Development and Preliminary Evaluation of a Real-time Fluorescent Recombinase-Aided Amplification Assay for Rapid Detection of Mycobacterium aviumsubsp. Paratuberculosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Development and Preliminary Evaluation of a Real-time Fluorescent Recombinase-Aided Amplification Assay for Rapid Detection of Mycobacterium aviumsubsp. Paratuberculosis Haoqian Wang, Shuhui Sang, Bingqian Zhou, Peihang Song, Luyao Song, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9530592/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Paratuberculosis (PTB) caused by Mycobacterium avium subsp. paratuberculosis (MAP) is not only globally prevalent infectious disease that endangers ruminants worldwide, leading to chronic intestinal inflammation in ruminants, but also poses a severe public health challenge due to its potential association with human Crohn's disease. Current diagnostic methods such as bacterial culture and conventional PCR are limited by issues like long processing times, complex instrumentation, or insufficient sensitivity for early detection. To address these limitations, we combined the Recombinase Aided Amplification (RAA) technique with fluorescent probes to develop a novel real - time fluorescent Recombinase Aided Amplification (RAA) assay targeting the specific F57 gene of MAP. The optimized MAP detection method can achieve rapid amplification within 20 minutes at 39°C. This method has a detection limit of 1.93×10² copies/µL, demonstrating high sensitivity, and shows no cross - reactivity with 13 non - target pathogens. This real - time fluorescent RAA assay provides a rapid, highly sensitive, and instrument - flexible tool for MAP detection. It is suitable for large - scale screening and point - of - care testing in resource - limited settings. Moreover, this approach can also inform the rapid point-of-care diagnosis and epidemiological investigation of other diseases. Mycobacterium aviumsubsp. Paratuberculosis (MAP) real-time recombinase-aided amplification (RAA) F57 gene diagnostics Johne's disease Figures Figure 1 Figure 2 Introduction Mycobacterium avium subsp. Paratuberculosis (MAP) is a Gram-positive, acid-fast bacterium and the causative agent of paratuberculosis (Johne's disease), a chronic intestinal disorder affecting ruminants worldwide. The pathogen has also been implicated in Crohn's disease in humans, raising concerns about its zoonotic potential [ 1 , 2 ]. MAP is primarily transmitted through the fecal-oral route via contaminated environments, leading to substantial economic losses in livestock production due to reduced milk yield, weight loss, and premature culling [ 3 ]. A major challenge in controlling this disease lies in its insidious nature; infected animals experience a prolonged incubation period with intermittent, low-level bacterial shedding in feces, making early and accurate detection difficult [ 4 ]. The current diagnostic gold standard for MAP isolation remains bacterial culture from fecal samples, yet this method is hampered by MAP's fastidious growth requirements and can take several weeks to yield results [ 5 ]. While molecular techniques like conventional PCR offer improved speed and specificity [ 6 ], they still rely on sophisticated thermal cycling equipment, limiting their application in point-of-care or field settings. Consequently, there is a pressing need for diagnostic tools that combine the reliability of molecular methods with operational simplicity and rapid turnaround. Recombinase-aided amplification (RAA) is an innovative isothermal nucleic acid amplification technology that has emerged as a powerful alternative [ 7 ]. By employing a recombinase, single-stranded DNA-binding protein (SSB), and DNA polymerase, RAA efficiently amplifies target genes at a constant temperature of 39–42 ℃, eliminating the need for precise thermal cycling. The entire process, from initiation to result interpretation, can be completed within 5–20 minutes. The real-time fluorescent RAA variant further enhances this platform by integrating specific fluorescent probes, enabling continuous monitoring of the amplification reaction. This technology has been successfully applied to the rapid detection of various pathogenic microorganisms, demonstrating exceptional sensitivity, specificity, and suitability for on-site testing. In this study, we developed a real-time fluorescent RAA assay targeting the MAP-specific F57 gene. We optimized reaction conditions and systematically evaluated its sensitivity and specificity. The developed assay is characterized by rapid detection, simple operation, high sensitivity, and strong specificity. Such a tool holds considerable promise for enhancing large-scale screening programs, enabling timely intervention, and ultimately contributing to the control and eradication of paratuberculosis. Materials and methods Experimental Materials Bacterial strains, including Escherichia coli , Salmonellaspp. , Proteus mirabilis , Shigella flexneri , and Pasteurella multocida , were obtained from the culture collection of the Poultry Disease Institute at Henan Agricultural University. Nucleic acid extracts of Mycobacterium aviumsubsp. paratuberculosis and other mycobacterial species ( Mycobacterium fortuitum , Mycobacterium kansasii , Mycobacterium abscessus , Mycobacterium bovis , Mycobacterium tuberculosis (human type), Mycobacterium