HTLV-1-infected cells drive the differentiation of monocytes into macrophages in vitro

HTLV-1-infected cells drive the differentiation of monocytes into macrophages in vitro | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article HTLV-1-infected cells drive the differentiation of monocytes into macrophages in vitro Sabrina Pires Maciel Souza, Guilherme A. Melo, Carolina Calôba, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4359860/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 20 Mar, 2025 Read the published version in BMC Immunology → Version 1 posted 4 You are reading this latest preprint version Abstract Background. The human T-cell lymphotropic virus type 1 (HTLV-1) is a retrovirus that causes HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). HAM/TSP is a chronic inflammatory neurodegenerative disease characterized by leukocyte infiltration in the spinal cord. T-lymphocytes are the most important targets of HTLV-1 infection, but monocytes are also infected. Monocytes from HTLV-1-infected individuals exhibit important functional differences compared to cells from uninfected donors. Here, we investigated the effects of cell-cell physical contact and/or secreted factors of HTLV-1-infected cells in monocyte activation and differentiation. Methods. The THP-1 human monocytic cell line was co-cultured with a human cell line transformed by HTLV-1 (MT-2) for 6 days. To determine the effects of co-culturing HTLV-1-infected cells in THP-1 monocytes cells were characterized by flow cytometry, immunofluorescence microscopy, and real-time PCR. Computational analysis of published transcriptomic datasets was realized to investigate molecular profiles of macrophages with mononuclear cells from HTLV-1 carriers. Results. Co-culture of monocytes with HTLV-1-infected cells induced macrophage differentiation and upregulation of typical macrophages-associated molecules (HLA-DR, CD80, and CD86), increased cytokine (TNFα, IL-6, and IL-1β) levels and their coding genes. Consistently, published transcriptomic datasets showed changes in important genes associated with inflammation during HAM/TSP in patients. The presence of HTLV-1-infected cells in the culture also induced significant upregulation of Interferon Stimulated Genes (ISG), indicating viral infection. Monocyte activation and differentiation into pro-inflammatory macrophages occurred in a cell-to-cell contact-independent manner, suggesting the role of factors secreted by infected cells. Conclusions. Together our results indicated that the presence of HTLV-1-infected cells can induce monocyte differentiation into macrophages, predominantly, inflammatory. HTLV-1 monocyte macrophage cell differentiation inflammatory phenotype Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background The human T-cell lymphotropic virus type 1 (HTLV-1) is a retrovirus associated with myelopathy/tropical spastic paraparesis (HAM/TSP) and adult T leukemia/lymphoma (ATLL) [ 1 , 2 ]. HTLV-1 is endemic and widely distributed among different ethnicities and regions, prevailing in Africa, Japan, and Central and South America. Worldwide, it is estimated that around 15 to 20 million individuals are living with HTLV-1 [ 3 ]. HAM/TSP is a chronic inflammatory disease characterized by leukocyte infiltration into the spinal cord, causing degeneration and loss of motor capacity [ 4 , 5 ]. HAM/TSP patients can present spastic paraparesis followed by sphincter alterations, peripheral neuropathy, low back pain, erectile dysfunction, cognitive and dysautonomic alterations, and loss of myelin sheath and axons [ 6 – 8 ]. HTLV-1 primarily infects T CD4 + lymphocytes [ 9 , 10 ], but can also infect other cells, such as T CD8 + lymphocytes [ 11 ], natural killer cells [ 12 ], dendritic cells [ 13 ], monocytes, and macrophages [ 14 – 17 ], including colostrum macrophages [ 18 ]. According to the bystander model, described by Bangham (2015), infected cells and activated HTLV-1-specific lymphocytes cross the blood-brain barrier and induce an inflammatory response by IFN-γ, TNF-α, and IL-6 production [ 19 ]. IFN-γ stimulates astrocytes to secrete CXCL10, attracting CX3CR1 + lymphocytes and phagocytes to the Central Nervous System (CNS) [ 20 , 21 ] , . Consequently, these leukocytes induce glial stress, demyelination, and destruction of axons [ 19 ]. Monocytes play an important role in neurodegenerative diseases but are under-investigated during HTLV-1 HAM/TSP. Generally, these cells infiltrate into the CNS after the blood-brain barrier breaks [ 22 ] and differentiate into dendritic cells and M1 (classic) macrophages promoting inflammation [ 23 ]. The impairment of monocyte-derived dendritic cells during HTLV-1 infection has been described. Monocytes obtained from infected individuals and stimulated in vitro with GM-CSF and IL-4 have a reduced capacity to differentiate into dendritic cells compared to non-infected individuals [ 16 ]. Moreover, a lower frequency of these cells has been observed in ATLL and HAM/TSP patients [ 24 , 25 ]. Ziegler-Heitbrock (1989) divided monocytes into three groups according to the expression of CD14 and CD16 (FcRγIII): classical (CD14 high CD16 neg ), intermediate (CD14 + CD16 + ), and non-classical (CD14 low/neg CD16 high ) [ 26 ]. In patients with acquired immunodeficiency syndrome (AIDS), intermediate monocytes (CD14 + CD16 + ) expand during HIV-1-associated dementia [ 27 , 28 ]. De Castro-Amarante et al . (2015) showed that classical monocytes obtained from individuals with HTLV-1 express higher levels of chemokine receptors CCR5, CXCR3, and CX3CR1 [ 29 ]. This evidence suggests that intermediate monocytes could carry this virus to the CNS [ 30 , 31 ]. Enose-Akahata et al (2012) observed the presence of phagocytes expressing high levels of HLA-DR and CX3CR1 in spinal cord injuries of individuals with HAM/TSP [ 21 ]. Using proteomic analysis, our group revealed important changes in the expression of cytoskeletal proteins in monocytes of HTLV-1 carriers, demonstrating an increase in proteins associated with adhesion and migration phenomena, such as gelsolin [ 17 ]. In this study, we investigated the phenotypic and functional profile of differentiated macrophages using a monocyte cell line (THP-1) co-cultured with HTLV-1 permanently infected cells. We showed that HTLV-1 induces a macrophage differentiation in vitro , characterized by the expression of molecules associated with M1-like phenotype, predominantly, but also with M2-like molecules up-regulated. The comparison of published transcriptomic datasets highlighted inflammatory-associated genes on monocytes and macrophages’ transcriptional signatures from HTLV-1 infected individuals, corroborating our in vitro model. Our study can contribute to understanding the immunopathogenesis of HTLV-1-associated diseases. METHODS Cell culture and THP-1 differentiation HTLV-1 transformed cell line MT-2 [ 32 ] was a gift from Instituto Nacional de Infectologia Evandro Chagas, Fundação Oswaldo Cruz, RJ, Brazil, and Monocytic cell line (THP-1). All cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Lonza) supplemented with 10% fetal bovine serum (FBS) (Gibco/Thermo Fisher), penicillin (100 UI/ml), and streptomycin (100 mg/ml; LGC Biotechnology, Brazil) (complete medium). Cells were cultivated at 37°C in a humidified atmosphere with 5% of CO 2 and were passed twice a week. To induce macrophage differentiation, THP-1 cells were incubated in the presence of 50 ng/ml of Phorbol 12-myristate-13-acetate (PMA; Sigma-Aldrich/Merck) for 72 h in a 37°C humidified atmosphere with 5% of CO 2 . Then, cells were washed with PBS (Sigma-Aldrich/Merck) and incubated with a fresh complete medium under the same conditions [ 33 ]. Concurrently, THP-1 monocytes were co-cultured with MT-2 cells in a 1:2 ratio in a complete medium or in the presence of a conditioned medium from MT-2 or THP-1 cells for 6 days at 37°C in a humidified atmosphere with 5% of CO 2 . To evaluate the cell-contact dependence, THP-1 cells were co-cultured with MT-2 cells (1:2 ratio) in the presence or absence of an insert (0,47 cm 2 0.4 µm pore; Thermo Fisher Scientific) in a complete medium. After 6 days at 37°C in a humidified atmosphere with 5% of CO 2 , the supernatants were collected, and the wells were harvested for phenotypic and/or molecular assay. Cell viability assay Cell viability was assessed using MTT (3-[4,5-dimethylthiazol-2-yl])-2,5-diphenyl tetrazolium bromide (5 mg/mL; Sigma-Aldrich/Merk) and Lactate dehydrogenase (LDH; Invitrogen®) assay, according to the manufacturer’s instructions. Both assays were performed by colorimetry in a SpectraMax® Paradigm® microplate reader (Molecular Devices) at 490 nm wavelength. Cell morphology Cell images were captured through phase-contrast microscopy with magnification objectives 20 and 40. The image analysis system consisted of a light microscope (Olympus CKX41) and a charge-coupled device color camera connected to a computer. All images were stored as TIFF files, using Olympus cell Sens. Image analysis was performed using the ImageJ software. Phenotype characterization To determine the effects of co-culturing HTLV-1-infected cells in THP-1 monocytes we characterize the cell phenotype by flow cytometry and immunofluorescence microscopy. After the co-culture period, supernatant was collected and attached cells were washed twice with PBS. For flow cytometry analyses, adherent cells were then detached and incubated for 30 minutes, on ice, in PBS with 1 mM of EDTA (Sigma-Aldrich/Merck). Cells were stained with anti-human CD14 FITC (clone 61D3, Bioscience), CD80 PE (clone 307.4), CD86 PE (clone 307.4), HLA-DR APC (clone G46-6), CD127 PE-Cy7 (clone HIL-7R-M21) and CD32 PE (clone 3D3), all obtained from BD Pharmigen, for 30 minutes on ice. For intracellular staining, cells were permeabilized using eBioscence (ThermoFisher) Permeabilization buffer according to the manufacturer’s instructions. Then, cells were stained with polyclonal rabbit IgG anti-WARS (Invitrogen/ThermoFisher, PA5-29102) for 30 minutes at room temperature. After that, cells were washed with permeabilization buffer and labeled with a secondary anti-rabbit IgG polyclonal antibody conjugated to fluorochrome Alexa Fluor 488 (ThermoFisher Scientific, A-11034). Then, cells were washed and acquired on FACSCallibur™ or FACSCanto™ (Beckton & Dickinson). Twenty thousand events were acquired gating forward scatter vs. sideward scatter properties to exclude debris and doublets. Frequency and mean fluorescence intensity (MFI) were assessed by FlowJo 10.0 Software. For immunofluorescence analyses, cells were also plated in glass coverslips and, after the differentiation process, were fixed with paraformaldehyde 4% (Sigma-Aldrick/Merck) overnight at 4°C. After washing, cells were permeabilized using Permeabilization buffer according to the manufacturer’s instructions and blocked with 2% of FBS for 2 hours at room temperature. Then, samples were stained with CD68 FITC (clone eBioY1/82A; eBioscience®) overnight at 4°C in a humid chamber. After 3 washes with PBS, the nucleic acids were stained with 1 µg/mL of 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI; Sigma-Aldrich/Merck) for 1 minute at room temperature. Slides were mounted with 30 µL Fluoromount (Sigma-Aldrich/Merck) antifade reagent and analyzed on Leica® fluorescence microscope. Image analyses were performed using the MIF in the Image J Software. Cytokine production Tumor necrosis factor alpha (TNF-α) and Interleukin-6 (IL-6) production were analyzed in THP-1 supernatant from control groups and MT-2/THP1 co-cultured cells using sandwich immunosorbent assay (ELISA) kit according to the manufacturer's instructions (R&D System). Differential gene expression Gene expression was performed by Real-Time polymerase chain reaction (RT-PCR) after RNA isolation and cDNA synthesis. RNAs were isolated using the Quick-RNA™ MiniPrep Plus (Zymo Research®), following the manufacturer’s instructions. RNAs were stored at -80°C until cDNA synthesis was performed using the ImProm-II™ Reverse Transcription (Promega®). cDNAs were synthesized using the PTC-100™ Programmable Thermal Controller (MJR/BioRad) thermocycler and stored at -20ºC until use. RT-PCR was performed using Applied Biosystems™ StepOne™ system with Master Mix Syber Green (QuatroG P&D Ltda), following the manufacturer’s instructions. In Table 1 the specific primers were listed and synthesized by IDT (Coralveille, Iowa, USA). The expression level of each gene was normalized by GAPDH or β-ACTIN and expressed as a fold change concerning the control group (undifferentiated THP-1), using the 2-ΔΔCT method 34 . Each sample was quantified in triplicate and points containing nuclease-free water were used as negative controls. Table 1 Primers used for gene expression by Real-Time PCR. Primer Forward Reverse [ ] β-actin CAGGCACCAGGGCGTGAT GCCAGCCAGGTCCAGACG 200 nM Gapdh GTGAAGGTCGGAGTCAACGG CTCCTGGAAGATGGTGATGGG 200 nM TNF-α TGTAGCAAACCCTCAAGCTG TTGATGGCAGAGAGGAGGTT 200 nM TLR-4 CAGAGTTGCTTTCAATGGCATC AGACTGTAATCAAGAACCTGGAGG 200 nM IL18 AACAAACTATTTGTCGCAGGAAT TGCCACAAAGTTGATGCAAT 200 nM IL6 GCCCAGCTATGAACTCCTTCT CTTCTCCTGGGGGTACTGG 200 nM TLR-2 GGGTCATCATCAGCCTCTCC AGGTCACTGTTGCTAATGTAGGTG 200 nM IL-1β TTACAGTGGCAATGAGGATGAC GTCGGAGATTCGTAGCTGGAT 200 nM MD-2 GCTCAGAAGCAGTATTGGGTCTG CGCTTTGGAAGATTCATGGTG 400 nM ARG1 ACGGAAGAATCAGCCTGGTG GTCCACGTCTCTCTCAAGCCAA 400 nM CCL22 ATCGCCTACAGACTGCACTC GACGGTAACGGACGTAATCAC 200 nM TGF-β GCCCTGGACACCAACTATTGC GCTGCATTGCAGGAGCGCAC 200 nM ISG15 GCCTCAGCTCTGACACC CGAACTCATCTTTGCCAGTACA 200 nM IFN-β ATGACCAACAAGTCTTCAAAG GGAATCCAAGCAAGTTGTAGCTC 200 nM IL-28 TCCAGTCACGGTCAGCA CAGCCTCAGAGTGTTTCTTCT 200 nM IL-29 GAAGACAGGAGAGCTGCAAC GGTTCAAATCTCTGTCACCACA 200 nM OASL GCAGAAATTTCCAGGACCAC CCCATCACGGTCACCATTG 200 nM H2A AGCTCAACAAGCTTCTGGGCAA TTGTGGTGGCTCTCGGTCTTCTT 400 nM H2B TGCGCCCAAGAAGGGTTCTAAA ACGAAGGAGTTCATGATGCCCA 200 nM H4 ACCGTAAAGTACTGCGCGACAA TTCTCCAGGAACACCCTTCAGCA 400 nM H1S4 CCGGTGTCCGAGCTCATTACTAAA GCTTTCTTGAGAGCGGCCAAAGAT 200 nM Qualitative PCR Qualitative PCR was performed using Platinum DreamTaq Green PCR Master mix (Fermentas®) following the manufacturer’s instructions, using the same primers for HTLV-1 tax. The second round of PCR was performed under the same conditions using 2 µl of the products from the first PCR round. The amplification cycle consisted of enzyme activation at 94°C for 3 minutes, 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, and a final extension step at 72°C for 10 minutes. PCR products were electrophoresed in 2% agarose (Sigma-Aldrich/Merck) gel stained with GelRed® (Biotium) in 1× Tris-Borate-EDTA buffer (Invitrogen) at 100 V for 90 min. The bands were visualized using the MiniBis Pro ultraviolet transilluminator (DNR Bio-Imaging Systems Ltd®). Statistical analysis Experimental data were analyzed using the Prisma 8.0 Software. The values expressed in the graphs indicate the mean ± standard error of the mean. Statistical analysis was performed using a two-tailed Student t- test or repeated-measures one-way ANOVA with Bonferroni’s multiple comparison post-test. Values of p < 0.05 were considered significant. Computational analysis of published transcriptomic datasets Datasets GSE29312 of Tattermusch et al ., 2012, and GSE117040 of Gerrick et al ., 2018 were obtained from the Gene Expression Omnibus (GEO) database. The dataset GSE29312 characterizes global gene expression profiles of blood cells taken from AC and HAM/TSP patients by HumanHT-12 V3 or WG6 V3 expression BeadChip arrays (Illumina, San Diego, CA, USA) 35 and the dataset GSE117040 characterized differential gene expression from macrophages derived from human peripheral blood monocytes cultured in the presence of LPS and IFNγ to induce M1 polarization, or IL-4 and IL-13 to induce M2 polarization. The authors used TrueSeq Stranded Total RNA kit (Illumina) to prepare the libraries and sequenced by HS2500 Rapid Run instrument Illumina [ 36 ]. Differential gene expression results from both datasets were downloaded using R Studio GEOquery package software [ 37 ]. Data were visualized using the R packages ggplot2 and ComplexHeatmap [ 38 , 39 ]. RESULTS HTLV-1-infected cells induced macrophage differentiation in vitro To evaluate the monocyte profile during HTLV-1 infection, we used an in vitro system. The human monocytic cell line (THP-1) was cultured with HTLV-1-infected cells (MT-2), previously irradiated, and THP-1 cell morphology and viability were analyzed after 6 days. The co-culture with MT-2 or PMA did not impact cell viability ( Supplementary Fig. 1 ). THP-1 cells showed a non-adherent and rounded