Macrolide Resistance in Streptococcus pyogenes from Tonsillitis Patients: Phenotypic Profiles, Resistance Genes, and Clinical Associations | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Macrolide Resistance in Streptococcus pyogenes from Tonsillitis Patients: Phenotypic Profiles, Resistance Genes, and Clinical Associations Elnaim Bushra Ahmed, Elsir Ali AbuGroun, Babiker Saad Almugadam, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7929845/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Streptococcal tonsillitis is a global health challenge. The current study aimed to determine the frequency of macrolide resistance phenotypes and genotypes in S. pyogenes and to examine the association between resistance genes and clinical factors. Method: From 2019 to 2021, 159 S. pyogenes strains were isolated from children with tonsillitis. The macrolide resistance phenotype was determined by performing a double-disk diffusion test according to the Clinical and Laboratory Standards Institute guidelines. PCR has detected macrolide resistance genes. Results : In this study, 31.4% (50/159) of S. pyogenes strains were macrolide-resistant. The resistance rate was higher in isolates from females (33.7%, 32/95) than in isolates from males (28.1%, 18/64), but this difference was not significant (P = 0.459). Our results revealed that macrolide-resistant S. pyogenes is associated with tonsil hyperemia and hyperplasia ( P =0.044). Based on the double-disk diffusion test, the frequencies of M phenotype, cMLSB, and iMLSB among isolates were 27% (43/159), 3% (5/159), and 1% (2/159), respectively. The amplification of genes showed that 11.9% (19/159) of the strains harbored ErmC and 4.4% (7/159) carried ErmB genes. In contrast, both ErmA and Mef A genes were not detected in S. pyogenes isolates. On regression analysis, macrolide resistance was associated with tonsil hyperemia and hyperplasia (AOR: 3.780, 95%CI:1.244-11.487, P =0.019).There was no significant variation in the rate of resistance phenotypes or in the ErmA and MefA genes among subjects’ characteristics or clinical data. Conclusion: This study provides insight into the epidemiology of macrolide resistance in S. pyogenes within the study area. Although the rate of resistance is considerable, the findings should be interpreted with caution due to the limited sample size and absence of DNA sequencing data. Broader, multicenter studies incorporating molecular sequencing and whole-genome analysis are recommended to clarify the genetic basis of macrolide resistance in S. pyogenes. Streptococcus pyogenes Macrolides ErmA MefA ErmB Figures Figure 1 Figure 2 1. Introduction Group A Streptococci (GAS) tonsillitis is a known infection caused by S. pyogenes (GAS) and is estimated to affect about 616 million people worldwide annually [1]. Penicillin (a β-lactam antibiotic) remains the drug of choice for the management of GAS infections. Macrolides and lincosamides are a choice for patients with β-lactam hypersensitivity [2]. Macrolide is a group of antibiotics composed of 16 (such as josamycin, spiramycin, and tylosin), 15 (such as azithromycin), or 14 (such as erythromycin and clarithromycin) membered lactones [3,4]. Erythromycin (ERY) is an active antimicrobial prescribed to treat S . pyogenes upper respiratory tract infections [5]. Azithromycin is the most commonly used macrolide due to its single-daily dosing and shorter course of therapy [6]. Clindamycin is a good option for the treatment of recurrent GAS infections and can be used to treat specific erythromycin-resistant S. pyogenes infections [2]. Antibiotic resistance is a global challenge. This rising problem threatens our competence to treat both human and animal infections [7,8]. Currently, macrolide resistance (MR) is widespread among clinical isolates [5,9]. The emergence of macrolide-resistant S. pyogenes strains has been reported worldwide, and recent reports indicate that macrolide-resistant GAS (MRGAS) is increasing at varying rates across geographic locations [10-12]. The MR rate was 32.8%, 40%, 98.4%, and 22.8% in Spain [13], Belgium [14], China [10], and Greece [11], respectively. In Japan, the MRGAS rate was 30%-40% [15]. Macrolide resistance usually results from one of two common mechanisms. The first mechanism involves the Mef genes, mainly Mef A, which encode an efflux pump that expels antibiotics from the cell and inhibits their binding to the ribosome [16-18]. The second mechanism involves the ( ErmA , ErmB ) genes, which encode methylases targeting 23S rRNA [19,20], thereby interfering with the binding of macrolides to their targets on the rRNA (MLS B phenotype). The MLS B phenotype can be induced by Macrolide, lincosamide, and streptogramin B (iMLSB phenotype) or constitutive Macrolide, lincosamide, and streptogramin B (cMLS B phenotype). Other mechanisms of MR occur due to mutations in the 23S rRNA gene and/or changes in riboproteins L4 and L22 [3]. Furthermore, Erythromycin resistance can occur through phosphorylation, which causes structural modification of erythromycin, glycosylation, and lactone ring breakdown by erythromycin esterase [21-23]. The global efforts to combat antimicrobial resistance are affected by several challenges, including the prescription and overuse of antibiotics in animal food and agriculture [23]. Delaying or failure to treat Streptococcus tonsillitis can lead to post-streptococcal complications, including glomerulonephritis and rheumatic heart disease [21]. The MRGAS rate is poorly understood in Sudan, especially in White Nile state, and, to our knowledge, this is the first study on MR in White Nile state. Understanding the MRGAS (phenotypes and molecular genotypes) is critical for epidemiology, therapy, and control of GAS tonsillitis. The current study was undertaken to examine MR phenotypes and genotypes in S. pyogenes isolates from Sudanese individuals with clinical tonsillitis and to determine the association between resistance genes and clinical factors. 2. Materials and Methods 2.1. Study design, area, and duration A cross-sectional hospital-based study was carried out in Kosti Teaching Hospital throughout 2019-2021 to identify the rate of MR in S. pyogenes isolated from tonsillitis patients. The hospital in the study area is located in Kosti, White Nile State. It provides services to most of the people of the White Nile state, especially the population of the Kosti locality. 2.2. Inclusion and exclusion criteria The targeted subjects were children aged 5-15 years with symptomatic tonsillitis. The study included subjects who attended the Ear, Nose, and Throat (ENT) unit at Kosti Teaching Hospital. For every subject, the ENT consultant did the physical examination and obtained the clinical history. The study excluded subjects who had a history of respiratory surgery, chemotherapy, radiotherapy, or autoimmune disease. To enhance GAS recovery and avoid the effect of antibiotic use on bacterial detection by culture, throat swabs were collected only from subjects with no recent medical history of antibiotic use at least 7 days prior [24,25]. Data were collected using a pre-tested questionnaire that included the participant’s information (such as residence and gender) and clinical data, including sore throat and tonsillar hyperplasia (enlargement). 2.3. Laboratory analysis A throat swab was collected from each participant and cultured to isolate GAS. Next, all the isolated S. pyogenes were screened for macrolide resistance. Then, each isolate was screened for macrolide resistance, and those that tested positive were tested for the MR phenotype. Next, all macrolide resistance isolates were screened for macrolide resistance genes by PCR using primers targeting MefA , ErmA , ErmB , and ErmC . To maintain the viability of isolates for PCR, the preservation of isolates was done aseptically by adding 2-3 loop-full of the pure isolates to one ml of brain heart infusion broth (HiMedia, India) containing 15% glycerol (The media was prepared in a micro-centrifuge tube) and preserved at -20 º C until further analysis [26]. 2.3.1. Isolation and identification of bacteria Three hundred eighty-four throat swabs were collected from patients with tonsil infection (tonsillitis). The specimens were obtained from patients in the ENT unit at Kosti Teaching Hospital. Under good light, the throat specimen was collected by using a swab and a tongue depressor. All samples were cultured on 5% sheep blood agar (HiMedia, India) and incubated aerobically at 37 °C overnight. The isolate was identified based on culture characters (colonial morphology, such as colony size), Gram stain results (Gram reaction, shape, and arrangement of bacteria), and conventional biochemical tests [27], including catalase and bacitracin susceptibility tests (0.05 U bacitracin, HiMedia, India). S. aureus ATCC (American Type Culture Collection) 25922 and S. pyogenes ATCC 19615 were used as control strains. 2.3.2. Phenotypic detection of macrolide resistant For phenotypic detection of macrolide resistance, each isolate was tested by disc diffusion using clindamycin (AD2 µg), erythromycin (E15 µg), and azithromycin (AZM 15 µg). The test was done based on the Clinical and Laboratory Standards Institute (CLSI) guidelines 2018. Briefly, suspensions of each test organism equivalent to 0.5 McFarland standards were prepared in physiological saline and inoculated onto Mueller-Hinton-based blood agar (HiMedia, India) using a cotton swab. Following overnight incubation at 37ºC, each S. pyogenes isolates showing decreased potential for one or more macrolides were classified as resistant strains [20,28]. The double-disk diffusion test determined the MR phenotype. Briefly, the test organism turbidity (Equivalent to 0.5 McFarland standards turbidity) was prepared in physiological saline. Next, the test organism turbidity was inoculated into Muller-Hinton-based blood agar (HiMedia, India) using a sterile cotton swab. Using sterile forceps, the clindamycin (AD 2 µg) and erythromycin (E15 µg) discs were placed into the inoculated plate, with 15 mm spacing between them as recommended by the CLSI guidelines 2018 [20,28]. Following overnight incubation at 37ºC, the ruler read the inhibition zone, and the result was stated and interpreted as follows: An erythromycin-resistant, clindamycin-susceptible strain without a D-shaped zone of inhibition surrounding the clindamycin disc was reported as an M phenotype. cMLS B resistance phenotype was indicated by resistance to erythromycin and clindamycin together. In contrast, the iMLSB resistance phenotype was indicated by sensitivity to clindamycin, with a D-shaped zone of inhibition [20,28]. S. aureus ATCC25922 and S. pyogenes ATCC19615 were used as control strains. 2.3.3. Molecular detection of macrolide resistance genes Genotypic characterization of macrolide resistance genes was performed using polymerase chain reaction (PCR). In DNA extraction, colonies of macrolide-resistant S. pyogenes were suspended in 1ml NaCl. DNA extraction was done by a commercial spin column DNA extraction kit (TaKara MiniBEST Bacteria Genomic DNA Extraction Kit Ver. 3.0 Cat. #9763 v201309 Da: China) according to company guidelines [29]. The extracted DNA was electrophoresed on a 1% agarose gel to assess its quality. Table1 presents the list of primers (Intron –Korea) that were used to amplify the targeted genes ( MefA, ErmA, ErmB , and ErmC ), which link to macrolide resistance [30-32]. For amplification of each gene by PCR, a 25 µL PCR mixture containing 3 µL of template DNA, 1 µL of each primer, 5 µL of Taq PCR Master Mix (Intron-Korea), and 15 µL of nuclease-free water was used. Gene amplification was performed using a PCR machine (Prime – England). PCR reaction was initiated with an initial heat denaturation at 94ºC for 60 seconds, followed by 30 cycles of denaturation at 94ºC for 30 seconds, primer annealing ( ErmA at 55ºC, ErmB at 54ºC, ErmC at 58ºC, MefA at 55ºC) for 30 seconds, and extension at 72ºC for 60 seconds. The final extension step was performed at 72ºC for 10 minutes [30-32]. For each gene, the PCR product was run on an agarose gel using agarose Gel electrophoresis. Briefly, 5 µL of each PCR product was separated on a 1.5% agarose gel by electrophoresis at 120 V (using 1x TBE running buffer) for 60 minutes. Next, the gel was stained with 2 µL ethidium bromide (2 g/mL) (Sigma, USA). Finally, the DNA bands were viewed using the UVP BioDoc-It digital imaging system. The DNA ladder (100 bp, Intron-Korea) was used in every run. Table 1: List of (F: forward, R: reverse) primers and PCR products Primer Sequence (5′ to 3′) Annealing temperature (°C) Size of PCR product (bp) referances ErmA F AGAAGGTTATAATGAAACAGA 55 210 [30-32] R GGCATGACATAAACCTTCAT ErmB F GAAAAGGTACTCAACCAAATA 54 640 R AGTAACGGTACTTAAATTGTTTAC ErmC F GCTAATATTGTTTAAATCGTCAATTC 58 572 R GGATCAGGAAAAGAACATTTTAC MefA F AGTATCATTAATCACTAGTGC 55 350 R TTCTTCTGGTACTAAAAGTGG 2.4. Data analysis The data from the present study were analmacrolide susceptibilityackage for the Social Sciences (SPSS version 21 (SPSS Statistics 21, IBM Corp., Armonk, N.Y., USA), and the results were presented in figures and tables. The Fisher's Exact Test, Pearson Chi-Square, and Chi-Square Continuity Correction were used in data analysis. Association was assessed using binary (Unadjusted Odds ratio) and multinomial (Adjusted Odds ratio) logistic regression. GraphPad Prism version 8.0.2 (263) was used to display the figures. P˂0.05 was specified as a significant value. 3. Results and Discussion 3.1. Results Of 384 throat swabs, only 159 were positive for GAS by culture, representing 41.4% of the total. Thus, the current work was carried out in 159 GAS isolated from the throat of children with an age range from five to sixteen years old. The mean age of children with clinical indications of streptococcal tonsillitis was 9.0±3.0 years. The distribution of GAS isolates across age groups, gender, residence, and education levels is summarized in Table 2 . The study participants include 64 males (40.3%) and 95 females (59.7%). The most frequent age group was 5-10 years (69.2%, 110/159). Moreover, urbanized children accounted for 78% of study subjects, and those in rural areas had a lower frequency (22%) compared to urban residents. Almost 65.4% of cases are at a primary school education level. Regarding the clinical features of tonsillitis, fever and sore throat were observed in all participants, while tonsil hyperemia and hyperplasia were observed in 80.5% (128/159) of cases. Other clinical findings, interestingly, lymphadenopathy was seen in 47.8% (76/159) of subjects with GAS tonsillitis ( Table 2 ). In this study, all isolates were tested for macrolide susceptibility using the disc diffusion method. 