microti , and Mycobacterium intracellulare ) were provided by the Henan Provincial Center for Disease Control and Prevention. A plasmid standard containing the MAP-specific F57 gene was constructed and prepared by Tsingke Biotechnology Co., Ltd. (Nanjing, China). The basic reaction system for the Isothermal Fluorescent Amplification Rapid Detection Kit (DNA Fluorescent Type) was purchased from NAKE (Guangzhou) Biotechnology Co., Ltd., Guangzhou, China. Experimental Methods Primer and Probe Design Following the general principles for RAA assay design, specific primers and a corresponding fluorescent probe were designed to target the conserved F57 gene region of MAP (GenBank Accession No. MW546860.1). The oligonucleotides were designed using Oligo 7 software and synthesized by Shangya Biotechnology Co., Ltd. The sequences are listed in Table 1 . Table 1 Fluorescent RAA Primers and Probes Primer/Probe Primer Sequence (5′ཞ3′) Primer F1 CTCAGGCAGCTCCAGATCGTCATTCATGAA Primer F2 TGACGCACCGAACGACCCCAGAGCACTCGT Primer F3 CCCGACCCTGGTACGCCTCCCACTACAACG Primer R1 ATGGTCGTCTGTGCCAGCCGCCCACTCGTG Primer R2 GTGTTCGAGTTGCAGCTGAGAATTGTCGAT Primer R3 TTCAGCTATTGGTGTACCGAATGTTGTTGTC Probe P1 TCGCCAACGGGAGCGACTGGTAGACGCCCA[FAM-dT][THF][BHQ1-dT]CATCGATACCCAAACT-spacer C3 Note: FAM: Fluorescent Reporter Group, THF: Tetrahydrofuran Residue, BHQ1: Fluorescence Quenching Group Primer/Probe Screening and Assay Validation Primer/probe combinations (F1R1, F2R1, F3R1, F1R2, F2R2, F3R2, F1R3, F2R3, F3R3) were screened using a real-time fluorescent recombinase-aided amplification (RAA) assay. Each 50 µL reaction, assembled on ice, contained 29.4 µL Buffer A, 2.0 µL each of forward and reverse primer (10 µM), 0.6 µL fluorescent probe (10 µM), 5.0 µL template DNA (MAP plasmid standard or nuclease-free water as controls), and nuclease-free water to 47.5 µL. After adding 2.5 µL Buffer B to the tube cap, the mixture was inverted, centrifuged, and amplified at 39°C for 20 min in a fluorescence detector, with FAM signal acquired every 30 s (Fig. 1 ). The combination demonstrating the earliest signal onset and highest amplification efficiency was selected for subsequent assays . Evaluation of Sensitivity and Specificity The sensitivity of the optimized F3R1 primer/probe set was evaluated using 10-fold serial dilutions of a MAP plasmid standard (ranging from 1.93 × 10³ to 1.93 × 10⁰ copies/µL). The limit of detection (LOD) was defined as the lowest concentration that produced a positive amplification curve. Specificity was assessed against genomic DNA from related bacterial species, including Escherichia coli , Salmonellaspp. , Proteus mirabilis , Shigella flexneri , Pasteurella multocida , Mycobacterium fortuitum , Mycobacterium kansasii , Mycobacterium abscessus , Mycobacterium bovis , Mycobacterium tuberculosis , Mycobacterium microti , and Mycobacterium intracellulare . MAP nucleic acid and nuclease-free water were used as positive and negative controls, respectively. The reaction setup and procedural steps were performed following the protocol described in the "Primer/Probe Screening and Assay Validation" section above. Conventional PCR Comparison A conventional PCR assay targeting the same F57 gene region was performed for comparison. The reaction (25 µL) contained 12.5 µL 2× Rapid Taq Master Mix, 0.5 µL each primer (10 µM; F: 5´-CTCAGGCAGCTCCAGA-3´; R: 5´-TTCAGCTATTGGTGTACCG-3´), and 2.5 µL template DNA (MAP plasmid dilutions from 1.93 × 10⁻⁷ to 1.93 × 10⁰ copies/µL). Amplification conditions were: 95°C for 3 min; 34 cycles of 95°C for 15 s, 53°C for 15 s, and 72°C for 30 s; final extension at 72°C for 5 min. Products were visualized on a 1% agarose gel. Results Results of Primer Screening Among the nine primer pairs evaluated under identical real-time fluorescent RAA conditions, F3R1 exhibited the shortest time to detection and highest amplification efficiency (Fig. 2 A). It was therefore selected for all subsequent assays. Results of the Sensitivity and Specificity The sensitivity of the F3R1-based RAA assay was evaluated using tenfold serial dilutions of a MAP plasmid standard (ranging from 1.93 × 10³ to 1.93 × 10⁰ copies/µL). The method consistently detected the target at a concentration as low as 1.93 × 10² copies/µL, establishing this as the limit of detection (Fig. 2 B). Specificity was assessed against 13 reference strains, with amplification observed exclusively in the MAP positive control and no cross-reactivity detected (Fig. 2 C), confirming the high specificity of the assay. Results of Comparison with Conventional PCR The sensitivity of the real-time RAA assay was compared with conventional PCR targeting the same F57 gene region. While conventional PCR had an LOD of 1.93 × 10⁵ copies/µL (Fig. 2 D), the RAA assay demonstrated a 1,000-fold higher sensitivity (LOD = 1.93 × 10² copies/µL), highlighting its potential for early MAP detection. Discussion MAP presents significant diagnostic challenges due to its fastidious growth requirements, prolonged incubation period, and difficulty in early-stage detection. The infection typically progresses through four stages: asymptomatic, subclinical, clinical, and advanced, posing a substantial economic threat to the global dairy and beef cattle industries owing to its widespread prevalence [ 8 ]. RAA is achieved by adding recombinase, SSB, DNA polymerase, and deoxyribonucleoside triphosphate (dNTP). These four substances can replace the strand-breaking thermal cycling process of ordinary PCR, enabling nucleic acid amplification to proceed rapidly at 39°C − 42°C. Compared with the general molecular detection methods, real-time fluorescent RAA possesses several advantages, such as simplicity of operation (as it does not necessitate complex equipment or highly skilled personnel, can be conducted using portable device), low and constant reaction temperature (39°C), and rapid reaction speed (within 20 min) [ 7 ]. Both IS900 and F57 are conserved regions of MAP and are commonly used in the molecular detection techniques of MAP. However, Bannantine et al. discovered that the widely used PCR primer pair (P90 / P91) based on the IS900 region has errors in the binding position and reduced binding efficiency. The P90 primer is missing two nucleotides that should be present near the 3' end, and it does not bind all copies of IS900 due to 5' deletions at some IS900 loci [ 9 ]. Therefore, in this experiment, the F57 conserved region was selected. This study successfully established a novel real-time fluorescent RAA assay for the detection of MAP. The assay demonstrated superior sensitivity, with a detection limit of 1.93×10 2 copies/µL, which is significantly higher than that of conventional PCR technology. It also exhibited high specificity, showing no cross-reactivity with other mycobacterial species. These attributes provide a reliable alternative for the early, accurate, and rapid diagnosis of MAP. The method is particularly suitable for resource-limited diagnostic laboratories and holds great potential for point-of-care testing in clinical and field settings. Furthermore, the assay format could be adapted for the development of portable detection kits or colloidal gold-based lateral flow strips, facilitating immediate diagnosis in remote areas. A limitation of this study is the lack of large-scale clinical validation; therefore, further evaluation using clinical samples is warranted. Declarations Data availability All relevant data supporting the results of this study are available in the paper and its Supplementary Information. Conflict of interest The authors declare no competing interests. Funding This work was supported by the horizontal project "Tests on Biosafety and Disease Purification in Poultry Farms (No. 30801561) ". Author Contribution Conceptualization: Haoqian Wang, Xinwei Wang; Methodology: Haoqian Wang, Xinwei Wang; Formal analysis: Haoqian Wang, Shuhui Sang, Bingqian Zhou, Peihang Song, Luyao Song, Xinwei Wang; Investigation: Haoqian Wang; Resources: Haoqian Wang, Jianli LI, Yongtao LI, Liqiang Han, Xiumei Zhang, Xinwei Wang; Writing – original draft: Haoqian Wang, Xinwei Wang; Writing – review & editing: All authors; Funding acquisition: Xinwei Wang. Acknowledgments Conceptualization: Haoqian Wang, Xinwei Wang; Methodology: Haoqian Wang, Xinwei Wang; Formal analysis: Haoqian Wang, Shuhui Sang, Bingqian Zhou, Peihang Song, Luyao Song, Xinwei Wang; Investigation: Haoqian Wang; Resources: Haoqian Wang, Jianli LI, Yongtao LI, Liqiang Han, Xiumei Zhang, Xinwei Wang; Writing – original draft: Haoqian Wang, Xinwei Wang; Writing – review & editing: All authors; Funding acquisition: Xinwei Wang. References Ssekitoleko J, Ojok L, Abd El Wahed A, Erume J, Amanzada A, Eltayeb E et al (2021) Mycobacterium avium subsp. paratuberculosis Virulence: A Review. Microorganisms 9(12):2623. https://doi.org/10.3390/microorganisms9122623 Elmagzoub WA, Idris SM, Elnaiem MHE, Mukhtar ME, Eltayeb E, Bakhiet SM et al (2024) Faecal microbial diversity in a cattle herd infected by Mycobacterium avium subsp. paratuberculosis: a possible effect of production status. World J Microbiol Biotechnol 40(9):276. https://doi.org/10.1007/s11274-024-04080-1 Harman-McKenna VK, Eshraghisamani R, Shafer N, De Buck J (2024) Lining the small intestine with mycobacteriophages protects from Mycobacterium avium subsp. paratuberculosis and eliminates fecal shedding. Proc Natl Acad Sci U S A 121(33):e2318627121. https://doi.org/10.1073/pnas.2318627121 Worsley L, Davies PL (2024) Inter-laboratory ring trial to compare four quantitative polymerase chain reaction assays employed for detection of Mycobacterium avium subspecies paratuberculosis. Microbiol Spectr 12(3):e0221023. https://doi.org/10.1128/spectrum.02210-23 Matos AC, Figueira L, Martins MH, Cardoso L, Matos M, Pinto ML et al (2024) Mycobacterium avium subsp. paratuberculosis in Wild Boar (Sus scrofa) in Portugal. Pathogens 13(5):389. https://doi.org/10.3390/pathogens13050389 Badia-Bringué G, Canive M, Casais R, Blanco-Vázquez C, Amado J, Iglesias N et al (2022) Evaluation of a droplet digital PCR assay for quantification of Mycobacterium avium subsp. paratuberculosis DNA in whole-blood and fecal samples from MAP-infected Holstein cattle. Front Vet Sci 9:944189. https://doi.org/10.3389/fvets.2022.944189 Dong Y, Zhou D, Zhang B, Xu X, Zhang J (2024) Development of a real-time recombinase-aided amplification assay for rapid and sensitive detection of Edwardsiella piscicida. Front Cell Infect Microbiol 14:1355056. https://doi.org/10.3389/fcimb.2024.1355056 Behdad S, Pakdel A, Massudi R (2024) A novel diagnostic approach to Paratuberculosis in dairy cattle using near-infrared spectroscopy and aquaphotomics. Front Cell Infect Microbiol 14:1374560. https://doi.org/10.3389/fcimb.2024.1374560 