morphology of monocytes, as described in the literature (Fig. 1 A). PMA stimulation was used as a positive control for macrophage differentiation [ 33 ]. Interestingly, cells co-cultured with MT-2 spread out and adhered to the plate surface, acquiring a macrophage-like morphology, as also observed for PMA-treated cells (Fig. 1 A). Moreover, THP-1 cells cultured with MT-2 expressed CD68, a surface marker highly expressed in macrophages (Fig. 1 B). These results suggested monocyte differentiation into macrophages in the presence of HTLV-1-infected cells. To further evaluate the differentiation, we explored prototypical macrophage surface molecules. The levels of HLA-DR, a class II MHC molecule, increased in THP-1 cells after co-culture with MT-2 (Fig. 2 A and supplementary Fig. 2 ). The mean fluorescence intensity (MFI) was approximately 50-fold higher compared to undifferentiated cells (THP-1 CTR; Fig. 2 A). Co-stimulatory molecules CD80 and CD86 also increased significantly (Fig. 2 B-C). More than 50% of cells cultured with MT-2 cells expressed CD86, and it was approximately 200-fold higher than THP-1 CTR (Fig. 2 C). No difference was observed in the frequency of cells expressing CD14 (Fig. 2 D) but both THP-1 co-cultured with MT-2 and treated with PMA expressed higher levels of CD14, as demonstrated by the MFI in Fig. 2 D. The frequency of CD32 + (Fcγ receptor II) cells and their MFI were slightly increased after co-culturing with MT-2 or PMA (Fig. 2 E). We also observed an increase in the levels (MFI) of CD127 + (IL-7α receptor) cells after the co-culture compared to the undifferentiated THP-1 (CTR) (Fig. 2 F). Altogether these results support the hypothesis that monocyte differentiation into macrophages is induced by the HTLV-1-infected cells. THP-1 cells co-cultured with HTLV-1-infected cells express high levels of pro-inflammatory genes Monocyte-derived macrophages can polarize into different populations, usually M1 (classic) and M2 (alternative) [ 40 ]. Given that HTLV-1-infected cells induce changes in the THP-1 phenotype, we next evaluated the expression of M1 and M2-associated genes after co-culturing with MT-2. The mRNA levels for pro-inflammatory cytokines TNF-α, IL-6, and IL-1β were upregulated in THP-1 cells (Fig. 3 A). THP-1 macrophages differentiated using PMA and stimulated with LPS for 24 hours were used as a positive control and showed upregulation of pro-inflammatory genes ( Supplementary Fig. 3 ). Similarly, higher concentrations of TNF-α and IL-6 were found in the supernatant of THP-1 co-cultured with MT-2 (Fig. 3 B). Members of the matrix metalloproteinase (MMP) family are highly observed in various inflamed tissues [ 41 ] and MMP1 is an indicator of PMA-induced THP-1 cell differentiation [ 42 ]. MMP-1 was increased in PMA-differentiated cells (4370 ± 725.5 pg/mL) compared to control cells (320.4 ± 320 pg/mL; Fig. 3 C). After co-culture with MT-2, MMP-1 also increased (1024 ± 615.1 pg/mL), but the presence of MT-2 in the culture induced a higher production of MMP-2 (Fig. 3 C). Furthermore, soluble CD14 (sCD14) was highly produced after co-culturing compared to undifferentiated cells (Fig. 3 D) and it is consistent with the high expression of TLR2 and TLR4 (Fig. 3 E). Regarding M2-associated genes, we did not observe upregulation of arginase ( ARG ) or TGF-β (Fig. 3 F). Dexamethasone-treated cells were used as a positive control for M2 differentiation ( Supplementary Fig. 3 ). Interestingly, MD2 and CCL22 were induced by the co-culture with MT-2 (Fig. 3 G) as well as the release of IL-10 in the supernatant (Fig. 3 H). These data suggest the induction of a profile associated with M1 polarization in THP-1 cells co-cultured with HTLV-1-infected cells predominantly. High levels of interferon-stimulated genes were induced in THP-1 cells after co-culture with MT-2 Antiviral responses are characterized by the upregulation of Interferon-Stimulated Genes (ISGs) [ 43 ]. We accessed the expression of some genes of the interferon family (IL-18, IL-28, IL-29, and IFN-β), and ISGs (OASL and ISG15). THP-1 cells co-cultured with MT-2 showed significant upregulation of IL-29, IFN-β, OASL, and ISG15 genes (Fig. 4 A). Positive controls are represented in supplementary Fig. 4. Lee et al ., 2019 demonstrated that tryptophanyl-tRNA synthetase (WARS) is induced and released during viral infection [ 44 ]. This enzyme acts as an alarmin and stimulates type I IFNs production and mutations in WARS gene have been associated with motor neuropathy [ 45 , 46 ]. Figure 4 B shows the upregulation of WARS in THP-1 cultured with MT-2. HTLV-1 infection reduced histone genes transcription in THP-1 macrophages HTLV-1-infected cells undergo epigenetic modifications [ 47 , 48 ]. Moreover, our group demonstrated a negative regulation of histone expression in monocytes of HTLV-1 carriers through proteomic analyses [ 17 ]. We sought to investigate whether the co-culture of THP-1 with MT-2 affects the expression of histones. The mRNA expression of H2A, H2B, H4, and H1S4 is downregulated in THP-1 cells co-cultured with MT-2 (Fig. 5 A-D), suggesting that the macrophage differentiation induced by HTLV-1-infected cells affects histone gene expression. THP-1 co-cultured with MT-2 cells or its supernatant-induced cellular alterations and infection The fact that THP-1 acquired an M1-like phenotype conducted the hypothesis that MT-2 lymphocytes might be contacting THP-1 monocytes and inducing its activation and differentiation to macrophages. To address this hypothesis, THP-1 monocytes, and MT-2 cells were co-cultured with MT-2-filtered supernatant (SN MT2) or an insert to block cell contact. Co-cultured cells without cell contact still induce monocyte differentiation (Fig. 6 A). Pro-inflammatory cytokine IL-6 and ISGs, such as ISG15, OASL, and IFN-β were upregulated in THP-1 cells co-cultured with MT-2 supernatant. Furthermore, the frequency of CD86 + cells increased after co-culture without cell contact (Fig. 6 C). These data suggested that products secreted by MT-2 can induce THP-1 differentiation and activation of genes related to the inflammatory and antiviral response. HTLV-1 infects monocytes and macrophages [ 16 , 18 ]. We next investigated whether THP-1 is infected with HTLV-1, demonstrated by the expression of tax (SK43/44), after co-cultivation with MT-2 cell or its supernatant. This gene was found in THP-1 after the co-culture with MT-2 cells (THP-1 + MT-2) and MT-2 supernatant (+ SN MT-2; Fig. 6 D). These findings indicate that the presence of HTLV-1-infected cells in the culture is enough to induce monocyte activation and differentiation into M1-like macrophages. The cellular changes observed in the present study may be related to the infection of THP-1 cells, including a non-cell contact-dependent manner. Signatures of macrophages and their subpopulations in HTLV-1 patients Changes in phenotypic and functional profiles of monocytes from people living with HTLV-1 have been demonstrated by our group [ 16 , 17 ] and others [ 49 ]. Our in vitro findings demonstrated that HTLV-1 induces macrophage differentiation in an inflammatory profile, predominantly, but also expressing suppressor genes. To evaluate whether this phenotype is observed in HTLV-1 human carriers and further investigate monocytes and macrophages phenotypic and molecular profile, we compared PBMC gene expression data published by Tattermusch et al ., 2012 (GSE29312) [ 35 ] with M1/M2 transcriptional profiles from Gerrick et al ., 2018 (GSE117040) [ 36 ]. 52 genes were commonly expressed on “M1” and “HTLV-1” transcriptional signatures (Fig. 7 A-C, supplementary table 1 ), including genes associated with type 1 interferon ( CCR7 , IL23 , IFITM3 , WARS ) and purinergic receptors ( P2RY2 , P2RY14 ). In contrast, 51 genes were both upregulated in “M2” and “HTLV-1” signatures such as F13A1 (related to coagulation), CASP5 (regulation of the inflammatory response), DNSE1L3 (apoptotic cell death) and CTSC (antigen processing). Interestingly, the ISGs IFIT1/2 , OASL/3 , and IFITM3 were upregulated on the “M2” signature (Fig. 7 C) and were similarly found in THP-1 cultured with MT-2. We also compared “M1” and “M2”-associated genes with HAM/TSP signature. Figure 7 D shows 14 genes in the intersection of “M1” and “HAM/TSP”. Genes associated with antiviral response ( GBP1 , WARS , BTN3A1 , IFITM3 , and GBP5 ) were commonly expressed, as well as purinergic receptors ( P2RY2 and P2RY14 ) and cell death (FAS) genes (Fig. 7 F). The “M2” and “HAM/TSP” also exhibited 8 genes commonly expressed, related to neurodegeneration ( BACE2 ), antiviral response ( GBP5 , CASP5 , GBP1 , IFIT1 , and IFITM3 ), and signal transduction ( PLCL1 ). We presuppose that its upregulation contributes to neuroinflammation and antiviral response. DISCUSSION It is well described that HAM/TSP development and progression involve mononuclear cells, including monocytes and macrophages [ 17 , 21 , 50 ]. Given the difficulty of obtaining animal models to study HTLV-1, we used an in vitro model to characterize monocyte differentiation during the HTLV-1 infection. In this study, we demonstrated that HTLV-1-infected cells induced THP-1 monocyte activation and differentiation into macrophages. THP-1 cells acquired a macrophage morphology, up-regulated the levels of surface molecules (HLA-DR, CD80, CD86, CD14, CD127, TLR4, and TLR2), and increased the expression and/or levels of inflammatory cytokines (IL-6, TNF-α, IL-1β) and MMP2. Surprisingly, the upregulation of M2-associated molecules, such as CCL22, IL-10 , and MD-2 was observed after the co-culture. Moreover, the monocyte interaction with HTLV-1-infected cells resulted in a cellular antiviral state characterized by ISGs expression ( IFN-β, IL-29, OASL , and WARS ). We showed that HTLV-1-infected cells can induce macrophage differentiation and infection regardless of cell contact. We can attribute these findings, at least partially, to viral protein Tax effects on cells. Besides the direct Tax production by infected cells, viral protein is transferred by cell contact or exosomes [ 51 , 52 ]. Tax protein activates several specific transcription factors such as CREB (cAMP response element binding protein), AP-1, NF-κB, JNK, IRF4, and mTOR [ 53 – 55 ]. The hyperactivation of some of these factors was associated with macrophage M1 polarization during bacterial or viral infection [ 56 , 57 ]. Tax protein participates in viral replication, leading to histone ubiquitylation, which can be related to epigenetic modifications (methylation) and protein degradation [ 58 , 59 ].After co-culture THP1 monocytes presented a reduction in the levels of mRNAs for histones ( H2A, H2B, H4, H1S4 ), suggesting an effect on chromatin regulation. Interestingly, our group has demonstrated a reduction of histone expression in monocytes obtained from HTLV-1-infected individuals, using proteomic and immunofluorescence assays [ 17 ]. Furthermore, epigenetic modifications, such as hypomethylation and hypermethylation in H3K4 and H3K27, have been demonstrated during human monocyte differentiation to macrophage [ 60 ]. To further understand monocyte and macrophage profile during the infection and complement our findings, we compared M1 and M2 macrophage transcriptional gene signatures with signatures from PBMCs of HTLV-1-infected donors, including HAM/TSP patients. Common expression of several genes was remarkable: while the M1 signature in asymptomatic infection was marked by genes associated with inflammation, antigen processing, and antiviral response; the M2 signature was highlighted by genes associated with coagulation, apoptosis, and regulation of immune response. Interferon-inducible genes IFITM3, WARS, GBP1, GBP5, CCR7, ISG15 , and OASL were likewise in the intersection of macrophages (M1 and M2) and HTLV-1 or HAM/TSP gene signatures supporting our in vitro findings. Zarei Ghobadi et al . (2020) analyzed three microarray datasets to identify gene transcriptional signatures associated with HAM/TSP development, which we used to associate our data and found an intersection. The authors found 38 modules enriched in HAM/TSP patient signatures [ 61 ], including the IL-10 signaling pathway, associated with M2 phenotype, cytokine detected in this work. The involvement of immunological-related proteins, PSME1 and GBP5, can be considered an intersection of both findings. The PSME1 (or proteasome activator subunit 1) is an immunoproteasome component and is directly connected to the processing of class I MHC peptides [ 61 ]. This molecule was associated with HAM/TSP progression, and we connected this data to HLA-DR, CD80, and CD86 upregulation after THP1 monocytes co-cultured with HTLV-1-infected cells. These molecules are upregulated for effective antigen presentation during APC maturation [ 62 , 63 ]. Moreover, these proteins were also related to M1 polarization during the attenuated strain of Junin virus (etiological agent of Argentine hemorrhagic fever) [ 64 ]. In addition, GBP5 protein (guanine nucleotide binding protein 5) was also detected in the comparison of published datasets and can be associated with M1 macrophage polarization due to its effects. This GTPase was induced by influenza A virus infection, then stimulated infected-cell antiviral state, leading to IFNs type I and III expression genes [ 65 ]. Corroborating our data, it is known that GBP5 also promotes ISGs activation and proinflammatory cytokines production such as TNF-α, IL-6, and IL-1β/IL-18 [ 66 , 67 ]. Additionally, higher levels of IL-18 in cerebrospinal fluid from HAM/TSP patients have been demonstrated and validate this enhancement to neuroinflammation and BBB disruption [ 67 ]. Altogether, our findings propose the ability of monocyte differentiation into macrophages that may contribute to pro-inflammatory and anti-viral responses observed by the upregulation of associated genes. Although few features of M2 macrophages are still found during the infection, we suggest that the M1 phenotype may contribute to HAM/TSP progression based on Zarei Ghobadi et al . (2020) findings [ 61 ]. However, more specific studies are needed to further understand the role of M1 and M2 macrophages and molecular modifications resulting from HTLV-1 infection. Abbreviations HTLV-1: Human T-cell lymphotropic virus type 1 HAM/TSP: HTLV-1-associated myelopathy/tropical spastic paraparesis AC: asymptomatic carriers cDNA: complementary DNA CCL: Chemokine (C-C motif) ligand CCR5: C-C motif chemokine receptor 5 CXCR3: C-X-C motif chemokine receptor 3 CX3CR1: C-X3-C motif chemokine receptor 1 CD: cluster of differentiation DC: dendritic cell DNA: deoxyribonucleic acid GM-CSF: Granulocyte-macrophage colony-stimulating factor GO: Gene Ontology HIV-1: Human Immunodeficiency Virus type 1 IFN-γ: interferon-gamma IL: interleukin ISGs: interferon-stimulated genes MD2: myeloid differentiation protein 2 MFI: mean of fluorescence intensity ORF: open reading frame PBMC: peripheral blood mononuclear cells PBS: phosphate buffered saline PCR: polymerase chain reaction PMA: Phorbol 12-myristate-13-acetate RNA: ribonucleic acid RT-PCR: real-time PCR TNF-α: tumor necrosis factor-alpha Declarations Acknowledgments We are thankful to the Flow Cytometry Unit from the Programa de Pós-graduação em Imunologia e Inflamação at the Universidade Federal do Rio de Janeiro. Funding This work was supported by grants from Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ, E-26/211.003/2019), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). Sabrina Pires Maciel, Guilherme A. Melo, and Carolina Calôba were recipients of Fellowships from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). Authorship Sabrina Pires Maciel de Souza performed the experiments, data analysis, and writing the original draft; Carolina Calôba performed the experiments and the computational analysis; Guilherme A. Melo performed the computational analysis and figure elaboration, Renata M. Pereira and Juliana Echevarria-Lima conceived and designed the experiments edited and reviewed the manuscript text. Consent for publication Not applicable. Competing interests The authors declare no conflict of interest. Ethical approval and consent to participate Not applicable. Data Availability statement The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author. References Gessain A, Barin F, Vernant JC, et al. Antibodies to human T-lymphotropic virus type-I in patients with tropical spastic paraparesis. Lancet. 1985;2(8452):407-410. doi:10.1016/s0140-6736(85)92734-5 Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc Natl Acad Sci U S A. 1980;77(12):7415-7419. doi:10.1073/pnas.77.12.7415 Gessain A, Cassar O. Epidemiological Aspects and World Distribution of HTLV-1 Infection. Front Microbiol. 