin (0.075% and 0.15%) were selected based on previous studies employing dietary flavonoids in fish (Dong et al., 2021; Liu et al., 2020; Zhang et al., 2018). Dry ingredients were thoroughly mixed, followed by the addition of the oil fraction containing dissolved naringenin for the treatment diets. The mixture was homogenized with water to form a dough, extruded using a twin-screw extruder to produce slow-sinking pellets, and air-dried at room temperature. The dried pellets were stored at \u0026minus;\u0026thinsp;20\u0026deg;C until use. The total phenolic content was measured following (Siddiqui et al., 2017; Singleton et al., 1999) and the proximate composition of all diets was analyzed according to AOAC (2005) procedures.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFeed Composition and Proximate analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIngredients\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNFD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHFD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHFD\u0026thinsp;+\u0026thinsp;N1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHFD\u0026thinsp;+\u0026thinsp;N2\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWheat gluten\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRDGS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e85\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMeat and bone meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoya\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e185\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e185\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e185\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e185\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRice powder\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWheat powder\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCottonseed meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGNOC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e155\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e155\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e155\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e155\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLinseed oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSunflower oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCMC\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e19.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMineral\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin C\u003csup\u003e4\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethionine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMCP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNaringenin\u003csup\u003e5\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eProximate Composition (%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMoisture\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProtein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e39.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e39.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e39.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLipid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAsh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAcid insoluble ash\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal Phenolic content (mg GAE/g)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e30.90\u0026thinsp;\u0026plusmn;\u0026thinsp;16.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34.81\u0026thinsp;\u0026plusmn;\u0026thinsp;11.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100.8\u0026thinsp;\u0026plusmn;\u0026thinsp;7.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e140.9\u0026thinsp;\u0026plusmn;\u0026thinsp;13.08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003e\u003csup\u003e1\u003c/sup\u003eNICE Chemicals (p) LTD- Kochi, India\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003csup\u003e2\u003c/sup\u003eVitamin mixture (Supplevite\u0026reg;): composition per 250g: vit. A500000IU,vit.D3\u0026ndash;100,000IU,vit.B2\u0026ndash;200mg,vit.E-75units,vit.K-100mg, Ca pantothenate- 250mg, Nicotinamide- 100mg, vit. B12\u0026ndash;600mg, choline chloride-15,000mg, Ca-75,000mg, Mn-27,500mg, I-100mg, Fe-750mg, Zn1500mg, Cu-200mg, Co-45mg.\u003c/p\u003e \u003cp\u003e \u003csup\u003e3\u003c/sup\u003eMineral mix (Agrimin\u0026reg;): vit-A 7,00,000IU, vit-D3- 70,000, vit-E- 250mg, coabalt-150mg, Copper- 1200mg, iodine- 325mg, iron- 1500mg, manganese-6000mg, pottassium-100mg, sulphur-720mg, zinc-9600mg, DL-methionine-1000mg, calcium-25,500mg and phosphorous- 12,750mg.\u003c/p\u003e \u003cp\u003e \u003csup\u003e4\u003c/sup\u003eVitaminC- Ovans cure life science, Gurugram, India.\u003c/p\u003e \u003cp\u003e \u003csup\u003e5\u003c/sup\u003eSisco Research Laboratories pvt, Ltd- Maharashtra, India.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Feeding Trial\u003c/h2\u003e \u003cp\u003eSixty days old \u003cem\u003eOryzias dancena\u003c/em\u003e were obtained from Vizhinjam Regional Centre and transported to ICAR-CMFRI, Kochi, Wet Laboratory with oxygenated containers and acclimatized for 2 weeks in 1000 L FRP tank. During acclimatization fish were fed CMFRI Varna marine ornamental fish feed (38% protein, 9% fat) three times a day. Before stocking, the fish were starved for 48hrs. Subsequently, a total of 120 healthy individuals having average body weight (0.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.035gm) and average length (2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15cm) were selected randomly and stocked in twelve 50 L capacity tanks (10 fish/tank) in closed recirculatory system to ensure uniform water quality and aeration across treatments. Fish were fed till satiation (\u003cem\u003ead libitum\u003c/em\u003e) with 4 different experimental diets three times a day (9:00, 14:00, 18:00) Water salinity was maintained at 25 ppt throughout the trial period and every day uneaten feed and faecal matter were siphoned out. The trial continued for 45 days after which they were sampled for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Sampling\u003c/h2\u003e \u003cp\u003eAfter completion of the 45-day feeding trial, fish were starved for 24 h and anesthetized with clove oil (50 mg L⁻\u0026sup1;; immersion method; HiMedia, India) prior to euthanasia and sampling. A total of nine fish per tank were sacrificed for sample collection. For digestive enzyme analysis, guts from three fish were pooled to form one composite sample, and three pooled samples were collected per dietary group. Muscle samples were collected in triplicate for biochemical analyses. Gut and muscle tissues were homogenized in 10% (w/v) sucrose buffer at a tissue-to-buffer ratio of 1:20 and centrifuged at 8,000 rpm for 10 min at 4\u0026deg;C. The supernatant was collected and stored at \u0026minus;\u0026thinsp;20\u0026deg;C until further analysis. For gene expression analysis, liver samples were collected in triplicate and preserved in 500 \u0026micro;L of RNAlater\u0026reg; (Invitrogen\u0026trade;, Thermo Fisher Scientific), stored at 4\u0026deg;C for 24 h, and subsequently transferred to \u0026minus;\u0026thinsp;80\u0026deg;C to maintain RNA integrity until processing. For histological examination, liver samples were collected and fixed in 10% neutral buffered formalin (NBF; Sigma-Aldrich, HT501128) to preserve tissue architecture and stored at room temperature until analysis. Additionally, livers from four fish within the same dietary group were pooled and stored at \u0026minus;\u0026thinsp;80\u0026deg;C for lipid-related analyses to prevent lipid oxidation. All experimental procedures involving fish, including rearing, handling, and sampling, were reviewed and approved by the Animal Ethics Committee of the Central Marine Fisheries Research Institute (CMFRI), Kochi, India. Every effort was made to minimize fish stress by maintaining optimal rearing and handling conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Biochemical parameters\u003c/h2\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.4.1. Digestive Enzymes\u003c/h2\u003e \u003cp\u003eDigestive enzyme activities were quantified using gut homogenate supernatants. Protease activity was determined using casein as a substrate; enzyme extracts were incubated with casein solution under standard conditions, and the reaction was terminated with trichloroacetic acid (TCA). The released peptides were quantified by measuring absorbance at 280 nm following Drapeau (1976). Amylase activity was determined by incubating the enzyme extract with starch as a substrate, where the released reducing sugars like glucose reacted with DNS reagent to form a reddish-brown complex measurable at 540 nm (Rick \u0026amp; Stegbauer, 1974). Lipase activity was measured using p-nitrophenyl palmitate (pNPP) as a substrate, with the release of p-nitrophenol quantified spectrophotometrically at 410 nm (Winkler \u0026amp; Stuckmann, 1979). Total protein content was determined using the Lowry method (Lowry et al., 1951).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.4.2. Antioxidant and metabolic enzymes activity:\u003c/h2\u003e \u003cp\u003eVarious biochemical parameters like antioxidant enzymes metabolic enzymes and lipid peroxidase were measured in fish muscle. Superoxide dismutase (SOD) activity was determined by the epinephrine auto-oxidation method given by Misra \u0026amp; Fridovich, (1977), which measures the enzyme\u0026rsquo;s ability to inhibit the conversion of epinephrine to adrenochrome in an alkaline medium. The rate of adrenochrome formation was monitored spectrophotometrically (Multiskan\u0026trade; Skyhigh Microplate Spectrophotometer, Thermo Scientific) at 480 nm. Catalase activity was assayed following method described by (Aebi, 1984) by monitoring the decomposition of hydrogen peroxide (H₂O₂) into water and oxygen. The decrease in absorbance of H₂O₂ was recorded spectrophotometrically at 240 nm, and the rate of decline indicated the level of catalase activity. The total antioxidant capacity of the liver was assessed spectrophotometrically by the phosphomolybdenum method, following the procedure described by Prieto et al. (1999).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.4.3. Metabolic Enzymes\u003c/h2\u003e \u003cp\u003eAlanine Aminotransferase (ALT) and Aspartate Aminotransferase (AST) activities was estimated following the International Federation of Clinical Chemistry (IFCC) kinetic UV method, using a commercially available diagnostic kit (Coral Clinical Systems, India).