Bannantine JP, Stabel JR, Bayles DO, Biet F (2023) Improved DNA Amplification of the Hallmark IS900 Element in Mycobacterium avium subsp. paratuberculosis: a Reexamination Based on Whole-Genome Sequence Analysis. Appl Environ Microbiol 89(2):e0168222. https://doi.org/10.1128/aem.01682-22 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9530592","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":641614837,"identity":"2c884801-29b1-4eeb-af4a-cbd841f69597","order_by":0,"name":"Haoqian Wang","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Haoqian","middleName":"","lastName":"Wang","suffix":""},{"id":641614840,"identity":"945e24ac-0f03-4e4f-a001-5721050b1abf","order_by":1,"name":"Shuhui Sang","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shuhui","middleName":"","lastName":"Sang","suffix":""},{"id":641614846,"identity":"7d762170-ce3d-430a-bc6b-a0901daa31df","order_by":2,"name":"Bingqian Zhou","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Bingqian","middleName":"","lastName":"Zhou","suffix":""},{"id":641614851,"identity":"fee09099-c25e-434b-bbbd-0b46304c70fb","order_by":3,"name":"Peihang Song","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Peihang","middleName":"","lastName":"Song","suffix":""},{"id":641614856,"identity":"a2d18e0d-f5f0-4ec9-8007-e61932fcdf0e","order_by":4,"name":"Luyao Song","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Luyao","middleName":"","lastName":"Song","suffix":""},{"id":641614859,"identity":"a0ee8080-d85c-4fcc-89d9-f8e6d48e2804","order_by":5,"name":"Jianli LI","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jianli","middleName":"","lastName":"LI","suffix":""},{"id":641614868,"identity":"b288885b-a88a-4016-9664-a513f0cf183f","order_by":6,"name":"Yongtao LI","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yongtao","middleName":"","lastName":"LI","suffix":""},{"id":641614871,"identity":"794267e2-c0bc-496b-8367-faef8b933c73","order_by":7,"name":"Liqiang Han","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Liqiang","middleName":"","lastName":"Han","suffix":""},{"id":641614878,"identity":"8210655a-31f3-4605-912d-5173ac4c1a85","order_by":8,"name":"Xiumei Zhang","email":"","orcid":"","institution":"Qianyuanhao Biological Co., Ltd. Zhengzhou Biological Pharmaceutical Factory","correspondingAuthor":false,"prefix":"","firstName":"Xiumei","middleName":"","lastName":"Zhang","suffix":""},{"id":641614882,"identity":"3be9af5a-6212-4fb2-add9-88f5514623dd","order_by":9,"name":"Xinwei Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYPACmwQog5loLWmkazlMghaD42cPv+ZtO5/HL938TIKhwjqxgf3sAfxazuSlWc5su10sOeeYmQTDmfTEBp68BLxazA7kmBl83HY7ccONBDMJxrbDiQ0SPAb4tZx/Y2aQuO1c4v4b6d8kGP8Ro+VGjvGDj9sOJG6QyAHa0kCEFvsbb8wYZ/5LTpxxI6fYIuFYunEbTw5+LZL9Ocafec7YJfbPSN9440ONtWw/+xn8WoCATQLOTABxCakHAuYPRCgaBaNgFIyCkQwA5IJIwBAIYvEAAAAASUVORK5CYII=","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Xinwei","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2026-04-26 08:55:50","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9530592/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9530592/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":109479063,"identity":"230bcebd-43f7-4823-83cd-5ec441c360de","added_by":"auto","created_at":"2026-05-18 14:48:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2972740,"visible":true,"origin":"","legend":"\u003cp\u003eWorkflow of MAP Detection Using the Real-Time Fluorescent RAA Assay\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-9530592/v1/55c6703662e8b5fb8ccfa5fd.png"},{"id":109760681,"identity":"8d1b9444-dae1-4214-bff6-9637636997ed","added_by":"auto","created_at":"2026-05-22 07:28:59","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5895163,"visible":true,"origin":"","legend":"\u003cp\u003eComparison between the real-time fluorescent RAA assay and conventional PCR. (A) Primer selection for thethe real-time fluorescent RAA assay. (B) Detection sensitivity of the the real-time fluorescent RAA assay. (C) Detection specificity of the the real-time fluorescent RAA assay. (D) Detection sensitivity of conventional PCR\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-9530592/v1/2c181f0cd6e613fa9d38bb11.png"},{"id":109764145,"identity":"864186b9-6231-4ecd-b57a-a5ec70cea2ee","added_by":"auto","created_at":"2026-05-22 07:36:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9729583,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9530592/v1/cc54ed4e-b515-4f63-ab29-e30b5e46960d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Development and Preliminary Evaluation of a Real-time Fluorescent Recombinase-Aided Amplification Assay for Rapid Detection of Mycobacterium aviumsubsp. Paratuberculosis","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eMycobacterium avium subsp. Paratuberculosis\u003c/em\u003e (MAP) is a Gram-positive, acid-fast bacterium and the causative agent of paratuberculosis (Johne's disease), a chronic intestinal disorder affecting ruminants worldwide. The pathogen has also been implicated in Crohn's disease in humans, raising concerns about its zoonotic potential [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. MAP is primarily transmitted through the fecal-oral route via contaminated environments, leading to substantial economic losses in livestock production due to reduced milk yield, weight loss, and premature culling [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. A