2012;3:388. doi:10.3389/fmicb.2012.00388 Araujo AQC, Silva MTT. The HTLV-1 neurological complex. Lancet Neurol. 2006;5(12):1068-1076. doi:10.1016/S1474-4422(06)70628-7 Fuzii HT, da Silva Dias GA, de Barros RJ, Falcão LF, Quaresma JA. Immunopathogenesis of HTLV-1-assoaciated myelopathy/tropical spastic paraparesis (HAM/TSP) - PubMed. Accessed December 12, 2023. https://pubmed.ncbi.nlm.nih.gov/24704970/ Alamy AH, Menezes FB, Leite AC, Nascimento OM, Araújo AQ. Dysautonomia in human T-cell lymphotrophic virus type I-associated myelopathy/tropical spastic paraparesis. Ann Neurol. 2001;50(5):681-685. doi:10.1002/ana.1264 Silva MTT, Mattos P, Alfano A, Araújo AQC. Neuropsychological assessment in HTLV-1 infection: a comparative study among TSP/HAM, asymptomatic carriers, and healthy controls. J Neurol Neurosurg Psychiatry. 2003;74(8):1085-1089. doi:10.1136/jnnp.74.8.1085 Leite ACC, Silva MTT, Alamy AH, et al. Peripheral neuropathy in HTLV-I infected individuals without tropical spastic paraparesis/HTLV-I-associated myelopathy. J Neurol. 2004;251(7):877-881. doi:10.1007/s00415-004-0455-7 Prince HE, York J, Golding J, Owen SM, Lal RB. Spontaneous lymphocyte proliferation in human T-cell lymphotropic virus type I (HTLV-I) and HTLV-II infection: T-cell subset responses and their relationships to the presence of provirus and viral antigen production. Clin Diagn Lab Immunol. 1994;1(3):273-282. doi:10.1128/cdli.1.3.273-282.1994 Yasunaga J-i, Sakai T, Nosaka K, et al. Impaired production of naive T lymphocytes in human T-cell leukemia virus type I-infected individuals: its implications in the immunodeficient state. Blood. 2001;97(10):3177-3183. doi:10.1182/blood.v97.10.3177 Matsuoka M, Jeang KT. Human T-cell leukaemia virus type 1 (HTLV-1) infectivity and cellular transformation. Nat Rev Cancer. 2007;7(4):270-280. doi:10.1038/nrc2111 Nagai M, Yamano Y, Brennan MB, Mora CA, Jacobson S. Increased HTLV-I proviral load and preferential expansion of HTLV-I Tax-specific CD8+ T cells in cerebrospinal fluid from patients with HAM/TSP. Ann Neurol. 2001;50(6):807-812. doi:10.1002/ana.10065 Macatonia SE, Cruickshank JK, Rudge P, Knight SC. Dendritic cells from patients with tropical spastic paraparesis are infected with HTLV-1 and stimulate autologous lymphocyte proliferation. AIDS Res Hum Retroviruses. 1992;8(9):1699-1706. doi:10.1089/aid.1992.8.1699 Makino M, Wakamatsu S, Shimokubo S, Arima N, Baba M. Production of functionally deficient dendritic cells from HTLV-I-infected monocytes: implications for the dendritic cell defect in adult T cell leukemia. Virology. 2000;274(1):140-8. https://pubmed.ncbi.nlm.nih.gov/10936095/ Hishizawa M, Imada K, Kitawaki T, Ueda M, Kadowaki N, Uchiyama T. Depletion and impaired interferon-alpha-producing capacity of blood plasmacytoid dendritic cells in human T-cell leukaemia virus type I-infected individuals. Br J Haematol. 2004;125(5):568-575. doi:10.1111/j.1365-2141.2004.04956.x Nascimento CR, Lima MA, de Andrada Serpa MJ, Espindola O, Leite ACC, Echevarria-Lima J. Monocytes from HTLV-1-infected patients are unable to fully mature into dendritic cells. Blood. 2011;117(2):489-499. doi:10.1182/blood-2010-03-272690 Echevarria-Lima J, de Abreu Pereira D, de Oliveira TS, et al. Protein Profile of Blood Monocytes is Altered in HTLV-1 Infected Patients: Implications for HAM/TSP Disease. Sci Rep. 2018;8(1):14354. doi:10.1038/s41598-018-32324-2 Takeuchi H, Takahashi M, Norose Y, Takeshita T, Fukunaga Y, Takahashi H. Transformation of breast milk macrophages by HTLV-I: implications for HTLV-I transmission via breastfeeding. Biomed Res. 2010;31(1):53-61. doi:10.2220/biomedres.31.53 Bangham CRM, Araujo A, Yamano Y, Taylor GP. HTLV-1-associated myelopathy/tropical spastic paraparesis. Nat Rev Dis Primers. 2015;1:15012. doi:10.1038/nrdp.2015.12 Ando H, Sato T, Tomaru U, et al. Positive feedback loop via astrocytes causes chronic inflammation in virus-associated myelopathy. Brain. 2013;136(Pt 9):2876-2887. doi:10.1093/brain/awt183 Enose-Akahata Y, Matsuura E, Tanaka Y, Oh U, Jacobson S. Minocycline modulates antigen-specific CTL activity through inactivation of mononuclear phagocytes in patients with HTLV-I associated neurologic disease. Retrovirology. 2012;9:16. doi:10.1186/1742-4690-9-16 Gao L, Brenner D, Llorens-Bobadilla E, et al. Infiltration of circulating myeloid cells through CD95L contributes to neurodegeneration in mice. J Exp Med. 2015;212(4):469-480. doi:10.1084/jem.20132423 Prinz M, Priller J, Sisodia SS, Ransohoff RM. Heterogeneity of CNS myeloid cells and their roles in neurodegeneration. Nat Neurosci. 2011;14(10):1227-1235. doi:10.1038/nn.2923 Jones KS, Petrow-Sadowski C, Huang YK, Bertolette DC, Ruscetti FW. Cell-free HTLV-1 infects dendritic cells leading to transmission and transformation of CD4(+) T cells. Nat Med. 2008;14(4):429-436. doi:10.1038/nm1745 Azakami K, Sato T, Araya N, et al. Severe loss of invariant NKT cells exhibiting anti-HTLV-1 activity in patients with HTLV-1-associated disorders. Blood. 2009;114(15):3208-3215. doi:10.1182/blood-2009-02-203042 Ziegler-Heitbrock HW. The biology of the monocyte system. Eur J Cell Biol. 1989;49(1):1-12. Ancuta P, Kamat A, Kunstman KJ, et al. Microbial translocation is associated with increased monocyte activation and dementia in AIDS patients. PLoS One. 2008;3(6):e2516. doi:10.1371/journal.pone.0002516 Veenhuis RT, Williams DW, Shirk EN, et al. Higher circulating intermediate monocytes are associated with cognitive function in women with HIV. JCI Insight. 2021;6(11):e146215, 146215. doi:10.1172/jci.insight.146215 de Castro-Amarante MF, Pise-Masison CA, McKinnon K, et al. Human T Cell Leukemia Virus Type 1 Infection of the Three Monocyte Subsets Contributes to Viral Burden in Humans. J Virol. 2015;90(5):2195-2207. doi:10.1128/JVI.02735-15 Kim FJ, Manel N, Boublik Y, Battini JL, Sitbon M. Human T-cell leukemia virus type 1 envelope-mediated syncytium formation can be activated in resistant Mammalian cell lines by a carboxy-terminal truncation of the envelope cytoplasmic domain. J Virol. 2003;77(2):963-969. doi:10.1128/jvi.77.2.963-969.2003 Williams DW, Calderon TM, Lopez L, et al. Mechanisms of HIV entry into the CNS: increased sensitivity of HIV infected CD14+CD16+ monocytes to CCL2 and key roles of CCR2, JAM-A, and ALCAM in diapedesis. PLoS One. 2013;8(7):e69270. doi:10.1371/journal.pone.0069270 Miyoshi I, Kubonishi I, Yoshimoto S, Shiraishi Y. A T-cell line derived from normal human cord leukocytes by co-culturing with human leukemic T-cells. Gan. 1981;72(6):978-981. Daigneault M, Preston JA, Marriott HM, Whyte MKB, Dockrell DH. The identification of markers of macrophage differentiation in PMA-stimulated THP-1 cells and monocyte-derived macrophages. PLoS One. 2010;5(1):e8668. doi:10.1371/journal.pone.0008668 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-408. doi:10.1006/meth.2001.1262 Tattermusch S, Skinner JA, Chaussabel D, et al. Systems biology approaches reveal a specific interferon-inducible signature in HTLV-1 associated myelopathy. PLoS Pathog. 2012;8(1):e1002480. doi:10.1371/journal.ppat.1002480 Gerrick KY, Gerrick ER, Gupta A, Wheelan SJ, Yegnasubramanian S, Jaffee EM. Transcriptional profiling identifies novel regulators of macrophage polarization. PLoS One. 2018;13(12):e0208602. doi:10.1371/journal.pone.0208602 Davis S, Meltzer PS. GEOquery: a bridge between the Gene Expression Omnibus (GEO) and BioConductor. Bioinformatics. 2007;23(14):1846-1847. doi:10.1093/bioinformatics/btm254 Gu Z. Complex heatmap visualization. iMeta. 2022;1(3):e43. doi:10.1002/imt2.43 Gu Z, Hübschmann D. Pkgndep: a tool for analyzing dependency heaviness of R packages. Bioinformatics. 2022;38(17):4248-4251. doi:10.1093/bioinformatics/btac449 Yunna C, Mengru H, Lei W, Weidong C. Macrophage M1/M2 polarization. Eur J Pharmacol. 2020;877:173090. doi:10.1016/j.ejphar.2020.173090 Fingleton B. Matrix metalloproteinases as regulators of inflammatory processes. Biochim Biophys Acta Mol Cell Res. 2017;1864(11 Pt A):2036-2042. doi:10.1016/j.bbamcr.2017.05.010 Worley JR, Baugh MD, Hughes DA, et al. Metalloproteinase expression in PMA-stimulated THP-1 cells. Effects of peroxisome proliferator-activated receptor-gamma (PPAR gamma) agonists and 9-cis-retinoic acid. J Biol Chem. 2003;278(51):51340-51346. doi:10.1074/jbc.M310865200 Negishi H, Taniguchi T, Yanai H. The Interferon (IFN) Class of Cytokines and the IFN Regulatory Factor (IRF) Transcription Factor Family. Cold Spring Harb Perspect Biol. 2018;10(11):a028423. doi:10.1101/cshperspect.a028423 Lee HC, Lee ES, Uddin MB, et al. Released Tryptophanyl-tRNA Synthetase Stimulates Innate Immune Responses against Viral Infection. J Virol. 2019;93(2):e01291-18. doi:10.1128/JVI.01291-18 Paley EL, Denisova G, Sokolova O, Posternak N, Wang X, Brownell AL. Tryptamine induces tryptophanyl-tRNA synthetase-mediated neurodegeneration with neurofibrillary tangles in human cell and mouse models. Neuromolecular Med. 2007;9(1):55-82. doi:10.1385/nmm:9:1:55 Tsai PC, Soong BW, Mademan I, et al. A recurrent WARS mutation is a novel cause of autosomal dominant distal hereditary motor neuropathy. Brain. 2017;140(5):1252-1266. doi:10.1093/brain/awx058 Bogenberger JM, Laybourn PJ. Human T Lymphotropic Virus Type 1 protein Tax reduces histone levels. Retrovirology. 2008;5:9. doi: 10.1186/1742-4690-5-9 Nyborg JK, Egan D, Sharma N. The HTLV-1 Tax protein: revealing mechanisms of transcriptional activation through histone acetylation and nucleosome disassembly. Biochim Biophys Acta. 2010 Mar-Apr;1799(3-4):266-74. doi: 10.1016/j.bbagrm.2009.09.002 Amorim CF, Souza AS, Diniz AG, Carvalho NB, Santos SB, Carvalho EM. Functional activity of monocytes and macrophages in HTLV-1 infected subjects. PLoS Negl Trop Dis. 2014;8(12):e3399. doi:10.1371/journal.pntd.0003399 Rocamonde B, Carcone A, Mahieux R, Dutartre H. HTLV-1 infection of myeloid cells: from transmission to immune alterations. Retrovirology. 2019;16(1):45. doi:10.1186/s12977-019-0506-x Jaworski E, Narayanan A, Van Duyne R, et al. Human T-lymphotropic virus type 1-infected cells secrete exosomes that contain Tax protein. J Biol Chem. 2014;289(32):22284-22305. doi:10.1074/jbc.M114.549659 Matsuura E, Enose-Akahata Y, Yao K, et al. Dynamic acquisition of HTLV-1 tax protein by mononuclear phagocytes: Role in neurologic disease. J Neuroimmunol. 2017;304:43-50. doi:10.1016/j.jneuroim.2016.09.014 Suzuki S, Zhou Y, Refaat A, et al. Human T cell lymphotropic virus 1 manipulates interferon regulatory signals by controlling the TAK1-IRF3 and IRF4 pathways. J Biol Chem. 2010;285(7):4441-4446. doi:10.1074/jbc.M109.031476 Yoshita M, Higuchi M, Takahashi M, Oie M, Tanaka Y, Fujii M. Activation of mTOR by human T-cell leukemia virus type 1 Tax is important for the transformation of mouse T cells to interleukin-2-independent growth. Cancer Sci. 2012;103(2):369-374. doi:10.1111/j.1349-7006.2011.02123.x Gessain A, Mahieux R. Tropical spastic paraparesis and HTLV-1 associated myelopathy: clinical, epidemiological, virological and therapeutic aspects. Rev Neurol (Paris). 2012;168(3):257-269. doi:10.1016/j.neurol.2011.12.006 Giam CZ, Semmes OJ. HTLV-1 Infection and Adult T-Cell Leukemia/Lymphoma-A Tale of Two Proteins: Tax and HBZ. Viruses. 2016;8(6):161. doi:10.3390/v8060161 Gajanayaka N, Dong SXM, Ali H, et al. TLR-4 Agonist Induces IFN-γ Production Selectively in Proinflammatory Human M1 Macrophages through the PI3K-mTOR- and JNK-MAPK-Activated p70S6K Pathway. J Immunol. 2021;207(9):2310-2324. doi:10.4049/jimmunol.2001191 Giam CZ. HTLV-1 Replication and Adult T Cell Leukemia Development. Recent Results Cancer Res. 2021;217:209-243. doi:10.1007/978-3-030-57362-1_10 Matsuo M, Ueno T, Monde K, et al. Identification and characterization of a novel enhancer in the HTLV-1 proviral genome. Nat Commun. 2022;13(1):2405. doi:10.1038/s41467-022-30029-9 Dekkers KF, Neele AE, Jukema JW, Heijmans BT, de Winther MPJ. Human monocyte-to-macrophage differentiation involves highly localized gain and loss of DNA methylation at transcription factor binding sites. Epigenetics Chromatin. 2019;12(1):34. doi:10.1186/s13072-019-0279-4 Zarei Ghobadi M, Mozhgani SH, Erfani Y. Identification of dysregulated pathways underlying HTLV-1-associated myelopathy/tropical spastic paraparesis through co-expression network analysis. J Neurovirol. 2021;27(6):820-830. doi:10.1007/s13365-020-00919-z Li J, Schuler-Thurner B, Schuler G, Huber C, Seliger B. Bipartite regulation of different components of the MHC class I antigen-processing machinery during dendritic cell maturation. Int Immunol. 2001;13(12):1515-1523. doi:10.1093/intimm/13.12.1515 Jin Y, Fuller L, Ciancio G, et al. Antigen presentation and immune regulatory capacity of immature and mature-enriched antigen presenting (dendritic) cells derived from human bone marrow. Hum Immunol. 2004;65(2):93-103. doi:10.1016/j.humimm.2003.11.002 Ferrer MF, Thomas P, López Ortiz AO, et al. Junin Virus Triggers Macrophage Activation and Modulates Polarization According to Viral Strain Pathogenicity. Front Immunol. 2019;10:2499. doi:10.3389/fimmu.2019.02499 Feng J, Cao Z, Wang L, et al. Inducible GBP5 Mediates the Antiviral Response via Interferon-Related Pathways during Influenza A Virus Infection. J Innate Immun. 2017;9(4):419-435. doi:10.1159/000460294 Shenoy AR, Wellington DA, Kumar P, et al. GBP5 promotes NLRP3 inflammasome assembly and immunity in mammals. Science. 2012;336(6080):481-485. doi:10.1126/science.1217141 Freitas NL, Gomes YCP, Souza FDS, et al. Lessons from the Cerebrospinal Fluid Analysis of HTLV-1-Infected Individuals: Biomarkers of Inflammation for HAM/TSP Development. Viruses. 2022;14(10):2146. doi:10.3390/v14102146 Additional Declarations No competing interests reported. Supplementary Files Figsuppl1.pdf Supplementary Figure 1. Cell viability analysis of THP-1 cells co-cultured with HTLV-1-infected cells (MT-2). THP-1 monocytes were co-cultured with HTLV-1-infected cells (MT-2 irradiated at 20 Gy) in a 1:2 ratio. Cells treated with PMA (100 nM) as used as controls, positive and negative, respectively. (A) Cell viability was analyzed by LDH assay, using supernatants of cultures. (B) On day 6 at 37 ºC in a humid atmosphere with 5% CO 2 , cells were stimulated with or without LPS (10 ng/ml) for 24 h and incubated with MTT (5 mg/mL) for 3 h. Colorimetric analysis was measured at 490 nm, using a microplate spectrophotometer reader. Graphs are mean ± SEM values of supernatants from 3 independently experiments performed in duplicates. Figsuppl2.pdf Supplementary Figure 2: Flow cytometry gating strategies related to Figure 2. THP-1 monocytes were co-cultured with HTLV-1-infected cells (MT-2 irradiated at 20 Gy) in a 1:2 ratio. Cells treated with PMA (100 nM) as used as controls, positive and negative, respectively. On day 6, differentiated cells were detached with PSB + EDTA (100 nM) and stained with antibodies for flow cytometry. Gating strategies on cells for immunophenotyping of HLA-DR, CD80, CD86, CD14, CD32, and CD127. All histograms were compared with unstained cells (Negative) using FlowJo Software 10.0. Figsuppl3.pdf Supplementary Figure 3: Analysis of pro-inflammatory mediators produced by THP-1 cells differentiated with PMA. THP-1 cells were treated with PMA (100 nM) for 6 days. On day 6, cells were stimulated with LPS (10 ng/ml; M1 positive control) for 24 h or dexamethasone (100 nM; M2 positive control) for 72 h. Following, cells were lysed for RNA extraction and cDNA synthesis for RT-PCR. mRNA expression of TNF-α, IL-6, IL-1β, TLR2, TLR4 after LPS stimuli; mRNA expression of Arg, MD2, CCL22, TGFβ after LPS and/or dexamethasone treatment. Graphs represent relative mRNA level, calculated using the 2-ΔΔCT method and normalized to Gapdh or β-actin in the same sample, compared to the expression of the respective genes in PMA-treated THP-1 cells. Figsuppl4.pdf Supplementary Figure 4: Analysis of ISGs expression by THP-1 cells differentiated with PMA. THP-1 cells were treated with PMA (100 nM) for 6 days. On day 6, cells were stimulated with LPS (10 ng/ml; M1 positive control) for 24 h or dexamethasone (100 nM; M2 positive control) for 72 h. Following, cells were lysed for RNA extraction and cDNA synthesis for RT-PCR. mRNA expression of IL-18, IL-28, IL-29, ISG15, OASL, and IFNβ after LPS and/or dexamethasone treatment. Graphs represent relative mRNA level, calculated using the 2-ΔΔCT method and normalized to Gapdh or β-actin in the same sample, compared to the expression of the respective genes in PMA-treated THP-1 cells. SupplementaryTable1.pdf