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.4.4. Lipid Peroxidase:\u003c/h2\u003e \u003cp\u003eLipid peroxidase was detected using thiobarbituric acid (TBA) at 532nm following standard methods (Jagannivasan et al., 2024; Ohkawa et al., 1979).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Gene Expression\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from liver tissue using RNAiso Plus (Takara, India). The purity and concentration of RNA were assessed using NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). Only samples having purity above 1.8 were used for reverse transcription. The concentration of RNA of selected samples was diluted to100ng/ \u0026micro;l. Reverse transcription was carried out in a volume of 20 \u0026micro;l, containing uniform amounts of RNA (800 \u0026micro;l) using PrimeScript\u0026trade; 1st strand cDNA Synthesis Kit (6110A, Takara) according to the manufacturer\u0026rsquo;s instructions,\u003c/p\u003e \u003cp\u003eThe mRNA expression of Superoxide Dismutase \u003cem\u003e(sod)\u003c/em\u003e, Glutathione Peroxidase \u003cem\u003e(gpx)\u003c/em\u003e, Fatty Acid Desaturase 2 \u003cem\u003e(fads 2)\u003c/em\u003e, Peroxisome Proliferator-Activated Receptor-Delta \u003cem\u003e(ppar-δ), and\u003c/em\u003e Complement Component 8 \u003cem\u003e(c8)\u003c/em\u003e were quantified by quantitative real-time PCR (qPCR) using \u003cem\u003eβ-actin (actb)\u003c/em\u003e as a housekeeping gene. The primers used in this study were obtained from previously published literature or designed in-house using the NCBI Primer-BLAST tool. The custom primers were based on conserved regions within the gene across related medaka species (Table\u0026nbsp;2). Primer efficiency was validated using standard curves generated from serial dilutions of pooled cDNA, and only primers with amplification efficiency between 90\u0026ndash;110% were used. The qPCR reactions were performed on an AriaMx Real-Time PCR System (Agilent Technologies, Singapore). Each reaction medium of 10 \u0026micro;l volume containing 5 \u0026micro;l TB Green PREMIX EX Taq\u0026trade; (RR820A, Takara) 0.5 \u0026micro;l each of forward and reverse primer, 3 \u0026micro;l of nuclease-free water and 1 \u0026micro;l of cDNA template. The amplification program consisted of an initial denaturation at 95\u0026deg;C for 3 min, followed by 35 cycles of 95\u0026deg;C for 30 s, 60\u0026deg;C for 30 s, and 72\u0026deg;C for 30 s. A melting curve analysis (95\u0026deg;C for 30 s, 60\u0026deg;C for 30 s, 95\u0026deg;C for 30 s) was included to verify the specificity of amplification. For gene expression analysis, raw Ct values were converted into efficiency-corrected relative expression values using the Pfaffl method (Pfaffl, 2001). Expression levels of target genes were normalised against the reference gene \u003cem\u003eβ-actin\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eTable\u0026nbsp;2\u003c/strong\u003e \u003cp\u003ePrimers used for real-time quantitative PCR (qPCR) of \u003cem\u003eOryzias dancena.\u003c/em\u003e\u003c/p\u003e \u003c/p\u003e \u003c/div\u003e\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"623\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.98876%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 48.4751%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequence 5\u0026rsquo; to 3\u0026rsquo;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5939%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmplicon size\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.2488%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eEfficiency\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.6934%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAccession no.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.98876%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eSod\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 48.4751%;\"\u003e\n \u003cp\u003eF- AATCAAAGGCCTCACACCAG\u003c/p\u003e\n \u003cp\u003eR- GTCCCCAACGTGTCTTTCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5939%;\"\u003e\n \u003cp\u003e148\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.2488%;\"\u003e\n \u003cp\u003e110\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.6934%;\"\u003e\n \u003cp\u003e\u0026nbsp;Self-Designed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.98876%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003egpx\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 48.4751%;\"\u003e\n \u003cp\u003eF- CACGACCACCAGGGATTACA\u003c/p\u003e\n \u003cp\u003eR- TGGCCGAACTGATTACAGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5939%;\"\u003e\n \u003cp\u003e99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.2488%;\"\u003e\n \u003cp\u003e95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.6934%;\"\u003e\n \u003cp\u003eSelf-Designed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.98876%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003efads2\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 48.4751%;\"\u003e\n \u003cp\u003eF- GGGTGGATTTGGCGTGGTAT\u003c/p\u003e\n \u003cp\u003eR- CCAGTGACTCTCCAGGAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5939%;\"\u003e\n \u003cp\u003e122\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.2488%;\"\u003e\n \u003cp\u003e107\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.6934%;\"\u003e\n \u003cp\u003eMariselvammurugan, 2025\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.98876%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eppar\u0026delta;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 48.4751%;\"\u003e\n \u003cp\u003eF- GCAGGTGGAACAGAGTCAGG\u003c/p\u003e\n \u003cp\u003eR- AGTAGAGGGTGGAGCGAGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5939%;\"\u003e\n \u003cp\u003e156\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.2488%;\"\u003e\n \u003cp\u003e102\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.6934%;\"\u003e\n \u003cp\u003eMariselvammurugan, 2025\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.98876%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eC8\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 48.4751%;\"\u003e\n \u003cp\u003eF- ACSCTYTCAGAGCCCATGYTSACCA\u003c/p\u003e\n \u003cp\u003eR- TGGTCCTGRTCCACTTCACCACAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5939%;\"\u003e\n \u003cp\u003e155\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.2488%;\"\u003e\n \u003cp\u003e94\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.6934%;\"\u003e\n \u003cp\u003eSelf-Designed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 8.98876%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eactb\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 48.4751%;\"\u003e\n \u003cp\u003eF- GGAAATCGTGCGTGACATCA\u003c/p\u003e\n \u003cp\u003eR- TACCAAGGAATGAGGGCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 10.5939%;\"\u003e\n \u003cp\u003e188\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.2488%;\"\u003e\n \u003cp\u003e110\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.6934%;\"\u003e\n \u003cp\u003eMariselvammurugan, 2025 et al\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviations:\u0026nbsp;\u003c/strong\u003e\u003cem\u003esod\u003c/em\u003e- superoxide dismutase, \u003cem\u003egpx\u003c/em\u003e- glutathione peroxidase, \u003cem\u003efads 2\u003c/em\u003e- fatty acid desaturase \u003cem\u003eppar-\u0026delta;-\u0026nbsp;\u003c/em\u003eperoxisome proliferator-activated receptor-delta,\u003cem\u003e\u0026nbsp;c8-\u0026nbsp;\u003c/em\u003ecomplement component 8\u003cem\u003e\u0026nbsp;\u003c/em\u003eand \u003cem\u003e\u0026beta; -actin\u0026nbsp;\u003c/em\u003e- beta actin\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7. \u0026nbsp;Histological Examination:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe liver samples fixed in 10% NBF were dehydrated through a series of alcohols and then infiltrated with paraffin wax using automatic tissue processor. Sections of 3 \u0026mu;m thickness were cut on the semi- automatic microtome (Leica RM2125 RTS, Germany) then stained with H\u0026amp;E stains with slight modifications and observed under light microscope (40X) (leica) and photomicrographs were captured using a digital camera system.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8. Total Phenolic Content\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe total phenolic content (TPC) in feed was determined by reacting the sample supernatant extracted using 80% ethanol with the Folin\u0026ndash;Ciocalteu reagent, neutralizing with sodium carbonate, incubating for 30 minutes for colour development, and measuring absorbance at 765 nm against a standard curve of naringenin following (Siddiqui et al., 2017; Singleton et al., 1999).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9. In vitro Antioxidant Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003ein vitro\u003c/em\u003e antioxidant activity of naringenin (\u0026ge;95% purity; SRL Laboratories, India) was evaluated using DPPH (2,2-diphenyl-1-picrylhydrazyl) and ABTS ABTS (2,2\u0026prime;-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) radical scavenging assays. Naringenin was dissolved in methanol to prepare different test concentrations (25 - 250 \u0026micro;M). Ascorbic acid was used as the standard reference antioxidant. All assays were performed in triplicate, and results are expressed as mean \u0026plusmn; SEM.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9.1 DPPH Radical Scavenging Activity:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe DPPH (2,2-diphenyl-1-picrylhydrazyl) assay was performed according to Brand-Williams et al. (1995) with slight modifications. A 0.1 mM DPPH solution in methanol was freshly prepared. Equal volumes (1 mL each) of naringenin solution at different concentrations (10\u0026ndash;250 \u0026micro;M) or Trolox standard were mixed with the DPPH solution and incubated in the dark at room temperature for 30 min. Absorbance was recorded at 517 nm using a UV\u0026ndash;Vis spectrophotometer (Shimadzu, Japan). The percentage of radical scavenging activity was calculated as:\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Scavenging\u0026nbsp;activity\u0026nbsp;(%) = (Ac\u0026minus;As/Ac) \u0026times;100\u003c/p\u003e\n\u003cp\u003ewhere \u003cem\u003eAc\u003c/em\u003e is the absorbance of the control (DPPH solution without sample) and \u003cem\u003eAs\u003c/em\u003e is the absorbance of the sample. IC₅₀ values were determined by nonlinear regression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9.2. ABTS Radical Scavenging Activity:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ABTS (2,2\u0026prime;-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) assay was performed following Re et al. (1999) with modifications. ABTS⁺ radicals were generated by mixing 7 mM ABTS with 2.45 mM potassium persulfate and allowing the reaction to stand in the dark for 16 h. The ABTS⁺ solution was diluted with ethanol to an absorbance of 0.70 \u0026plusmn; 0.02 at 734 nm. Equal volumes (1 mL) of naringenin solution or ascorbic acid standard were mixed with 1 mL of ABTS⁺ solution, incubated in the dark for 6 min, and absorbance was recorded at 734 nm. Inhibition was calculated using the same formula as above.