major challenge in controlling this disease lies in its insidious nature; infected animals experience a prolonged incubation period with intermittent, low-level bacterial shedding in feces, making early and accurate detection difficult [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The current diagnostic gold standard for MAP isolation remains bacterial culture from fecal samples, yet this method is hampered by MAP's fastidious growth requirements and can take several weeks to yield results [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. While molecular techniques like conventional PCR offer improved speed and specificity [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], they still rely on sophisticated thermal cycling equipment, limiting their application in point-of-care or field settings. Consequently, there is a pressing need for diagnostic tools that combine the reliability of molecular methods with operational simplicity and rapid turnaround. Recombinase-aided amplification (RAA) is an innovative isothermal nucleic acid amplification technology that has emerged as a powerful alternative [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. By employing a recombinase, single-stranded DNA-binding protein (SSB), and DNA polymerase, RAA efficiently amplifies target genes at a constant temperature of 39\u0026ndash;42 ℃, eliminating the need for precise thermal cycling. The entire process, from initiation to result interpretation, can be completed within 5\u0026ndash;20 minutes. The real-time fluorescent RAA variant further enhances this platform by integrating specific fluorescent probes, enabling continuous monitoring of the amplification reaction. This technology has been successfully applied to the rapid detection of various pathogenic microorganisms, demonstrating exceptional sensitivity, specificity, and suitability for on-site testing.\u003c/p\u003e \u003cp\u003eIn this study, we developed a real-time fluorescent RAA assay targeting the MAP-specific F57 gene. We optimized reaction conditions and systematically evaluated its sensitivity and specificity. The developed assay is characterized by rapid detection, simple operation, high sensitivity, and strong specificity. Such a tool holds considerable promise for enhancing large-scale screening programs, enabling timely intervention, and ultimately contributing to the control and eradication of paratuberculosis.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExperimental Materials\u003c/h2\u003e \u003cp\u003eBacterial strains, including \u003cem\u003eEscherichia coli\u003c/em\u003e, \u003cem\u003eSalmonellaspp.\u003c/em\u003e, \u003cem\u003eProteus mirabilis\u003c/em\u003e, \u003cem\u003eShigella flexneri\u003c/em\u003e, and \u003cem\u003ePasteurella multocida\u003c/em\u003e, were obtained from the culture collection of the Poultry Disease Institute at Henan Agricultural University. Nucleic acid extracts of \u003cem\u003eMycobacterium aviumsubsp. paratuberculosis\u003c/em\u003e and other mycobacterial species (\u003cem\u003eMycobacterium fortuitum\u003c/em\u003e, \u003cem\u003eMycobacterium kansasii\u003c/em\u003e, \u003cem\u003eMycobacterium abscessus\u003c/em\u003e, \u003cem\u003eMycobacterium bovis\u003c/em\u003e, \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (human type), \u003cem\u003eMycobacterium microti\u003c/em\u003e, and \u003cem\u003eMycobacterium intracellulare\u003c/em\u003e) were provided by the Henan Provincial Center for Disease Control and Prevention. A plasmid standard containing the MAP-specific F57 gene was constructed and prepared by Tsingke Biotechnology Co., Ltd. (Nanjing, China). The basic reaction system for the Isothermal Fluorescent Amplification Rapid Detection Kit (DNA Fluorescent Type) was purchased from NAKE (Guangzhou) Biotechnology Co., Ltd., Guangzhou, China.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eExperimental Methods\u003c/h3\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePrimer and Probe Design\u003c/h2\u003e \u003cp\u003eFollowing the general principles for RAA assay design, specific primers and a corresponding fluorescent probe were designed to target the conserved F57 gene region of MAP (GenBank Accession No. MW546860.1). The oligonucleotides were designed using Oligo 7 software and synthesized by Shangya Biotechnology Co., Ltd. The sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFluorescent RAA Primers and Probes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer/Probe\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5\u0026prime;ཞ3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer F1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCAGGCAGCTCCAGATCGTCATTCATGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer F2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGACGCACCGAACGACCCCAGAGCACTCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer F3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCGACCCTGGTACGCCTCCCACTACAACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer R1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGTCGTCTGTGCCAGCCGCCCACTCGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer R2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGTTCGAGTTGCAGCTGAGAATTGTCGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer R3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCAGCTATTGGTGTACCGAATGTTGTTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProbe P1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGCCAACGGGAGCGACTGGTAGACGCCCA[FAM-dT][THF][BHQ1-dT]CATCGATACCCAAACT-spacer C3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003eNote: FAM: Fluorescent Reporter Group, THF: Tetrahydrofuran Residue, BHQ1: Fluorescence Quenching Group\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePrimer/Probe Screening and Assay Validation\u003c/h3\u003e\n\u003cp\u003ePrimer/probe combinations (F1R1, F2R1, F3R1, F1R2, F2R2, F3R2, F1R3, F2R3, F3R3) were screened using a real-time fluorescent recombinase-aided amplification (RAA) assay. Each 50 \u0026micro;L reaction, assembled on ice, contained 29.4 \u0026micro;L Buffer A, 2.0 \u0026micro;L each of forward and reverse primer (10 \u0026micro;M), 0.6 \u0026micro;L fluorescent probe (10 \u0026micro;M), 5.0 \u0026micro;L template DNA (MAP plasmid standard or nuclease-free water as controls), and nuclease-free water to 47.5 \u0026micro;L. After adding 2.5 \u0026micro;L Buffer B to the tube cap, the mixture was inverted, centrifuged, and amplified at 39\u0026deg;C for 20 min in a fluorescence detector, with FAM signal acquired every 30 s (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The combination demonstrating the earliest signal onset and highest amplification efficiency was selected for subsequent assays .\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eEvaluation of Sensitivity and Specificity\u003c/h3\u003e\n\u003cp\u003eThe sensitivity of the optimized F3R1 primer/probe set was evaluated using 10-fold serial dilutions of a MAP plasmid standard (ranging from 1.93 \u0026times; 10\u0026sup3; to 1.93 \u0026times; 10⁰ copies/\u0026micro;L). The limit of detection (LOD) was defined as the lowest concentration that produced a positive amplification curve. Specificity was assessed against genomic DNA from related bacterial species, including \u003cem\u003eEscherichia coli\u003c/em\u003e, \u003cem\u003eSalmonellaspp.\u003c/em\u003e, \u003cem\u003eProteus mirabilis\u003c/em\u003e, \u003cem\u003eShigella flexneri\u003c/em\u003e, \u003cem\u003ePasteurella multocida\u003c/em\u003e, \u003cem\u003eMycobacterium fortuitum\u003c/em\u003e, \u003cem\u003eMycobacterium kansasii\u003c/em\u003e, \u003cem\u003eMycobacterium abscessus\u003c/em\u003e, \u003cem\u003eMycobacterium bovis\u003c/em\u003e, \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e, \u003cem\u003eMycobacterium microti\u003c/em\u003e, and \u003cem\u003eMycobacterium intracellulare\u003c/em\u003e. MAP nucleic acid and nuclease-free water were used as positive and negative controls, respectively. The reaction setup and procedural steps were performed following the protocol described in the \"Primer/Probe Screening and Assay Validation\" section above.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eConventional PCR Comparison\u003c/h2\u003e \u003cp\u003eA conventional PCR assay targeting the same F57 gene region was performed for comparison. The reaction (25 \u0026micro;L) contained 12.5 \u0026micro;L 2\u0026times; Rapid Taq Master Mix, 0.5 \u0026micro;L each primer (10 \u0026micro;M; F: 5\u0026acute;-CTCAGGCAGCTCCAGA-3\u0026acute;; R: 5\u0026acute;-TTCAGCTATTGGTGTACCG-3\u0026acute;), and 2.5 \u0026micro;L template DNA (MAP plasmid dilutions from 1.93 \u0026times; 10⁻⁷ to 1.93 \u0026times; 10⁰ copies/\u0026micro;L). Amplification conditions were: 95\u0026deg;C for 3 min; 34 cycles of 95\u0026deg;C for 15 s, 53\u0026deg;C for 15 s, and 72\u0026deg;C for 30 s; final extension at 72\u0026deg;C for 5 min. Products were visualized on a 1% agarose gel.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eResults of Primer Screening\u003c/h2\u003e \u003cp\u003eAmong the nine primer pairs evaluated under identical real-time fluorescent RAA conditions, F3R1 exhibited the shortest time to detection and highest amplification efficiency (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). It was therefore selected for all subsequent assays.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eResults of the Sensitivity and Specificity\u003c/h2\u003e \u003cp\u003eThe sensitivity of the F3R1-based RAA assay was evaluated using tenfold serial dilutions of a MAP plasmid standard (ranging from 1.93 \u0026times; 10\u0026sup3; to 1.93 \u0026times; 10⁰ copies/\u0026micro;L). The method consistently detected the target at a concentration as low as 1.93 \u0026times; 10\u0026sup2; copies/\u0026micro;L, establishing this as the limit of detection (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Specificity was assessed against 13 reference strains, with amplification observed exclusively in the MAP positive control and no cross-reactivity detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), confirming the high specificity of the assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eResults of Comparison with Conventional PCR\u003c/h2\u003e \u003cp\u003eThe sensitivity of the real-time RAA assay was compared with conventional PCR targeting the same F57 gene region. While conventional PCR had an LOD of 1.93 \u0026times; 10⁵ copies/\u0026micro;L (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), the RAA assay demonstrated a 1,000-fold higher sensitivity (LOD\u0026thinsp;=\u0026thinsp;1.93 \u0026times; 10\u0026sup2; copies/\u0026micro;L), highlighting its potential for early MAP detection.