Cite Share Download PDF Status: Published Journal Publication published 20 Mar, 2025 Read the published version in BMC Immunology → Version 1 posted Editorial decision: Revision requested 08 May, 2024 Editor assigned by journal 08 May, 2024 Submission checks completed at journal 07 May, 2024 First submitted to journal 02 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4359860","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":300181740,"identity":"ae0d38a4-ee99-4a16-b360-209e97a89830","order_by":0,"name":"Sabrina Pires Maciel Souza","email":"","orcid":"","institution":"Instituto de Microbiologia Paulo de Góes, UFRJ- Rio de Janeiro","correspondingAuthor":false,"prefix":"","firstName":"Sabrina","middleName":"Pires Maciel","lastName":"Souza","suffix":""},{"id":300181742,"identity":"e2c446cf-13b2-44d5-a5ed-89fcff3869a8","order_by":1,"name":"Guilherme A. Melo","email":"","orcid":"","institution":"Instituto de Microbiologia Paulo de Góes, UFRJ- Rio de Janeiro","correspondingAuthor":false,"prefix":"","firstName":"Guilherme","middleName":"A.","lastName":"Melo","suffix":""},{"id":300181744,"identity":"dd241bf2-8a50-429c-aa44-97dd8a3a6744","order_by":2,"name":"Carolina Calôba","email":"","orcid":"","institution":"Instituto de Microbiologia Paulo de Góes, UFRJ- Rio de Janeiro","correspondingAuthor":false,"prefix":"","firstName":"Carolina","middleName":"","lastName":"Calôba","suffix":""},{"id":300181745,"identity":"60e58a79-26cf-45ab-97f3-ee8dae89a3ae","order_by":3,"name":"Renata M. Pereira","email":"","orcid":"","institution":"Instituto de Microbiologia Paulo de Góes, UFRJ- Rio de Janeiro","correspondingAuthor":false,"prefix":"","firstName":"Renata","middleName":"M.","lastName":"Pereira","suffix":""},{"id":300181746,"identity":"57f857a8-6dcc-4045-9909-4d95bf105e70","order_by":4,"name":"Juliana Echevarria-Lima","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCklEQVRIie3PQWvCMBTA8RcC8ZLuHAisX2FlYC0ofpVKoaeO7ehBJFLQi9s5MD+HJw8phZ7Czl7HwLNQGIzBWIrTUyMeB+YPgUfDj/QBuFz/MCQA8GncAzvMYyBwdwlB8kj0GdKETwM9TtocG8EyKeqncemHr+WsHmQ9P1wIworNDYRctf+YTBMudRms3kY5f1izYKUVYWpHIHqJLSTrYm+eIkmRaEjMWEz4XpldtGV9+fiJvZ90aEj+Hf0Rps6SjGBP9EeGzDm6iCx395xW/aQh0bPZRdIi7xlCo2U7CRbJe00nbCBp52P7tZ76rJMXW6Wq25BaiGh5uflWWQCAb7uY2C5cLpfr+voFV7pVGV4re/EAAAAASUVORK5CYII=","orcid":"","institution":"Instituto de Microbiologia Paulo de Góes, UFRJ- Rio de Janeiro","correspondingAuthor":true,"prefix":"","firstName":"Juliana","middleName":"","lastName":"Echevarria-Lima","suffix":""}],"badges":[],"createdAt":"2024-05-02 14:57:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4359860/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4359860/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12865-024-00670-8","type":"published","date":"2025-03-20T15:57:40+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":56564460,"identity":"dcb436d0-d089-4c05-9283-e6a994d340b2","added_by":"auto","created_at":"2024-05-15 22:47:27","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":474994,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of morphology and CD68 expression in THP-1 cells co-cultured HTLV-1-infected cells (MT-2). \u003c/strong\u003eTHP-1 monocytes were incubated in 24-well plates with coverslips for 6 days. Monocytes were co-cultured with HTLV-1-infected cells (MT-2 irradiated at 20 Gy) in a 1:2 ratio. Cells treated with PMA (100 nM) or untreated were used as controls, positive and negative, respectively. (\u003cstrong\u003eA\u003c/strong\u003e) On day 6 at 37 ºC in a humid atmosphere with 5% CO\u003csub\u003e2\u003c/sub\u003e, cell morphology was analyzed by phase contrast microscopy in 20x magnification objective, using a light microscope (Olympus CKX41). (\u003cstrong\u003eB\u003c/strong\u003e) Macrophage phenotype was characterized using CD68 immunofluorescence assay. After the THP1 culture, cells were permeabilized and stained with intracellular antibody CD68 FITC, followed by nucleic acid staining with DAPI. CD68-positive cells were indicated by white arrows. Photographs were taken on a Leica® fluorescence microscope at 40x magnification, and images were analyzed in ImageJ Software.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/67c52600dd79a19c2aa67242.png"},{"id":56563473,"identity":"d7effe6c-5a86-4680-ab5a-b68508387f75","added_by":"auto","created_at":"2024-05-15 22:39:27","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":114650,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of surface molecules in THP-1 cells co-cultured with MT-2. \u003c/strong\u003eTHP-1 cells were co-cultured with MT-2 (irradiated at 20 Gy) in a 1:2 ratio or treated with PMA (100 nM, positive control) for 6 days. On day 6, differentiated cells were detached with PSB + EDTA (100 nM) and stained with antibodies for flow cytometry. Frequency and media of intensity fluorescence (MIF) of (\u003cstrong\u003eA\u003c/strong\u003e) HLA-DR, (\u003cstrong\u003eB\u003c/strong\u003e) CD80, (\u003cstrong\u003eC\u003c/strong\u003e) CD86, (\u003cstrong\u003eD\u003c/strong\u003e) CD14, (\u003cstrong\u003eE\u003c/strong\u003e) CD32, and (\u003cstrong\u003eF\u003c/strong\u003e) CD127 in THP-1 cells cultured alone (THP-1), stimulated with PMA (+PMA) or co-cultured with MT-2 (+MT-2). Means of MIF were normalized based on the expression pattern of undifferentiated THP-1 control cells. Graphs are mean ± SEM values from 3 to 5 independently performed experiments. *p\u0026lt;0.05 compared to controls (THP-1).\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/7c1c4b5db4e6f899548fa624.png"},{"id":56563477,"identity":"ee544ae0-74b2-44df-a1aa-e4bec31c8a78","added_by":"auto","created_at":"2024-05-15 22:39:27","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":135263,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of gene expression and cytokines associated with M1-M2 profile in cells co-cultured with MT-2.\u003c/strong\u003e THP-1 cells were co-cultured with MT-2 (irradiated at 20 Gy) in a 1:2 ratio or treated with PMA (100 nM, positive control) for 6 days. On the sixth day, cells were lysed for RNA extraction and cDNA synthesis for RT-PCR, and cultured supernatants were collected to mediators were assayed by the ELISA method. mRNA expression of M1-associated pro-inflammatory genes (\u003cstrong\u003eA\u003c/strong\u003e) TNF-α, IL-6, IL-1, (\u003cstrong\u003eE\u003c/strong\u003e) TLR-2, and TLR-4; (\u003cstrong\u003eF\u003c/strong\u003e and \u003cstrong\u003eG\u003c/strong\u003e) mRNA expression of M2-associated genes Arg, TGF-β, CCL22, and MD-2. (\u003cstrong\u003eB\u003c/strong\u003e) Detection of TNF-α, IL-6, (\u003cstrong\u003eD\u003c/strong\u003e) sCD14, (\u003cstrong\u003eE\u003c/strong\u003e) MMP-1 and MMP-2, (\u003cstrong\u003eH\u003c/strong\u003e) IL-10, concentration in cultured supernatant. Graphs represent relative mRNA levels, calculated using the 2-ΔΔCT method and normalized to Gapdh or β-actin in the same sample, compared to the expression of the respective genes in undifferentiated THP-1 cells. Graphs are mean ± SEM values of supernatants from 4 to 7 independently performed experiments. *p\u0026lt;0.05 compared to controls (THP-1).\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/7b4272a4991919a9f90c5d5e.png"},{"id":56563475,"identity":"ba4f07ef-6e48-49aa-bcf7-003581dfca70","added_by":"auto","created_at":"2024-05-15 22:39:27","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":91751,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of gene expression associated with the IFN response in THP-1 cells co-cultured with MT-2.\u003c/strong\u003e THP-1 cells were co-cultured with MT-2 (irradiated at 20 Gy) in a 1:2 ratio or treated with PMA (100 nM, positive control) for 6 days. After that, cells were lysed for RNA extraction and cDNA synthesis for RT-PCR. (\u003cstrong\u003eA\u003c/strong\u003e) mRNA expression of IL-18, IL-28, IL-29, ISG15, OASL, and IFN-β. Graphs represent relative mRNA levels from 4 independently compiled experiments, calculated using the 2-ΔΔCT method and normalized to Gapdh or β-actin in the same sample, compared to the expression of the respective genes in undifferentiated THP-1 cells. (\u003cstrong\u003eB\u003c/strong\u003e) After the co-cultures, the WARS expression was investigated by flow cytometry, using a specific polyclonal antibody. The values on the graphs are mean ± SEM values of supernatants from 4 independently performed experiments. *p\u0026lt;0.05 compared to controls (THP-1).\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/775b9215d6a18046cae8076c.png"},{"id":56563482,"identity":"51b53060-ede4-4578-b758-8f8907b97851","added_by":"auto","created_at":"2024-05-15 22:39:27","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":54108,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of histone gene expression in THP-1 cells co-cultured with MT-2.\u003c/strong\u003e THP-1 cells were co-cultured with MT-2 (irradiated at 20 Gy) in a 1:2 ratio or treated with PMA (100 nM, positive control) for 6 days. After that, cells were lysed for RNA extraction and cDNA synthesis for RT-PCR. (\u003cstrong\u003eA\u003c/strong\u003e) mRNA expression of H2A, (\u003cstrong\u003eB\u003c/strong\u003e) H2B, (\u003cstrong\u003eC\u003c/strong\u003e) H4 and (\u003cstrong\u003eD\u003c/strong\u003e) H1S4. Graphs represent relative mRNA levels from 4 independently compiled experiments, calculated using the 2-ΔΔCT method and normalized to Gapdh in the same sample, compared to the expression of the respective genes in undifferentiated THP-1 cells. The values on the graphs are mean ± SEM values of supernatants from 3-4 independently performed experiments. *p\u0026lt;0.01 and ***p\u0026lt;0.0005 compared to PMA.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/2a676f5348285b8e5d7a4e56.png"},{"id":56564754,"identity":"910b3df5-ff54-4342-a557-5450dfd0c61d","added_by":"auto","created_at":"2024-05-15 22:55:27","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3757880,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of gene expression by THP-1 cells co-cultured with MT-2 cells or their supernatant.\u003c/strong\u003e THP-1 and MT-2 cells were cultured for 3 days at 37ºC for supernatant isolation. Then, fresh THP-1 cells were co-cultured with or without supernatants from THP1 or MT-2 cells. After 6 days, the morphology of the cells was analyzed by contrast phase microscopy. (\u003cstrong\u003eA\u003c/strong\u003e) Representative picture of cells. Photographs were taken on a Leica® fluorescence microscope at 40x magnification, and images were analyzed in ImageJ Software. After the culture, cells were lysed for RNA extraction and cDNA synthesis to perform RT-PCR (\u003cstrong\u003eB\u003c/strong\u003e) mRNA expression of IFN-β, OASL, ISG15, and IL-6. Representative image of 3 independently performed experiments. Nd= not detected. *p\u0026lt;0.05 compared to controls (THP1). Representative graph of 2 or 3 independently compiled experiments. THP1 cells were also cultured in the presence of MT-2 without cell contact, using an insert as described in the methods. Following, cells were stained and analyzed by flow cytometry. (\u003cstrong\u003eC\u003c/strong\u003e) Percentage of CD86\u003csup\u003e+\u003c/sup\u003e cells. (\u003cstrong\u003eD\u003c/strong\u003e) PCR was used to detect a fragment of 159-bp of HTLV-1 tax in DNA samples obtained from THP1 cells (uninfected control); + SN THP1 (THP-1 cells cultivated with THP1 supernatant); + SN MT-2 (THP-1 cells cultivated with MT-2 supernatant); THP1 + MT-2:( culture of THP-1 in presence of MT-2 cells); MT-2 (DNA from MT-2 cells, used as positive control). The β-actin gene was used as a constitutive control. L - 50-bp DNA ladder.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/7ef96e0267e6dc01a64d8c8b.png"},{"id":56563479,"identity":"22a426dc-bf6f-4208-afab-ed71e880fa5d","added_by":"auto","created_at":"2024-05-15 22:39:27","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":166003,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCorrelation between M1/M2 macrophage transcriptional profile and HTLV-1 or HAM/TSP transcriptional signatures. \u003c/strong\u003eDatasets were obtained from Gerrick \u003cem\u003eet al\u003c/em\u003e., 2018 and Tattermusch \u003cem\u003eet al\u003c/em\u003e., 2012 publications (GSE117040 and GSE29312, respectively). Venn diagrams comparing the intersection of M1- or M2-associated genes (1205 and 995, respectively) macrophage with (\u003cstrong\u003eA-B\u003c/strong\u003e) HTLV-1 (542 genes) or (\u003cstrong\u003eD-E\u003c/strong\u003e) HAM/TSP (80 genes) signatures; (\u003cstrong\u003eC\u003c/strong\u003e; \u003cstrong\u003eF\u003c/strong\u003e) Heatmap of M1 and M2 macrophage subpopulations during HTLV-1 infection (\u003cstrong\u003eC\u003c/strong\u003e) and HAM/TSP (\u003cstrong\u003eF\u003c/strong\u003e) normalized by Z score. Data were visualized in Heatmaps and Venn diagrams, using the R packages ggplot2, Complex Heatmap, and Venn Diagram. M1 ∩ HTLV-1: p=0.000020577; M2 \u0026nbsp;∩ HTLV-1: p=0.0000022564; M1 ∩ HAM/TSP: \u0026nbsp;p=0.0001048; M2 ∩ HAM/TSP: p=0.01893.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/2080eee9353f990e6ad1a438.png"},{"id":79120659,"identity":"9da88c83-2561-4322-b55d-774534da85d1","added_by":"auto","created_at":"2025-03-24 16:10:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8723633,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/de6c7258-e82c-4ac5-b6ef-81166ba8de21.pdf"},{"id":56564461,"identity":"6ca7dd22-07b4-4d51-b58c-9d272026b787","added_by":"auto","created_at":"2024-05-15 22:47:27","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":45650,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 1. Cell viability analysis of THP-1 cells co-cultured with HTLV-1-infected cells (MT-2). \u003c/strong\u003eTHP-1 monocytes were co-cultured with HTLV-1-infected cells (MT-2 irradiated at 20 Gy) in a 1:2 ratio. Cells treated with PMA (100 nM) as used as controls, positive and negative, respectively. (\u003cstrong\u003eA\u003c/strong\u003e) Cell viability was analyzed by LDH assay, using supernatants of cultures. (\u003cstrong\u003eB\u003c/strong\u003e) On day 6 at 37 ºC in a humid atmosphere with 5% CO\u003csub\u003e2\u003c/sub\u003e, cells were stimulated with or without LPS (10 ng/ml) for 24 h and incubated with MTT (5 mg/mL) for 3 h. Colorimetric analysis was measured at 490 nm, using a microplate spectrophotometer reader. Graphs are mean ± SEM values of supernatants from 3 independently experiments performed in duplicates.\u003c/p\u003e","description":"","filename":"Figsuppl1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/9956c8c5f962b42e587e5c10.pdf"},{"id":56563480,"identity":"777ad74c-b79b-40ba-bde5-c655ab1c5adb","added_by":"auto","created_at":"2024-05-15 22:39:27","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":349699,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 2: Flow cytometry gating strategies related to Figure 2\u003c/strong\u003e. THP-1 monocytes were co-cultured with HTLV-1-infected cells (MT-2 irradiated at 20 Gy) in a 1:2 ratio. Cells treated with PMA (100 nM) as used as controls, positive and negative, respectively. On day 6, differentiated cells were detached with PSB + EDTA (100 nM) and stained with antibodies for flow cytometry. Gating strategies on cells for immunophenotyping of HLA-DR, CD80, CD86, CD14, CD32, and CD127. All histograms were compared with unstained cells (Negative) using FlowJo Software 10.0.\u003c/p\u003e","description":"","filename":"Figsuppl2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/17d6941e9932839f012251dd.pdf"},{"id":56563485,"identity":"d1923bbb-936b-4607-8e3a-a77bc3e4a2fa","added_by":"auto","created_at":"2024-05-15 22:39:27","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":132286,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 3: Analysis of pro-inflammatory mediators produced by THP-1 cells differentiated with PMA. \u003c/strong\u003eTHP-1 cells were treated with PMA (100 nM) for 6 days. On day 6, cells were stimulated with LPS (10 ng/ml; M1 positive control) for 24 h or dexamethasone (100 nM; M2 positive control) for 72 h. Following, cells were lysed for RNA extraction and cDNA synthesis for RT-PCR. mRNA expression of TNF-α, IL-6, IL-1β, TLR2, TLR4 after LPS stimuli; mRNA expression of Arg, MD2, CCL22, TGFβ after LPS and/or dexamethasone treatment. Graphs represent relative mRNA level, calculated using the 2-ΔΔCT method and normalized to Gapdh or β-actin in the same sample, compared to the expression of the respective genes in PMA-treated THP-1 cells.