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10. \u0026nbsp; Statistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the statistical analyses were performed using the software GraphPad Prism version 8.4.2 (Graphpad Software Inc., San Diago, CA, USA). All data were checked for normality and homogeneity of variance using Kolmogorov-Smirnov and Levene\u0026rsquo;s tests, respectively. Data were analysed using one-way analysis of variance (ANOVA) to determine significant difference among treatment groups followed by Tukey\u0026rsquo;s post-hoc test for multiple comparisons to identify pairwise differences between group means. Results were considered statistically significant at p \u0026lt; 0.05. All data are shown as the mean \u0026plusmn; SEM (Standard Error of the Mean).\u0026nbsp;\u003c/p\u003e"},{"header":"3.\tResults","content":"\u003ch2\u003e\u003cstrong\u003e3.1. Effect on digestive enzymes:\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003e\u0026nbsp;The Effect of dietary fat levels and naringenin supplementation on digestive enzymes of \u003cem\u003eO. dancena\u003c/em\u003e were presented in \u003cem\u003eFigure 1\u003c/em\u003e. Lipase activity was significantly elevated in all groups receiving high-fat diets (HFD, HFD+N1, HFD+N2) compared to NFD (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Conversely, amylase activity was significantly higher in NFD-fed fish compared to all HFD groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Protease activity showed no statistically significant difference among treatments, although fish fed NFD had slightly higher protease activity compared to HFD fed groups. No significant effect of naringenin supplementation at either 0.075% or 0.15% was observed on\u0026nbsp;activities of protease, lipase, and amylase (\u003cem\u003eP\u0026gt;\u003c/em\u003e0.05) beyond those induced by dietary lipid level.\u003c/p\u003e\n\u003ch2 id=\"_Toc210053641\"\u003e\u003cstrong\u003e3.2. Effect on Antioxidant enzymes in muscle:\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eAntioxidant responses (SOD, CAT, and total antioxidant capacity (TAC)) in muscle of \u003cem\u003eO. dancena\u003c/em\u003e fed with diets containing varying lipid levels and naringenin are presented in \u003cem\u003eFigure 2.\u003c/em\u003e SOD activity was significantly reduced in fish fed HFD compared to NFD (p \u0026lt; 0.05). Supplementation with 0.075% naringenin produced a modest improvement, while 0.15% naringenin (HFD+N2) restored SOD activity to levels comparable to NFD. CAT activity was found to be lowest in HFD fed group though the difference among treatments were not statistically significant. Total antioxidant capacity (TAC) increased with NGE supplementation, with both HFD+N1 and HFD+N2 groups showing significantly higher TAC than NFD and HFD groups (p \u0026lt; 0.05).\u0026nbsp;\u003c/p\u003e\n\u003ch2 id=\"_Toc210053642\"\u003e\u003cstrong\u003e3.3. Effect on Metabolic enzymes in muscle\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eMuscle ALT and AST activities in \u003cem\u003eO. dancena\u003c/em\u003e under different dietary treatments are shown in Figure 3. ALT activity was significantly reduced in fish fed the HFD compared to the NFD group (p \u0026lt; 0.05). Fish receiving naringenin supplementation (HFD+N1 and HFD+N2) showed ALT activity values closer to those of NFD-fed fish. AST activity showed a similar directional trend, with lower values in HFD-fed fish; however, the differences among treatments were not statistically significant (p \u0026gt; 0.05).\u003c/p\u003e\n\u003ch2 id=\"_Toc210053643\"\u003e\u003cstrong\u003e3.4. Lipid Peroxidation levels\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eThe muscle lipid peroxidation value of \u003cem\u003eO. dancena\u003c/em\u003e fed with diets containing varying lipid levels and naringenin are presented in \u003cem\u003eFigure 4\u003c/em\u003e. Lipid peroxidation, measured as thiobarbituric acid reactive substances (TBARS), was significantly higher in the muscle of fish fed the HFD compared to the NFD group (p \u0026lt; 0.05). Naringenin supplementation resulted in lower TBARS values compared to the HFD group; however, these differences were not statistically significant (p \u0026gt; 0.05).\u003c/p\u003e\n\u003ch2 id=\"_Toc210053644\"\u003e\u003cstrong\u003e3.5. Gene Expression\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eThe hepatic mRNA expression of genes related to antioxidant (\u003cem\u003esod\u003c/em\u003e, \u003cem\u003egpx\u003c/em\u003e), lipid metabolism (\u003cem\u003efads2, ppar-\u0026delta;\u003c/em\u003e), immune marker \u003cem\u003ec8\u003c/em\u003e of \u003cem\u003eO. dancena\u003c/em\u003e fed with diets containing varying lipid levels and naringenin are presented in \u003cem\u003eFigure 5\u003c/em\u003e. \u0026nbsp;Fish fed HFD exhibited significantly higher mRNA expression of \u003cem\u003esod\u003c/em\u003e and\u003cem\u003e\u0026nbsp;gpx\u003c/em\u003e compared to NFD (p \u0026lt; 0.05). NGE supplementation reduced expression of these genes, with levels in HFD+N2 approaching those of NFD-fed fish. \u0026nbsp;\u003cem\u003eppar\u0026delta;\u0026nbsp;\u003c/em\u003eexpression was markedly upregulated in HFD-fed fish relative to NFD (p \u0026lt; 0.05), but declined progressively in NGE-supplemented groups, with the lowest expression in HFD+N2. By contrast, \u003cem\u003efads2\u003c/em\u003e expression was lowest in HFD-fed fish, while both NGE-supplemented groups showed partial restoration, with HFD+N2 showing the highest levels. Expression of the immune-related gene \u003cem\u003ec8\u003c/em\u003e did not differ significantly among treatments (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6. Histology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHistopathological examination of hepatic tissues revealed marked lipid accumulation in fish fed the high-fat diet (HFD), characterized by prominent cytoplasmic vacuolation and displacement of hepatocyte nuclei toward the periphery, indicative of microvesicular steatosis (Figure 6). In contrast, hepatocytes in the normal-fat diet (NFD) group exhibited normal architecture with centrally located nuclei and minimal lipid vacuolation. Fish fed naringenin-supplemented diets (HFD + N1 and HFD + N2) exhibited reduced hepatic lipid vacuolation compared to the HFD group, with histological features consistent with mild to moderate microvesicular steatosis, indicating a protective effect of naringenin against lipid-induced hepatic alterations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.7. Invitro Antioxidant assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNaringenin exhibited a concentration-dependent increase in antioxidant activity in both DPPH and ABTS assays (Figure 7). In the DPPH assay, the radical scavenging activity of naringenin increased progressively with concentration, ranging from approximately 25 % at 50 \u0026micro;M to 70 % at 250 \u0026micro;M, whereas ascorbic acid exhibited higher scavenging efficiency across all tested concentrations. A similar trend was observed in the ABTS assay, where naringenin demonstrated increasing radical-quenching activity with concentration, from 15 % at 50 \u0026micro;M to nearly 35 % at 250 \u0026micro;M, while ascorbic acid showed significantly greater inhibition. These results confirm that naringenin possesses intrinsic radical-scavenging potential, capable of neutralizing both DPPH and ABTS radicals.\u003c/p\u003e"},{"header":"4.\tDiscussion ","content":"\u003cp\u003eHigh-fat diets (HFDs) are known to induce hepatic steatosis, oxidative stress, and metabolic disturbances that collectively impair growth and physiological performance in fish. Therefore, exploring natural bioactive compounds capable of alleviating these adverse effects has gained considerable attention in aquaculture nutrition research. In the present study, the effects of dietary high fat intake on metabolic and oxidative parameters were evaluated, along with the potential of naringenin, a flavonoid with recognized antioxidant and lipid-lowering properties, to mitigate HFD-induced alterations.\u003c/p\u003e\n\u003cp\u003eDietary lipid levels influenced the activity of digestive enzymes in \u003cem\u003eOryzias dancena\u003c/em\u003e. Lipase activity was significantly higher in fish receiving higher dietary lipid levels compared to NFD. This was in response to higher lipid levels as lipase secretion increases to facilitate better lipid hydrolysis (Lu et al., 2024; Ma et al., 2020). Conversely, amylase activity was significantly lower in fish fed HFDs indicating metabolic shift away from carbohydrate utilization. Such reciprocal regulation between amylase and lipase has also been observed in other fish species like yellow croaker (\u003cem\u003eLarimichthys crocea\u003c/em\u003e) (Cai et al., 2016) and \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eNile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) (Yuan et al., 2025) reflecting dietary adaptation and digestive plasticity. Protease activity was found to be slightly higher in NFD compared to other groups. This reduced protease activity in HFDs is in consistent with previous studies which demonstrate increased protease activity in fish with lower lipid intake (Ma et al., 2020). External factors like protein-lipid ratio are known to affect the significance of variation of protease activity in response to change in lipid intake (Nogueda Torres \u0026amp; Lazo, 2024; Trenzado et al., 2018). The lack of significant contrasting trend in protease activity between NFD and HFD, HFD+N1 and HFD+N2 fed groups may be because of lower stocking density and higher protein to lipid ratio. Unlike other flavonoids like resveratrol (Afzali-Kordmahalleh \u0026amp; Meshkini, 2023) and curcumin (Eissa et al., 2024) dietary supplementation of naringenin did not show any influence on digestive enzyme modulation.