31.4% (50/159) of GAS strains were positive for macrolide resistance. The double disk diffusion test revealed that the frequencies of M phenotype, cMLSB, and iMLSB among all isolates were 27% (43/159), 3.1% (5/159), and 1.3% (2/159), respectively. Among those positive for macrolide resistance, the M phenotype of macrolide resistance dominated 86% (43/50), followed by cMLS B phenotype 10% (5/50), whereas iMLS B was the lowest (4%) frequency ( Figure 1 ). Macrolide resistance was higher in isolates from females (33.7%) than in isolates from males (28.1%), but this difference was not significant (χ2: 0.548, P = 0.459). On the other hand, macrolide resistance was almost at least twice as high ( P =0.017) in the isolates from patients with tonsil hyperemia and hyperplasia compared to those with non-tonsil hyperemia and hyperplasia ( Table 3 ). Logistic regression analysis also showed the association of macrolide resistance (AOR: 3.780, 95%CI:1.244-11.487, 0.019 ) with tonsil hyperemia and hyperplasia ( Table 4 ). The study didn’t find significant differences in the rates of macrolide resistance or resistance phenotypes among age groups, residence and education levels, or between isolates obtained from subjects with lymphadenopathy and those without. M phenotype is the predominant resistance phenotype among GAS isolates across all study variables, with P> 0.05 ( Table 3 ). Of 159 strains, Erm gene amplification showed that only 11.9% harbored the ErmC gene and 4.4% carried the ErmB gene. No GAS strain tested positive for mef A or erm A . 14.6% and 39.6% were the probability rates of ErmB and ErmC , respectively, among macrolide-resistant GAS isolates. In contrast, 0% was the rate of either MefA or ErmA ( Figure 2 ). Moreover, the rate of Erm B and Erm C resistance genes was higher in GAS strains isolated from males than from females, from individuals aged 5-10 years than from 11-16 years, from urban than from rural area residents, and from subjects with Tonsil hyperemia and hyperplasia than from non-subjects, P ˃ 0.05 ( Table 3 ). Table 2: Characteristics and Clinical features of the study subjects (Number=159) Characteristic/clinical features Category Frequency Number Percentage Gender Male Female 64 95 40.3 59.7 Age 5-10 Years 11-16 Years 110 49 69.2 30.8 Residence Urban Rural 124 35 78.0 22.0 Education level Kindergarten Basic school Secondary school 26 104 29 16.4 65.4 18.2 Tonsil hyperemia and hyperplasia No Yes 31 128 19.5 80.5 Lymphadenopathy No Yes 83 76 52.2 47.8 Sore throat No Yes 0 159 0.0 100 Fever No Yes 0 159 0.0 100 Table 3: Relationship of phenotypic and genotypic patterns of the GAS isolates (N=159) with gender, age groups, residence, and clinical features of study subjects Characteristic/clinical features Category MRGAS Resistance phenotype: N (%) Genes: N (%) M cMLS B iMLS B ErmB ErmC Gender Male Female P value X 2 18 (28.1) 32 (33.7) 0.459 0.548 15 (23.4) 28 (29.5) 0.401 0.706 3 (4.7) 2 (2.1) 0.652 0.204 0 (0) 2 (2.1) 0.658 0.192 4 (6.3) 3 (3.2) 0.591 0.289 8 (12.5) 11 (11.6) 0.861 0.031 Age 5-10 Years 11-16 Years P value X 2 35 (31.8) 15 (30.6) 0.830 0.023 29 (26.4) 14 (28.6) 0.772 0.084 4 (3.6) 1 (2.0) 0.968 0.002 2 (1.8) 0 (0) 0.858 0.032 7 (6.8) 0 (0) 0.165 1.925 14 (12.7) 5 (10.2) 0.651 0.205 Residence Urban Rural P value X 2 41 (33.1) 9 (25.7) 0.537 - 35 (28.2) 8 (22.9) 0.667 - 5 (4.0) 0 (0) 0.587 - 1 (0.8) 1 (2.9) 0.393 - 7 (5.6) 0 (0) 0.349 - 16 (12.9) 3 (8.6) 0.768 - Education level Kindergarten Basic school Secondary school P value X 2 9 (34.6) 32 (30.8) 9 (31.0) 0.967 0.218 7 (26.9) 27 (26) 9 (31.0) 0.838 0.392 2 (7.7) 3 (2.9) 0 (0) 0.300 2.301 0 (0) 2 (1.9) 0 (0) 1.000 0.605 2 (7.7) 5 (4.8) 0 (0) 0.367 1.864 3 (11.5) 14 (13.5) 2 (6.9) 0.719 0.757 Tonsil hyperemia and hyperplasia Yes No P value X 2 46 (35.9) 4 (12.9) 0.017 - 39 (30.5) 4 (12.9) 0.070 - 5 (3.9) 0 (0) 0.584 - 2 (1.6) 0 (0) 1.000 - 7 (5.5) 0 (0) 0.347 - 18 (14.1) 1 (3.2) 0.126 - Lymphadenopathy Yes No P value X 2 27 (35.5) 23 (27.7) 0.967 0.218 23 (30.3) 20 (24.1) 0.382 0.765 3 (3.9) 2 (2.4) 0.920 0.010 1 (1.3) 1 (1.2) 1.000 0.000 3 (3.9) 4 (4.8) 1.000 0000 10 (13.2) 9 (10.8) 0.653 0.202 N: Number; X 2 : Chi-square; MRGAS: Macrolide resistant Group A Streptococcus; cMLS B : constitutive Macrolide, lincosamide and streptogramin B; iMLS B : induced Macrolide, lincosamide and streptogramin B Table 4: Relationship of macrolide resistance with Tonsil hyperemia and hyperplasia Variable Binary Multinomial COR (95%CI) P value AOR (95%CI) P value Tonsil hyperemia and hyperplasia 3.787 (1.247-11.495) 0.019 3.780 (1.244-11.487) 0.019 COR: Crude odds ratio, AOR: Adjusted odds ratio (Gender adjusted), CI: Confidence interval 3.2. Discussion The causative agent of tonsillitis ( S. pyogenes ) is responsible for several illnesses and deaths globally. Streptococcal infections range from acute pharyngitis to life-threatening pyogenic or toxigenic infections, such as toxic shock syndrome [33]. The emergence of macrolide-resistant S. pyogenes strains was a growing problem documented worldwide [34]. Thus, we aimed to estimate the prevalence of macrolide resistance and characterize the resistance genes in S. pyogenes strains isolated from patients with tonsillitis attending Kosti Teaching Hospital (Kosti city, Sudan) during 2019-2021. The frequency of macrolide resistance varies across locations. In the present study, the rate of macrolide resistance was 31.4%. This rate is comparable to a survey by Hirakata et al. [12] in Japan, which documented an MR S. pyogenes rate of 30%-40%. In contrast, it was higher than the findings of a study by Wajima et al. [35], which concluded that the frequency of MRGAS was less than 10%. Compared with Italy [41], the present study's finding was higher. It was also higher than the findings of many studies conducted in Ethiopia [42,43]. The divergence between study results could be attributed to variation in sample size, study area, population and duration, and methods. Overall, the study findings highlighted and provided evidence regarding the epidemiology of macrolide resistance. An alarming rate of macrolide resistance in the current study area suggests the need for a comprehensive surveillance program. In some Asian countries, the MR rate has decreased, including Taiwan and Korea [36,37]. However, this problem has been persistently higher in China [38,39]. Concerning European countries, macrolide resistance reduced in Germany and France [40]. The infection with antibiotic-resistant bacteria may be associated with severe infections, prolonged stay in hospital, elevated healthcare costs, and risk of complications, or raised morbidity and deaths [44]. In the present research, we reported the M phenotype of macrolide resistance as the predominant phenotype (27%), followed by the cMLSB phenotype (3.1%), whereas iMLSB was the least frequent phenotype (1.3%). The current results were more relevant to several previous studies carried out in various countries, such as Greece [45], Austria and Hungary [46], Germany [47], Spain [48], Argentina [49], and Serbia [50], which stated the M phenotype as the predominant phenotype among the S. pyogenes isolates. Unlike the current study, a previous study [50] reported the iMLSB phenotype as more common than the cMLS B phenotype. Likewise, an equal distribution of the M and iMLS B phenotypes was reported from the European section of Turkey, which differs from the current study's results [51]. Previously, iMLS B and cMLS B phenotypes were reported as predominant in Korea, which differs from the present study's outcomes [52]. Contrary to the current study's results, several studies in Tunis reported that cMLSB S. pyogenes strains that harbor the ErmB gene were predominant [53-55]. Similar results regarding this fact were seen in different countries around the world, include Italy [56], Portugal [57], Korea [58], India [59], Japan [60], and China [61]. Previously, M phenotype strains, which harbor the MefA gene, have been reported as predominant GAS strains in Europe, including Spain [16, 62, 63], Norway [64], and Greece [65, 66 ]. M phenotype was also predominant in Mexico [67,68], Taiwan [36], Serbia [69], and Egypt [70]. Reasonably, the variation between these findings may be due to differences in sample size, seasonal period, or other factors. The differences between studies may also suggest variability in GAS strains, which are directly linked to the rates of MR phenotypes (M phenotypes, cMLSB, and iMLSB) and to antibiotic prescription and consumption strategies across different locations globally. The current study revealed that the predominant gene among S. pyogenes isolates was ErmC (11.9%), followed by ErmB (4.4%). This finding suggests a higher frequency of these genes in the current study area, but it requires further study with a larger sample size to verify. In contrast to our findings, the Martínez et al. study didn’t detect ErmC in S. pyogenes isolates [49]. Surprisingly, neither the ErmA nor the MefA gene was detected in our study, which is consistent with the findings of the Martínez et al. study regarding ErmA [49]. In Iraq, Ali et al study that none of the studied S. pyogenes strains carried Erm genes [30]. These results suggest the variations in epidemiology of MRGAS strains. Interestingly, we observed significant discordance between the phenotype and genotype of S. pyogenes . Specifically, 24 macrolide-resistant S. pyogenes isolates did not harbor the Erm (A, B, C) or MefA gene. Similarly, the Malbruny et al. study showed that two azithromycin-resistant strains lacked both the Erm and MefA genes [71]. Altogether, this could suggest the presence of other resistance mechanisms or possibly a mutation in the 23S rRNA [72]. In this study, there was no statistical difference in MR rates or in MR phenotypes and genotypes across gender, age groups, residence, and education levels. These outcomes may be due to the small sample size in the current study. Regular monitoring of antibiotic resistance epidemiology and its link with socio-demographic features is crucial for the effective management of GAS tonsillitis. Importantly, macrolide-nonsusceptible S. pyogenes isolates were significantly (P < 0.05) associated with tonsil hyperemia and hyperplasia. Still, this result requires additional studies in microbiology, immunology, pathology, pharmacology, and molecular biology to understand better. 4. Conclusion The present work highlighted the epidemiology of macrolide resistance in S. pyogenes isolated from patients with tonsillitis. The study demonstrates a concerning prevalence of macrolide resistance (31.4%) in the study area, primarily mediated by the M phenotype and associated with tonsil hyperemia and hyperplasia. This finding, based on local data, suggests the need for enhanced surveillance. Further studies with larger sample sizes are necessary to better understand the macrolide resistance patterns in S. pyogenes across Sudan. Limitations This study has some limitations that should be acknowledged. First, the sample size was moderate, which may influence the extent to which the findings can be generalized to broader populations. Second, resistance gene detection was based on PCR amplification using specific primers, and no sequencing analysis was performed; therefore, nucleotide sequence data were not generated. Third, other potential mechanisms of macrolide resistance, such as ribosomal mutations or additional efflux systems, were beyond the scope of this work. Nonetheless, the study provides valuable regional insights into S. pyogenes macrolide resistance and establishes a useful foundation for future molecular and epidemiological investigations. Declarations Acknowledgements We want to express our sincere gratitude to the study subjects and staff at Kosti Teaching Hospital. We would also like to thank the patients for cooperating during the procedures. Authors’ contributions EBA and NA were responsible for conceptualization. EBA, EAA, BSA, and AMN were responsible for investigation and data curation. EBA and YMAA were accountable for methodology, formal analysis, and visualization. EAA and NA were responsible for supervision. EBA, BMTG, and NA were responsible for drafting the manuscript and for critical review & editing. Funding The author(s) did not receive any financial support to report. Data availability The data that support this study’s findings are not publicly accessible due to sensitivity and privacy concerns, but can be obtained from the corresponding author upon reasonable request. Ethics approval and consent to participate The study protocol was approved by the Ethical Review Committee of the Research Unit at Kosti Teaching Hospital, White Nile State (Approval No: 04, Date: 4/7/2019). Administrative permission was also granted by the Faculty of Postgraduate Studies at Omdurman Islamic University, Khartoum. Written informed consent was obtained from the parent or legal guardian of each participating child before enrollment. All participants were assigned a unique code to ensure anonymity and protect their privacy throughout the study. All procedures were conducted in accordance with the ethical principles of the Declaration of Helsinki. As this study was observational and not a clinical trial, a clinical trial registration number is not applicable. Consent for publication Consent statements for publication have been obtained from all participants before enrollment in the study. All authors consent to publish this study. Competing interests The authors declare no competing interests. References Carapetis JR, Steer AC, Mulholland EK, Weber M. The global burden of group A streptococcal diseases. The Lancet infectious diseases 2005 Nov 1;5(11):685-94. Bisno AL, Gerber MA, Gwaltney Jr JM, Kaplan EL, Schwartz RH. Practice guidelines for the diagnosis and management of group A streptococcal pharyngitis. Clinical infectious diseases 2002 Jul 15:113-25. Leclercq R. Mechanisms of resistance to macrolides and lincosamides: nature of the resistance elements and their clinical implications.Clinical infectious diseases 2002 Feb 15;34(4):482-92. Roberts MC, Sutcliffe J, Courvalin P, Jensen LB, Rood J, Seppala H. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrobial agents and chemotherapy 1999 Dec 1;43(12):2823-30. Roberts MC. Update on macrolide–lincosamide–streptogramin, ketolide, and oxazolidinone resistance genes.FEMS microbiology letters 2008 May 1;282(2):147-59. Morita JY, Kahn E, Thompson T, Laclaire L, Beall B, Gherardi G, O'BRIEN KL, Schwartz B. Impact of azithromycin on oropharyngeal carriage of group A Streptococcus and nasopharyngeal carriage of macrolide-resistant Streptococcus pneumoniae. The Pediatric infectious disease journal 2000 Jan 1;19(1):41-6. McEwen SA, Fedorka-Cray PJ. Antimicrobial use and resistance in animals. Clinical infectious diseases 2002 Jun 1;34(Supplement_3):S93-106. Vaz-Moreira I, Nunes OC, Manaia CM. Bacterial diversity and antibiotic resistance in water habitats: searching the links with the human microbiome. FEMS microbiology reviews 2014 Jul 1;38(4):761-78. Klugman KP, Lonks JR. Hidden epidemic of macrolide-resistant pneumococci. Emerging infectious diseases 2005 Jun;11(6):802. Rubio-López V, Valdezate S, Álvarez D, Villalón P, Medina MJ, Salcedo C, Sáez-Nieto JA. Molecular epidemiology, antimicrobial susceptibilities, and resistance mechanisms of Streptococcus pyogenes isolates resistant to erythromycin and tetracycline in Spain (1994–2006). BMC microbiology 2012 Dec;12(1):1-1. Syrogiannopoulos GA, Grivea IN, Al-Lahham A, Panagiotou M, Tsantouli AG, Michoula Ralf René Reinert AN, van der Linden M. Seven-year surveillance of emm types of pediatric Group A streptococcal pharyngitis isolates in Western Greece. PLoS One 2013 ;8(8):e71558. Hirakata Y, Komatsu M, Muratani T, Kaku M. Drug susceptibility of bacteria isolated from pediatric respiratory infections at general practitioners' clinics to pediatric antibiotics. The Japanese Journal of Antibiotics 2009 Apr 1;62(2):90-102. Van Heirstraeten L, Coenen S, Lammens C, Hens N, Goossens H, Malhotra-Kumar S. Antimicrobial drug use and macrolide-resistant Streptococcus pyogenes, Belgium.Emerging infectious diseases 2012 Sep;18(9):1515. Zhou W, Jiang YM, Wang HJ, Kuang LH, Hu ZQ, Shi H, Shu M, Wan CM. Erythromycin-resistant genes in group A β-haemolytic Streptococci in Chengdu, Southwestern China. Indian Journal of Medical Microbiology 2014 Jul 1;32(3):290-3. Goossens H, Ferech M, Vander Stichele R, Elseviers M, ESAC Project Group. Outpatient antibiotic use in Europe and association with resistance: a cross-national database study. The Lancet 2005 Feb 12;365(9459):579-87. Clancy J, Petitpas J, Dib‐Hajj F, Yuan W, Cronan M, Kamath AV, Bergeron J, Retsema JA.Molecular cloning and functional analysis of a novel macrolide‐resistance determinant, mefA, from Streptococcus pyogenes. Molecular microbiology 1996;22(5):867-79. Sutcliffe J, Tait-Kamradt A, Wondrack L. Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrobial agents and chemotherapy 1996 Aug;40(8):1817-24. Tait-Kamradt A, Clancy J, Cronan M, Dib-Hajj F, Wondrack L, Yuan W, Sutcliffe J. mefE is necessary for the erythromycin-resistant M phenotype in Streptococcus pneumoniae. Antimicrobial agents and chemotherapy 1997 Oct;41(10):2251-5. Malhotra-Kumar S, Lammens C, Coenen S, Van Herck K, Goossens H. Effect of azithromycin and clarithromycin therapy on pharyngeal carriage of macrolide-resistant streptococci in healthy volunteers: a randomised, double-blind, placebo-controlled study. The Lancet 2007 Feb 10;369(9560):482-90. Seppälä H, Skurnik M, Soini H, Roberts MC, Huovinen P. A novel erythromycin resistance methylase gene (ermTR) in Streptococcus pyogenes. Antimicrobial agents and chemotherapy 1998 Feb 1;42(2):257-62. Davies J, Davies D. Origins and evolution of antibiotic resistance. Microbiology and molecular biology reviews 2010 Sep;74(3):417-33. Hawkey PM, Jones AM. The changing epidemiology of resistance. Journal of antimicrobial chemotherapy 2009 Sep 1;64(suppl_1):i3-10. Levy SB, Marshall B. Antibacterial resistance worldwide: causes, challenges and responses. Nature medicine 2004 Dec;10(12):S122-9. Li L, Xu L, Zhu R, et al. Effect of prior receipt of antibiotics on the pathogen distribution: a retrospective observational cohort study on 27,792 patients. BMC Infect Dis 2020; 20: 8. Harris AM, Bramley AM, Jain S, Arnold SR, Ampofo K, Self WH, Williams DJ, Anderson EJ, Grijalva CG, McCullers JA, Pavia AT, Wunderink RG, Edwards KM, Winchell JM, Hicks LA. Influence of Antibiotics on the Detection of Bacteria by Culture-Based and Culture-Independent Diagnostic Tests in Patients Hospitalized With Community-Acquired Pneumonia. Open Forum Infect Dis. 2017 Feb 10;4(1):ofx014. Gera K, McIver KS. Laboratory growth and maintenance of Streptococcus pyogenes (the Group A Streptococcus, GAS). Current protocols in microbiology. 2013 Oct;30(1):9D-2. Shulman ST, Bisno AL, Clegg HW, Gerber MA, Kaplan EL, Lee G, Martin JM, Van Beneden C. Clinical practice guideline for the diagnosis and management of group A streptococcal pharyngitis: 2012 update by the Infectious Diseases Society of America. Clinical infectious diseases 2012 Nov 15;55(10):e86-102. Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing. 28th ed. CLSI supplement M100 (ISBN 1-56238-838-X [Print]; ISBN 1-56238-839-8 [Electronic]). Clinical and Laboratory Standards Institute, 950 West Valley Road, Suite 2500, Wayne, Pennsylvania 19087 USA, 2018. TaKaRa MiniBEST Bacteria Genomic DNA Extraction Kit Ver.3.0 Cat. #9763 v201309Da: China. URL:http://www.takara-bio.com Ali HN, Dhahi MA, Abd AK. Molecular screening for erythromycin resistance genes in Streptococcus pyogenes isolated from Iraqi patients with tonsilo-pharyngites. African Journal of Biotechnology .2015 Aug 4;14(28):2244-50. Morosini MI, Cantón R, Loza E, del Campo R, Almaraz F, Baquero F. Streptococcus pyogenes isolates with characterized macrolide resistance mechanisms in Spain: in vitro activities of telithromycin and cethromycin. J Antimicrob Chemother. 2003;52(1):50-55. Nagarkoti D, Prajapati K, Sharma AN, Gyawali A, Manandhar S. Distribution of Macrolide-Lincosamide-Streptogramin B Antibiotics Resistance Genes in Clinical Isolates of Staphylococci. J Nepal Health Res Counc. 2021;18(4):734-740. Gherardi G, Petrelli D, Di Luca MC, Pimentel de Araujo F, Bernaschi P, Repetto A, Bellesi J, Vitali LA. Decline in macrolide resistance rates among Streptococcus pyogenes causing pharyngitis in children isolated in Italy. European Journal of Clinical Microbiology & Infectious Diseases 2015 Sep;34(9):1797-802. Ray D, Sinha S, Saha S, Karmakar S, Dutta RN, Bhattacharya S, Pal NK, Bhattacharya B. A preliminary sentinel surveillance report on antibiotics resistance trend of Streptococcus pyogenes in Kolkata region, India. Al Ameen J Med Sci 2010;3(2):146-51. Wajima T, Murayama SY, Sunaoshi K, Nakayama E, Sunakawa K, Ubukata K. Distribution of emm type and antibiotic susceptibility of group A streptococci causing invasive and noninvasive disease. Journal of Medical Microbiology 2008 Nov 1;57(11):1383-8. Huang CY, Lai JF, Huang IW, Chen PC, Wang HY, Shiau YR, Cheng YW, Hsieh LY, Chang SC, Lauderdale TL. Epidemiology and molecular characterization of macrolide-resistant Streptococcus pyogenes in Taiwan. Journal of clinical microbiology 2014 Feb;52(2):508-16. Kim S, Yong Lee N. Antibiotic resistance and genotypic characteristics of group A streptococci associated with acute pharyngitis in Korea. Microbial Drug Resistance 2004 Dec 1;10(4):300-5. Liu X, Shen X, Chang H, Huang G, Fu Z, Zheng Y, Wang L, Li C, Liu L, Shen Y, Yang Y. High macrolide resistance in Streptococcus pyogenes strains isolated from children with pharyngitis in China. Pediatric pulmonology 2009 May;44(5):436-41. Li H, Zhou L, Zhao Y, Ma L, Liu X, Hu J. Molecular epidemiology and antimicrobial resistance of group a streptococcus recovered from patients in Beijing, China. BMC Infect Dis. 2020 Jul 13;20(1):507. d’Humières, C., Cohen, R., Levy, C., Bidet, P., Thollot, F., Wollner, A. and Bingen, E. Decline in macrolide-resistant Streptococcus pyogenes isolates from French children. International Journal of Medical Microbiology 2012; 302 (7-8), pp.300-303. Olivieri R, Morandi M, Zanchi A, Tordini G, Pozzi G, De Luca A, Montagnani F. Evolution of macrolide resistance in Streptococcus pyogenes over 14 years in an area of central Italy. J Med Microbiol. 2015 Oct;64(10):1186-1195. Tadesse M, Hailu Y, Biset S, Ferede G, Gelaw B. Prevalence, Antibiotic Susceptibility Profile and Associated Factors of Group A Streptococcal pharyngitis Among Pediatric Patients with Acute Pharyngitis in Gondar, Northwest Ethiopia. Infect Drug Resist. 2023 Mar 22;16:1637-1648. Tesfaw G, Kibru G, Mekonnen D, Abdissa A. Prevalence of group A β-haemolytic Streptococcus among children with pharyngitis in Jimma town, Southwest Ethiopia. Egyptian Journal of Ear, Nose, Throat and Allied Sciences. 2015;16:35-40. Kariuki S, Kering K, Wairimu C, Onsare R, Mbae C. Antimicrobial Resistance Rates and Surveillance in Sub-Saharan Africa: Where Are We Now? Infect Drug Resist. 2022 Jul 7;15:3589-3609. Petinaki E, Kontos F, Pratti A, Skulakis C, Maniatis AN. Clinical isolates of macrolide-resistant Streptococcus pyogenes in Central Greece. International journal of antimicrobial agents 2003 Jan 1;21(1):67-70. Gattringer R, Sauermann R, Lagler H, Stich K, Buxbaum A, Graninger W, Georgopoulos A. Antimicrobial susceptibility and macrolide resistance genes in Streptococcus pyogenes collected in Austria and Hungary. International journal of antimicrobial agents 2004 Sep 1;24(3):290-3. Sauermann, R., Gattringer, R., Graninger, W., Buxbaum, A. and Georgopoulos, A. Phenotypes of macrolide resistance of group A streptococci isolated from outpatients in Bavaria and susceptibility to 16 antibiotics. Journal of Antimicrobial Chemotherapy 2003;51 (1), pp.53-57. Alos JI, Aracil B, Oteo J, Torres C, Gomez-Garces JL. High prevalence of erythromycin-resistant, clindamycin/miocamycin-susceptible (M phenotype) Streptococcus pyogenes: results of a Spanish multicentre study in 1998. Journal of Antimicrobial Chemotherapy 2000 May 1;45(5):605-9. Martínez S, Amoroso AM, Famiglietti A, de Mier C, Vay C, Gutkind GO. Genetic and phenotypic characterization of resistance to macrolides in Streptococcus pyogenes from Argentina. International journal of antimicrobial agents 2004 Jan 1;23(1):95-8. Pavlovic L, Grego E, Sipetic-Grujicic S. Prevalence of macrolide resistance in Streptococcus pyogenes collected in Serbia. Japanese journal of infectious diseases 2010 Jul 1;63(4):275-6. Akata F, Öztürk D, Tansel Ö, Tatman-Otkun M, Otkun M, Fitoussi F, Bingen E, Tugrul M. Resistance to macrolides in Group A streptococci from the European section of Turkey: genetic and phenotypic characterization. International journal of antimicrobial agents 2002 Dec 1;20(6):461-3. Bae SY, Kim JS, Kwon JA, Yoon SY, Lim CS, Lee KN, Cho Y, Kim YK, Lee CK. Phenotypes and genotypes of macrolide-resistant Streptococcus pyogenes isolated in Seoul, Korea. Journal of medical microbiology 2007 Feb 1;56(2):229-35. Hraoui M, Boutiba‐Ben Boubaker I, Doloy A, Samir E, Ben Redjeb S, Bouvet A. Epidemiological markers of Streptococcus pyogenes strains in Tunisia. Clinical microbiology and infection 2011 Jan;17(1):63-8. Ksia S, Smaoui H, Kechrid A, Bouvet A. Streptococcus pyogenes isolated in a Tunisian pediatric population: Emm types, T types, virulence factors and genes of resistance to macrolide and tetracycline. Malaysian Journal of Microbiology 2013:24-32. Hraoui M, Boubaker IB, Doloy A, Redjeb SB, Bouvet A. Molecular mechanisms of tetracycline and macrolide resistance and emm characterization of Streptococcus pyogenes isolates in Tunisia. Microbial Drug Resistance 2011 Aug 1;17(3):377-82. Gherardi G, Petrelli D, Di Luca MC, Pimentel de Araujo F, Bernaschi P, Repetto A, Bellesi J, Vitali LA. Decline in macrolide resistance rates among Streptococcus pyogenes causing pharyngitis in children isolated in Italy. European Journal of Clinical Microbiology & Infectious Diseases. 2015 Sep;34(9):1797-802. Silva-Costa C, Ramirez M, Melo-Cristino J, Portuguese Group for the Study of Streptococcal Infections, Vaz T, Gião M, Ferreira R, Klyeshtorna I, Fonseca AB, Oliveira H, Silva AC. Declining macrolide resistance in Streptococcus pyogenes in Portugal (2007–13) was accompanied by continuous clonal changes. Journal of Antimicrobial Chemotherapy. 2015 Oct 1;70(10):2729-33. Koh E, Kim S. Decline in erythromycin resistance in group A streptococci from acute pharyngitis due to changes in the emm genotypes rather than restriction of antibiotic use. The Korean journal of laboratory medicine. 2010 Oct 1;30(5):485-90. Shivekar S, Menon T. Molecular basis for erythromycin resistance in group A Streptococcus isolated from skin and soft tissue infections. Journal of Clinical and Diagnostic Research: JCDR. 2015 Nov;9(11):DC21. Takahashi T, Arai K, Lee DH, Koh EH, Yoshida H, Yano H, Kaku M, Kim S. Epidemiological study of erythromycin-resistant Streptococcus pyogenes from Korea and Japan by emm genotyping and multilocus sequence typing. Annals of laboratory medicine.. 2016 Jan 1;36(1):9-61. You YH, Song YY, Yan XM, Wang HB, Zhang MH, Tao XX, Li LL, Zhang YX, Jiang XH, Zhang BH, Hao ZH. Molecular epidemiological characteristics of Streptococcus pyogenes strains involved in an outbreak of scarlet fever in China, 2011. Biomedical and Environmental Sciences. 2013 Nov 1;26(11):877-85. Montes M, Tamayo E, Mojica C, García-Arenzana JM, Esnal O, Pérez-Trallero E. What causes decreased erythromycin resistance in Streptococcus pyogenes? Dynamics of four clones in a southern European region from 2005 to 2012. Journal of Antimicrobial Chemotherapy. 2014 Jun 1;69(6):1474-82. Pérez-Trallero E, Martín-Herrero JE, Mazón A, García-Delafuente C, Robles P, Iriarte V, Dal-Ré R, García-de-Lomas J. Antimicrobial resistance among respiratory pathogens in Spain: latest data and changes over 11 years (1996-1997 to 2006-2007). Antimicrobial agents and chemotherapy. 2010 Jul;54(7):2953-9. Littauer P, Caugant DA, Sangvik M, Høiby EA, Sundsfjord A, Simonsen GS, Norwegian Macrolide Study Group. Macrolide-resistant Streptococcus pyogenes in Norway: population structure and resistance determinants. Antimicrobial agents and chemotherapy. 2006 May;50(5):1896-9. Michos A, Koutouzi FI, Tsakris A, Chatzichristou P, Koutouzis EI, Daikos GL, Stathi A, Syriopoulou VP. Molecular analysis of Streptococcus pyogenes macrolide resistance of paediatric isolates during a 7 year period (2007–13). Journal of Antimicrobial Chemotherapy. 