\u003c/p\u003e","description":"","filename":"Figsuppl3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/c09962ee266d09d2214c6398.pdf"},{"id":56563481,"identity":"646c310d-2bb8-47db-8f03-49e539c56c23","added_by":"auto","created_at":"2024-05-15 22:39:27","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":102254,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 4: Analysis of ISGs expression by THP-1 cells differentiated with PMA. \u003c/strong\u003eTHP-1 cells were treated with PMA (100 nM) for 6 days. On day 6, cells were stimulated with LPS (10 ng/ml; M1 positive control) for 24 h or dexamethasone (100 nM; M2 positive control) for 72 h. Following, cells were lysed for RNA extraction and cDNA synthesis for RT-PCR. mRNA expression of IL-18, IL-28, IL-29, ISG15, OASL, and IFNβ after LPS and/or dexamethasone treatment. Graphs represent relative mRNA level, calculated using the 2-ΔΔCT method and normalized to Gapdh or β-actin in the same sample, compared to the expression of the respective genes in PMA-treated THP-1 cells.\u003c/p\u003e","description":"","filename":"Figsuppl4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/bd460f14b576f59ecadb2845.pdf"},{"id":56564462,"identity":"02da9917-a932-4e3c-b89c-f2414d7f3caf","added_by":"auto","created_at":"2024-05-15 22:47:27","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":86727,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4359860/v1/3feb612184e5ffce5267df50.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"HTLV-1-infected cells drive the differentiation of monocytes into macrophages in vitro","fulltext":[{"header":"Background","content":"\u003cp\u003eThe human T-cell lymphotropic virus type 1 (HTLV-1) is a retrovirus associated with myelopathy/tropical spastic paraparesis (HAM/TSP) and adult T leukemia/lymphoma (ATLL) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. HTLV-1 is endemic and widely distributed among different ethnicities and regions, prevailing in Africa, Japan, and Central and South America. Worldwide, it is estimated that around 15 to 20\u0026nbsp;million individuals are living with HTLV-1 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. HAM/TSP is a chronic inflammatory disease characterized by leukocyte infiltration into the spinal cord, causing degeneration and loss of motor capacity [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. HAM/TSP patients can present spastic paraparesis followed by sphincter alterations, peripheral neuropathy, low back pain, erectile dysfunction, cognitive and dysautonomic alterations, and loss of myelin sheath and axons [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHTLV-1 primarily infects T CD4\u003csup\u003e+\u003c/sup\u003e lymphocytes [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], but can also infect other cells, such as T CD8\u003csup\u003e+\u003c/sup\u003e lymphocytes [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], natural killer cells [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], dendritic cells [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], monocytes, and macrophages [\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], including colostrum macrophages [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAccording to the bystander model, described by Bangham (2015), infected cells and activated HTLV-1-specific lymphocytes cross the blood-brain barrier and induce an inflammatory response by IFN-γ, TNF-α, and IL-6 production [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. IFN-γ stimulates astrocytes to secrete CXCL10, attracting CX3CR1\u003csup\u003e+\u003c/sup\u003e lymphocytes and phagocytes to the Central Nervous System (CNS) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003csup\u003e,\u003c/sup\u003e. Consequently, these leukocytes induce glial stress, demyelination, and destruction of axons [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMonocytes play an important role in neurodegenerative diseases but are under-investigated during HTLV-1 HAM/TSP. Generally, these cells infiltrate into the CNS after the blood-brain barrier breaks [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] and differentiate into dendritic cells and M1 (classic) macrophages promoting inflammation [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. The impairment of monocyte-derived dendritic cells during HTLV-1 infection has been described. Monocytes obtained from infected individuals and stimulated \u003cem\u003ein vitro\u003c/em\u003e with GM-CSF and IL-4 have a reduced capacity to differentiate into dendritic cells compared to non-infected individuals [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Moreover, a lower frequency of these cells has been observed in ATLL and HAM/TSP patients [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eZiegler-Heitbrock (1989) divided monocytes into three groups according to the expression of CD14 and CD16 (FcRγIII): classical (CD14\u003csup\u003ehigh\u003c/sup\u003eCD16\u003csup\u003eneg\u003c/sup\u003e), intermediate (CD14\u003csup\u003e+\u003c/sup\u003eCD16\u003csup\u003e+\u003c/sup\u003e), and non-classical (CD14\u003csup\u003elow/neg\u003c/sup\u003eCD16\u003csup\u003ehigh\u003c/sup\u003e) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In patients with acquired immunodeficiency syndrome (AIDS), intermediate monocytes (CD14\u003csup\u003e+\u003c/sup\u003eCD16\u003csup\u003e+\u003c/sup\u003e) expand during HIV-1-associated dementia [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. De Castro-Amarante \u003cem\u003eet al\u003c/em\u003e. (2015) showed that classical monocytes obtained from individuals with HTLV-1 express higher levels of chemokine receptors CCR5, CXCR3, and CX3CR1 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. This evidence suggests that intermediate monocytes could carry this virus to the CNS [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Enose-Akahata et al (2012) observed the presence of phagocytes expressing high levels of HLA-DR and CX3CR1 in spinal cord injuries of individuals with HAM/TSP [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Using proteomic analysis, our group revealed important changes in the expression of cytoskeletal proteins in monocytes of HTLV-1 carriers, demonstrating an increase in proteins associated with adhesion and migration phenomena, such as gelsolin [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we investigated the phenotypic and functional profile of differentiated macrophages using a monocyte cell line (THP-1) co-cultured with HTLV-1 permanently infected cells. We showed that HTLV-1 induces a macrophage differentiation \u003cem\u003ein vitro\u003c/em\u003e, characterized by the expression of molecules associated with M1-like phenotype, predominantly, but also with M2-like molecules up-regulated. The comparison of published transcriptomic datasets highlighted inflammatory-associated genes on monocytes and macrophages\u0026rsquo; transcriptional signatures from HTLV-1 infected individuals, corroborating our \u003cem\u003ein vitro\u003c/em\u003e model. Our study can contribute to understanding the immunopathogenesis of HTLV-1-associated diseases.\u003c/p\u003e"},{"header":"METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and THP-1 differentiation\u003c/h2\u003e \u003cp\u003eHTLV-1 transformed cell line MT-2 [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] was a gift from Instituto Nacional de Infectologia Evandro Chagas, Funda\u0026ccedil;\u0026atilde;o Oswaldo Cruz, RJ, Brazil, and Monocytic cell line (THP-1). All cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Lonza) supplemented with 10% fetal bovine serum (FBS) (Gibco/Thermo Fisher), penicillin (100 UI/ml), and streptomycin (100 mg/ml; LGC Biotechnology, Brazil) (complete medium). Cells were cultivated at 37\u0026deg;C in a humidified atmosphere with 5% of CO\u003csub\u003e2\u003c/sub\u003e and were passed twice a week.\u003c/p\u003e \u003cp\u003eTo induce macrophage differentiation, THP-1 cells were incubated in the presence of 50 ng/ml of Phorbol 12-myristate-13-acetate (PMA; Sigma-Aldrich/Merck) for 72 h in a 37\u0026deg;C humidified atmosphere with 5% of CO\u003csub\u003e2\u003c/sub\u003e. Then, cells were washed with PBS (Sigma-Aldrich/Merck) and incubated with a fresh complete medium under the same conditions [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Concurrently, THP-1 monocytes were co-cultured with MT-2 cells in a 1:2 ratio in a complete medium or in the presence of a conditioned medium from MT-2 or THP-1 cells for 6 days at 37\u0026deg;C in a humidified atmosphere with 5% of CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003cp\u003eTo evaluate the cell-contact dependence, THP-1 cells were co-cultured with MT-2 cells (1:2 ratio) in the presence or absence of an insert (0,47 cm\u003csup\u003e2\u003c/sup\u003e 0.4 \u0026micro;m pore; Thermo Fisher Scientific) in a complete medium. After 6 days at 37\u0026deg;C in a humidified atmosphere with 5% of CO\u003csub\u003e2\u003c/sub\u003e, the supernatants were collected, and the wells were harvested for phenotypic and/or molecular assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell viability assay\u003c/h2\u003e \u003cp\u003eCell viability was assessed using MTT (3-[4,5-dimethylthiazol-2-yl])-2,5-diphenyl tetrazolium bromide (5 mg/mL; Sigma-Aldrich/Merk) and Lactate dehydrogenase (LDH; Invitrogen\u0026reg;) assay, according to the manufacturer\u0026rsquo;s instructions. Both assays were performed by colorimetry in a SpectraMax\u0026reg; Paradigm\u0026reg; microplate reader (Molecular Devices) at 490 nm wavelength.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCell morphology\u003c/h2\u003e \u003cp\u003eCell images were captured through phase-contrast microscopy with magnification objectives 20 and 40. The image analysis system consisted of a light microscope (Olympus CKX41) and a charge-coupled device color camera connected to a computer. All images were stored as TIFF files, using Olympus cell Sens. Image analysis was performed using the ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003ePhenotype characterization\u003c/h2\u003e \u003cp\u003eTo determine the effects of co-culturing HTLV-1-infected cells in THP-1 monocytes we characterize the cell phenotype by flow cytometry and immunofluorescence microscopy. After the co-culture period, supernatant was collected and attached cells were washed twice with PBS. For flow cytometry analyses, adherent cells were then detached and incubated for 30 minutes, on ice, in PBS with 1 mM of EDTA (Sigma-Aldrich/Merck). Cells were stained with anti-human CD14 FITC (clone 61D3, Bioscience), CD80 PE (clone 307.4), CD86 PE (clone 307.4), HLA-DR APC (clone G46-6), CD127 PE-Cy7 (clone HIL-7R-M21) and CD32 PE (clone 3D3), all obtained from BD Pharmigen, for 30 minutes on ice. For intracellular staining, cells were permeabilized using eBioscence (ThermoFisher) Permeabilization buffer according to the manufacturer\u0026rsquo;s instructions. Then, cells were stained with polyclonal rabbit IgG anti-WARS (Invitrogen/ThermoFisher, PA5-29102) for 30 minutes at room temperature. After that, cells were washed with permeabilization buffer and labeled with a secondary anti-rabbit IgG polyclonal antibody conjugated to fluorochrome Alexa Fluor 488 (ThermoFisher Scientific, A-11034). Then, cells were washed and acquired on FACSCallibur\u0026trade; or FACSCanto\u0026trade; (Beckton \u0026amp; Dickinson). Twenty thousand events were acquired gating forward scatter vs. sideward scatter properties to exclude debris and doublets. Frequency and mean fluorescence intensity (MFI) were assessed by FlowJo 10.0 Software.\u003c/p\u003e \u003cp\u003eFor immunofluorescence analyses, cells were also plated in glass coverslips and, after the differentiation process, were fixed with paraformaldehyde 4% (Sigma-Aldrick/Merck) overnight at 4\u0026deg;C. After washing, cells were permeabilized using Permeabilization buffer according to the manufacturer\u0026rsquo;s instructions and blocked with 2% of FBS for 2 hours at room temperature. Then, samples were stained with CD68 FITC (clone eBioY1/82A; eBioscience\u0026reg;) overnight at 4\u0026deg;C in a humid chamber. After 3 washes with PBS, the nucleic acids were stained with 1 \u0026micro;g/mL of 4\u0026prime;,6-Diamidino-2-phenylindole dihydrochloride (DAPI; Sigma-Aldrich/Merck) for 1 minute at room temperature. Slides were mounted with 30 \u0026micro;L Fluoromount (Sigma-Aldrich/Merck) antifade reagent and analyzed on Leica\u0026reg; fluorescence microscope. Image analyses were performed using the MIF in the Image J Software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCytokine production\u003c/h2\u003e \u003cp\u003eTumor necrosis factor alpha (TNF-α) and Interleukin-6 (IL-6) production were analyzed in THP-1 supernatant from control groups and MT-2/THP1 co-cultured cells using sandwich immunosorbent assay (ELISA) kit according to the manufacturer's instructions (R\u0026amp;D System).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDifferential gene expression\u003c/h2\u003e \u003cp\u003eGene expression was performed by Real-Time polymerase chain reaction (RT-PCR) after RNA isolation and cDNA synthesis. RNAs were isolated using the Quick-RNA\u0026trade; MiniPrep Plus (Zymo Research\u0026reg;), following the manufacturer\u0026rsquo;s instructions. RNAs were stored at -80\u0026deg;C until cDNA synthesis was performed using the ImProm-II\u0026trade; Reverse Transcription (Promega\u0026reg;). cDNAs were synthesized using the PTC-100\u0026trade; Programmable Thermal Controller (MJR/BioRad) thermocycler and stored at -20\u0026ordm;C until use.\u003c/p\u003e \u003cp\u003eRT-PCR was performed using Applied Biosystems\u0026trade; StepOne\u0026trade; system with Master Mix Syber Green (QuatroG P\u0026amp;D Ltda), following the manufacturer\u0026rsquo;s instructions. In Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e the specific primers were listed and synthesized by IDT (Coralveille, Iowa, USA). The expression level of each gene was normalized by \u003cem\u003eGAPDH\u003c/em\u003e or \u003cem\u003eβ-ACTIN\u003c/em\u003e and expressed as a fold change concerning the control group (undifferentiated THP-1), using the 2-ΔΔCT method\u003csup\u003e34\u003c/sup\u003e. Each sample was quantified in triplicate and points containing nuclease-free water were used as negative controls.