\u003c/p\u003e\n\u003cp\u003eThe hepatic mRNA expression of \u003cem\u003esod\u003c/em\u003e and \u003cem\u003egpx\u003c/em\u003e was significantly upregulated in fish fed HFD compared to NFD which is an indication of an oxidative stress\u0026ndash;induced adaptive response previously reported in rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e), Golden Pompano (\u003cem\u003eTrachinotus ovatus\u003c/em\u003e) and tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) (Chen et al., 2022; Jia et al., 2020; Vranković et al., 2021). This transcriptional upregulation is indicative of an oxidative stress\u0026ndash;induced adaptive response, since excess dietary lipids promote mitochondrial \u0026beta;-oxidation, peroxisomal lipid catabolism, and NADPH oxidase activity, collectively leading to elevated reactive oxygen species (ROS) production (Chen et al., 2022; Jia et al., 2020). \u0026nbsp;Liver, being the primary site of lipid metabolism, responds to this increased oxidative load by enhancing the transcription of antioxidant related genes. \u0026nbsp; \u0026nbsp;Interestingly, while hepatic antioxidant gene transcription was elevated in response to HFD, the muscle exhibited the opposite trend showing lowest enzymatic activity of SOD and CAT, highlighting tissue-specific responses to oxidative stress. Similar suppression of antioxidant enzyme activity in response to HFD has been reported in zebrafish (Jafari et al., 2025) and largemouth bass \u003cem\u003eMicropterus salmoides\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/em\u003e(Zhou et al., 2020). This mismatch between hepatic transcript levels and muscle enzyme activity may be due to tissue-specific regulation of oxidative stress, post-translational modifications, or oxidative inactivation of enzymes (Kim et al., 2018; Selvam et al., 2022). Increased dietary fat increases ROS production which in turn can lead to oxidative modification and inactivation of antioxidant proteins, depletion of cofactors, any of which would reduce measurable activity despite elevated transcription (Kwon et al., 2000; Miyamoto et al., 2003). Lipid peroxidation\u0026ndash;derived aldehydes such as 4-hydroxynonenal (4-HNE) and malondialdehyde (MDA) are known to covalently modify key amino acid residues in antioxidant enzymes, leading to conformational changes and catalytic impairment (Kim et al., 2018). Consistent with this mechanism, higher levels of lipid peroxidation products were observed in the muscle of HFD-fed fish, indicating enhanced oxidative damage in this tissue.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNaringenin supplementation effectively stabilized the antioxidant defence system. Hepatic\u003cem\u003e\u0026nbsp;sod\u003c/em\u003e and \u003cem\u003egpx\u003c/em\u003e mRNA expression in the HFD + naringenin group remained close to NFD levels, indicating reduced oxidative stress. Furthermore, naringenin preserved SOD and CAT activity in muscle, suggesting protection against oxidative inactivation. This protective effect can be attributed to both its radical scavenging properties and its ability to modulate Nrf2-mediated transcriptional pathways (Mehranfard et al., 2023; Rashmi et al., 2018). The elevated total antioxidant capacity (TAC) in naringenin-supplemented fish further supports its role in sustaining antioxidant equilibrium. Moreover, naringenin supplementation attenuated muscle lipid peroxidation relative to the HFD group, although values remained marginally higher than those in NFD-fed fish. This suggests that naringenin primarily acts to preserve and stabilize antioxidant defences under oxidative challenge, rather than completely reversing pre-existing lipid peroxidation. A further study with time series sampling to provide both transcriptional and post-translational aspects of antioxidant defence, as tissue-specific oxidative stress can lead to discrepancies between gene expression and enzyme activity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTransaminase activities, ALT and AST are commonly used as indicators of hepatic health and metabolic status, with elevated levels generally reflecting hepatocellular damage (Bojarski et al., 2025). Interestingly, ALT activity was significantly lower in HFD-fed group compared to NFD-fed group, while AST showed a similar but non-significant trend. Restoration of both enzymes to near-control levels in NGE-supplemented groups suggests improved metabolic balance. \u0026nbsp;This decrease in ALT and AST levels in response to lipid-rich diets \u0026nbsp;has been reported in rohu, \u003cem\u003eLabeo rohita\u003c/em\u003e, butter catfish, \u003cem\u003eOmpok\u0026nbsp;bimaculatus\u003c/em\u003e and Rainbow Trout \u003cem\u003eOncorhynchus mykis\u0026nbsp;\u003c/em\u003e(Chen et al., 2023; Paul et al., 2021; Siddiqua \u0026amp; Khan, 2022) and it\u0026rsquo;s generally interpreted as a reduction in protein catabolism owing to increased reliance on dietary lipids as energy substrates. The ability of naringenin to normalise transaminase activity likely reflects its protective effects against oxidative inactivation and its role in maintaining metabolic homeostasis.\u003c/p\u003e\n\u003cp\u003eAt the transcriptional level, HFD feeding significantly elevated \u003cem\u003eppar-\u0026delta;\u003c/em\u003e expression while suppressing \u003cem\u003efads2\u003c/em\u003e, with naringenin supplementation exerting opposite. The elevated \u003cem\u003eppar-\u0026delta;\u003c/em\u003e expression under HFD likely reflects a compensatory response to lipid overload, promoting fatty acid oxidation to mitigate lipotoxicity. Similar trends have been reported in fish and mammalian models, where excess dietary lipid load induces PPAR signalling to regulate lipid transport and oxidation (Inoue et al., 2005; Zhou et al., 2024). Naringenin supplementation reduces the\u003cem\u003e\u0026nbsp;ppar-\u0026delta;\u003c/em\u003e expression in a dose-dependent manner, consistent with the alleviation of hepatic lipid accumulation and oxidative stress, thereby lowering the requirement for compensatory activation (Gao et al., 2024). Furthermore, the elevated expression of \u003cem\u003eppar-\u0026delta;\u003c/em\u003e in HFD-fed fish may not only represent a compensatory mechanism for lipid overload but also reflect its role as a signalling mediator in inflammation (Wang et al., 2019). As HFD feeding induces oxidative and inflammatory stress (Jia et al., 2020; Shen et al., 2023), both may contribute to elevated \u003cem\u003eppar-\u0026delta;\u003c/em\u003e expression. The attenuation of HFD-induced changes in gene expression by naringenin reflects its broader antioxidant and anti-inflammatory actions. Interestingly, the expression of \u003cem\u003ec8\u003c/em\u003e, a terminal complement component, did not differ significantly among dietary treatments. This is likely because activation of the complement system under metabolic stress primarily involves early pathway components such as \u003cem\u003ec3\u003c/em\u003e and \u003cem\u003ec4\u003c/em\u003e, which mediate recognition of altered-self signals, lipid accumulation, and inflammation (Xin et al., 2018; Jin et al., 2018). In contrast, \u003cem\u003ec8\u003c/em\u003e participates in the late stage of complement activation, forming part of the membrane attack complex (MAC), which is typically triggered during pathogen invasion rather than sterile metabolic stress (Sikorski et al., 2021). Thus, the lack of a significant response in \u003cem\u003ec8\u003c/em\u003e expression suggests that while HFD induced oxidative and lipid metabolic stress, it may not have been sufficient to trigger terminal complement activation in the absence of infection\u003c/p\u003e\n\u003cp\u003eHistological analysis further supported biochemical and molecular findings. HFD-fed fish exhibited severe hepatic steatosis, characterized by the presence of large vacuoles indicative of lipid overload. Naringenin supplementation reduced lipid vacuolization in a dose-dependent manner, with livers of the higher-supplemented group displaying near-normal architecture. \u0026nbsp;In agreement with our results, few studies in mammalian systems where naringenin ameliorates steatosis through regulation of lipid metabolism and oxidative stress (Hua et al., 2021; Mulvihill et al., 2010; Wang et al., 2020) in contrast, the suppression of \u003cem\u003efads2\u003c/em\u003e expression under HFD may reflect feedback inhibition of endogenous fatty acid biosynthesis.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThe transformation of essential fatty acids into long-chain polyunsaturated fatty acids (LC-PUFAs) depends on \u003cem\u003efads2\u003c/em\u003e enzymes (\u0026Delta;5 and \u0026Delta;6 desaturases), \u0026nbsp;and when dietary lipid intake is high, particularly with high LC-PUFAs in the diet, transcriptional regulation typically downregulates \u003cem\u003efads2\u003c/em\u003e to limit redundant de novo synthesis\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e(Ampong et al., 2022; Jump, 2002; Nakamura \u0026amp; Nara, 2004). The partial restoration of \u003cem\u003efads2\u003c/em\u003e expression in naringenin supplemented groups suggests that it may mitigate this feedback suppression, thereby supporting endogenous LC-PUFA biosynthesis and maintaining lipid homeostasis.\u003c/p\u003e\n\u003cp\u003eIn addition to the \u003cem\u003ein vivo\u003c/em\u003e antioxidant responses, the in vitro assays further confirmed the radical-scavenging potential of naringenin. Both DPPH and ABTS assays showed a dose-dependent increase in scavenging activity, although ascorbic acid exhibited higher efficacy across the tested concentrations. These results demonstrate that naringenin possesses intrinsic hydrogen- or electron-donating capacity to neutralize free radicals, consistent with previous reports highlighting its redox-active flavonoid structure (Cavia-Saiz et al., 2010; Kumar \u0026amp; Pandey, 2013). The observed in vitro antioxidant capacity is consistent with the in vivo biochemical responses, where naringenin supplementation enhanced TAC and upregulated enzymatic antioxidants such as SOD and CAT. This coherence suggests that naringenin maintains oxidative balance through both direct radical-scavenging and indirect modulation of antioxidant defences. Similar protective mechanisms have been reported in mammalian models, where naringenin reduced ROS generation and lipid peroxidation via combined chemical and enzymatic pathways (Salehi et al., 2019; Wang et al., 2020).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCollectively, these results suggests that naringenin effectively counters HFD-induced oxidative stress and lipid accumulation in \u003cem\u003eO. dancena\u003c/em\u003e through coordinated regulation of antioxidant defences, metabolic enzyme activity, gene expression, and hepatic architecture. Importantly, this study demonstrates the utility of \u003cem\u003eO. dancena\u003c/em\u003e as a marine model fish for mechanistic nutriphysiological studies. Much like zebrafish in freshwater systems, \u003cem\u003eO. dancena\u003c/em\u003e provides a tractable model where, mechanistic endpoints, rather than growth performance, can be investigated in detail. This positions \u003cem\u003eO. dancena\u003c/em\u003e as a valuable tool for exploring dietary strategies and functional bio-actives in marine contexts.