2016 Aug 1;71(8):2113-7. Grivea, I.N., Al-Lahham, A., Katopodis, G.D., Syrogiannopoulos, G.A. and Reinert, R.R. Resistance to erythromycin and telithromycin in Streptococcus pyogenes isolates obtained between 1999 and 2002 from Greek children with tonsillopharyngitis: phenotypic and genotypic analysis. Antimicrobial agents and chemotherapy 2006;50 (1), pp.256-261 Sánchez RR, Paz RF, Mendez CP, Alba MA. Antimicrobial susceptibility of beta haemolytic Streptococci isolated from paediatric patients with pharyngoamigdalitis. Fam Med Med Sci Res 2015;4(151):2. Villaseñor-Sierra, A., Katahira, E., Jaramillo-Valdivia, A.N., de los Angeles Barajas-García, M., Bryant, A., Morfín-Otero, R., Márquez-Díaz, F., Tinoco, J.C., Sánchez-Corona, J. and Stevens, D.L. Phenotypes and genotypes of erythromycin-resistant Streptococcus pyogenes strains isolated from invasive and non-invasive infections from Mexico and the USA during 1999–2010. International journal of infectious diseases 2012;16 (3), pp.e178-e181. Opavski N, Gajic I, Borek AL, Obszańska K, Stanojevic M, Lazarevic I, Ranin L, Sitkiewicz I, Mijac V. Molecular characterization of macrolide resistant Streptococcus pyogenes isolates from pharyngitis patients in Serbia. Infection, Genetics and Evolution 2015 Jul 1;33:246-52. Ibrahim SB, El-Sokkary RH, Elhewala AA, El-Anwar MW, Awad WM, Hamed AM, Badawy II. Emerging resistance to erythromycin and penicillin among Streptococcus pyogenes isolates in Zagazig, Egypt. Int J Curr Microbiol App Sci 2014;3(10):750-6. Malbruny B, Nagai K, Coquemont M, Bozdogan B, Andrasevic AT, Hupkova H, Leclercq R, Appelbaum PC. Resistance to macrolides in clinical isolates of Streptococcus pyogenes due to ribosomal mutations. Journal of Antimicrobial Chemotherapy 2002 Jun 1;49(6):935-9. Lu B, Fang Y, Fan Y, Chen X, Wang J, Zeng J, Li Y, Zhang Z, Huang L, Li H, Li D. High prevalence of macrolide-resistance and molecular characterization of Streptococcus pyogenes isolates circulating in China from 2009 to 2016. Frontiers in microbiology 2017 Jun 8;8:1052. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7929845","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":568971282,"identity":"bd27337d-4097-4e34-92ab-a242718e0338","order_by":0,"name":"Elnaim Bushra Ahmed","email":"","orcid":"","institution":"Omdurman Islamic University","correspondingAuthor":false,"prefix":"","firstName":"Elnaim","middleName":"Bushra","lastName":"Ahmed","suffix":""},{"id":568971283,"identity":"40b6292b-4b49-4296-a6fe-08fd258bc5a4","order_by":1,"name":"Elsir Ali AbuGroun","email":"","orcid":"","institution":"University of Khartoum","correspondingAuthor":false,"prefix":"","firstName":"Elsir","middleName":"Ali","lastName":"AbuGroun","suffix":""},{"id":568971284,"identity":"24bd2a1b-4a77-4425-bab6-c0fc6a9a9a9c","order_by":2,"name":"Babiker Saad Almugadam","email":"","orcid":"","institution":"University of El Imam El Mahdi","correspondingAuthor":false,"prefix":"","firstName":"Babiker","middleName":"Saad","lastName":"Almugadam","suffix":""},{"id":568971285,"identity":"2301d363-a695-4e0f-b961-07088e1f6bcf","order_by":3,"name":"Aymen Mudawe Nurain","email":"","orcid":"","institution":"Delta College of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Aymen","middleName":"Mudawe","lastName":"Nurain","suffix":""},{"id":568971286,"identity":"ce7b5c5d-c761-4cbd-a014-266051dc86e9","order_by":4,"name":"Yousif Mousa Alobaid Ahmed","email":"","orcid":"","institution":"University of El Imam El Mahdi","correspondingAuthor":false,"prefix":"","firstName":"Yousif","middleName":"Mousa Alobaid","lastName":"Ahmed","suffix":""},{"id":568971287,"identity":"8fdb0fe4-6698-4dd2-ad61-de61f6539555","order_by":5,"name":"Babbiker Mohammed Taher Gorish","email":"","orcid":"","institution":"Omdurman Islamic University","correspondingAuthor":false,"prefix":"","firstName":"Babbiker","middleName":"Mohammed Taher","lastName":"Gorish","suffix":""},{"id":568971288,"identity":"0273d73f-3f66-4d59-8efb-894e2a71f62f","order_by":6,"name":"Nadir Abuzeid","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+ElEQVRIiWNgGAWjYHACgwMMDEDEwNgg8YFBAiwCxMzEaZGcQawWBogWBgZpHoQIbi3m7Ic3Hq6ouZM4v7258bZNhUViA3vzNgmGP9Y4tVj2pBUcPHPsWWJjz8Fm65wzEokNPMfKJBjb0vF4JMfgYAPb4cRmicQ26dw2oBaJHDMJxobDuLWcfwPU8u9wYpv8wzZpS5AW+TdmQIfh0XIDaEtj2+HEHqBjpBnBtvAAtbDh0/Ks4GBj3zPjGTyJzZY9ZySM23jSii0S8fnlfPLmjw3f7sjObz/+8MaPijrZfmAY3viAJ8QwARuISCBBwygYBaNgFIwCTAAAzrBbEOOKDEUAAAAASUVORK5CYII=","orcid":"","institution":"Omdurman Islamic University","correspondingAuthor":true,"prefix":"","firstName":"Nadir","middleName":"","lastName":"Abuzeid","suffix":""}],"badges":[],"createdAt":"2025-10-23 08:08:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7929845/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7929845/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":99813330,"identity":"aad1df7b-0259-48aa-aeb4-f32b0f041278","added_by":"auto","created_at":"2026-01-08 14:38:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":46210,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMacrolide resistance profile of Group A Streptococci (GAS) isolates.\u0026nbsp;\u003c/strong\u003eThe figure shows (a) sampling methodology, (b) prevalence of macrolide resistance among all isolates (N=159), and (c) distribution of resistance phenotypes among resistant isolates (N=50). Abbreviations: cMLSB, constitutive macrolide-lincosamide-streptogramin B; iMLSB, inducible MLSB; M phenotype, efflux-based resistance. cMLS\u003csub\u003eB\u003c/sub\u003e: constitutive Macrolide, lincosamide and streptogramin B; iMLS\u003csub\u003eB\u003c/sub\u003e: induced Macrolide, lincosamide and streptogramin B; GAS: Group A \u003cem\u003eStreptococci\u003c/em\u003e; N: Number.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7929845/v1/e893458065ee5bca5ca5634d.png"},{"id":99813494,"identity":"d863d0c9-526d-4d69-9929-90fd7890682a","added_by":"auto","created_at":"2026-01-08 14:39:12","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":350903,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMolecular identification and distribution of macrolide resistance genes.\u003c/strong\u003e\u0026nbsp;(A, B)\u0026nbsp;Representative agarose gel electrophoresis image showing PCR amplification of the\u0026nbsp;\u003cem\u003eErmB\u003c/em\u003e\u0026nbsp;(640 bp) and\u0026nbsp;\u003cem\u003eErmC\u003c/em\u003e\u0026nbsp;(572 bp) genes. Lane M: 100 bp DNA ladder.\u0026nbsp;(C)\u0026nbsp;The frequency of\u0026nbsp;\u003cem\u003eErm\u003c/em\u003e\u0026nbsp;genes across all GAS isolates (N=159).\u0026nbsp;(D)\u0026nbsp;The proportion of\u0026nbsp;\u003cem\u003eErm\u003c/em\u003e\u0026nbsp;genes among the macrolide-resistant isolates (N=50).\u003cstrong\u003e \u003c/strong\u003ecMLS\u003csub\u003eB\u003c/sub\u003e: constitutive Macrolide, lincosamide and streptogramin B; iMLS\u003csub\u003eB\u003c/sub\u003e: induced Macrolide, lincosamide and streptogramin B; GAS: Group A Streptococci; N: Number.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7929845/v1/74177aa444c2492a1a4010f0.png"},{"id":99816345,"identity":"6ff43aa4-00d8-4e61-a3e8-abfd0dd362c8","added_by":"auto","created_at":"2026-01-08 14:46:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1834244,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7929845/v1/0724a2cc-4f5a-4d96-babb-794f93850e83.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eMacrolide Resistance in Streptococcus pyogenes from Tonsillitis Patients: Phenotypic Profiles, Resistance Genes, and Clinical Associations\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eGroup A Streptococci (GAS) tonsillitis is a known infection caused by \u003cem\u003eS. pyogenes\u003c/em\u003e (GAS) and is estimated to affect about 616 million people worldwide annually [1]. Penicillin (a \u0026beta;-lactam antibiotic) remains the drug of choice for the management of GAS infections. Macrolides and lincosamides are a choice for patients with \u0026beta;-lactam hypersensitivity [2]. Macrolide is a group of antibiotics composed of 16 (such as josamycin, spiramycin, and tylosin), 15 (such as azithromycin), or 14 (such as erythromycin and clarithromycin) membered lactones [3,4]. Erythromycin (ERY) is an active antimicrobial prescribed to treat S\u003cem\u003e. pyogenes\u003c/em\u003e upper respiratory tract infections [5]. Azithromycin is the most commonly used macrolide due to its single-daily dosing and shorter course of therapy [6]. Clindamycin is a good option for the treatment of recurrent GAS infections and can be used to treat specific erythromycin-resistant \u003cem\u003eS. pyogenes\u0026nbsp;\u003c/em\u003einfections [2].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAntibiotic resistance is a global challenge. This rising problem threatens our competence to treat both human and animal infections [7,8]. Currently, macrolide resistance (MR) is widespread among clinical isolates [5,9]. The emergence of macrolide-resistant \u003cem\u003eS. pyogenes\u003c/em\u003e strains has been reported worldwide, and recent reports indicate that macrolide-resistant GAS (MRGAS) is increasing at varying rates across geographic locations [10-12]. The MR rate was 32.8%, 40%, 98.4%, and 22.8% in Spain [13], Belgium [14], China [10], and Greece [11], respectively. In Japan, the MRGAS rate was 30%-40% [15]. Macrolide resistance usually results from one of two common mechanisms. The first mechanism involves the \u003cem\u003eMef\u003c/em\u003e genes, mainly \u003cem\u003eMef\u003c/em\u003eA, which encode an efflux pump that expels antibiotics from the cell and inhibits their binding to the ribosome [16-18]. The second mechanism involves the (\u003cem\u003eErmA\u003c/em\u003e, \u003cem\u003eErmB\u003c/em\u003e) genes, which encode methylases targeting 23S rRNA [19,20], thereby interfering with the binding of macrolides to their targets on the rRNA (MLS\u003csub\u003eB\u003c/sub\u003e phenotype). The MLS\u003csub\u003eB\u003c/sub\u003e phenotype can be induced by Macrolide, lincosamide, and streptogramin B (iMLSB phenotype) or constitutive Macrolide, lincosamide, and streptogramin B (cMLS\u003csub\u003eB\u003c/sub\u003e phenotype). Other mechanisms of MR occur due to mutations in the 23S rRNA gene and/or changes in riboproteins L4 and L22 [3]. Furthermore, Erythromycin resistance can occur through phosphorylation, which causes structural modification of erythromycin, glycosylation, and lactone ring breakdown by erythromycin esterase [21-23].\u003c/p\u003e\n\u003cp\u003eThe global efforts to combat antimicrobial resistance are affected by several challenges, including the prescription and overuse of antibiotics in animal food and agriculture [23]. Delaying or failure to treat Streptococcus tonsillitis can lead to post-streptococcal complications, including glomerulonephritis and rheumatic heart disease [21]. The MRGAS rate is poorly understood in Sudan, especially in White Nile state, and, to our knowledge, this is the first study on MR in White Nile state. Understanding the MRGAS (phenotypes and molecular genotypes) is critical for epidemiology, therapy, and control of GAS tonsillitis. The current study was undertaken to examine MR phenotypes and genotypes in \u003cem\u003eS. pyogenes\u003c/em\u003e isolates from Sudanese individuals with clinical tonsillitis and to determine the association between resistance genes and clinical factors.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1. Study design, area, and duration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA cross-sectional hospital-based study was carried out in Kosti Teaching Hospital throughout 2019-2021 to identify the rate of MR in\u0026nbsp;\u003cem\u003eS. pyogenes\u0026nbsp;\u003c/em\u003eisolated from tonsillitis patients. The hospital in the study area is located in Kosti, White Nile State. It provides services to most of the people of the White Nile state, especially the population of the Kosti locality.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2. Inclusion and exclusion criteria\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe targeted subjects were children aged 5-15 years with symptomatic tonsillitis. The study included subjects who attended the Ear, Nose, and Throat (ENT) unit at Kosti Teaching Hospital. For every subject, the ENT consultant did the physical examination and obtained the clinical history. \u0026nbsp;The study excluded subjects who had a history of respiratory surgery, chemotherapy, radiotherapy, or autoimmune disease. To enhance GAS recovery and avoid the effect of antibiotic use on bacterial detection by culture, throat swabs were collected only from subjects with no recent medical history of antibiotic use at least 7 days prior [24,25]. Data were collected using a pre-tested questionnaire that included the participant\u0026rsquo;s information (such as residence and gender) and clinical data, including sore throat and tonsillar hyperplasia (enlargement).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3. Laboratory analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA throat swab was collected from each participant and cultured to isolate GAS. Next, all the isolated \u003cem\u003eS. pyogenes\u0026nbsp;\u003c/em\u003ewere screened for macrolide resistance. Then, each isolate was screened for macrolide resistance, and those that tested positive were tested for the MR phenotype. Next, all macrolide resistance isolates were screened for macrolide resistance genes by PCR using primers targeting \u003cem\u003eMefA\u003c/em\u003e, \u003cem\u003eErmA\u003c/em\u003e, \u003cem\u003eErmB\u003c/em\u003e, and \u003cem\u003eErmC\u003c/em\u003e. To maintain the viability of isolates for PCR, the preservation of isolates was done aseptically by adding 2-3 loop-full of the pure isolates to one ml of brain heart infusion broth (HiMedia, India) containing 15% glycerol (The media was prepared in a micro-centrifuge tube) and preserved at -20 \u003csup\u003e\u0026ordm;\u0026nbsp;\u003c/sup\u003eC until further analysis [26].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3.1. Isolation and identification of bacteria\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThree hundred eighty-four throat swabs were collected from patients with tonsil infection (tonsillitis). The specimens were obtained from patients in the ENT unit at Kosti Teaching Hospital. Under good light, the throat specimen was collected by using a swab and a tongue depressor. All samples were cultured on 5% sheep blood agar (HiMedia, India) and incubated aerobically at 37 \u0026deg;C overnight. The isolate was identified based on culture characters (colonial morphology, such as colony size), Gram stain results (Gram reaction, shape, and arrangement of bacteria), and conventional biochemical tests [27], including catalase and bacitracin susceptibility tests (0.05 U bacitracin, HiMedia, India). \u003cem\u003eS. aureus\u003c/em\u003e ATCC (American Type Culture Collection) 25922 and \u003cem\u003eS. pyogenes\u003c/em\u003e ATCC 19615 were used as control strains.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3.2. Phenotypic detection of macrolide resistant\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor phenotypic detection of macrolide resistance, each isolate was tested by disc diffusion using clindamycin (AD2 \u0026micro;g), erythromycin (E15 \u0026micro;g), and azithromycin (AZM 15 \u0026micro;g). The test was done based on the Clinical and Laboratory Standards Institute (CLSI) guidelines 2018. Briefly, suspensions of each test organism equivalent to 0.5 McFarland standards were prepared in physiological saline and inoculated onto Mueller-Hinton-based blood agar (HiMedia, India) using a cotton swab. Following overnight incubation at 37\u0026ordm;C, each S.