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for gene expression by Real-Time PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[ ]\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGCACCAGGGCGTGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCAGCCAGGTCCAGACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGapdh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGAAGGTCGGAGTCAACGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCTGGAAGATGGTGATGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTAGCAAACCCTCAAGCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGATGGCAGAGAGGAGGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTLR-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGAGTTGCTTTCAATGGCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGACTGTAATCAAGAACCTGGAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACAAACTATTTGTCGCAGGAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCCACAAAGTTGATGCAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCCAGCTATGAACTCCTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCTCCTGGGGGTACTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTLR-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGTCATCATCAGCCTCTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGTCACTGTTGCTAATGTAGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTACAGTGGCAATGAGGATGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCGGAGATTCGTAGCTGGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMD-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCAGAAGCAGTATTGGGTCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCTTTGGAAGATTCATGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e400 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eARG1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACGGAAGAATCAGCCTGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCCACGTCTCTCTCAAGCCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e400 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCCL22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCGCCTACAGACTGCACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACGGTAACGGACGTAATCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGF-β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCCTGGACACCAACTATTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGCATTGCAGGAGCGCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eISG15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCTCAGCTCTGACACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGAACTCATCTTTGCCAGTACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGACCAACAAGTCTTCAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAATCCAAGCAAGTTGTAGCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCAGTCACGGTCAGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCCTCAGAGTGTTTCTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAAGACAGGAGAGCTGCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTTCAAATCTCTGTCACCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOASL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAGAAATTTCCAGGACCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCATCACGGTCACCATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH2A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCTCAACAAGCTTCTGGGCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGTGGTGGCTCTCGGTCTTCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e400 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH2B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCGCCCAAGAAGGGTTCTAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACGAAGGAGTTCATGATGCCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCGTAAAGTACTGCGCGACAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTCCAGGAACACCCTTCAGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e400 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH1S4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGGTGTCCGAGCTCATTACTAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTTTCTTGAGAGCGGCCAAAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e200 nM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eQualitative PCR\u003c/h2\u003e \u003cp\u003eQualitative PCR was performed using Platinum DreamTaq Green PCR Master mix (Fermentas\u0026reg;) following the manufacturer\u0026rsquo;s instructions, using the same primers for HTLV-1 tax. The second round of PCR was performed under the same conditions using 2 \u0026micro;l of the products from the first PCR round. The amplification cycle consisted of enzyme activation at 94\u0026deg;C for 3 minutes, 35 cycles of denaturation at 94\u0026deg;C for 30 s, annealing at 60\u0026deg;C for 30 s, extension at 72\u0026deg;C for 30 s, and a final extension step at 72\u0026deg;C for 10 minutes. PCR products were electrophoresed in 2% agarose (Sigma-Aldrich/Merck) gel stained with GelRed\u0026reg; (Biotium) in 1\u0026times; Tris-Borate-EDTA buffer (Invitrogen) at 100 V for 90 min. The bands were visualized using the MiniBis Pro ultraviolet transilluminator (DNR Bio-Imaging Systems Ltd\u0026reg;).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eExperimental data were analyzed using the Prisma 8.0 Software. The values expressed in the graphs indicate the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean. Statistical analysis was performed using a two-tailed \u003cem\u003eStudent t-\u003c/em\u003etest or repeated-measures one-way ANOVA with Bonferroni\u0026rsquo;s multiple comparison post-test. Values of p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered significant.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eComputational analysis of published transcriptomic datasets\u003c/h2\u003e \u003cp\u003eDatasets GSE29312 of Tattermusch \u003cem\u003eet al\u003c/em\u003e., 2012, and GSE117040 of Gerrick \u003cem\u003eet al\u003c/em\u003e., 2018 were obtained from the Gene Expression Omnibus (GEO) database. The dataset GSE29312 characterizes global gene expression profiles of blood cells taken from AC and HAM/TSP patients by HumanHT-12 V3 or WG6 V3 expression BeadChip arrays (Illumina, San Diego, CA, USA)\u003csup\u003e35\u003c/sup\u003e and the dataset GSE117040 characterized differential gene expression from macrophages derived from human peripheral blood monocytes cultured in the presence of LPS and IFNγ to induce M1 polarization, or IL-4 and IL-13 to induce M2 polarization. The authors used TrueSeq Stranded Total RNA kit (Illumina) to prepare the libraries and sequenced by HS2500 Rapid Run instrument Illumina [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Differential gene expression results from both datasets were downloaded using R Studio GEOquery package software [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Data were visualized using the R packages ggplot2 and ComplexHeatmap [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cstrong\u003eHTLV-1-infected cells induced macrophage differentiation\u003c/strong\u003e \u003cstrong\u003ein vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the monocyte profile during HTLV-1 infection, we used an \u003cem\u003ein vitro\u003c/em\u003e system. The human monocytic cell line (THP-1) was cultured with HTLV-1-infected cells (MT-2), previously irradiated, and THP-1 cell morphology and viability were analyzed after 6 days. The co-culture with MT-2 or PMA did not impact cell viability (\u003cstrong\u003eSupplementary Fig.\u0026nbsp;1\u003c/strong\u003e). THP-1 cells showed a non-adherent and rounded morphology of monocytes, as described in the literature (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA). PMA stimulation was used as a positive control for macrophage differentiation [\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e]. Interestingly, cells co-cultured with MT-2 spread out and adhered to the plate surface, acquiring a macrophage-like morphology, as also observed for PMA-treated cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA). Moreover, THP-1 cells cultured with MT-2 expressed CD68, a surface marker highly expressed in macrophages (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB). These results suggested monocyte differentiation into macrophages in the presence of HTLV-1-infected cells.\u003c/p\u003e\n\u003cp\u003eTo further evaluate the differentiation, we explored prototypical macrophage surface molecules. The levels of HLA-DR, a class II MHC molecule, increased in THP-1 cells after co-culture with MT-2 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cstrong\u003esupplementary Fig.\u0026nbsp;2\u003c/strong\u003e). The mean fluorescence intensity (MFI) was approximately 50-fold higher compared to undifferentiated cells (THP-1 CTR; Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). Co-stimulatory molecules CD80 and CD86 also increased significantly (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB-C). More than 50% of cells cultured with MT-2 cells expressed CD86, and it was approximately 200-fold higher than THP-1 CTR (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC). No difference was observed in the frequency of cells expressing CD14 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD) but both THP-1 co-cultured with MT-2 and treated with PMA expressed higher levels of CD14, as demonstrated by the MFI in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD. The frequency of CD32\u003csup\u003e+\u003c/sup\u003e (Fc\u0026gamma; receptor II) cells and their MFI were slightly increased after co-culturing with MT-2 or PMA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eE). We also observed an increase in the levels (MFI) of CD127\u003csup\u003e+\u003c/sup\u003e (IL-7\u0026alpha; receptor) cells after the co-culture compared to the undifferentiated THP-1 (CTR) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eF). Altogether these results support the hypothesis that monocyte differentiation into macrophages is induced by the HTLV-1-infected cells.\u003c/p\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n\u003ch2\u003eTHP-1 cells co-cultured with HTLV-1-infected cells express high levels of pro-inflammatory genes\u003c/h2\u003e\n\u003cp\u003eMonocyte-derived macrophages can polarize into different populations, usually M1 (classic) and M2 (alternative) [\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e]. Given that HTLV-1-infected cells induce changes in the THP-1 phenotype, we next evaluated the expression of M1 and M2-associated genes after co-culturing with MT-2. The mRNA levels for pro-inflammatory cytokines TNF-\u0026alpha;, IL-6, and IL-1\u0026beta; were upregulated in THP-1 cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA). THP-1 macrophages differentiated using PMA and stimulated with LPS for 24 hours were used as a positive control and showed upregulation of pro-inflammatory genes (\u003cstrong\u003eSupplementary Fig.\u0026nbsp;3\u003c/strong\u003e). Similarly, higher concentrations of TNF-\u0026alpha; and IL-6 were found in the supernatant of THP-1 co-cultured with MT-2 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). Members of the matrix metalloproteinase (MMP) family are highly observed in various inflamed tissues [\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e] and MMP1 is an indicator of PMA-induced THP-1 cell differentiation [\u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e]. MMP-1 was increased in PMA-differentiated cells (4370\u0026thinsp;\u0026plusmn;\u0026thinsp;725.5 pg/mL) compared to control cells (320.4\u0026thinsp;\u0026plusmn;\u0026thinsp;320 pg/mL; Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC). After co-culture with MT-2, MMP-1 also increased (1024\u0026thinsp;\u0026plusmn;\u0026thinsp;615.1 pg/mL), but the presence of MT-2 in the culture induced a higher production of MMP-2 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC). Furthermore, soluble CD14 (sCD14) was highly produced after co-culturing compared to undifferentiated cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD) and it is consistent with the high expression of \u003cem\u003eTLR2\u003c/em\u003e and \u003cem\u003eTLR4\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e\n\u003cp\u003eRegarding M2-associated genes, we did not observe upregulation of arginase (\u003cem\u003eARG\u003c/em\u003e) or TGF-\u0026beta; (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eF). Dexamethasone-treated cells were used as a positive control for M2 differentiation (\u003cstrong\u003eSupplementary Fig.\u0026nbsp;3\u003c/strong\u003e). Interestingly, \u003cem\u003eMD2\u003c/em\u003e and \u003cem\u003eCCL22\u003c/em\u003e were induced by the co-culture with MT-2 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eG) as well as the release of IL-10 in the supernatant (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eH). These data suggest the induction of a profile associated with M1 polarization in THP-1 cells co-cultured with HTLV-1-infected cells predominantly.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n\u003ch2\u003eHigh levels of interferon-stimulated genes were induced in THP-1 cells after co-culture with MT-2\u003c/h2\u003e\n\u003cp\u003eAntiviral responses are characterized by the upregulation of Interferon-Stimulated Genes (ISGs) [\u003cspan class=\"CitationRef\"\u003e43\u003c/span\u003e]. We accessed the expression of some genes of the interferon family (IL-18, IL-28, IL-29, and IFN-\u0026beta;), and ISGs (OASL and ISG15). THP-1 cells co-cultured with MT-2 showed significant upregulation of IL-29, IFN-\u0026beta;, OASL, and ISG15 genes (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA). Positive controls are represented in supplementary Fig.\u0026nbsp;4. Lee \u003cem\u003eet al\u003c/em\u003e., 2019 demonstrated that tryptophanyl-tRNA synthetase (WARS) is induced and released during viral infection [\u003cspan class=\"CitationRef\"\u003e44\u003c/span\u003e]. This enzyme acts as an alarmin and stimulates type I IFNs production and mutations in \u003cem\u003eWARS\u003c/em\u003e gene have been associated with motor neuropathy [\u003cspan class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e]. Figure\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB shows the upregulation of \u003cem\u003eWARS\u003c/em\u003e in THP-1 cultured with MT-2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHTLV-1 infection reduced histone genes transcription in THP-1 macrophages\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHTLV-1-infected cells undergo epigenetic modifications [\u003cspan class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e48\u003c/span\u003e]. Moreover, our group demonstrated a negative regulation of histone expression in monocytes of HTLV-1 carriers through proteomic analyses [\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e]. We sought to investigate whether the co-culture of THP-1 with MT-2 affects the expression of histones. The mRNA expression of H2A, H2B, H4, and H1S4 is downregulated in THP-1 cells co-cultured with MT-2 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA-D), suggesting that the macrophage differentiation induced by HTLV-1-infected cells affects histone gene expression.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003eTHP-1 co-cultured with MT-2 cells or its supernatant-induced cellular alterations and infection\u003c/h2\u003e\n\u003cp\u003eThe fact that THP-1 acquired an M1-like phenotype conducted the hypothesis that MT-2 lymphocytes might be contacting THP-1 monocytes and inducing its activation and differentiation to macrophages. To address this hypothesis, THP-1 monocytes, and MT-2 cells were co-cultured with MT-2-filtered supernatant (SN MT2) or an insert to block cell contact. Co-cultured cells without cell contact still induce monocyte differentiation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA). Pro-inflammatory cytokine IL-6 and ISGs, such as ISG15, OASL, and IFN-\u0026beta; were upregulated in THP-1 cells co-cultured with MT-2 supernatant. Furthermore, the frequency of CD86\u003csup\u003e+\u003c/sup\u003e cells increased after co-culture without cell contact (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eC). These data suggested that products secreted by MT-2 can induce THP-1 differentiation and activation of genes related to the inflammatory and antiviral response.\u003c/p\u003e\n\u003cp\u003eHTLV-1 infects monocytes and macrophages [\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e]. We next investigated whether THP-1 is infected with HTLV-1, demonstrated by the expression of \u003cem\u003etax\u003c/em\u003e (SK43/44), after co-cultivation with MT-2 cell or its supernatant. This gene was found in THP-1 after the co-culture with MT-2 cells (THP-1\u0026thinsp;+\u0026thinsp;MT-2) and MT-2 supernatant (+\u0026thinsp;SN MT-2; Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eD). These findings indicate that the presence of HTLV-1-infected cells in the culture is enough to induce monocyte activation and differentiation into M1-like macrophages. The cellular changes observed in the present study may be related to the infection of THP-1 cells, including a non-cell contact-dependent manner.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003eSignatures of macrophages and their subpopulations in HTLV-1 patients\u003c/h2\u003e\n\u003cp\u003eChanges in phenotypic and functional profiles of monocytes from people living with HTLV-1 have been demonstrated by our group [\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e] and others [\u003cspan class=\"CitationRef\"\u003e49\u003c/span\u003e]. Our \u003cem\u003ein vitro\u003c/em\u003e findings demonstrated that HTLV-1 induces macrophage differentiation in an inflammatory profile, predominantly, but also expressing suppressor genes. To evaluate whether this phenotype is observed in HTLV-1 human carriers and further investigate monocytes and macrophages phenotypic and molecular profile, we compared PBMC gene expression data published by Tattermusch \u003cem\u003eet al\u003c/em\u003e., 2012 (GSE29312) [\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e] with M1/M2 transcriptional profiles from Gerrick \u003cem\u003eet al\u003c/em\u003e., 2018 (GSE117040) [\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e]. 52 genes were commonly expressed on \u0026ldquo;M1\u0026rdquo; and \u0026ldquo;HTLV-1\u0026rdquo; transcriptional signatures (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA-C, \u003cstrong\u003esupplementary table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e\u003c/strong\u003e), including genes associated with type 1 interferon (\u003cem\u003eCCR7\u003c/em\u003e, \u003cem\u003eIL23\u003c/em\u003e, \u003cem\u003eIFITM3\u003c/em\u003e, \u003cem\u003eWARS\u003c/em\u003e) and purinergic receptors (\u003cem\u003eP2RY2\u003c/em\u003e, \u003cem\u003eP2RY14\u003c/em\u003e). In contrast, 51 genes were both upregulated in \u0026ldquo;M2\u0026rdquo; and \u0026ldquo;HTLV-1\u0026rdquo; signatures such as \u003cem\u003eF13A1\u003c/em\u003e (related to coagulation), \u003cem\u003eCASP5\u003c/em\u003e (regulation of the inflammatory response), \u003cem\u003eDNSE1L3\u003c/em\u003e (apoptotic cell death) and \u003cem\u003eCTSC\u003c/em\u003e (antigen processing). Interestingly, the ISGs \u003cem\u003eIFIT1/2\u003c/em\u003e, \u003cem\u003eOASL/3\u003c/em\u003e, and \u003cem\u003eIFITM3\u003c/em\u003e were upregulated on the \u0026ldquo;M2\u0026rdquo; signature (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC) and were similarly found in THP-1 cultured with MT-2.