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis study involving animals was approved by ICAR-CMFRI, Kochi, India, under the project \u003cem\u003eNutrition and Nutri-genomics Research in Mariculture and Marine Fisheries\u003c/em\u003e (MBT/NGM/24). All procedures were carried out in compliance with institutional guidelines and local legislation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;TST: Writing-original draft, Investigation, Formal analysis. CS: Writing-original draft, Conceptualization, Data curation, Supervision, Project Administration, Funding Acquisition. MA: Writing- review \u0026amp; editing, formal analysis. SH: Writing- review \u0026amp; editing, formal analysis. LP: Writing- review \u0026amp; editing, Project Administration. SE: Writing- review \u0026amp; editing. AHG: Writing- review \u0026amp; editing, Validation. NAS: Writing- review \u0026amp; editing, Formal Analysis. APG: Writing- review \u0026amp; editing. CP: Writing- review \u0026amp; editing. KC: Writing- review \u0026amp; editing, Resources.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the Indian Council of Agricultural Research (ICAR), Department of Agricultural Research and Education, Government of India. The authors express their sincere gratitude to the Director, ICAR\u0026ndash;Central Marine Fisheries Research Institute (CMFRI), Kochi, for providing the necessary facilities to carry out this work. The study was conducted under the institute project (MBT/NGM/24) funded by ICAR-Central Marine Fisheries Research Institute, which is gratefully acknowledged. The first author also acknowledges the Kerala University of Fisheries and Ocean Studies (KUFOS) for the award of master\u0026rsquo;s degree fellowship.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author(s) declare that financial support was received for the research, authorship and/or publication of this article. The work was performed under the project \u0026ldquo;\u003cem\u003eNutrition and Nutri-genomics Research in Mariculture and Marine Fisheries\u003c/em\u003e (MBT/NGM/24)\u0026rdquo; funded by ICAR-Central Marine Fisheries Research Institute.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that this research was conducted without any commercial or financial relationships that could be construed as potential conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbasubong, K. P., Jiang, G.-Z., Guo, H., Wang, X., Li, X.-F., Yan-zou, D., Liu, W., \u0026amp; Desouky, H. Eed. (2023). High-fat diet alters intestinal microbiota and induces endoplasmic reticulum stress via the activation of apoptosis and inflammation in blunt snout bream. \u003cem\u003eFish Physiology and Biochemistry\u003c/em\u003e, \u003cem\u003e49\u003c/em\u003e(6), 1079\u0026ndash;1095. https://doi.org/10.1007/s10695-023-01240-2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAebi, H. (1984). Catalase in vitro. \u003cem\u003eMethods in Enzymology\u003c/em\u003e, \u003cem\u003e105\u003c/em\u003e, 121\u0026ndash;126. https://doi.org/10.1016/s0076-6879(84)05016-3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAfzali-Kordmahalleh, A., \u0026amp; Meshkini, S. (2023). Effects of dietary resveratrol supplementation on digestive enzymes activities and serum biochemistry of rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). \u003cem\u003eVeterinary Research Forum\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(11), 625\u0026ndash;630. https://doi.org/10.30466/vrf.2023.560224.3650\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmpong, I., John Ikwuobe, O., Brown, J. E. P., Bailey, C. J., Gao, D., Gutierrez-Merino, J., \u0026amp; Griffiths, H. R. (2022). Odd chain fatty acid metabolism in mice after a high fat diet. \u003cem\u003eThe International Journal of Biochemistry \u0026amp; Cell Biology\u003c/em\u003e, \u003cem\u003e143\u003c/em\u003e, 106135. https://doi.org/10.1016/j.biocel.2021.106135\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAssini, J. M., Mulvihill, E. E., Burke, A. C., Sutherland, B. G., Telford, D. E., Chhoker, S. S., Sawyez, C. G., Drangova, M., Adams, A. C., Kharitonenkov, A., Pin, C. L., \u0026amp; Huff, M. W. (n.d.). \u003cem\u003eNaringenin Prevents Obesity, Hepatic Steatosis, and Glucose Intolerance in Male Mice Independent of Fibroblast Growth Factor 21\u003c/em\u003e. Retrieved October 16, 2015, from https://dx.doi.org/10.1210/en.2014-2003\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBojarski, B., Witeska, M., \u0026amp; Kondera, E. (2025). Blood Biochemical Biomarkers in Fish Toxicology\u0026mdash;A Review. \u003cem\u003eAnimals\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(7), 965. https://doi.org/10.3390/ani15070965\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrand-Williams, W., Cuvelier, M. E., \u0026amp; Berset, C. (1995). Use of a free radical method to evaluate antioxidant activity. \u003cem\u003eLWT - Food Science and Technology\u003c/em\u003e, \u003cem\u003e28\u003c/em\u003e(1), 25\u0026ndash;30. https://doi.org/10.1016/S0023-6438(95)80008-5\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai, J., Wen, H., Zhou, H., Zhang, D., Lan, D., Liu, S., Li, C., Dai, X., Song, T., Wang, X., He, Y., He, Z., Tan, J., \u0026amp; Zhang, J. (2023). Naringenin: A flavanone with anti-inflammatory and anti-infective properties. \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy\u003c/em\u003e, \u003cem\u003e164\u003c/em\u003e, 114990. https://doi.org/10.1016/j.biopha.2023.114990\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai, Z., Feng, S., Xiang, X., Mai, K., \u0026amp; Ai, Q. (2016). Effects of dietary phospholipid on lipase activity, antioxidant capacity and lipid metabolism-related gene expression in large yellow croaker larvae (\u003cem\u003eLarimichthys crocea\u003c/em\u003e). \u003cem\u003eComparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology\u003c/em\u003e, \u003cem\u003e201\u003c/em\u003e, 46\u0026ndash;52. https://doi.org/10.1016/j.cbpb.2016.06.007\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCavia-Saiz, M., Busto, M. D., Pilar-Izquierdo, M. C., Ortega, N., Perez-Mateos, M., \u0026amp; Mu\u0026ntilde;iz, P. (2010). Antioxidant properties, radical scavenging activity and biomolecule protection capacity of flavonoid naringenin and its glycoside naringin: A comparative study. \u003cem\u003eJournal of the Science of Food and Agriculture\u003c/em\u003e, \u003cem\u003e90\u003c/em\u003e(7), 1238\u0026ndash;1244. https://doi.org/10.1002/jsfa.3959\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, X., Niu, J., Wang, J., \u0026amp; Zhao, W. (2022). Effects of L-carnitine Supplementation in High-Fat Diet on Growth, Antioxidant Capacity and Lipid Metabolism of Golden Pompano (Trachinotus ovatus). \u003cem\u003eFrontiers in Marine Science\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e. https://doi.org/10.3389/fmars.2022.831153\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, Y.-F., Cao, K.-L., Huang, H.-F., Li, X.-Q., \u0026amp; Leng, X.-J. (2023). Dietary Effects of Lipid and Protein Levels on Growth, Feed Utilization, Lipid Metabolism, and Antioxidant Capacity of Triploid Rainbow Trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). \u003cem\u003eAquaculture Nutrition\u003c/em\u003e, \u003cem\u003e2023\u003c/em\u003e, 8325440. https://doi.org/10.1155/2023/8325440\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong, Y.-Z., Xia, T., Lin, J.-B., Wang, L., Song, K., \u0026amp; Zhang, C.-X. (2021). Quercetin Attenuates High-Fat Diet-Induced Excessive Fat Deposition of Spotted Seabass (\u003cem\u003eLateolabrax maculatus\u003c/em\u003e) Through the Regulatory for Mitochondria and Endoplasmic Reticulum. \u003cem\u003eFrontiers in Marine Science\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e. https://doi.org/10.3389/fmars.2021.746811\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDrapeau, G. R. (1976). Protease from \u003cem\u003eStaphyloccus aureus\u003c/em\u003e. \u003cem\u003eMethods in Enzymology\u003c/em\u003e, \u003cem\u003e45\u003c/em\u003e, 469\u0026ndash;475. https://doi.org/10.1016/s0076-6879(76)45041-3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEissa, E.-S. H., Khattab, M. S., Elbahnaswy, S., Elshopakey, G. E., Alamoudi, M. O., Alj\u0026agrave;rari, R. M., Munir, M. B., Kari, Z. A., \u0026amp; Naiel, M. A. E. (2024). The effects of dietary Spirulina platensis or curcumin nanoparticles on performance, body chemical composition, blood biochemical, digestive enzyme, antioxidant and immune activities of \u003cem\u003eOreochromis niloticus\u003c/em\u003e fingerlings. \u003cem\u003eBMC Veterinary Research\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(1), 215. https://doi.org/10.1186/s12917-024-04058-z\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElshopakey, G. E., Mahboub, H. H., Sheraiba, N. I., Abduljabbar, M. H., Mahmoud, Y. K., Abomughaid, M. M., \u0026amp; Ismail, A. K. (2023). Ammonia toxicity in Nile tilapia: Potential role of dietary baicalin on biochemical profile, antioxidant status and inflammatory gene expression. \u003cem\u003eAquaculture Reports\u003c/em\u003e, \u003cem\u003e28\u003c/em\u003e, 101434. https://doi.org/10.1016/j.aqrep.2022.101434\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFei, S., Xia, Y., Chen, Z., Liu, C., Liu, H., Han, D., ... \u0026amp; Xie, S. (2022). A high-fat diet alters lipid accumulation and oxidative stress and reduces the disease resistance of overwintering hybrid yellow catfish (\u003cem\u003ePelteobagrus fulvidraco\u003c/em\u003e♀\u0026times; \u003cem\u003eP. vachelli\u003c/em\u003e♂). \u003cem\u003eAquaculture Reports\u003c/em\u003e, \u003cem\u003e23\u003c/em\u003e, 101043.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao, J., Yuan, L., Jiang, H., Li, G., Zhang, Y., Zhou, R., Xian, W., Zou, Y., Du, Q., \u0026amp; Zhou, X. (2024). Naringenin modulates oxidative stress and lipid metabolism: Insights from network pharmacology, mendelian randomization, and molecular docking. \u003cem\u003eFrontiers in Pharmacology\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e, 1448308. https://doi.org/10.3389/fphar.2024.1448308\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGe, Y., Zhang, L., Chen, W., Sun, M., Liu, W., \u0026amp; Li, X. (2023). Resveratrol Modulates the Redox Response and Bile Acid Metabolism to Maintain the Cholesterol Homeostasis in Fish Megalobrama amblycephala Offered a High-Carbohydrate Diet. \u003cem\u003eAntioxidants\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(1), Article 1. https://doi.org/10.3390/antiox12010121\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlencross, B. D. (2009). Exploring the nutritional demand for essential fatty acids by aquaculture species. \u003cem\u003eReviews in aquaculture\u003c/em\u003e, \u003cem\u003e1\u003c/em\u003e(2), 71\u0026ndash;124.