\u0026nbsp;\u003cem\u003epyogenes\u0026nbsp;\u003c/em\u003eisolates showing decreased potential for one or more macrolides were classified as resistant strains [20,28].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe double-disk diffusion test determined the MR phenotype. \u0026nbsp;Briefly, the test organism turbidity (Equivalent to 0.5 McFarland standards turbidity) was prepared in physiological saline. Next, the test organism turbidity was inoculated into Muller-Hinton-based blood agar (HiMedia, India) using a sterile cotton swab. Using sterile forceps, the clindamycin (AD 2 \u0026micro;g) and erythromycin (E15 \u0026micro;g) discs were placed into the inoculated plate, with 15 mm spacing between them as recommended by the CLSI guidelines 2018 [20,28].\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eFollowing overnight incubation at 37\u0026ordm;C, the ruler read the inhibition zone, and the result was stated and interpreted as follows:\u003c/p\u003e\n\u003cp\u003eAn erythromycin-resistant, clindamycin-susceptible strain without a D-shaped zone of inhibition surrounding the clindamycin disc was reported as an M phenotype. \u0026nbsp;cMLS\u003csub\u003eB\u003c/sub\u003e resistance phenotype was indicated by resistance to erythromycin and clindamycin together. In contrast, the iMLSB resistance phenotype was indicated by sensitivity to clindamycin, with a D-shaped zone of inhibition [20,28].\u003cem\u003e\u0026nbsp;S. aureus\u003c/em\u003e ATCC25922 and \u003cem\u003eS. pyogenes\u003c/em\u003e ATCC19615 were used as control strains.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3.3. Molecular detection of macrolide resistance genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenotypic characterization of macrolide resistance genes was performed using polymerase chain reaction (PCR). In DNA extraction, colonies of macrolide-resistant \u003cem\u003eS. pyogenes\u003c/em\u003e were suspended in 1ml NaCl. DNA extraction was done by a commercial spin column DNA extraction kit (TaKara MiniBEST Bacteria Genomic DNA Extraction Kit Ver. 3.0 Cat. #9763 v201309 Da: China) according to company guidelines [29]. The extracted DNA was electrophoresed on a 1% agarose gel to assess its quality. \u003cstrong\u003eTable1\u003c/strong\u003e presents the list of primers (Intron \u0026ndash;Korea) that were used to amplify the targeted genes (\u003cem\u003eMefA, ErmA, ErmB\u003c/em\u003e, and \u003cem\u003eErmC\u003c/em\u003e),\u003cem\u003e\u0026nbsp;\u003c/em\u003ewhich link to macrolide resistance [30-32].\u0026nbsp;For amplification of each gene by PCR, a 25 \u0026micro;L PCR mixture containing 3 \u0026micro;L of template DNA, 1 \u0026micro;L of each primer, 5 \u0026micro;L of Taq PCR Master Mix (Intron-Korea), and 15 \u0026micro;L of nuclease-free water was used. Gene amplification was performed using a PCR machine (Prime \u0026ndash; England). PCR reaction was initiated with an initial heat denaturation at 94\u0026ordm;C for 60 seconds, followed by 30 cycles of denaturation at 94\u0026ordm;C for 30 seconds, primer annealing (\u003cem\u003eErmA\u003c/em\u003e at 55\u0026ordm;C,\u0026nbsp;\u003cem\u003eErmB\u003c/em\u003e at\u0026nbsp;54\u0026ordm;C,\u0026nbsp;\u003cem\u003eErmC\u003c/em\u003e at 58\u0026ordm;C,\u0026nbsp;\u003cem\u003eMefA\u003c/em\u003e at\u0026nbsp;55\u0026ordm;C)\u003cem\u003e\u0026nbsp;\u003c/em\u003efor 30 seconds, and extension at 72\u0026ordm;C for 60 seconds. The final extension step was performed at 72\u0026ordm;C for 10 minutes [30-32]. For each gene, the PCR product was run on an agarose gel using agarose Gel electrophoresis. Briefly, 5 \u0026micro;L of each PCR product was separated on a 1.5% agarose gel by electrophoresis at 120 V (using 1x TBE running buffer) for 60 minutes. Next, the gel was stained with 2 \u0026micro;L ethidium bromide (2 g/mL) (Sigma, USA). Finally, the DNA bands were viewed using the UVP BioDoc-It digital imaging system. The DNA ladder (100 bp, Intron-Korea) was used in every run.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1:\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eList of (F: forward, R: reverse) primers and PCR products\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"635\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eSequence (5\u0026prime; to 3\u0026prime;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 114px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnnealing temperature (\u0026deg;C)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSize of PCR product (bp)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 92px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ereferances\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eErmA\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eAGAAGGTTATAATGAAACAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 114px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e210\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"8\" valign=\"top\" style=\"width: 92px;\"\u003e\n \u003cp\u003e[30-32]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eGGCATGACATAAACCTTCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eErmB\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eGAAAAGGTACTCAACCAAATA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 114px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e640\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eAGTAACGGTACTTAAATTGTTTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eErmC\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eGCTAATATTGTTTAAATCGTCAATTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 114px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e572\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eGGATCAGGAAAAGAACATTTTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 54px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eMefA\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eAGTATCATTAATCACTAGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 114px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e350\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 30px;\"\u003e\n \u003cp\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 255px;\"\u003e\n \u003cp\u003eTTCTTCTGGTACTAAAAGTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e2.4. Data analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data from the present study were analmacrolide susceptibilityackage for the Social Sciences (SPSS version 21 (SPSS Statistics 21, IBM Corp., Armonk, N.Y., USA), and the results were presented in figures and tables. The Fisher\u0026apos;s Exact Test, Pearson Chi-Square, and Chi-Square Continuity Correction were used in data analysis. Association was assessed using binary (Unadjusted Odds ratio) and multinomial (Adjusted Odds ratio) logistic regression. GraphPad Prism version 8.0.2 (263) was used to display the figures. P˂0.05 was specified as a significant value.\u0026nbsp;\u003c/p\u003e"},{"header":"3. Results and Discussion","content":"\u003cp\u003e\u003cstrong\u003e3.1. Results\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOf 384 throat swabs, only 159 were positive for GAS by culture, representing 41.4% of the total. Thus, the current work was carried out in 159 GAS isolated from the throat of children with an age range from five to sixteen years old. The mean age of children with clinical indications of streptococcal tonsillitis was 9.0\u0026plusmn;3.0 years. The distribution of GAS isolates across age groups, gender, residence, and education levels is summarized in \u003cstrong\u003eTable 2\u003c/strong\u003e. The study participants include 64 males (40.3%) and 95 females (59.7%). The most frequent age group was 5-10 years (69.2%, 110/159). Moreover, urbanized children accounted for 78% of study subjects, and those in rural areas had a lower frequency (22%) compared to urban residents. Almost 65.4% of cases are at a primary school education level. Regarding the clinical features of tonsillitis, fever and sore throat were observed in all participants, while tonsil hyperemia and hyperplasia were observed in 80.5% (128/159) of cases. Other clinical findings, interestingly, lymphadenopathy was seen in 47.8% (76/159) of subjects with GAS tonsillitis (\u003cstrong\u003eTable 2\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eIn this study, all isolates were tested for macrolide susceptibility using the disc diffusion method. 31.4% (50/159) of GAS strains were positive for macrolide resistance. The double disk diffusion test revealed that the frequencies of M phenotype, cMLSB, and iMLSB among all isolates were 27% (43/159), 3.1% (5/159), and 1.3% (2/159), respectively. Among those positive for macrolide resistance, the M phenotype of macrolide resistance dominated 86% (43/50), followed by cMLS\u003csub\u003eB\u003c/sub\u003e phenotype 10% (5/50), whereas iMLS\u003csub\u003eB\u0026nbsp;\u003c/sub\u003ewas the lowest (4%) frequency\u0026nbsp;(\u003cstrong\u003eFigure 1\u003c/strong\u003e).\u003cstrong\u003e\u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMacrolide resistance was higher in isolates from females (33.7%) than in isolates from males (28.1%), but this difference was not significant (\u0026chi;2: 0.548, P = 0.459). On the other hand, macrolide resistance was almost at least twice as high (\u003cem\u003eP\u003c/em\u003e=0.017) in the isolates from patients with tonsil hyperemia and hyperplasia compared to those with non-tonsil hyperemia and hyperplasia (\u003cstrong\u003eTable 3\u003c/strong\u003e). Logistic regression analysis also showed the association of macrolide resistance (AOR: 3.780, 95%CI:1.244-11.487, \u003cem\u003e0.019\u003c/em\u003e) with tonsil hyperemia and hyperplasia (\u003cstrong\u003eTable 4\u003c/strong\u003e).\u0026nbsp;The study didn\u0026rsquo;t find significant differences in the rates of macrolide resistance or resistance phenotypes among age groups, residence and education levels, or between isolates obtained from subjects with lymphadenopathy and those without. M phenotype is the predominant resistance phenotype among GAS isolates across all study variables, with P\u0026gt; 0.05 (\u003cstrong\u003eTable 3\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eOf 159 strains, \u003cem\u003eErm\u0026nbsp;\u003c/em\u003egene amplification showed that only 11.9% harbored the\u003cem\u003e\u0026nbsp;ErmC\u003c/em\u003e gene\u003cem\u003e\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;\u003c/em\u003e4.4% carried the \u003cem\u003eErmB\u003c/em\u003e gene. No GAS strain tested positive for \u003cem\u003emef A\u003c/em\u003e or \u003cem\u003eerm A\u003c/em\u003e. 14.6% and 39.6% were the probability rates of \u003cem\u003eErmB\u003c/em\u003e and \u003cem\u003eErmC\u003c/em\u003e, respectively, among macrolide-resistant GAS isolates. In contrast, 0% was the rate of either \u003cem\u003eMefA\u003c/em\u003e or \u003cem\u003eErmA\u003c/em\u003e (\u003cstrong\u003eFigure 2\u003c/strong\u003e). Moreover, the rate of \u003cem\u003eErm\u003c/em\u003e\u003cem\u003eB\u003c/em\u003e and \u003cem\u003eErm\u003c/em\u003e\u003cem\u003eC\u003c/em\u003e resistance genes was higher in GAS strains isolated from males than from females, from individuals aged 5-10 years than from 11-16 years, from urban than from rural area residents, and from subjects with Tonsil hyperemia and hyperplasia than from non-subjects, \u003cem\u003eP\u003c/em\u003e˃ 0.05 (\u003cstrong\u003eTable 3\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2: Characteristics and Clinical features of the study subjects (Number=159)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"509\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCharacteristic/clinical features\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCategory\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFrequency\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePercentage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGender \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eMale\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e64\u003c/p\u003e\n \u003cp\u003e95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003e40.3\u003c/p\u003e\n \u003cp\u003e59.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e5-10 Years\u003c/p\u003e\n \u003cp\u003e11-16 Years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e110\u003c/p\u003e\n \u003cp\u003e49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003e69.2\u003c/p\u003e\n \u003cp\u003e30.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eResidence \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003eUrban\u003c/p\u003e\n \u003cp\u003eRural\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e124\u003c/p\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003e78.0\u003c/p\u003e\n \u003cp\u003e22.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eEducation level \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003eKindergarten\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eBasic school\u003c/p\u003e\n \u003cp\u003eSecondary school\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003cp\u003e104\u003c/p\u003e\n \u003cp\u003e29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003e16.4\u003c/p\u003e\n \u003cp\u003e65.4\u003c/p\u003e\n \u003cp\u003e18.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTonsil hyperemia and hyperplasia\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eNo\u003c/p\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003cp\u003e128\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003e19.5\u003c/p\u003e\n \u003cp\u003e80.5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLymphadenopathy \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003cp\u003eYes\u003cstrong\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e83\u003c/p\u003e\n \u003cp\u003e76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003e52.2\u003c/p\u003e\n \u003cp\u003e47.