\u003c/p\u003e\n\u003cp\u003eWe also compared \u0026ldquo;M1\u0026rdquo; and \u0026ldquo;M2\u0026rdquo;-associated genes with HAM/TSP signature. Figure\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eD shows 14 genes in the intersection of \u0026ldquo;M1\u0026rdquo; and \u0026ldquo;HAM/TSP\u0026rdquo;. Genes associated with antiviral response (\u003cem\u003eGBP1\u003c/em\u003e, \u003cem\u003eWARS\u003c/em\u003e, \u003cem\u003eBTN3A1\u003c/em\u003e, \u003cem\u003eIFITM3\u003c/em\u003e, and \u003cem\u003eGBP5\u003c/em\u003e) were commonly expressed, as well as purinergic receptors (\u003cem\u003eP2RY2\u003c/em\u003e and \u003cem\u003eP2RY14\u003c/em\u003e) and cell death (FAS) genes (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eF). The \u0026ldquo;M2\u0026rdquo; and \u0026ldquo;HAM/TSP\u0026rdquo; also exhibited 8 genes commonly expressed, related to neurodegeneration (\u003cem\u003eBACE2\u003c/em\u003e), antiviral response (\u003cem\u003eGBP5\u003c/em\u003e, \u003cem\u003eCASP5\u003c/em\u003e, \u003cem\u003eGBP1\u003c/em\u003e, \u003cem\u003eIFIT1\u003c/em\u003e, and \u003cem\u003eIFITM3\u003c/em\u003e), and signal transduction (\u003cem\u003ePLCL1\u003c/em\u003e). We presuppose that its upregulation contributes to neuroinflammation and antiviral response.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eIt is well described that HAM/TSP development and progression involve mononuclear cells, including monocytes and macrophages [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Given the difficulty of obtaining animal models to study HTLV-1, we used an \u003cem\u003ein vitro\u003c/em\u003e model to characterize monocyte differentiation during the HTLV-1 infection.\u003c/p\u003e \u003cp\u003eIn this study, we demonstrated that HTLV-1-infected cells induced THP-1 monocyte activation and differentiation into macrophages. THP-1 cells acquired a macrophage morphology, up-regulated the levels of surface molecules (HLA-DR, CD80, CD86, CD14, CD127, TLR4, and TLR2), and increased the expression and/or levels of inflammatory cytokines (IL-6, TNF-α, IL-1β) and MMP2. Surprisingly, the upregulation of M2-associated molecules, such as \u003cem\u003eCCL22, IL-10\u003c/em\u003e, and \u003cem\u003eMD-2\u003c/em\u003e was observed after the co-culture. Moreover, the monocyte interaction with HTLV-1-infected cells resulted in a cellular antiviral state characterized by ISGs expression (\u003cem\u003eIFN-β, IL-29, OASL\u003c/em\u003e, and \u003cem\u003eWARS\u003c/em\u003e). We showed that HTLV-1-infected cells can induce macrophage differentiation and infection regardless of cell contact.\u003c/p\u003e \u003cp\u003eWe can attribute these findings, at least partially, to viral protein Tax effects on cells. Besides the direct Tax production by infected cells, viral protein is transferred by cell contact or exosomes [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Tax protein activates several specific transcription factors such as CREB (cAMP response element binding protein), AP-1, NF-κB, JNK, IRF4, and mTOR [\u003cspan additionalcitationids=\"CR54\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. The hyperactivation of some of these factors was associated with macrophage M1 polarization during bacterial or viral infection [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Tax protein participates in viral replication, leading to histone ubiquitylation, which can be related to epigenetic modifications (methylation) and protein degradation [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e].After co-culture THP1 monocytes presented a reduction in the levels of mRNAs for histones (\u003cem\u003eH2A, H2B, H4, H1S4\u003c/em\u003e), suggesting an effect on chromatin regulation. Interestingly, our group has demonstrated a reduction of histone expression in monocytes obtained from HTLV-1-infected individuals, using proteomic and immunofluorescence assays [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Furthermore, epigenetic modifications, such as hypomethylation and hypermethylation in H3K4 and H3K27, have been demonstrated during human monocyte differentiation to macrophage [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo further understand monocyte and macrophage profile during the infection and complement our findings, we compared M1 and M2 macrophage transcriptional gene signatures with signatures from PBMCs of HTLV-1-infected donors, including HAM/TSP patients. Common expression of several genes was remarkable: while the M1 signature in asymptomatic infection was marked by genes associated with inflammation, antigen processing, and antiviral response; the M2 signature was highlighted by genes associated with coagulation, apoptosis, and regulation of immune response. Interferon-inducible genes \u003cem\u003eIFITM3, WARS, GBP1, GBP5, CCR7, ISG15\u003c/em\u003e, and \u003cem\u003eOASL\u003c/em\u003e were likewise in the intersection of macrophages (M1 and M2) and HTLV-1 or HAM/TSP gene signatures supporting our \u003cem\u003ein vitro\u003c/em\u003e findings.\u003c/p\u003e \u003cp\u003eZarei Ghobadi \u003cem\u003eet al\u003c/em\u003e. (2020) analyzed three microarray datasets to identify gene transcriptional signatures associated with HAM/TSP development, which we used to associate our data and found an intersection. The authors found 38 modules enriched in HAM/TSP patient signatures [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e], including the IL-10 signaling pathway, associated with M2 phenotype, cytokine detected in this work. The involvement of immunological-related proteins, PSME1 and GBP5, can be considered an intersection of both findings. The PSME1 (or proteasome activator subunit 1) is an immunoproteasome component and is directly connected to the processing of class I MHC peptides [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. This molecule was associated with HAM/TSP progression, and we connected this data to HLA-DR, CD80, and CD86 upregulation after THP1 monocytes co-cultured with HTLV-1-infected cells. These molecules are upregulated for effective antigen presentation during APC maturation [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Moreover, these proteins were also related to M1 polarization during the attenuated strain of Junin virus (etiological agent of Argentine hemorrhagic fever) [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. In addition, GBP5 protein (guanine nucleotide binding protein 5) was also detected in the comparison of published datasets and can be associated with M1 macrophage polarization due to its effects. This GTPase was induced by influenza A virus infection, then stimulated infected-cell antiviral state, leading to IFNs type I and III expression genes [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. Corroborating our data, it is known that GBP5 also promotes ISGs activation and proinflammatory cytokines production such as TNF-α, IL-6, and IL-1β/IL-18 [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. Additionally, higher levels of IL-18 in cerebrospinal fluid from HAM/TSP patients have been demonstrated and validate this enhancement to neuroinflammation and BBB disruption [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAltogether, our findings propose the ability of monocyte differentiation into macrophages that may contribute to pro-inflammatory and anti-viral responses observed by the upregulation of associated genes. Although few features of M2 macrophages are still found during the infection, we suggest that the M1 phenotype may contribute to HAM/TSP progression based on Zarei Ghobadi \u003cem\u003eet al\u003c/em\u003e. (2020) findings [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. However, more specific studies are needed to further understand the role of M1 and M2 macrophages and molecular modifications resulting from HTLV-1 infection.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cstrong\u003eHTLV-1:\u003c/strong\u003e Human T-cell lymphotropic virus type 1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHAM/TSP:\u003c/strong\u003e HTLV-1-associated myelopathy/tropical spastic paraparesis\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAC:\u003c/strong\u003e asymptomatic carriers\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ecDNA:\u003c/strong\u003e complementary DNA\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCCL:\u003c/strong\u003e Chemokine (C-C motif) ligand\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCCR5:\u003c/strong\u003e C-C motif chemokine receptor 5\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCXCR3:\u003c/strong\u003e C-X-C motif chemokine receptor 3\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCX3CR1:\u003c/strong\u003e C-X3-C motif chemokine receptor 1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCD:\u003c/strong\u003e cluster of differentiation\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDC:\u003c/strong\u003e dendritic cell\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA:\u003c/strong\u003e deoxyribonucleic acid\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGM-CSF:\u003c/strong\u003e Granulocyte-macrophage colony-stimulating factor\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGO:\u003c/strong\u003e Gene Ontology\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHIV-1:\u003c/strong\u003e Human Immunodeficiency Virus type 1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIFN-\u0026gamma;:\u003c/strong\u003e interferon-gamma\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIL:\u003c/strong\u003e interleukin\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eISGs: \u003c/strong\u003einterferon-stimulated genes\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMD2:\u003c/strong\u003e myeloid differentiation protein 2\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMFI:\u003c/strong\u003e mean of fluorescence intensity\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eORF:\u003c/strong\u003e open reading frame\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePBMC:\u003c/strong\u003e peripheral blood mononuclear cells\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePBS:\u003c/strong\u003e phosphate buffered saline\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePCR:\u003c/strong\u003e polymerase chain reaction\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePMA:\u003c/strong\u003e Phorbol 12-myristate-13-acetate\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA:\u003c/strong\u003e ribonucleic acid\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRT-PCR:\u003c/strong\u003e real-time PCR\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTNF-\u0026alpha;:\u003c/strong\u003e tumor necrosis factor-alpha\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are thankful to the Flow Cytometry Unit from the Programa de P\u0026oacute;s-gradua\u0026ccedil;\u0026atilde;o em Imunologia e Inflama\u0026ccedil;\u0026atilde;o at the Universidade Federal do Rio de Janeiro.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from Funda\u0026ccedil;\u0026atilde;o Carlos Chagas Filho de Amparo \u0026agrave; Pesquisa do Estado do Rio de Janeiro (FAPERJ, E-26/211.003/2019), Conselho Nacional de Desenvolvimento Cient\u0026iacute;fico e Tecnol\u0026oacute;gico (CNPq). Sabrina Pires Maciel, Guilherme A. Melo, and Carolina Cal\u0026ocirc;ba were recipients of Fellowships from Coordena\u0026ccedil;\u0026atilde;o de Aperfei\u0026ccedil;oamento de Pessoal de N\u0026iacute;vel Superior (CAPES).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthorship\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSabrina Pires Maciel de Souza performed the experiments, data analysis, and writing the original draft; Carolina Cal\u0026ocirc;ba performed the experiments and the \u003cem\u003ecomputational\u003c/em\u003e analysis; Guilherme A. Melo performed the \u003cem\u003ecomputational\u0026nbsp;\u003c/em\u003eanalysis and figure elaboration, Renata M. Pereira and Juliana Echevarria-Lima conceived and designed the experiments edited and reviewed the manuscript text.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col start=\"1\" type=\"1\"\u003e\n\u003cli\u003eGessain A, Barin F, Vernant JC, et al. Antibodies to human T-lymphotropic virus type-I in patients with tropical spastic paraparesis. Lancet. 1985;2(8452):407-410. doi:10.1016/s0140-6736(85)92734-5\u003c/li\u003e\n\u003cli\u003ePoiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc Natl Acad Sci U S A. 1980;77(12):7415-7419. doi:10.1073/pnas.77.12.7415\u003c/li\u003e\n\u003cli\u003eGessain A, Cassar O. Epidemiological Aspects and World Distribution of HTLV-1 Infection. Front Microbiol. 2012;3:388. doi:10.3389/fmicb.2012.00388\u003c/li\u003e\n\u003cli\u003eAraujo AQC, Silva MTT. The HTLV-1 neurological complex. Lancet Neurol. 2006;5(12):1068-1076. doi:10.1016/S1474-4422(06)70628-7\u003c/li\u003e\n\u003cli\u003eFuzii HT, da Silva Dias GA, de Barros RJ, Falc\u0026atilde;o LF, Quaresma JA. Immunopathogenesis of HTLV-1-assoaciated myelopathy/tropical spastic paraparesis (HAM/TSP) - PubMed. Accessed December 12, 2023. https://pubmed.ncbi.nlm.nih.gov/24704970/\u003c/li\u003e\n\u003cli\u003eAlamy AH, Menezes FB, Leite AC, Nascimento OM, Ara\u0026uacute;jo AQ. Dysautonomia in human T-cell lymphotrophic virus type I-associated myelopathy/tropical spastic paraparesis. Ann Neurol. 2001;50(5):681-685. doi:10.1002/ana.1264\u003c/li\u003e\n\u003cli\u003eSilva MTT, Mattos P, Alfano A, Ara\u0026uacute;jo AQC. Neuropsychological assessment in HTLV-1 infection: a comparative study among TSP/HAM, asymptomatic carriers, and healthy controls. J Neurol Neurosurg Psychiatry. 2003;74(8):1085-1089. doi:10.1136/jnnp.74.8.1085\u003c/li\u003e\n\u003cli\u003eLeite ACC, Silva MTT, Alamy AH, et al. Peripheral neuropathy in HTLV-I infected individuals without tropical spastic paraparesis/HTLV-I-associated myelopathy. J Neurol. 2004;251(7):877-881. doi:10.1007/s00415-004-0455-7\u003c/li\u003e\n\u003cli\u003ePrince HE, York J, Golding J, Owen SM, Lal RB. Spontaneous lymphocyte proliferation in human T-cell lymphotropic virus type I (HTLV-I) and HTLV-II infection: T-cell subset responses and their relationships to the presence of provirus and viral antigen production. Clin Diagn Lab Immunol. 1994;1(3):273-282. doi:10.1128/cdli.1.3.273-282.1994\u003c/li\u003e\n\u003cli\u003eYasunaga J-i, Sakai T, Nosaka K, et al. Impaired production of naive T lymphocytes in human T-cell leukemia virus type I-infected individuals: its implications in the immunodeficient state. Blood. 2001;97(10):3177-3183. doi:10.1182/blood.v97.10.3177\u003c/li\u003e\n\u003cli\u003eMatsuoka M, Jeang KT. Human T-cell leukaemia virus type 1 (HTLV-1) infectivity and cellular transformation. Nat Rev Cancer. 2007;7(4):270-280. doi:10.1038/nrc2111\u003c/li\u003e\n\u003cli\u003eNagai M, Yamano Y, Brennan MB, Mora CA, Jacobson S. Increased HTLV-I proviral load and preferential expansion of HTLV-I Tax-specific CD8+ T cells in cerebrospinal fluid from patients with HAM/TSP. Ann Neurol. 2001;50(6):807-812. doi:10.1002/ana.10065\u003c/li\u003e\n\u003cli\u003eMacatonia SE, Cruickshank JK, Rudge P, Knight SC. Dendritic cells from patients with tropical spastic paraparesis are infected with HTLV-1 and stimulate autologous lymphocyte proliferation. AIDS Res Hum Retroviruses. 1992;8(9):1699-1706. doi:10.1089/aid.1992.8.1699\u003c/li\u003e\n\u003cli\u003eMakino M, Wakamatsu S, Shimokubo S, Arima N, Baba M. Production of functionally deficient dendritic cells from HTLV-I-infected monocytes: implications for the dendritic cell defect in adult T cell leukemia. Virology. 2000;274(1):140-8. https://pubmed.ncbi.nlm.nih.gov/10936095/\u003c/li\u003e\n\u003cli\u003eHishizawa M, Imada K, Kitawaki T, Ueda M, Kadowaki N, Uchiyama T. Depletion and impaired interferon-alpha-producing capacity of blood plasmacytoid dendritic cells in human T-cell leukaemia virus type I-infected individuals. Br J Haematol. 