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoldwasser, J., Cohen, P. Y., Yang, E., Balaguer, P., Yarmush, M. L., \u0026amp; Nahmias, Y. (2010). Transcriptional Regulation of Human and Rat Hepatic Lipid Metabolism by the Grapefruit Flavonoid Naringenin: Role of PPARα, PPARγ and LXRα. \u003cem\u003ePLOS ONE\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e(8), e12399. https://doi.org/10.1371/journal.pone.0012399\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGora, A. H., Rehman, S., Dias, J., Fernandes, J. M., Olsvik, P. A., S\u0026oslash;rensen, M., \u0026amp; Kiron, V. (2023). Protective mechanisms of a microbial oil against hypercholesterolemia: evidence from a zebrafish model. \u003cem\u003eFrontiers in Nutrition\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 1161119.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHua, Y. Q., Zeng, Y., Xu, J., \u0026amp; Xu, X. L. (2021). Naringenin alleviates nonalcoholic steatohepatitis in middle-aged Apoe-/-mice: Role of SIRT1. \u003cem\u003ePhytomedicine: International Journal of Phytotherapy and Phytopharmacology\u003c/em\u003e, \u003cem\u003e81\u003c/em\u003e, 153412. https://doi.org/10.1016/j.phymed.2020.153412\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInoue, M., Ohtake, T., Motomura, W., Takahashi, N., Hosoki, Y., Miyoshi, S., Suzuki, Y., Saito, H., Kohgo, Y., \u0026amp; Okumura, T. (2005). Increased expression of PPARgamma in high fat diet-induced liver steatosis in mice. \u003cem\u003eBiochemical and Biophysical Research Communications\u003c/em\u003e, \u003cem\u003e336\u003c/em\u003e(1), 215\u0026ndash;222. https://doi.org/10.1016/j.bbrc.2005.08.070\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJafari, S., Akhavan-Bahabadi, M., Shekarabi, S. P. H., Mehrgan, M. S., Lowen, E., Lotfi, K., \u0026amp; Azari, A. (2025). Astaxanthin-rich Nannochloropsis oculata mitigates high-fat diet-induced liver dysfunction in zebrafish by modulating lipid metabolism and oxidative stress. \u003cem\u003eScientific Reports\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(1), 28862. https://doi.org/10.1038/s41598-025-13642-8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJagannivasan, A., Gopakumar, S. T., Sharma S R, K., Suresh, G., Raveendranathan, D. N., Peter, R., Gop, A. P., \u0026amp; Achamveetil, G. (2024). Profiling the antioxidant biomarkers in marine fish larvae: A comparative assessment of different storage conditions to select the optimal strategy. \u003cem\u003eFish Physiology and Biochemistry\u003c/em\u003e, \u003cem\u003e50\u003c/em\u003e(2), 557\u0026ndash;574. https://doi.org/10.1007/s10695-023-01290-6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJasim, S. A., Al-Mosawi, R. H., Khalikov, K., Abdelbasset, W. K., Ahmad, I., Shoukat, S., Jawad, M. A., Hafsan, H., Mustafa, Y. F., \u0026amp; Norbakhsh, M. (2022). Dietary quercetin improved growth, body composition, haematology, immunity and resistance to Aeromonas hydrophila infection in common carp (Cyprinus carpio). \u003cem\u003eAquaculture Research\u003c/em\u003e, \u003cem\u003e53\u003c/em\u003e(18), 6910\u0026ndash;6920. https://doi.org/10.1111/are.16156\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeon, S.-M., Kim, H. K., Kim, H.-J., Do, G.-M., Jeong, T.-S., Park, Y. B., \u0026amp; Choi, M.-S. (2007). Hypocholesterolemic and antioxidative effects of naringenin and its two metabolites in high-cholesterol fed rats. \u003cem\u003eTranslational Research\u003c/em\u003e, \u003cem\u003e149\u003c/em\u003e(1), 15\u0026ndash;21. https://doi.org/10.1016/j.trsl.2006.08.001\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJia, R., Cao, L.-P., Du, J.-L., He, Q., Gu, Z.-Y., Jeney, G., Xu, P., \u0026amp; Yin, G.-J. (2020). Effects of high-fat diet on antioxidative status, apoptosis and inflammation in liver of tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) via Nrf2, TLRs and JNK pathways. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e104\u003c/em\u003e, 391\u0026ndash;401. https://doi.org/10.1016/j.fsi.2020.06.025\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin, H., Yan, C., Xiao, T., Yan, N., Xu, J., Zhou, L., Zhou, X., Shao, Q., \u0026amp; Xia, S. (2018). High fish oil diet promotes liver inflammation and activates the complement system. \u003cem\u003eMolecular Medicine Reports\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(5), 6852\u0026ndash;6858. https://doi.org/10.3892/mmr.2018.8687\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin, M., Pan, T., Tocher, D. R., Betancor, M. B., Monroig, \u0026Oacute;., Shen, Y., Zhu, T., Sun, P., Jiao, L., \u0026amp; Zhou, Q. (2019). Dietary choline supplementation attenuated high-fat diet-induced inflammation through regulation of lipid metabolism and suppression of NFκB activation in juvenile black seabream (\u003cem\u003eAcanthopagrus schlegelii\u003c/em\u003e). \u003cem\u003eJournal of Nutritional Science\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e, e38. https://doi.org/10.1017/jns.2019.34\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJump, D. B. (2002). The Biochemistry of n-3 Polyunsaturated Fatty Acids. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e, \u003cem\u003e277\u003c/em\u003e(11), 8755\u0026ndash;8758. https://doi.org/10.1074/jbc.R100062200\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, J. M., Kim, H. G., \u0026amp; Son, C. G. (2018). Tissue-Specific Profiling of Oxidative Stress-Associated Transcriptome in a Healthy Mouse Model. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, \u003cem\u003e19\u003c/em\u003e(10), 3174. https://doi.org/10.3390/ijms19103174\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar, S., \u0026amp; Pandey, A. K. (2013). Chemistry and Biological Activities of Flavonoids: An Overview. \u003cem\u003eThe Scientific World Journal\u003c/em\u003e, \u003cem\u003e2013\u003c/em\u003e(1), 162750. https://doi.org/10.1155/2013/162750\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKwon, H. Y., Choi, S. Y., Won, M. H., Kang, T., \u0026amp; Kang, J. H. (2000). Oxidative modification and inactivation of Cu, Zn-superoxide dismutase by 2,2\u0026rsquo;-azobis(2-amidinopropane) dihydrochloride. \u003cem\u003eBiochimica Et Biophysica Acta\u003c/em\u003e, \u003cem\u003e1543\u003c/em\u003e(1), 69\u0026ndash;76. https://doi.org/10.1016/s0167-4838(00)00197-7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, F., Qu, Y.-K., Geng, C., Wang, A.-M., Zhang, J.-H., Chen, K.-J., Liu, B., Tian, H.-Y., Yang, W.-P., \u0026amp; Yu, Y.-B. (2020). Effects of hesperidin on the growth performance, antioxidant capacity, immune responses and disease resistance of red swamp crayfish (\u003cem\u003eProcambarus clarkii\u003c/em\u003e). \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e99\u003c/em\u003e, 154\u0026ndash;166. https://doi.org/10.1016/j.fsi.2020.02.014\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLowry, OliverH., Rosebrough, NiraJ., Farr, A. L., \u0026amp; Randall, RoseJ. (1951). Protein measurement with the folin phenol reagent. \u003cem\u003eJournal of Biological Chemistry\u003c/em\u003e, \u003cem\u003e193\u003c/em\u003e(1), 265\u0026ndash;275. https://doi.org/10.1016/S0021-9258(19)52451-6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu, S., Wang, C., Liu, Y., Liu, B., Zhang, Y., Shi, H., Xu, G., Han, S., \u0026amp; Liu, H. (2024). Effects of Dietary Fish Oil Levels on Growth Performance, Lipid Metabolism, Hepatic Health, Nonspecific Immune Response, and Intestinal Microbial Community of Juvenile Amur Grayling (\u003cem\u003eThymallus grubii\u003c/em\u003e). \u003cem\u003eAquaculture Nutrition\u003c/em\u003e, \u003cem\u003e2024\u003c/em\u003e(1), 8587410. https://doi.org/10.1155/anu/8587410\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMacusi, E. D., Cayacay, M. A., Borazon, E. Q., Sales, A. C., Habib, A., Fadli, N., \u0026amp; Santos, M. D. (2023). Protein Fishmeal Replacement in Aquaculture: A Systematic Review and Implications on Growth and Adoption Viability. \u003cem\u003eSustainability\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(16), Article 16. https://doi.org/10.3390/su151612500\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMariselvammurugan, A. (2025). Effects of salinity variation on hepatic lipid morphology, muscle fatty acid profile, and expression of metabolic and osmoregulatory genes in Indian ricefish, Oryzias dancena (Master\u0026rsquo;s thesis). Kerala University of Fisheries and Ocean Studies (KUFOS), Kerala, India.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMehranfard, N., Ghasemi, M., Rajabian, A., \u0026amp; Ansari, L. (2023). Protective potential of naringenin and its nanoformulations in redox mechanisms of injury and disease. \u003cem\u003eHeliyon\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(12), e22820. https://doi.org/10.1016/j.heliyon.2023.e22820\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMisra, H. P., \u0026amp; Fridovich, I. (1977). Superoxide dismutase: A photochemical augmentation assay. \u003cem\u003eArchives of Biochemistry and Biophysics\u003c/em\u003e, \u003cem\u003e181\u003c/em\u003e(1), 308\u0026ndash;312. https://doi.org/10.1016/0003-9861(77)90509-4\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiyamoto, Y., Koh, Y. H., Park, Y. S., Fujiwara, N., Sakiyama, H., Misonou, Y., Ookawara, T., Suzuki, K., Honke, K., \u0026amp; Taniguchi, N. (2003). Oxidative stress caused by inactivation of glutathione peroxidase and adaptive responses. \u003cem\u003eBiological Chemistry\u003c/em\u003e, \u003cem\u003e384\u003c/em\u003e(4), 567\u0026ndash;574. https://doi.org/10.1515/BC.2003.064\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMulvihill, E. E., Assini, J. M., Sutherland, B. G., DiMattia, A. S., Khami, M., Koppes, J. B., Sawyez, C. G., Whitman, S. C., \u0026amp; Huff, M. W. (2010). Naringenin decreases progression of atherosclerosis by improving dyslipidemia in high-fat-fed low-density lipoprotein receptor-null mice. \u003cem\u003eArteriosclerosis, Thrombosis, and Vascular Biology\u003c/em\u003e, \u003cem\u003e30\u003c/em\u003e(4), 742\u0026ndash;748. https://doi.org/10.1161/ATVBAHA.109.201095\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaiel, M. A. E., Negm, S. S., Ghazanfar, S., Shukry, M., \u0026amp; Abdelnour, S. A. (2023). The risk assessment of high-fat diet in farmed fish and its mitigation approaches: A review. \u003cem\u003eJournal of Animal Physiology and Animal Nutrition\u003c/em\u003e, \u003cem\u003e107\u003c/em\u003e(3), 948\u0026ndash;969. https://doi.org/10.1111/jpn.13759\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakamura, M. T., \u0026amp; Nara, T. Y. (2004). Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases. \u003cem\u003eAnnual Review of Nutrition\u003c/em\u003e, \u003cem\u003e24\u003c/em\u003e, 345\u0026ndash;376. https://doi.org/10.1146/annurev.nutr.24.121803.063211\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNational Research Council, Division on Earth, Life Studies, Committee on the Nutrient Requirements of Fish, \u0026amp; Shrimp. (2011). \u003cem\u003eNutrient requirements of fish and shrimp\u003c/em\u003e. National academies press.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNayak, S., Yogev, U., Kpordzaxor, Y., Zhu, Z., Gur, N., Gross, A., \u0026amp; Zilberg, D. (2023). From fish excretions to high-protein dietary ingredient: Feeding intensively cultured barramundi (\u003cem\u003eLates calcarifer\u003c/em\u003e) a diet containing microbial biomass (biofloc) from effluent of an aquaculture system. \u003cem\u003eAquaculture\u003c/em\u003e, \u003cem\u003e562\u003c/em\u003e, 738780. https://doi.org/10.1016/j.aquaculture.2022.738780\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNguyen, P., Leray, V., Diez, M., Serisier, S., Le Bloc\u0026rsquo;h, J., Siliart, B., \u0026amp; Dumon, H. (2008). Liver lipid metabolism. \u003cem\u003eJournal of Animal Physiology and Animal Nutrition\u003c/em\u003e, \u003cem\u003e92\u003c/em\u003e(3), 272\u0026ndash;283. https://doi.org/10.1111/j.1439-0396.2007.00752.x\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNogueda Torres, E., \u0026amp; Lazo, J. P. (2024). The effect of protein to lipid ratios on growth, digestibility, and feed utilization of striped bass (\u003cem\u003eMorone saxatilis\u003c/em\u003e) raised in seawater at 21\u0026deg;C. \u003cem\u003eAquaculture International\u003c/em\u003e, \u003cem\u003e32\u003c/em\u003e(7), 9853\u0026ndash;9872. https://doi.org/10.1007/s10499-024-01639-5\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOhkawa, H., Ohishi, N., \u0026amp; Yagi, K. (1979). Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. \u003cem\u003eAnalytical Biochemistry\u003c/em\u003e, \u003cem\u003e95\u003c/em\u003e(2), 351\u0026ndash;358. https://doi.org/10.1016/0003-2697(79)90738-3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePanche, A. N., Diwan, A. D., \u0026amp; Chandra, S. R. (2016). Flavonoids: An overview. \u003cem\u003eJournal of Nutritional Science\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e, e47. https://doi.org/10.1017/jns.2016.41\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaul, B. N., Chowdhury, D., Das, A., Mandal, R. N., Singh, P., Adhikari, S., Chakrabarti, P. P., Giri, S. S., \u0026amp; Ghosh, K. (2021). Effect of dietary lipid levels on growth, body composition, and enzyme activities of larvae of butter catfish, \u003cem\u003eOmpok bimaculatus\u003c/em\u003e (Actinopterygii: Siluriformes: Siluridae). \u003cem\u003eActa Ichthyologica et Piscatoria\u003c/em\u003e, \u003cem\u003e51\u003c/em\u003e, 289\u0026ndash;298. https://doi.org/10.3897/aiep.51.67079\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT\u0026ndash;PCR. Nucleic acids research, 29(9), e45-e45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrieto, P., Pineda, M., \u0026amp; Aguilar, M. (1999). Spectrophotometric quantitation of antioxidant capacity through the formation of a phosphomolybdenum complex: Specific application to the determination of vitamin E. \u003cem\u003eAnalytical Biochemistry\u003c/em\u003e, \u003cem\u003e269\u003c/em\u003e(2), 337\u0026ndash;341. https://doi.org/10.1006/abio.1999.4019\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiao, L., Men, L., Yu, S., Yao, J., Li, Y., Wang, M., Yu, Y., Wang, N., Ran, L., Wu, Y., \u0026amp; Du, J. (2022). Hepatic deficiency of selenoprotein S exacerbates hepatic steatosis and insulin resistance. \u003cem\u003eCell Death \u0026amp; Disease\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(3), 275. https://doi.org/10.1038/s41419-022-04716-w\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRanjan, R., Anil, M. K., Ambarish, G. P., Megarajan, S., Xavier, B., Ghosh, S., Gomathi, P., Raju, B., Anand, V., \u0026amp; Gopalakrishnan, A. (2022). Protocol developed for the hatchery production of marine model fish \u003cem\u003eOryzias dancena\u003c/em\u003e (Hamilton, 1822). \u003cem\u003eMarine Fisheries Information Service; Technical and Extension Series\u003c/em\u003e, \u003cem\u003e254\u003c/em\u003e, 32\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRashmi, R., Bojan Magesh, S., Mohanram Ramkumar, K., Suryanarayanan, S., \u0026amp; Venkata SubbaRao, M. (2018). Antioxidant Potential of Naringenin Helps to Protect Liver Tissue from Streptozotocin-Induced Damage. \u003cem\u003eReports of Biochemistry \u0026amp; Molecular Biology\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(1), 76\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRe, R., Pellegrini, N., Proteggente, A., Pannala, A., Yang, M., \u0026amp; Rice-Evans, C. (1999). Antioxidant activity applying an improved ABTS radical cation decolorization assay. \u003cem\u003eFree Radical Biology \u0026amp; Medicine\u003c/em\u003e, \u003cem\u003e26\u003c/em\u003e(9\u0026ndash;10), 1231\u0026ndash;1237. https://doi.org/10.1016/s0891-5849(98)00315-3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRick, W., \u0026amp; Stegbauer, H. P. (1974). α-Amylase Measurement of Reducing Groups. In H. U. Bergmeyer (Ed.), \u003cem\u003eMethods of Enzymatic Analysis (Second Edition)\u003c/em\u003e (pp. 885\u0026ndash;890). Academic Press. https://doi.org/10.1016/B978-0-12-091302-2.50074-8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoy, A., Khan, A., Ahmad, I., Alghamdi, S., Rajab, B. S., Babalghith, A. O., Alshahrani, M. Y., Islam, S., \u0026amp; Islam, M. R. (2022). Flavonoids a Bioactive Compound from Medicinal Plants and Its Therapeutic Applications. \u003cem\u003eBioMed Research International\u003c/em\u003e, \u003cem\u003e2022\u003c/em\u003e, 5445291. https://doi.org/10.1155/2022/5445291\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalehi, B., Fokou, P. V. T., Sharifi-Rad, M., Zucca, P., Pezzani, R., Martins, N., \u0026amp; Sharifi-Rad, J. (2019). The Therapeutic Potential of Naringenin: A Review of Clinical Trials. \u003cem\u003ePharmaceuticals (Basel, Switzerland)\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(1), 11. https://doi.org/10.3390/ph12010011\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelvam, C., Saito, T., Sissener, N. H., Philip, A. J. P., \u0026amp; S\u0026aelig;le, \u0026Oslash;. (2022). Intracellular trafficking of fatty acids in the fish intestinal epithelial cell line RTgutGC. \u003cem\u003eFrontiers in Marine Science\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e. https://doi.org/10.3389/fmars.2022.954773\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen, Y., Zhao, W., Monroig, \u0026Oacute;., Bao, Y., Zhu, T., Jiao, L., ... \u0026amp; Jin, M. (2023). High-fat-diet induced inflammation and apoptosis via activation of Ire1α in liver and hepatocytes of black seabream (\u003cem\u003eAcanthopagrus schlegelii\u003c/em\u003e). \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e143\u003c/em\u003e, 109212.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiddiqua, K. S., \u0026amp; Khan, M. A. (2022). Effects of dietary lipid levels on growth, feed utilization, RNA/DNA ratio, digestive tract enzyme activity, non-specific immune response and optimum inclusion in feeds for fingerlings of rohu, \u003cem\u003eLabeo rohita\u003c/em\u003e (Hamilton). \u003cem\u003eAquaculture\u003c/em\u003e, \u003cem\u003e554\u003c/em\u003e, 738114. https://doi.org/10.1016/j.aquaculture.2022.738114\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiddiqui, N., Rauf, A., Latif, A., \u0026amp; Mahmood, Z. (2017). Spectrophotometric determination of the total phenolic content, spectral and fluorescence study of the herbal Unani drug Gul-e-Zoofa (\u003cem\u003eNepeta bracteata\u003c/em\u003e Benth). \u003cem\u003eJournal of Taibah University Medical Sciences\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(4), 360\u0026ndash;363. https://doi.org/10.1016/j.jtumed.2016.11.006\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSikorski, P. M., Commodaro, A. G., \u0026amp; Grigg, M. E. (2021). A Protective and Pathogenic Role for Complement During Acute Toxoplasma gondii Infection. \u003cem\u003eFrontiers in Cellular and Infection Microbiology\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e. https://doi.org/10.3389/fcimb.2021.634610\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingleton, V. L., Orthofer, R., \u0026amp; Lamuela-Ravent\u0026oacute;s, R. M. (1999). [14] Analysis of total phenols and other oxidation substrates and antioxidants by means of folin-ciocalteu reagent. In \u003cem\u003eMethods in Enzymology\u003c/em\u003e (Vol. 299, pp. 152\u0026ndash;178). Academic Press. https://doi.org/10.1016/S0076-6879(99)99017-1\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTocher, D. R. (2010). Fatty acid requirements in ontogeny of marine and freshwater fish. \u003cem\u003eAquaculture research\u003c/em\u003e, \u003cem\u003e41\u003c/em\u003e(5), 717\u0026ndash;732.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrenzado, C. E., Carmona, R., Merino, R., Garc\u0026iacute;a-Gallego, M., Furn\u0026eacute;, M., Domezain, A., \u0026amp; Sanz, A. (2018). Effect of dietary lipid content and stocking density on digestive enzymes profile and intestinal histology of rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). \u003cem\u003eAquaculture\u003c/em\u003e, \u003cem\u003e497\u003c/em\u003e, 10\u0026ndash;16. https://doi.org/10.1016/j.aquaculture.2018.07.031\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurchini, G. M., Torstensen, B. E., \u0026amp; Ng, W. K. (2009). Fish oil replacement in finfish nutrition. \u003cem\u003eReviews in aquaculture\u003c/em\u003e, \u003cem\u003e1\u003c/em\u003e(1), 10\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVranković, J. S., Stanković, M. B., \u0026amp; Marković, Z. Z. (2021). Levels of antioxidant enzyme activities in cultured rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) fed with different diet compositions. \u003cem\u003eBulletin of the European Association of Fish Pathologists\u003c/em\u003e, \u003cem\u003e41\u003c/em\u003e(4), 135\u0026ndash;145. https://doi.org/10.48045/001c.31752\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, L.