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSore throat \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003cp\u003e159\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003e0.0\u003c/p\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFever \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003cp\u003eYes\u003cstrong\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003cp\u003e159\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003e0.0\u003c/p\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3: Relationship of phenotypic and genotypic patterns of the GAS isolates (N=159) with gender, age groups, residence, and clinical features of study subjects\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"762\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCharacteristic/clinical features\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 187px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eCategory\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eMRGAS\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 186px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eResistance phenotype: N (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 144px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenes: N (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eM\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ecMLS\u003csub\u003eB\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eiMLS\u003csub\u003eB\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eErmB\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eErmC\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGender \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 187px;\"\u003e\n \u003cp\u003eMale\u003c/p\u003e\n \u003cp\u003eFemale\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e\n \u003cp\u003eX\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003e18 (28.1)\u003c/p\u003e\n \u003cp\u003e32 (33.7)\u003c/p\u003e\n \u003cp\u003e0.459\u003c/p\u003e\n \u003cp\u003e0.548\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e15 (23.4)\u003c/p\u003e\n \u003cp\u003e28 (29.5)\u003c/p\u003e\n \u003cp\u003e0.401\u003c/p\u003e\n \u003cp\u003e0.706\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e3 (4.7)\u003c/p\u003e\n \u003cp\u003e2 (2.1)\u003c/p\u003e\n \u003cp\u003e0.652\u003c/p\u003e\n \u003cp\u003e0.204\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e2 (2.1)\u003c/p\u003e\n \u003cp\u003e0.658\u003c/p\u003e\n \u003cp\u003e0.192\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e4 (6.3)\u003c/p\u003e\n \u003cp\u003e3 (3.2)\u003c/p\u003e\n \u003cp\u003e0.591\u003c/p\u003e\n \u003cp\u003e0.289\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e8 (12.5)\u003c/p\u003e\n \u003cp\u003e11 (11.6)\u003c/p\u003e\n \u003cp\u003e0.861\u003c/p\u003e\n \u003cp\u003e0.031\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 187px;\"\u003e\n \u003cp\u003e5-10 Years\u003c/p\u003e\n \u003cp\u003e11-16 Years\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e\n \u003cp\u003eX\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003e35 (31.8)\u003c/p\u003e\n \u003cp\u003e15 (30.6)\u003c/p\u003e\n \u003cp\u003e0.830\u003c/p\u003e\n \u003cp\u003e0.023\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e29 (26.4)\u003c/p\u003e\n \u003cp\u003e14 (28.6)\u003c/p\u003e\n \u003cp\u003e0.772\u003c/p\u003e\n \u003cp\u003e0.084\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e4 (3.6)\u003c/p\u003e\n \u003cp\u003e1 (2.0)\u003c/p\u003e\n \u003cp\u003e0.968\u003c/p\u003e\n \u003cp\u003e0.002\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e2 (1.8)\u003c/p\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e0.858\u003c/p\u003e\n \u003cp\u003e0.032\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e7 (6.8)\u003c/p\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e0.165\u003c/p\u003e\n \u003cp\u003e1.925\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e14 (12.7)\u003c/p\u003e\n \u003cp\u003e5 (10.2)\u003c/p\u003e\n \u003cp\u003e0.651\u003c/p\u003e\n \u003cp\u003e0.205\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eResidence \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 187px;\"\u003e\n \u003cp\u003eUrban\u003c/p\u003e\n \u003cp\u003eRural\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u0026nbsp;\u003c/em\u003evalue\u003c/p\u003e\n \u003cp\u003eX\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003e41 (33.1)\u003c/p\u003e\n \u003cp\u003e9 (25.7)\u003c/p\u003e\n \u003cp\u003e0.537\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e35 (28.2)\u003c/p\u003e\n \u003cp\u003e8 (22.9)\u003c/p\u003e\n \u003cp\u003e0.667\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e5 (4.0)\u003c/p\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e0.587\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e1 (0.8)\u003c/p\u003e\n \u003cp\u003e1 (2.9)\u003c/p\u003e\n \u003cp\u003e0.393\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e7 (5.6)\u003c/p\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e0.349\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e16 (12.9)\u003c/p\u003e\n \u003cp\u003e3 (8.6)\u003c/p\u003e\n \u003cp\u003e0.768\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eEducation level \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 187px;\"\u003e\n \u003cp\u003eKindergarten\u003c/p\u003e\n \u003cp\u003eBasic school\u003c/p\u003e\n \u003cp\u003eSecondary school\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e\n \u003cp\u003eX\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003e9 (34.6)\u003c/p\u003e\n \u003cp\u003e32 (30.8)\u003c/p\u003e\n \u003cp\u003e9 (31.0)\u003c/p\u003e\n \u003cp\u003e0.967\u003c/p\u003e\n \u003cp\u003e0.218\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e7 (26.9)\u003c/p\u003e\n \u003cp\u003e27 (26)\u003c/p\u003e\n \u003cp\u003e9 (31.0)\u003c/p\u003e\n \u003cp\u003e0.838\u003c/p\u003e\n \u003cp\u003e0.392\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e2 (7.7)\u003c/p\u003e\n \u003cp\u003e3 (2.9)\u003c/p\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e0.300\u003c/p\u003e\n \u003cp\u003e2.301\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e2 (1.9)\u003c/p\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003cp\u003e0.605\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e2 (7.7)\u003c/p\u003e\n \u003cp\u003e5 (4.8)\u003c/p\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e0.367\u003c/p\u003e\n \u003cp\u003e1.864\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e3 (11.5)\u003c/p\u003e\n \u003cp\u003e14 (13.5)\u003c/p\u003e\n \u003cp\u003e2 (6.9)\u003c/p\u003e\n \u003cp\u003e0.719\u003c/p\u003e\n \u003cp\u003e0.757\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTonsil hyperemia and hyperplasia \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 187px;\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003cp\u003eP value\u003c/p\u003e\n \u003cp\u003eX\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003e46 (35.9)\u003c/p\u003e\n \u003cp\u003e4 (12.9)\u003c/p\u003e\n \u003cp\u003e0.017\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e39 (30.5)\u003c/p\u003e\n \u003cp\u003e4 (12.9)\u003c/p\u003e\n \u003cp\u003e0.070\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e5 (3.9)\u003c/p\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e0.584\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e2 (1.6)\u003c/p\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e7 (5.5)\u003c/p\u003e\n \u003cp\u003e0 (0)\u003c/p\u003e\n \u003cp\u003e0.347\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e18 (14.1)\u003c/p\u003e\n \u003cp\u003e1 (3.2)\u003c/p\u003e\n \u003cp\u003e0.126\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 145px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLymphadenopathy \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 187px;\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e\n \u003cp\u003eX\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003e27 (35.5)\u003c/p\u003e\n \u003cp\u003e23 (27.7)\u003c/p\u003e\n \u003cp\u003e0.967\u003c/p\u003e\n \u003cp\u003e0.218\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e23 (30.3)\u003c/p\u003e\n \u003cp\u003e20 (24.1)\u003c/p\u003e\n \u003cp\u003e0.382\u003c/p\u003e\n \u003cp\u003e0.765\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e3 (3.9)\u003c/p\u003e\n \u003cp\u003e2 (2.4)\u003c/p\u003e\n \u003cp\u003e0.920\u003c/p\u003e\n \u003cp\u003e0.010\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 60px;\"\u003e\n \u003cp\u003e1 (1.3)\u003c/p\u003e\n \u003cp\u003e1 (1.2)\u003c/p\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e3 (3.9)\u003c/p\u003e\n \u003cp\u003e4 (4.8)\u003c/p\u003e\n \u003cp\u003e1.000\u003c/p\u003e\n \u003cp\u003e0000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 72px;\"\u003e\n \u003cp\u003e10 (13.2)\u003c/p\u003e\n \u003cp\u003e9 (10.8)\u003c/p\u003e\n \u003cp\u003e0.653\u003c/p\u003e\n \u003cp\u003e0.202\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eN: Number; X\u003csup\u003e2\u003c/sup\u003e: Chi-square; MRGAS: Macrolide resistant Group A Streptococcus; cMLS\u003csub\u003eB\u003c/sub\u003e: constitutive Macrolide, lincosamide and streptogramin B; iMLS\u003csub\u003eB\u003c/sub\u003e: induced Macrolide, lincosamide and streptogramin B\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4: Relationship of macrolide resistance with Tonsil hyperemia and hyperplasia \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"641\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 231px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eVariable\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 204px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBinary\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 207px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMultinomial\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 140px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCOR (95%CI)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eP\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAOR (95%CI)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eP\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 231px;\"\u003e\n \u003cp\u003eTonsil hyperemia and hyperplasia \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 140px;\"\u003e\n \u003cp\u003e3.787 (1.247-11.495)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003e0.019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp\u003e3.780 (1.244-11.487)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003e0.019\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eCOR: Crude odds ratio, AOR: Adjusted odds ratio (Gender adjusted), CI: Confidence interval\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2. Discussion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe causative agent of tonsillitis (\u003cem\u003eS. pyogenes\u003c/em\u003e) is responsible for several illnesses and deaths globally. Streptococcal infections range from acute pharyngitis to life-threatening pyogenic or toxigenic infections, such as toxic shock syndrome [33]. The emergence of\u003cem\u003e\u0026nbsp;macrolide-resistant S. pyogenes strains\u003c/em\u003e was a growing problem documented worldwide [34]. Thus, we aimed to estimate the prevalence of macrolide resistance and characterize the resistance genes in \u003cem\u003eS. pyogenes\u003c/em\u003e strains isolated from patients with tonsillitis attending Kosti Teaching Hospital (Kosti city, Sudan) during 2019-2021.\u003c/p\u003e\n\u003cp\u003eThe frequency of macrolide resistance varies across locations. In the present study, the rate of macrolide resistance was 31.4%. This rate is comparable to a survey by Hirakata et al. [12] in Japan, which documented an MR \u003cem\u003eS. pyogenes\u003c/em\u003e rate of 30%-40%. In contrast, it was higher than the findings of a study by Wajima et al. [35], which concluded that the frequency of MRGAS was less than 10%. Compared with Italy [41], the present study\u0026apos;s finding was higher. It was also higher than the findings of many studies conducted in Ethiopia [42,43]. The divergence between study results could be attributed to variation in sample size, study area, population and duration, and methods. Overall, the study findings highlighted and provided evidence regarding the epidemiology of macrolide resistance. An alarming rate of macrolide resistance in the current study area suggests the need for a comprehensive surveillance program. In some Asian countries, the MR rate has decreased, including Taiwan and Korea [36,37]. However, this problem has been persistently higher in China [38,39]. Concerning European countries, macrolide resistance reduced in Germany and France [40]. The infection with antibiotic-resistant bacteria may be associated with severe infections, prolonged stay in hospital, elevated healthcare costs, and risk of complications, or raised morbidity and deaths [44].\u003c/p\u003e\n\u003cp\u003eIn the present research, we reported the M phenotype of macrolide resistance as the predominant phenotype (27%), followed by the cMLSB phenotype (3.1%), whereas iMLSB was the least frequent phenotype (1.3%). The current results were more relevant to several previous studies carried out in various countries, such as Greece [45], Austria and Hungary [46], Germany [47], Spain [48], Argentina [49], and Serbia [50], which stated the M phenotype as the predominant phenotype among the \u003cem\u003eS. pyogenes\u0026nbsp;\u003c/em\u003eisolates. Unlike the current study, a previous study [50] reported the iMLSB phenotype as more common than the cMLS\u003csub\u003eB\u003c/sub\u003e phenotype. Likewise, an equal distribution of the M and iMLS\u003csub\u003eB\u003c/sub\u003e phenotypes was reported from the European section of Turkey, which differs from the current study\u0026apos;s results [51]. Previously, iMLS\u003csub\u003eB\u003c/sub\u003e and cMLS\u003csub\u003eB\u003c/sub\u003e phenotypes were reported as predominant in Korea, which differs from the present study\u0026apos;s outcomes [52]. Contrary to the current study\u0026apos;s results, several studies in Tunis reported that cMLSB \u003cem\u003eS. pyogenes\u003c/em\u003e strains that harbor the \u003cem\u003eErmB\u003c/em\u003e gene were predominant [53-55]. Similar results regarding this fact were seen in different countries around the world, include Italy [56], Portugal [57], Korea [58], India [59], Japan [60], and China [61]. Previously, M phenotype strains, which harbor the MefA gene, have been reported as predominant GAS strains in Europe, including\u003cem\u003e\u0026nbsp;Spain [16, 62, 63], Norway [64], and Greece [65, 66\u003c/em\u003e]. M phenotype was also predominant in Mexico [67,68], Taiwan [36], Serbia [69], and Egypt [70]. Reasonably, the variation between these findings may be due to differences in sample size, seasonal period, or other factors. The differences between studies may also suggest variability in GAS strains, which are directly linked to the rates of MR phenotypes (M phenotypes, cMLSB, and iMLSB) and to antibiotic prescription and consumption strategies across different locations globally.