2004;125(5):568-575. doi:10.1111/j.1365-2141.2004.04956.x\u003c/li\u003e\n\u003cli\u003eNascimento CR, Lima MA, de Andrada Serpa MJ, Espindola O, Leite ACC, Echevarria-Lima J. Monocytes from HTLV-1-infected patients are unable to fully mature into dendritic cells. Blood. 2011;117(2):489-499. doi:10.1182/blood-2010-03-272690\u003c/li\u003e\n\u003cli\u003eEchevarria-Lima J, de Abreu Pereira D, de Oliveira TS, et al. Protein Profile of Blood Monocytes is Altered in HTLV-1 Infected Patients: Implications for HAM/TSP Disease. Sci Rep. 2018;8(1):14354. doi:10.1038/s41598-018-32324-2\u003c/li\u003e\n\u003cli\u003eTakeuchi H, Takahashi M, Norose Y, Takeshita T, Fukunaga Y, Takahashi H. Transformation of breast milk macrophages by HTLV-I: implications for HTLV-I transmission via breastfeeding. Biomed Res. 2010;31(1):53-61. doi:10.2220/biomedres.31.53\u003c/li\u003e\n\u003cli\u003eBangham CRM, Araujo A, Yamano Y, Taylor GP. HTLV-1-associated myelopathy/tropical spastic paraparesis. Nat Rev Dis Primers. 2015;1:15012. doi:10.1038/nrdp.2015.12\u003c/li\u003e\n\u003cli\u003eAndo H, Sato T, Tomaru U, et al. Positive feedback loop via astrocytes causes chronic inflammation in virus-associated myelopathy. Brain. 2013;136(Pt 9):2876-2887. doi:10.1093/brain/awt183\u003c/li\u003e\n\u003cli\u003eEnose-Akahata Y, Matsuura E, Tanaka Y, Oh U, Jacobson S. Minocycline modulates antigen-specific CTL activity through inactivation of mononuclear phagocytes in patients with HTLV-I associated neurologic disease. Retrovirology. 2012;9:16. doi:10.1186/1742-4690-9-16\u003c/li\u003e\n\u003cli\u003eGao L, Brenner D, Llorens-Bobadilla E, et al. Infiltration of circulating myeloid cells through CD95L contributes to neurodegeneration in mice. J Exp Med. 2015;212(4):469-480. doi:10.1084/jem.20132423\u003c/li\u003e\n\u003cli\u003ePrinz M, Priller J, Sisodia SS, Ransohoff RM. Heterogeneity of CNS myeloid cells and their roles in neurodegeneration. Nat Neurosci. 2011;14(10):1227-1235. doi:10.1038/nn.2923\u003c/li\u003e\n\u003cli\u003eJones KS, Petrow-Sadowski C, Huang YK, Bertolette DC, Ruscetti FW. Cell-free HTLV-1 infects dendritic cells leading to transmission and transformation of CD4(+) T cells. Nat Med. 2008;14(4):429-436. doi:10.1038/nm1745\u003c/li\u003e\n\u003cli\u003eAzakami K, Sato T, Araya N, et al. Severe loss of invariant NKT cells exhibiting anti-HTLV-1 activity in patients with HTLV-1-associated disorders. Blood. 2009;114(15):3208-3215. doi:10.1182/blood-2009-02-203042\u003c/li\u003e\n\u003cli\u003eZiegler-Heitbrock HW. The biology of the monocyte system. Eur J Cell Biol. 1989;49(1):1-12.\u003c/li\u003e\n\u003cli\u003eAncuta P, Kamat A, Kunstman KJ, et al. Microbial translocation is associated with increased monocyte activation and dementia in AIDS patients. PLoS One. 2008;3(6):e2516. doi:10.1371/journal.pone.0002516\u003c/li\u003e\n\u003cli\u003eVeenhuis RT, Williams DW, Shirk EN, et al. Higher circulating intermediate monocytes are associated with cognitive function in women with HIV. JCI Insight. 2021;6(11):e146215, 146215. doi:10.1172/jci.insight.146215\u003c/li\u003e\n\u003cli\u003ede Castro-Amarante MF, Pise-Masison CA, McKinnon K, et al. Human T Cell Leukemia Virus Type 1 Infection of the Three Monocyte Subsets Contributes to Viral Burden in Humans. J Virol. 2015;90(5):2195-2207. doi:10.1128/JVI.02735-15\u003c/li\u003e\n\u003cli\u003eKim FJ, Manel N, Boublik Y, Battini JL, Sitbon M. Human T-cell leukemia virus type 1 envelope-mediated syncytium formation can be activated in resistant Mammalian cell lines by a carboxy-terminal truncation of the envelope cytoplasmic domain. J Virol. 2003;77(2):963-969. doi:10.1128/jvi.77.2.963-969.2003\u003c/li\u003e\n\u003cli\u003eWilliams DW, Calderon TM, Lopez L, et al. Mechanisms of HIV entry into the CNS: increased sensitivity of HIV infected CD14+CD16+ monocytes to CCL2 and key roles of CCR2, JAM-A, and ALCAM in diapedesis. PLoS One. 2013;8(7):e69270. doi:10.1371/journal.pone.0069270\u003c/li\u003e\n\u003cli\u003eMiyoshi I, Kubonishi I, Yoshimoto S, Shiraishi Y. A T-cell line derived from normal human cord leukocytes by co-culturing with human leukemic T-cells. Gan. 1981;72(6):978-981.\u003c/li\u003e\n\u003cli\u003eDaigneault M, Preston JA, Marriott HM, Whyte MKB, Dockrell DH. The identification of markers of macrophage differentiation in PMA-stimulated THP-1 cells and monocyte-derived macrophages. PLoS One. 2010;5(1):e8668. doi:10.1371/journal.pone.0008668\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-408. doi:10.1006/meth.2001.1262\u003c/li\u003e\n\u003cli\u003eTattermusch S, Skinner JA, Chaussabel D, et al. Systems biology approaches reveal a specific interferon-inducible signature in HTLV-1 associated myelopathy. PLoS Pathog. 2012;8(1):e1002480. doi:10.1371/journal.ppat.1002480\u003c/li\u003e\n\u003cli\u003eGerrick KY, Gerrick ER, Gupta A, Wheelan SJ, Yegnasubramanian S, Jaffee EM. Transcriptional profiling identifies novel regulators of macrophage polarization. PLoS One. 2018;13(12):e0208602. doi:10.1371/journal.pone.0208602\u003c/li\u003e\n\u003cli\u003eDavis S, Meltzer PS. GEOquery: a bridge between the Gene Expression Omnibus (GEO) and BioConductor. Bioinformatics. 2007;23(14):1846-1847. doi:10.1093/bioinformatics/btm254\u003c/li\u003e\n\u003cli\u003eGu Z. Complex heatmap visualization. iMeta. 2022;1(3):e43. doi:10.1002/imt2.43\u003c/li\u003e\n\u003cli\u003eGu Z, H\u0026uuml;bschmann D. Pkgndep: a tool for analyzing dependency heaviness of R packages. Bioinformatics. 2022;38(17):4248-4251. doi:10.1093/bioinformatics/btac449\u003c/li\u003e\n\u003cli\u003eYunna C, Mengru H, Lei W, Weidong C. Macrophage M1/M2 polarization. Eur J Pharmacol. 2020;877:173090. doi:10.1016/j.ejphar.2020.173090\u003c/li\u003e\n\u003cli\u003eFingleton B. Matrix metalloproteinases as regulators of inflammatory processes. Biochim Biophys Acta Mol Cell Res. 2017;1864(11 Pt A):2036-2042. doi:10.1016/j.bbamcr.2017.05.010\u003c/li\u003e\n\u003cli\u003eWorley JR, Baugh MD, Hughes DA, et al. Metalloproteinase expression in PMA-stimulated THP-1 cells. Effects of peroxisome proliferator-activated receptor-gamma (PPAR gamma) agonists and 9-cis-retinoic acid. J Biol Chem. 2003;278(51):51340-51346. doi:10.1074/jbc.M310865200\u003c/li\u003e\n\u003cli\u003eNegishi H, Taniguchi T, Yanai H. The Interferon (IFN) Class of Cytokines and the IFN Regulatory Factor (IRF) Transcription Factor Family. Cold Spring Harb Perspect Biol. 2018;10(11):a028423. doi:10.1101/cshperspect.a028423\u003c/li\u003e\n\u003cli\u003eLee HC, Lee ES, Uddin MB, et al. Released Tryptophanyl-tRNA Synthetase Stimulates Innate Immune Responses against Viral Infection. J Virol. 2019;93(2):e01291-18. doi:10.1128/JVI.01291-18\u003c/li\u003e\n\u003cli\u003ePaley EL, Denisova G, Sokolova O, Posternak N, Wang X, Brownell AL. Tryptamine induces tryptophanyl-tRNA synthetase-mediated neurodegeneration with neurofibrillary tangles in human cell and mouse models. Neuromolecular Med. 2007;9(1):55-82. doi:10.1385/nmm:9:1:55\u003c/li\u003e\n\u003cli\u003eTsai PC, Soong BW, Mademan I, et al. A recurrent WARS mutation is a novel cause of autosomal dominant distal hereditary motor neuropathy. Brain. 2017;140(5):1252-1266. doi:10.1093/brain/awx058\u003c/li\u003e\n\u003cli\u003eBogenberger JM, Laybourn PJ. Human T Lymphotropic Virus Type 1 protein Tax reduces histone levels. Retrovirology. 2008;5:9. doi: 10.1186/1742-4690-5-9\u003c/li\u003e\n\u003cli\u003eNyborg JK, Egan D, Sharma N. The HTLV-1 Tax protein: revealing mechanisms of transcriptional activation through histone acetylation and nucleosome disassembly. Biochim Biophys Acta. 2010 Mar-Apr;1799(3-4):266-74. doi: 10.1016/j.bbagrm.2009.09.002\u003c/li\u003e\n\u003cli\u003eAmorim CF, Souza AS, Diniz AG, Carvalho NB, Santos SB, Carvalho EM. Functional activity of monocytes and macrophages in HTLV-1 infected subjects. PLoS Negl Trop Dis. 2014;8(12):e3399. doi:10.1371/journal.pntd.0003399\u003c/li\u003e\n\u003cli\u003eRocamonde B, Carcone A, Mahieux R, Dutartre H. HTLV-1 infection of myeloid cells: from transmission to immune alterations. Retrovirology. 2019;16(1):45. doi:10.1186/s12977-019-0506-x\u003c/li\u003e\n\u003cli\u003eJaworski E, Narayanan A, Van Duyne R, et al. Human T-lymphotropic virus type 1-infected cells secrete exosomes that contain Tax protein. J Biol Chem. 2014;289(32):22284-22305. doi:10.1074/jbc.M114.549659\u003c/li\u003e\n\u003cli\u003eMatsuura E, Enose-Akahata Y, Yao K, et al. Dynamic acquisition of HTLV-1 tax protein by mononuclear phagocytes: Role in neurologic disease. J Neuroimmunol. 2017;304:43-50. doi:10.1016/j.jneuroim.2016.09.014\u003c/li\u003e\n\u003cli\u003eSuzuki S, Zhou Y, Refaat A, et al. Human T cell lymphotropic virus 1 manipulates interferon regulatory signals by controlling the TAK1-IRF3 and IRF4 pathways. J Biol Chem. 2010;285(7):4441-4446. doi:10.1074/jbc.M109.031476\u003c/li\u003e\n\u003cli\u003eYoshita M, Higuchi M, Takahashi M, Oie M, Tanaka Y, Fujii M. Activation of mTOR by human T-cell leukemia virus type 1 Tax is important for the transformation of mouse T cells to interleukin-2-independent growth. Cancer Sci. 2012;103(2):369-374. doi:10.1111/j.1349-7006.2011.02123.x\u003c/li\u003e\n\u003cli\u003eGessain A, Mahieux R. Tropical spastic paraparesis and HTLV-1 associated myelopathy: clinical, epidemiological, virological and therapeutic aspects. Rev Neurol (Paris). 2012;168(3):257-269. doi:10.1016/j.neurol.2011.12.006\u003c/li\u003e\n\u003cli\u003eGiam CZ, Semmes OJ. HTLV-1 Infection and Adult T-Cell Leukemia/Lymphoma-A Tale of Two Proteins: Tax and HBZ. Viruses. 2016;8(6):161. doi:10.3390/v8060161\u003c/li\u003e\n\u003cli\u003eGajanayaka N, Dong SXM, Ali H, et al. TLR-4 Agonist Induces IFN-\u0026gamma; Production Selectively in Proinflammatory Human M1 Macrophages through the PI3K-mTOR- and JNK-MAPK-Activated p70S6K Pathway. J Immunol. 2021;207(9):2310-2324. doi:10.4049/jimmunol.2001191\u003c/li\u003e\n\u003cli\u003eGiam CZ. HTLV-1 Replication and Adult T Cell Leukemia Development. Recent Results Cancer Res. 2021;217:209-243. doi:10.1007/978-3-030-57362-1_10\u003c/li\u003e\n\u003cli\u003eMatsuo M, Ueno T, Monde K, et al. Identification and characterization of a novel enhancer in the HTLV-1 proviral genome. Nat Commun. 2022;13(1):2405. doi:10.1038/s41467-022-30029-9\u003c/li\u003e\n\u003cli\u003eDekkers KF, Neele AE, Jukema JW, Heijmans BT, de Winther MPJ. Human monocyte-to-macrophage differentiation involves highly localized gain and loss of DNA methylation at transcription factor binding sites. Epigenetics Chromatin. 2019;12(1):34. doi:10.1186/s13072-019-0279-4\u003c/li\u003e\n\u003cli\u003eZarei Ghobadi M, Mozhgani SH, Erfani Y. Identification of dysregulated pathways underlying HTLV-1-associated myelopathy/tropical spastic paraparesis through co-expression network analysis. J Neurovirol. 2021;27(6):820-830. doi:10.1007/s13365-020-00919-z\u003c/li\u003e\n\u003cli\u003eLi J, Schuler-Thurner B, Schuler G, Huber C, Seliger B. Bipartite regulation of different components of the MHC class I antigen-processing machinery during dendritic cell maturation. Int Immunol. 2001;13(12):1515-1523. doi:10.1093/intimm/13.12.1515\u003c/li\u003e\n\u003cli\u003eJin Y, Fuller L, Ciancio G, et al. Antigen presentation and immune regulatory capacity of immature and mature-enriched antigen presenting (dendritic) cells derived from human bone marrow. Hum Immunol. 2004;65(2):93-103. doi:10.1016/j.humimm.2003.11.002\u003c/li\u003e\n\u003cli\u003eFerrer MF, Thomas P, L\u0026oacute;pez Ortiz AO, et al. Junin Virus Triggers Macrophage Activation and Modulates Polarization According to Viral Strain Pathogenicity. Front Immunol. 2019;10:2499. doi:10.3389/fimmu.2019.02499\u003c/li\u003e\n\u003cli\u003eFeng J, Cao Z, Wang L, et al. Inducible GBP5 Mediates the Antiviral Response via Interferon-Related Pathways during Influenza A Virus Infection. J Innate Immun. 2017;9(4):419-435. doi:10.1159/000460294\u003c/li\u003e\n\u003cli\u003eShenoy AR, Wellington DA, Kumar P, et al. GBP5 promotes NLRP3 inflammasome assembly and immunity in mammals. Science. 2012;336(6080):481-485. doi:10.1126/science.1217141\u003c/li\u003e\n\u003cli\u003eFreitas NL, Gomes YCP, Souza FDS, et al. Lessons from the Cerebrospinal Fluid Analysis of HTLV-1-Infected Individuals: Biomarkers of Inflammation for HAM/TSP Development. Viruses. 2022;14(10):2146. doi:10.3390/v14102146\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-immunology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"imno","sideBox":"Learn more about [BMC Immunology](http://bmcimmunol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/imno/default.aspx","title":"BMC Immunology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"HTLV-1, monocyte, macrophage, cell differentiation, inflammatory phenotype","lastPublishedDoi":"10.21203/rs.3.rs-4359860/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4359860/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground.\u003c/strong\u003e The human T-cell lymphotropic virus type 1 (HTLV-1) is a retrovirus that causes HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). HAM/TSP is a chronic inflammatory neurodegenerative disease characterized by leukocyte infiltration in the spinal cord. T-lymphocytes are the most important targets of HTLV-1 infection, but monocytes are also infected. Monocytes from HTLV-1-infected individuals exhibit important functional differences compared to cells from uninfected donors. Here, we investigated the effects of cell-cell physical contact and/or secreted factors of HTLV-1-infected cells in monocyte activation and differentiation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods. \u003c/strong\u003eThe THP-1 human monocytic cell line was co-cultured with a human cell line transformed by HTLV-1 (MT-2) for 6 days. To determine the effects of co-culturing HTLV-1-infected cells in THP-1 monocytes cells were characterized by flow cytometry, immunofluorescence microscopy, and real-time PCR. Computational analysis of published transcriptomic datasets was realized to investigate molecular profiles of macrophages with mononuclear cells from HTLV-1 carriers.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults.\u003c/strong\u003e Co-culture of monocytes with HTLV-1-infected cells induced macrophage differentiation and upregulation of typical macrophages-associated molecules (HLA-DR, CD80, and CD86), increased cytokine (TNFα, IL-6, and IL-1β) levels and their coding genes. Consistently, published transcriptomic datasets showed changes in important genes associated with inflammation during HAM/TSP in patients. The presence of HTLV-1-infected cells in the culture also induced significant upregulation of Interferon Stimulated Genes (ISG), indicating viral infection. Monocyte activation and differentiation into pro-inflammatory macrophages occurred in a cell-to-cell contact-independent manner, suggesting the role of factors secreted by infected cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions.\u003c/strong\u003e Together our results indicated that the presence of HTLV-1-infected cells can induce monocyte differentiation into macrophages, predominantly, inflammatory.\u003c/p\u003e","manuscriptTitle":"HTLV-1-infected cells drive the differentiation of monocytes into macrophages in vitro","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-15 22:39:22","doi":"10.21203/rs.3.rs-4359860/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-08T12:13:39+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-08T12:07:41+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-07T08:37:24+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Immunology","date":"2024-05-02T14:56:16+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-immunology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"imno","sideBox":"Learn more about [BMC Immunology](http://bmcimmunol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/imno/default.aspx","title":"BMC Immunology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1a8015da-e90f-4733-9bbc-d8a8fbe48a15","owner":[],"postedDate":"May 15th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-03-24T16:05:55+00:00","versionOfRecord":{"articleIdentity":"rs-4359860","link":"https://doi.org/10.1186/s12865-024-00670-8","journal":{"identity":"bmc-immunology","isVorOnly":false,"title":"BMC Immunology"},"publishedOn":"2025-03-20 15:57:40","publishedOnDateReadable":"March 20th, 2025"},"versionCreatedAt":"2024-05-15 22:39:22","video":"","vorDoi":"10.1186/s12865-024-00670-8","vorDoiUrl":"https://doi.org/10.1186/s12865-024-00670-8","workflowStages":[]},"version":"v1","identity":"rs-4359860","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4359860","identity":"rs-4359860","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}