-H., Zeng, X.-A., Wang, M.-S., Brennan, C. S., \u0026amp; Gong, D. (2018). Modification of membrane properties and fatty acids biosynthesis-related genes in \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eStaphylococcus aureus\u003c/em\u003e: Implications for the antibacterial mechanism of naringenin. \u003cem\u003eBiochimica et Biophysica Acta (BBA) - Biomembranes\u003c/em\u003e, \u003cem\u003e1860\u003c/em\u003e(2), 481\u0026ndash;490. https://doi.org/10.1016/j.bbamem.2017.11.007\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Q., Ou, Y., Hu, G., Wen, C., Yue, S., Chen, C., Xu, L., Xie, J., Dai, H., Xiao, H., Zhang, Y., \u0026amp; Qi, R. (2020). Naringenin attenuates non-alcoholic fatty liver disease by down-regulating the NLRP3/NF-κB pathway in mice. \u003cem\u003eBritish Journal of Pharmacology\u003c/em\u003e, \u003cem\u003e177\u003c/em\u003e(8), 1806\u0026ndash;1821. https://doi.org/10.1111/bph.14938\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Y., Yu, Y., Wang, Q., Wei, S., Wang, S., Qin, Q., \u0026amp; Yang, M. (2019). PPAR-δ of orange-spotted grouper exerts antiviral activity against fish virus and regulates interferon signaling and inflammatory factors. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e94\u003c/em\u003e, 38\u0026ndash;49. https://doi.org/10.1016/j.fsi.2019.08.068\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWinkler, U. K., \u0026amp; Stuckmann, M. (1979). Glycogen, hyaluronate, and some other polysaccharides greatly enhance the formation of exolipase by \u003cem\u003eSerratia marcescens\u003c/em\u003e. \u003cem\u003eJournal of Bacteriology\u003c/em\u003e, \u003cem\u003e138\u003c/em\u003e(3), 663\u0026ndash;670. https://doi.org/10.1128/jb.138.3.663-670.1979\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, D., Li, J., Fan, Z., Wang, L., \u0026amp; Zheng, X. (2022). Resveratrol ameliorates oxidative stress, inflammatory response and lipid metabolism in common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e) fed with high-fat diet. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e. https://doi.org/10.3389/fimmu.2022.965954\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, D., Li, J., Fan, Z., Wang, L., \u0026amp; Zheng, X. (2022). Resveratrol ameliorates oxidative stress, inflammatory response and lipid metabolism in common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e) fed with high-fat diet. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e, 965954.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXin, Y., Hertle, E., van der Kallen, C. J. H., Schalkwijk, C. G., Stehouwer, C. D. A., \u0026amp; van Greevenbroek, M. M. J. (2018). Complement C3 and C4, but not their regulators or activated products, are associated with incident metabolic syndrome: The CODAM study. \u003cem\u003eEndocrine\u003c/em\u003e, \u003cem\u003e62\u003c/em\u003e(3), 617\u0026ndash;627. https://doi.org/10.1007/s12020-018-1712-3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan, Y., Omar, A. A., Emam, W., \u0026amp; Mohamed, R. A. (2025). Impact of dietary inclusion of bile acid and fat percent on growth, intestinal histomorphology, immune-physiological and transcriptomic responses of Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e). \u003cem\u003eOpen Veterinary Journal\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(1), 222\u0026ndash;243. https://doi.org/10.5455/OVJ.2025.v15.i1.21\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, D., Yan, Y., Tian, H., Jiang, G., Li, X., \u0026amp; Liu, W. (2018). Resveratrol supplementation improves lipid and glucose metabolism in high-fat diet-fed blunt snout bream. \u003cem\u003eFish Physiology and Biochemistry\u003c/em\u003e, \u003cem\u003e44\u003c/em\u003e(1), 163\u0026ndash;173. https://doi.org/10.1007/s10695-017-0421-9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Z.-Y., Limbu, S. M., Zhao, S.-H., Chen, L.-Q., Luo, Y., Zhang, M.-L., Qiao, F., \u0026amp; Du, Z.-Y. (2022). Dietary l-carnitine supplementation recovers the increased pH and hardness in fillets caused by high-fat diet in Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e). \u003cem\u003eFood Chemistry\u003c/em\u003e, \u003cem\u003e382\u003c/em\u003e, 132367. https://doi.org/10.1016/j.foodchem.2022.132367\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao, X., Chen, W., Zhang, Y., Gao, X., Huang, Y., Ren, H., Chang, K., Sun, P., \u0026amp; Gao, S. (2024). Dietary guar gum supplementation reduces the adverse effects of high-fat diets on the growth performance, antioxidant capacity, inflammation, and apoptosis of juvenile largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e). \u003cem\u003eAnimal Feed Science and Technology\u003c/em\u003e, \u003cem\u003e308\u003c/em\u003e, 115881. https://doi.org/10.1016/j.anifeedsci.2024.115881\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, J., Feng, P., Li, Y., Ji, H., \u0026amp; Gisbert, E. (2024). Effects of dietary lipid levels on lipid accumulation and health status of adult \u003cem\u003eOnychostoma macrolepis\u003c/em\u003e. \u003cem\u003eAquaculture and Fisheries\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(5), 795\u0026ndash;803. https://doi.org/10.1016/j.aaf.2023.07.008\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, Y.-L., Guo, J.-L., Tang, R.-J., Ma, H.-J., Chen, Y.-J., \u0026amp; Lin, S.-M. (2020). High dietary lipid level alters the growth, hepatic metabolism enzyme, and anti-oxidative capacity in juvenile largemouth bass \u003cem\u003eMicropterus salmoides\u003c/em\u003e. \u003cem\u003eFish Physiology and Biochemistry\u003c/em\u003e, \u003cem\u003e46\u003c/em\u003e(1), 125\u0026ndash;134. https://doi.org/10.1007/s10695-019-00705-7\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"fish-physiology-and-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fish","sideBox":"Learn more about [Fish Physiology and Biochemistry](https://www.springer.com/journal/10695)","snPcode":"10695","submissionUrl":"https://submission.nature.com/new-submission/10695/3","title":"Fish Physiology and Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Marine model fish, High-Fat Diet, Naringenin, lipid metabolism, Antioxidant Defence","lastPublishedDoi":"10.21203/rs.3.rs-8479933/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8479933/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHigh-fat diets (HFDs) are commonly used in aquaculture to enhance growth and reduce feed costs; however, prolonged feeding can induce oxidative stress, disrupt lipid metabolism, and impair physiological homeostasis. The present study evaluated the protective effects of naringenin (NGE) in the marine model fish \u003cem\u003eOryzias dancena\u003c/em\u003e fed a high-fat diet. Fish were fed one of four experimental diets for 45 days: a normal-fat diet (NFD, 8% crude lipid), a high-fat diet (HFD, 15% crude lipid), and HFD supplemented with 0.075% (HFD\u0026thinsp;+\u0026thinsp;N1) or 0.15% (HFD\u0026thinsp;+\u0026thinsp;N2) naringenin. Digestive enzyme activities, antioxidant status, lipid peroxidation, hepatic histology, and the expression of genes related to antioxidant defence, lipid metabolism, and immunity were assessed at the end of the feeding trial.\u003c/p\u003e \u003cp\u003eHFD feeding selectively modulated digestive enzyme activities, characterized by increased lipase activity and reduced amylase activity. Muscle superoxide dismutase (SOD) activity was significantly reduced in HFD-fed fish, while catalase (CAT) activity showed no significant change but followed a similar directional trend. In contrast, hepatic expression of sod and gpx was upregulated, indicating tissue-specific oxidative stress responses. Alanine aminotransferase (ALT) activity was significantly reduced in the HFD group, whereas aspartate aminotransferase (AST) activity remained statistically unchanged, although a comparable pattern was observed. SOD activityon with naringenin, particularly at 0.15%, restored muscle SOD activity, enhanced total antioxidant capacity, reduced lipid peroxidation, and partially restored ALT activity. At the molecular level, HFD feeding upregulated \u003cem\u003epparδ\u003c/em\u003e and suppressed \u003cem\u003efads2\u003c/em\u003e expression, indicative of lipid metabolic stress, which was modestly alleviated by naringenin supplementation. Histological analysis revealed pronounced hepatic lipid accumulation in HFD-fed fish, while naringenin supplementation significantly reduced hepatic vacuolation. Collectively, these findings demonstrate that dietary naringenin, particularly at 0.15%, mitigates HFD-induced oxidative stress and hepatic lipid accumulation in \u003cem\u003eOryzias dancena\u003c/em\u003e by enhancing antioxidant defence and modulating lipid metabolic pathways.\u003c/p\u003e","manuscriptTitle":"Dietary naringenin modulates antioxidant status and hepatic lipid deposition in marine medaka (Oryzias dancena) fed a high-fat diet","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-02 10:23:23","doi":"10.21203/rs.3.rs-8479933/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"30275191948119839628077432015369517829","date":"2026-05-08T05:34:33+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-02T13:22:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"311301081928468460415925353330524810259","date":"2026-01-31T10:50:06+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-29T09:38:42+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-27T19:29:56+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-31T05:55:15+00:00","index":"","fulltext":""},{"type":"submitted","content":"Fish Physiology and Biochemistry","date":"2025-12-30T09:41:25+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"fish-physiology-and-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fish","sideBox":"Learn more about [Fish Physiology and Biochemistry](https://www.springer.com/journal/10695)","snPcode":"10695","submissionUrl":"https://submission.nature.com/new-submission/10695/3","title":"Fish Physiology and Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"691e688f-b938-406c-9cd2-6407926fe4c1","owner":[],"postedDate":"February 2nd, 2026","published":true,"recentEditorialEvents":[{"type":"reviewerAgreed","content":"30275191948119839628077432015369517829","date":"2026-05-08T05:34:33+00:00","index":15,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-02-02T10:23:23+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-02 10:23:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8479933","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8479933","identity":"rs-8479933","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}