\u003c/p\u003e\n\u003cp\u003eThe current study revealed that the predominant gene among \u003cem\u003eS. pyogenes\u0026nbsp;\u003c/em\u003eisolates was \u003cem\u003eErmC\u0026nbsp;\u003c/em\u003e(11.9%), followed by \u003cem\u003eErmB\u0026nbsp;\u003c/em\u003e(4.4%). This finding suggests a higher frequency of these genes in the current study area, but it requires further study with a larger sample size to verify. In contrast to our findings, the Mart\u0026iacute;nez et al. study didn\u0026rsquo;t detect \u003cem\u003eErmC\u003c/em\u003e in \u003cem\u003eS. pyogenes\u0026nbsp;\u003c/em\u003eisolates [49]. Surprisingly, neither the \u003cem\u003eErmA\u003c/em\u003e nor the \u003cem\u003eMefA\u003c/em\u003e gene was detected in our study, which is consistent with the findings of the Mart\u0026iacute;nez et al. study regarding\u003cem\u003e\u0026nbsp;ErmA\u0026nbsp;\u003c/em\u003e[49]. In Iraq, Ali \u003cem\u003eet al\u003c/em\u003e study that none of the studied \u003cem\u003eS. pyogenes\u0026nbsp;\u003c/em\u003estrains carried \u003cem\u003eErm\u003c/em\u003e genes [30]. These results suggest the variations in epidemiology of MRGAS strains. Interestingly, we observed significant discordance between the phenotype and genotype of \u003cem\u003eS. pyogenes\u003c/em\u003e. Specifically, 24 macrolide-resistant \u003cem\u003eS. pyogenes\u003c/em\u003e isolates did not harbor the \u003cem\u003eErm\u003c/em\u003e (A, B, C) or \u003cem\u003eMefA\u003c/em\u003e gene. Similarly, the Malbruny et al. study showed that two azithromycin-resistant strains lacked both the \u003cem\u003eErm\u003c/em\u003e and \u003cem\u003eMefA\u003c/em\u003e genes [71]. Altogether, this could suggest the presence of other resistance mechanisms or possibly a mutation in the 23S rRNA [72].\u003c/p\u003e\n\u003cp\u003eIn this study, there was no statistical difference in MR rates or in MR phenotypes and genotypes across gender, age groups, residence, and education levels. These outcomes may be due to the small sample size in the current study. Regular monitoring of antibiotic resistance epidemiology and its link with socio-demographic features is crucial for the effective management of GAS tonsillitis. Importantly, macrolide-nonsusceptible \u003cem\u003eS. pyogenes\u003c/em\u003e isolates were significantly (P \u0026lt; 0.05) associated with tonsil hyperemia and hyperplasia. Still, this result requires additional studies in microbiology, immunology, pathology, pharmacology, and molecular biology to understand better.\u003c/p\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eThe present work highlighted the epidemiology of macrolide resistance in S. pyogenes isolated from patients with tonsillitis. The study demonstrates a concerning prevalence of macrolide resistance (31.4%) in the study area, primarily mediated by the M phenotype and associated with tonsil hyperemia and hyperplasia. This finding, based on local data, suggests the need for enhanced surveillance. Further studies with larger sample sizes are necessary to better understand the macrolide resistance patterns in \u003cem\u003eS. pyogenes\u003c/em\u003e across Sudan.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eLimitations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study has some limitations that should be acknowledged. First, the sample size was moderate, which may influence the extent to which the findings can be generalized to broader populations. Second, resistance gene detection was based on PCR amplification using specific primers, and no sequencing analysis was performed; therefore, nucleotide sequence data were not generated. Third, other potential mechanisms of macrolide resistance, such as ribosomal mutations or additional efflux systems, were beyond the scope of this work. Nonetheless, the study provides valuable regional insights into\u003cem\u003e\u0026nbsp;S. pyogenes\u003c/em\u003e macrolide resistance and establishes a useful foundation for future molecular and epidemiological investigations.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe want to express our sincere gratitude to the study subjects and staff at Kosti Teaching Hospital. We would also like to thank the patients for cooperating during the procedures.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEBA and NA were responsible for conceptualization. EBA, EAA, BSA, and AMN were responsible for investigation and data curation. EBA and YMAA were accountable for methodology, formal analysis, and visualization. \u0026nbsp;EAA and NA were responsible for supervision. EBA, BMTG, and NA were responsible for drafting the manuscript and for critical review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author(s) did not receive any financial support to report.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support this study\u0026rsquo;s findings are not publicly accessible due to sensitivity and privacy concerns, but can be obtained from the corresponding author upon reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study protocol was approved by the Ethical Review Committee of the Research Unit at Kosti Teaching Hospital, White Nile State \u003cstrong\u003e(Approval No: 04, Date: 4/7/2019).\u003c/strong\u003e Administrative permission was also granted by the Faculty of Postgraduate Studies at Omdurman Islamic University, Khartoum. Written informed consent was obtained from the parent or legal guardian of each participating child before enrollment. All participants were assigned a unique code to ensure anonymity and protect their privacy throughout the study. All procedures were conducted in accordance with the ethical principles of the Declaration of Helsinki. As this study was observational and not a clinical trial, a clinical trial registration number is not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConsent statements for publication have been obtained from all participants before enrollment in the study. All authors consent to publish this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eCarapetis JR, Steer AC, Mulholland EK, Weber M. The global burden of group A streptococcal diseases. The Lancet infectious diseases 2005 Nov 1;5(11):685-94.\u003c/li\u003e\n \u003cli\u003eBisno AL, Gerber MA, Gwaltney Jr JM, Kaplan EL, Schwartz RH. Practice guidelines for the diagnosis and management of group A streptococcal pharyngitis. Clinical infectious diseases 2002 Jul 15:113-25.\u003c/li\u003e\n \u003cli\u003eLeclercq R. Mechanisms of resistance to macrolides and lincosamides: nature of the resistance elements and their clinical implications.Clinical infectious diseases 2002 Feb 15;34(4):482-92.\u003c/li\u003e\n \u003cli\u003eRoberts MC, Sutcliffe J, Courvalin P, Jensen LB, Rood J, Seppala H. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. \u0026nbsp; Antimicrobial agents and chemotherapy 1999 Dec 1;43(12):2823-30.\u003c/li\u003e\n \u003cli\u003eRoberts MC. Update on macrolide\u0026ndash;lincosamide\u0026ndash;streptogramin, ketolide, and oxazolidinone resistance genes.FEMS microbiology letters 2008 May 1;282(2):147-59.\u003c/li\u003e\n \u003cli\u003eMorita JY, Kahn E, Thompson T, Laclaire L, Beall B, Gherardi G, O\u0026apos;BRIEN KL, Schwartz B. Impact of azithromycin on oropharyngeal carriage of group A Streptococcus and nasopharyngeal carriage of macrolide-resistant Streptococcus pneumoniae. The \u0026nbsp; Pediatric infectious disease journal 2000 Jan 1;19(1):41-6.\u003c/li\u003e\n \u003cli\u003eMcEwen SA, Fedorka-Cray PJ. Antimicrobial use and resistance in animals. Clinical \u0026nbsp;infectious diseases 2002 Jun 1;34(Supplement_3):S93-106.\u003c/li\u003e\n \u003cli\u003eVaz-Moreira I, Nunes OC, Manaia CM. Bacterial diversity and antibiotic resistance in water habitats: searching the links with the human microbiome. FEMS microbiology reviews 2014 Jul 1;38(4):761-78.\u003c/li\u003e\n \u003cli\u003eKlugman KP, Lonks JR. Hidden epidemic of macrolide-resistant pneumococci. Emerging \u0026nbsp;infectious diseases 2005 Jun;11(6):802.\u003c/li\u003e\n \u003cli\u003eRubio-L\u0026oacute;pez V, Valdezate S, \u0026Aacute;lvarez D, Villal\u0026oacute;n P, Medina MJ, Salcedo C, S\u0026aacute;ez-Nieto JA. Molecular epidemiology, antimicrobial susceptibilities, and resistance mechanisms of Streptococcus pyogenes isolates resistant to erythromycin and tetracycline in Spain (1994\u0026ndash;2006). BMC microbiology 2012 Dec;12(1):1-1.\u003c/li\u003e\n \u003cli\u003eSyrogiannopoulos GA, Grivea IN, Al-Lahham A, Panagiotou M, Tsantouli AG, Michoula Ralf Ren\u0026eacute; Reinert AN, van der Linden M. Seven-year surveillance of emm types of pediatric Group A streptococcal pharyngitis isolates in Western Greece. PLoS \u0026nbsp;One 2013 ;8(8):e71558.\u003c/li\u003e\n \u003cli\u003eHirakata Y, Komatsu M, Muratani T, Kaku M. Drug susceptibility of bacteria isolated from pediatric respiratory infections at general practitioners\u0026apos; clinics to pediatric antibiotics. The Japanese Journal of Antibiotics 2009 Apr 1;62(2):90-102.\u003c/li\u003e\n \u003cli\u003eVan Heirstraeten L, Coenen S, Lammens C, Hens N, Goossens H, Malhotra-Kumar S. Antimicrobial drug use and macrolide-resistant Streptococcus pyogenes, Belgium.Emerging infectious diseases 2012 Sep;18(9):1515.\u003c/li\u003e\n \u003cli\u003eZhou W, Jiang YM, Wang HJ, Kuang LH, Hu ZQ, Shi H, Shu M, Wan CM. Erythromycin-resistant genes in group A \u0026beta;-haemolytic Streptococci in Chengdu, Southwestern China. Indian Journal of Medical Microbiology 2014 Jul 1;32(3):290-3.\u003c/li\u003e\n \u003cli\u003eGoossens H, Ferech M, Vander Stichele R, Elseviers M, ESAC Project Group. Outpatient antibiotic use in Europe and association with resistance: a cross-national database study. The Lancet 2005 Feb 12;365(9459):579-87.\u003c/li\u003e\n \u003cli\u003eClancy J, Petitpas J, Dib‐Hajj F, Yuan W, Cronan M, Kamath AV, Bergeron J, Retsema JA.Molecular cloning and functional analysis of a novel macrolide‐resistance determinant, mefA, from Streptococcus pyogenes. Molecular microbiology 1996;22(5):867-79.\u003c/li\u003e\n \u003cli\u003eSutcliffe J, Tait-Kamradt A, Wondrack L. Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrobial agents and chemotherapy 1996 Aug;40(8):1817-24.\u003c/li\u003e\n \u003cli\u003eTait-Kamradt A, Clancy J, Cronan M, Dib-Hajj F, Wondrack L, Yuan W, Sutcliffe J. mefE is necessary for the erythromycin-resistant M phenotype in Streptococcus pneumoniae. Antimicrobial agents and chemotherapy 1997 Oct;41(10):2251-5.\u003c/li\u003e\n \u003cli\u003eMalhotra-Kumar S, Lammens C, Coenen S, Van Herck K, Goossens H. Effect of azithromycin and clarithromycin therapy on pharyngeal carriage of macrolide-resistant streptococci in healthy volunteers: a randomised, double-blind, placebo-controlled study. The Lancet 2007 Feb 10;369(9560):482-90.\u003c/li\u003e\n \u003cli\u003eSeppälä H, Skurnik M, Soini H, Roberts MC, Huovinen P. A novel erythromycin \u0026nbsp; resistance methylase gene (ermTR) in Streptococcus pyogenes. Antimicrobial agents and \u0026nbsp; chemotherapy 1998 Feb 1;42(2):257-62.\u003c/li\u003e\n \u003cli\u003eDavies J, Davies D. Origins and evolution of antibiotic resistance. Microbiology and molecular biology reviews 2010 Sep;74(3):417-33.\u003c/li\u003e\n \u003cli\u003eHawkey PM, Jones AM. The changing epidemiology of resistance. Journal of antimicrobial chemotherapy 2009 Sep 1;64(suppl_1):i3-10.\u003c/li\u003e\n \u003cli\u003eLevy SB, Marshall B. Antibacterial resistance worldwide: causes, challenges and responses. Nature medicine 2004 Dec;10(12):S122-9.\u003c/li\u003e\n \u003cli\u003eLi L, Xu L, Zhu R, et al. Effect of prior receipt of antibiotics on the pathogen distribution: a retrospective observational cohort study on 27,792 patients. BMC Infect Dis 2020; 20: 8.\u003c/li\u003e\n \u003cli\u003eHarris AM, Bramley AM, Jain S, Arnold SR, Ampofo K, Self WH, Williams DJ, Anderson EJ, Grijalva CG, McCullers JA, Pavia AT, Wunderink RG, Edwards KM, Winchell JM, Hicks LA. Influence of Antibiotics on the Detection of Bacteria by Culture-Based and Culture-Independent Diagnostic Tests in Patients Hospitalized With Community-Acquired Pneumonia. Open Forum Infect Dis. 2017 Feb 10;4(1):ofx014.\u003c/li\u003e\n \u003cli\u003eGera K, McIver KS. Laboratory growth and maintenance of Streptococcus pyogenes (the Group A Streptococcus, GAS). Current protocols in microbiology. 2013 Oct;30(1):9D-2.\u003c/li\u003e\n \u003cli\u003eShulman ST, Bisno AL, Clegg HW, Gerber MA, Kaplan EL, Lee G, Martin JM, Van Beneden C. Clinical practice guideline for the diagnosis and management of group A streptococcal pharyngitis: 2012 update by the Infectious Diseases Society of America. Clinical infectious diseases 2012 Nov 15;55(10):e86-102.\u003c/li\u003e\n \u003cli\u003eClinical and Laboratory Standards Institute (CLSI). \u003cem\u003ePerformance Standards for Antimicrobial Susceptibility Testing.\u0026nbsp;\u003c/em\u003e28th ed. CLSI supplement M100 (ISBN 1-56238-838-X [Print]; ISBN 1-56238-839-8 [Electronic]). Clinical and Laboratory Standards Institute, 950 West Valley Road, Suite 2500, Wayne, Pennsylvania 19087 USA, 2018.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eTaKaRa MiniBEST Bacteria Genomic DNA Extraction Kit Ver.3.0 Cat. #9763 v201309Da: China. URL:http://www.takara-bio.com\u003c/li\u003e\n \u003cli\u003eAli HN, Dhahi MA, Abd AK. Molecular screening for erythromycin resistance genes in Streptococcus pyogenes isolated from Iraqi patients with tonsilo-pharyngites. African \u0026nbsp; Journal of Biotechnology .2015 Aug 4;14(28):2244-50.\u003c/li\u003e\n \u003cli\u003eMorosini MI, Cant\u0026oacute;n R, Loza E, del Campo R, Almaraz F, Baquero F. Streptococcus pyogenes isolates with characterized macrolide resistance mechanisms in Spain: in vitro activities of telithromycin and cethromycin. J Antimicrob Chemother. 2003;52(1):50-55.\u003c/li\u003e\n \u003cli\u003eNagarkoti D, Prajapati K, Sharma AN, Gyawali A, Manandhar S. Distribution of Macrolide-Lincosamide-Streptogramin B Antibiotics Resistance Genes in Clinical Isolates of Staphylococci. J Nepal Health Res Counc. 2021;18(4):734-740.\u003c/li\u003e\n \u003cli\u003eGherardi G, Petrelli D, Di Luca MC, Pimentel de Araujo F, Bernaschi P, Repetto A, Bellesi J, Vitali LA. Decline in macrolide resistance rates among Streptococcus pyogenes causing pharyngitis in children isolated in Italy. European Journal of Clinical Microbiology \u0026amp; Infectious Diseases 2015 Sep;34(9):1797-802.\u003c/li\u003e\n \u003cli\u003eRay D, Sinha S, Saha S, Karmakar S, Dutta RN, Bhattacharya S, Pal NK, Bhattacharya B. A preliminary sentinel surveillance report on antibiotics resistance trend of Streptococcus pyogenes in Kolkata region, India. Al Ameen J Med Sci 2010;3(2):146-51.\u003c/li\u003e\n \u003cli\u003eWajima T, Murayama SY, Sunaoshi K, Nakayama E, Sunakawa K, Ubukata K. Distribution of emm type and antibiotic susceptibility of group A streptococci causing invasive and noninvasive disease. Journal of Medical Microbiology 2008 Nov 1;57(11):1383-8.\u003c/li\u003e\n \u003cli\u003eHuang CY, Lai JF, Huang IW, Chen PC, Wang HY, Shiau YR, Cheng YW, Hsieh LY, Chang SC, Lauderdale TL. Epidemiology and molecular characterization of macrolide-resistant Streptococcus pyogenes in Taiwan. Journal of clinical microbiology 2014 Feb;52(2):508-16.\u003c/li\u003e\n \u003cli\u003eKim S, Yong Lee N. Antibiotic resistance and genotypic characteristics of group A streptococci associated with acute pharyngitis in Korea. Microbial Drug Resistance 2004 Dec 1;10(4):300-5.\u003c/li\u003e\n \u003cli\u003eLiu X, Shen X, Chang H, Huang G, Fu Z, Zheng Y, Wang L, Li C, Liu L, Shen Y, Yang Y. High macrolide resistance in Streptococcus pyogenes strains isolated from children with pharyngitis in China. Pediatric pulmonology 2009 May;44(5):436-41.\u003c/li\u003e\n \u003cli\u003eLi H, Zhou L, Zhao Y, Ma L, Liu X, Hu J. Molecular epidemiology and antimicrobial resistance of group a streptococcus recovered from patients in Beijing, China. BMC Infect Dis. 2020 Jul 13;20(1):507.\u003c/li\u003e\n \u003cli\u003ed\u0026rsquo;Humi\u0026egrave;res, C., Cohen, R., Levy, C., Bidet, P., Thollot, F., Wollner, A. and Bingen, E. Decline in macrolide-resistant Streptococcus pyogenes isolates from French children. \u003cem\u003eInternational Journal of Medical Microbiology\u003c/em\u003e 2012;\u003cem\u003e302\u003c/em\u003e(7-8), pp.300-303.\u003c/li\u003e\n \u003cli\u003eOlivieri R, Morandi M, Zanchi A, Tordini G, Pozzi G, De Luca A, Montagnani F. Evolution of macrolide resistance in Streptococcus pyogenes over 14 years in an area of central Italy. J Med Microbiol. 2015 Oct;64(10):1186-1195.\u003c/li\u003e\n \u003cli\u003eTadesse M, Hailu Y, Biset S, Ferede G, Gelaw B. Prevalence, Antibiotic Susceptibility Profile and Associated Factors of Group A Streptococcal pharyngitis Among Pediatric Patients with Acute Pharyngitis in Gondar, Northwest Ethiopia. Infect Drug Resist. 2023 Mar 22;16:1637-1648.\u003c/li\u003e\n \u003cli\u003eTesfaw G, Kibru G, Mekonnen D, Abdissa A. Prevalence of group A \u0026beta;-haemolytic Streptococcus among children with pharyngitis in Jimma town, Southwest Ethiopia. Egyptian Journal of Ear, Nose, Throat and Allied Sciences. 2015;16:35-40.\u003c/li\u003e\n \u003cli\u003eKariuki S, Kering K, Wairimu C, Onsare R, Mbae C. Antimicrobial Resistance Rates and Surveillance in Sub-Saharan Africa: Where Are We Now? Infect Drug Resist. 2022 Jul 7;15:3589-3609.\u003c/li\u003e\n \u003cli\u003ePetinaki E, Kontos F, Pratti A, Skulakis C, Maniatis AN. Clinical isolates of macrolide-resistant Streptococcus pyogenes in Central Greece. International journal of antimicrobial agents 2003 Jan 1;21(1):67-70.\u003c/li\u003e\n \u003cli\u003eGattringer R, Sauermann R, Lagler H, Stich K, Buxbaum A, Graninger W, Georgopoulos A. Antimicrobial susceptibility and macrolide resistance genes in Streptococcus pyogenes collected in Austria and Hungary. International journal of antimicrobial agents 2004 Sep 1;24(3):290-3.\u003c/li\u003e\n \u003cli\u003eSauermann, R., Gattringer, R., Graninger, W., Buxbaum, A. and Georgopoulos, A. Phenotypes of macrolide resistance of group A streptococci isolated from outpatients in Bavaria and susceptibility to 16 antibiotics. \u003cem\u003eJournal of Antimicrobial Chemotherapy 2003;51\u003c/em\u003e(1), pp.53-57.\u003c/li\u003e\n \u003cli\u003eAlos JI, Aracil B, Oteo J, Torres C, Gomez-Garces JL. High prevalence of erythromycin-resistant, clindamycin/miocamycin-susceptible (M phenotype) Streptococcus pyogenes: results of a Spanish multicentre study in 1998. Journal of Antimicrobial Chemotherapy 2000 May 1;45(5):605-9.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eMart\u0026iacute;nez S, Amoroso AM, Famiglietti A, de Mier C, Vay C, Gutkind GO. Genetic and phenotypic characterization of resistance to macrolides in Streptococcus pyogenes from Argentina. International journal of antimicrobial agents 2004 Jan 1;23(1):95-8.\u003c/li\u003e\n \u003cli\u003ePavlovic L, Grego E, Sipetic-Grujicic S. Prevalence of macrolide resistance in Streptococcus pyogenes collected in Serbia. Japanese journal of infectious diseases 2010 Jul 1;63(4):275-6.\u003c/li\u003e\n \u003cli\u003eAkata F, \u0026Ouml;zt\u0026uuml;rk D, Tansel \u0026Ouml;, Tatman-Otkun M, Otkun M, Fitoussi F, Bingen E, Tugrul M. Resistance to macrolides in Group A streptococci from the European section of Turkey: genetic and phenotypic characterization. International journal of antimicrobial agents 2002 Dec 1;20(6):461-3.\u003c/li\u003e\n \u003cli\u003eBae SY, Kim JS, Kwon JA, Yoon SY, Lim CS, Lee KN, Cho Y, Kim YK, Lee CK. Phenotypes and genotypes of macrolide-resistant Streptococcus pyogenes isolated in Seoul, Korea. Journal of medical microbiology 2007 Feb 1;56(2):229-35.\u003c/li\u003e\n \u003cli\u003eHraoui M, Boutiba‐Ben Boubaker I, Doloy A, Samir E, Ben Redjeb S, Bouvet A. Epidemiological markers of Streptococcus pyogenes strains in Tunisia. Clinical microbiology and infection 2011 Jan;17(1):63-8.\u003c/li\u003e\n \u003cli\u003eKsia S, Smaoui H, Kechrid A, Bouvet A. Streptococcus pyogenes isolated in a Tunisian pediatric population: Emm types, T types, virulence factors and genes of resistance to macrolide and tetracycline. Malaysian Journal of Microbiology 2013:24-32.\u003c/li\u003e\n \u003cli\u003eHraoui M, Boubaker IB, Doloy A, Redjeb SB, Bouvet A. Molecular mechanisms of tetracycline and macrolide resistance and emm characterization of Streptococcus pyogenes isolates in Tunisia. Microbial Drug Resistance 2011 Aug 1;17(3):377-82.\u003c/li\u003e\n \u003cli\u003eGherardi G, Petrelli D, Di Luca MC, Pimentel de Araujo F, Bernaschi P, Repetto A, Bellesi J, Vitali LA. Decline in macrolide resistance rates among Streptococcus pyogenes causing pharyngitis in children isolated in Italy. European Journal of Clinical Microbiology \u0026amp; Infectious Diseases. 2015 Sep;34(9):1797-802.\u003c/li\u003e\n \u003cli\u003eSilva-Costa C, Ramirez M, Melo-Cristino J, Portuguese Group for the Study of Streptococcal Infections, Vaz T, Gi\u0026atilde;o M, Ferreira R, Klyeshtorna I, Fonseca AB, Oliveira H, Silva AC. Declining macrolide resistance in Streptococcus pyogenes in Portugal (2007\u0026ndash;13) was accompanied by continuous clonal changes. Journal of Antimicrobial Chemotherapy. 2015 Oct 1;70(10):2729-33.\u003c/li\u003e\n \u003cli\u003eKoh E, Kim S. Decline in erythromycin resistance in group A streptococci from acute pharyngitis due to changes in the emm genotypes rather than restriction of antibiotic use. The Korean journal of laboratory medicine. 2010 Oct 1;30(5):485-90.\u003c/li\u003e\n \u003cli\u003eShivekar S, Menon T. Molecular basis for erythromycin resistance in group A Streptococcus isolated from skin and soft tissue infections. Journal of Clinical and Diagnostic Research: JCDR. 2015 Nov;9(11):DC21.\u003c/li\u003e\n \u003cli\u003eTakahashi T, Arai K, Lee DH, Koh EH, Yoshida H, Yano H, Kaku M, Kim S. Epidemiological study of erythromycin-resistant Streptococcus pyogenes from Korea and Japan by emm genotyping and multilocus sequence typing. Annals of laboratory medicine.. 2016 Jan 1;36(1):9-61.\u003c/li\u003e\n \u003cli\u003eYou YH, Song YY, Yan XM, Wang HB, Zhang MH, Tao XX, Li LL, Zhang YX, Jiang XH, Zhang BH, Hao ZH. Molecular epidemiological characteristics of Streptococcus pyogenes strains involved in an outbreak of scarlet fever in China, 2011. Biomedical and Environmental Sciences. 2013 Nov 1;26(11):877-85.\u003c/li\u003e\n \u003cli\u003eMontes M, Tamayo E, Mojica C, Garc\u0026iacute;a-Arenzana JM, Esnal O, P\u0026eacute;rez-Trallero E. What causes decreased erythromycin resistance in Streptococcus pyogenes? Dynamics of four clones in a southern European region from 2005 to 2012. Journal of Antimicrobial Chemotherapy. 2014 Jun 1;69(6):1474-82.\u003c/li\u003e\n \u003cli\u003eP\u0026eacute;rez-Trallero E, Mart\u0026iacute;n-Herrero JE, Maz\u0026oacute;n A, Garc\u0026iacute;a-Delafuente C, Robles P, Iriarte V, Dal-R\u0026eacute; R, Garc\u0026iacute;a-de-Lomas J. Antimicrobial resistance among respiratory pathogens in Spain: latest data and changes over 11 years (1996-1997 to 2006-2007). Antimicrobial agents and chemotherapy. 2010 Jul;54(7):2953-9.\u003c/li\u003e\n \u003cli\u003eLittauer P, Caugant DA, Sangvik M, H\u0026oslash;iby EA, Sundsfjord A, Simonsen GS, Norwegian Macrolide Study Group. Macrolide-resistant Streptococcus pyogenes in Norway: population structure and resistance determinants. Antimicrobial agents and chemotherapy. 2006 May;50(5):1896-9.\u003c/li\u003e\n \u003cli\u003eMichos A, Koutouzi FI, Tsakris A, Chatzichristou P, Koutouzis EI, Daikos GL, Stathi A, Syriopoulou VP. Molecular analysis of Streptococcus pyogenes macrolide resistance of paediatric isolates during a 7 year period (2007\u0026ndash;13). Journal of Antimicrobial Chemotherapy. 2016 Aug 1;71(8):2113-7.\u003c/li\u003e\n \u003cli\u003eGrivea, I.N., Al-Lahham, A., Katopodis, G.D., Syrogiannopoulos, G.A. and Reinert, R.R. Resistance to erythromycin and telithromycin in Streptococcus pyogenes isolates obtained between 1999 and 2002 from Greek children with tonsillopharyngitis: phenotypic and genotypic analysis. \u003cem\u003eAntimicrobial agents and chemotherapy 2006;50\u003c/em\u003e(1), pp.256-261\u003c/li\u003e\n \u003cli\u003eS\u0026aacute;nchez RR, Paz RF, Mendez CP, Alba MA. Antimicrobial susceptibility of beta haemolytic Streptococci isolated from paediatric patients with pharyngoamigdalitis. Fam Med Med Sci Res 2015;4(151):2.\u003c/li\u003e\n \u003cli\u003eVillase\u0026ntilde;or-Sierra, A., Katahira, E., Jaramillo-Valdivia, A.N., de los Angeles Barajas-Garc\u0026iacute;a, M., Bryant, A., Morf\u0026iacute;n-Otero, R., M\u0026aacute;rquez-D\u0026iacute;az, F., Tinoco, J.C., S\u0026aacute;nchez-Corona, J. and Stevens, D.L. Phenotypes and genotypes of erythromycin-resistant Streptococcus pyogenes strains isolated from invasive and non-invasive infections from Mexico and the USA during 1999\u0026ndash;2010. \u003cem\u003eInternational journal of infectious diseases 2012;16\u003c/em\u003e(3), pp.e178-e181.\u003c/li\u003e\n \u003cli\u003eOpavski N, Gajic I, Borek AL, Obszańska K, Stanojevic M, Lazarevic I, Ranin L, Sitkiewicz I, Mijac V. Molecular characterization of macrolide resistant Streptococcus pyogenes isolates from pharyngitis patients in Serbia. \u0026nbsp;Infection, Genetics and Evolution 2015 Jul 1;33:246-52.\u003c/li\u003e\n \u003cli\u003eIbrahim SB, El-Sokkary RH, Elhewala AA, El-Anwar MW, Awad WM, Hamed AM, Badawy II. Emerging resistance to erythromycin and penicillin among Streptococcus pyogenes isolates in Zagazig, Egypt. Int J Curr Microbiol App Sci 2014;3(10):750-6.\u003c/li\u003e\n \u003cli\u003eMalbruny B, Nagai K, Coquemont M, Bozdogan B, Andrasevic AT, Hupkova H, Leclercq R, Appelbaum PC. Resistance to macrolides in clinical isolates of Streptococcus pyogenes due to ribosomal mutations. Journal of Antimicrobial Chemotherapy 2002 Jun 1;49(6):935-9.\u003c/li\u003e\n \u003cli\u003eLu B, Fang Y, Fan Y, Chen X, Wang J, Zeng J, Li Y, Zhang Z, Huang L, Li H, Li D. High prevalence of macrolide-resistance and molecular characterization of Streptococcus pyogenes isolates circulating in China from 2009 to 2016. Frontiers in microbiology 2017 Jun 8;8:1052.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Streptococcus pyogenes, Macrolides, ErmA, MefA, ErmB","lastPublishedDoi":"10.21203/rs.3.rs-7929845/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7929845/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003eStreptococcal tonsillitis is a global health challenge.\u003cstrong\u003e \u003c/strong\u003eThe current study aimed to determine the frequency of macrolide resistance phenotypes and genotypes in \u003cem\u003eS. pyogenes \u003c/em\u003eand to examine the association between resistance genes and clinical factors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethod:\u003c/strong\u003eFrom 2019 to 2021, 159 \u003cem\u003eS. pyogenes\u003c/em\u003e strains were isolated from children with tonsillitis. The macrolide resistance phenotype was determined by performing a double-disk diffusion test according to the Clinical and Laboratory Standards Institute guidelines. PCR has detected macrolide resistance genes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: In this study, 31.4% (50/159) of \u003cem\u003eS. pyogenes\u003c/em\u003e strains were macrolide-resistant. The resistance rate was higher in isolates from females (33.7%, 32/95) than in isolates from males (28.1%, 18/64), but this difference was not significant (P = 0.459). Our results revealed that macrolide-resistant \u003cem\u003eS. pyogenes \u003c/em\u003eis associated with tonsil hyperemia and hyperplasia (\u003cem\u003eP\u003c/em\u003e=0.044). Based on the double-disk diffusion test, the frequencies of M phenotype, cMLSB, and iMLSB among isolates were 27% (43/159), 3% (5/159), and 1% (2/159), respectively. The amplification of genes showed that 11.9% (19/159) of the strains harbored\u003cem\u003e ErmC \u003c/em\u003eand 4.4% (7/159) carried \u003cem\u003eErmB\u003c/em\u003e genes. In contrast, both \u003cem\u003eErmA\u003c/em\u003eand \u003cem\u003eMef\u003c/em\u003eA\u003cem\u003e \u003c/em\u003egenes were not detected in \u003cem\u003eS. pyogenes\u003c/em\u003eisolates. On regression analysis, macrolide resistance was associated with tonsil hyperemia and hyperplasia (AOR: 3.780, 95%CI:1.244-11.487, \u003cem\u003eP\u003c/em\u003e=0.019).There was no significant variation in the rate of resistance phenotypes or in the \u003cem\u003eErmA\u003c/em\u003e and \u003cem\u003eMefA\u003c/em\u003e genes among subjects’ characteristics or clinical data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThis study provides insight into the epidemiology of macrolide resistance in \u003cem\u003eS. pyogenes \u003c/em\u003ewithin the study area. Although the rate of resistance is considerable, the findings should be interpreted with caution due to the limited sample size and absence of DNA sequencing data. Broader, multicenter studies incorporating molecular sequencing and whole-genome analysis are recommended to clarify the genetic basis of macrolide resistance in \u003cem\u003eS. pyogenes.\u003c/em\u003e\u003c/p\u003e","manuscriptTitle":"Macrolide Resistance in Streptococcus pyogenes from Tonsillitis Patients: Phenotypic Profiles, Resistance Genes, and Clinical Associations","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-08 14:02:18","doi":"10.21203/rs.3.rs-7929845/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"85f7eea5-12bb-44c3-8863-c45e32a13bbb","owner":[],"postedDate":"January 8th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-01-08T14:02:19+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-08 14:02:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7929845","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7929845","identity":"rs-7929845","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.