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMAP presents significant diagnostic challenges due to its fastidious growth requirements, prolonged incubation period, and difficulty in early-stage detection. The infection typically progresses through four stages: asymptomatic, subclinical, clinical, and advanced, posing a substantial economic threat to the global dairy and beef cattle industries owing to its widespread prevalence [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRAA is achieved by adding recombinase, SSB, DNA polymerase, and deoxyribonucleoside triphosphate (dNTP). These four substances can replace the strand-breaking thermal cycling process of ordinary PCR, enabling nucleic acid amplification to proceed rapidly at 39\u0026deg;C\u0026thinsp;\u0026minus;\u0026thinsp;42\u0026deg;C. Compared with the general molecular detection methods, real-time fluorescent RAA possesses several advantages, such as simplicity of operation (as it does not necessitate complex equipment or highly skilled personnel, can be conducted using portable device), low and constant reaction temperature (39\u0026deg;C), and rapid reaction speed (within 20 min) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Both IS900 and F57 are conserved regions of MAP and are commonly used in the molecular detection techniques of MAP. However, Bannantine et al. discovered that the widely used PCR primer pair (P90 / P91) based on the IS900 region has errors in the binding position and reduced binding efficiency. The P90 primer is missing two nucleotides that should be present near the 3' end, and it does not bind all copies of IS900 due to 5' deletions at some IS900 loci [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Therefore, in this experiment, the F57 conserved region was selected.\u003c/p\u003e \u003cp\u003eThis study successfully established a novel real-time fluorescent RAA assay for the detection of MAP. The assay demonstrated superior sensitivity, with a detection limit of 1.93\u0026times;10\u003csup\u003e2\u003c/sup\u003e copies/\u0026micro;L, which is significantly higher than that of conventional PCR technology. It also exhibited high specificity, showing no cross-reactivity with other mycobacterial species. These attributes provide a reliable alternative for the early, accurate, and rapid diagnosis of MAP. The method is particularly suitable for resource-limited diagnostic laboratories and holds great potential for point-of-care testing in clinical and field settings. Furthermore, the assay format could be adapted for the development of portable detection kits or colloidal gold-based lateral flow strips, facilitating immediate diagnosis in remote areas. A limitation of this study is the lack of large-scale clinical validation; therefore, further evaluation using clinical samples is warranted.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eAll relevant data supporting the results of this study are available in the paper and its Supplementary Information.\u003c/p\u003e \u003c/div\u003e\u003cp\u003e \u003ch2\u003eConflict of interest\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the horizontal project \"Tests on Biosafety and Disease Purification in Poultry Farms (No. 30801561) \".\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization: Haoqian Wang, Xinwei Wang; Methodology: Haoqian Wang, Xinwei Wang; Formal analysis: Haoqian Wang, Shuhui Sang, Bingqian Zhou, Peihang Song, Luyao Song, Xinwei Wang; Investigation: Haoqian Wang; Resources: Haoqian Wang, Jianli LI, Yongtao LI, Liqiang Han, Xiumei Zhang, Xinwei Wang; Writing \u0026ndash; original draft: Haoqian Wang, Xinwei Wang; Writing \u0026ndash; review \u0026amp; editing: All authors; Funding acquisition: Xinwei Wang.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eConceptualization: Haoqian Wang, Xinwei Wang; Methodology: Haoqian Wang, Xinwei Wang; Formal analysis: Haoqian Wang, Shuhui Sang, Bingqian Zhou, Peihang Song, Luyao Song, Xinwei Wang; Investigation: Haoqian Wang; Resources: Haoqian Wang, Jianli LI, Yongtao LI, Liqiang Han, Xiumei Zhang, Xinwei Wang; Writing \u0026ndash; original draft: Haoqian Wang, Xinwei Wang; Writing \u0026ndash; review \u0026amp; editing: All authors; Funding acquisition: Xinwei Wang.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSsekitoleko J, Ojok L, Abd El Wahed A, Erume J, Amanzada A, Eltayeb E et al (2021) Mycobacterium avium subsp. paratuberculosis Virulence: A Review. Microorganisms 9(12):2623. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms9122623\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms9122623\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElmagzoub WA, Idris SM, Elnaiem MHE, Mukhtar ME, Eltayeb E, Bakhiet SM et al (2024) Faecal microbial diversity in a cattle herd infected by Mycobacterium avium subsp. paratuberculosis: a possible effect of production status. World J Microbiol Biotechnol 40(9):276. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11274-024-04080-1\u003c/span\u003e\u003cspan address=\"10.1007/s11274-024-04080-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarman-McKenna VK, Eshraghisamani R, Shafer N, De Buck J (2024) Lining the small intestine with mycobacteriophages protects from Mycobacterium avium subsp. paratuberculosis and eliminates fecal shedding. Proc Natl Acad Sci U S A 121(33):e2318627121. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.2318627121\u003c/span\u003e\u003cspan address=\"10.1073/pnas.2318627121\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWorsley L, Davies PL (2024) Inter-laboratory ring trial to compare four quantitative polymerase chain reaction assays employed for detection of Mycobacterium avium subspecies paratuberculosis. Microbiol Spectr 12(3):e0221023. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/spectrum.02210-23\u003c/span\u003e\u003cspan address=\"10.1128/spectrum.02210-23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatos AC, Figueira L, Martins MH, Cardoso L, Matos M, Pinto ML et al (2024) Mycobacterium avium subsp. paratuberculosis in Wild Boar (Sus scrofa) in Portugal. Pathogens 13(5):389. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pathogens13050389\u003c/span\u003e\u003cspan address=\"10.3390/pathogens13050389\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBadia-Bringu\u0026eacute; G, Canive M, Casais R, Blanco-V\u0026aacute;zquez C, Amado J, Iglesias N et al (2022) Evaluation of a droplet digital PCR assay for quantification of Mycobacterium avium subsp. paratuberculosis DNA in whole-blood and fecal samples from MAP-infected Holstein cattle. Front Vet Sci 9:944189. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fvets.2022.944189\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2022.944189\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong Y, Zhou D, Zhang B, Xu X, Zhang J (2024) Development of a real-time recombinase-aided amplification assay for rapid and sensitive detection of Edwardsiella piscicida. Front Cell Infect Microbiol 14:1355056. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcimb.2024.1355056\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2024.1355056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBehdad S, Pakdel A, Massudi R (2024) A novel diagnostic approach to Paratuberculosis in dairy cattle using near-infrared spectroscopy and aquaphotomics. Front Cell Infect Microbiol 14:1374560. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcimb.2024.1374560\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2024.1374560\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBannantine JP, Stabel JR, Bayles DO, Biet F (2023) Improved DNA Amplification of the Hallmark IS900 Element in Mycobacterium avium subsp. paratuberculosis: a Reexamination Based on Whole-Genome Sequence Analysis. Appl Environ Microbiol 89(2):e0168222. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/aem.01682-22\u003c/span\u003e\u003cspan address=\"10.1128/aem.01682-22\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Mycobacterium aviumsubsp. Paratuberculosis (MAP), real-time recombinase-aided amplification (RAA), F57 gene, diagnostics, Johne's disease","lastPublishedDoi":"10.21203/rs.3.rs-9530592/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9530592/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eParatuberculosis (PTB) caused by \u003cem\u003eMycobacterium avium subsp. paratuberculosis\u003c/em\u003e (MAP) is not only globally prevalent infectious disease that endangers ruminants worldwide, leading to chronic intestinal inflammation in ruminants, but also poses a severe public health challenge due to its potential association with human Crohn's disease. Current diagnostic methods such as bacterial culture and conventional PCR are limited by issues like long processing times, complex instrumentation, or insufficient sensitivity for early detection. To address these limitations, we combined the Recombinase Aided Amplification (RAA) technique with fluorescent probes to develop a novel real - time fluorescent Recombinase Aided Amplification (RAA) assay targeting the specific F57 gene of MAP. The optimized MAP detection method can achieve rapid amplification within 20 minutes at 39\u0026deg;C. This method has a detection limit of 1.93\u0026times;10\u0026sup2; copies/\u0026micro;L, demonstrating high sensitivity, and shows no cross - reactivity with 13 non - target pathogens. This real - time fluorescent RAA assay provides a rapid, highly sensitive, and instrument - flexible tool for MAP detection. It is suitable for large - scale screening and point - of - care testing in resource - limited settings. Moreover, this approach can also inform the rapid point-of-care diagnosis and epidemiological investigation of other diseases.\u003c/p\u003e","manuscriptTitle":"Development and Preliminary Evaluation of a Real-time Fluorescent Recombinase-Aided Amplification Assay for Rapid Detection of Mycobacterium aviumsubsp. Paratuberculosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-18 14:48:34","doi":"10.21203/rs.3.rs-9530592/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"dc9db951-e774-4bc4-bf0a-9046b66cf381","owner":[],"postedDate":"May 18th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Rejected","date":"2026-05-21T13:48:10+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-16T00:17:27+00:00","index":29,"fulltext":""},{"type":"reviewerAgreed","content":"220946644218831919766498480122539246386","date":"2026-05-15T04:06:33+00:00","index":28,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-14T01:34:52+00:00","index":27,"fulltext":""},{"type":"reviewerAgreed","content":"72749730303970439080015407331587062221","date":"2026-05-11T09:48:26+00:00","index":26,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-11T08:47:58+00:00","index":25,"fulltext":""},{"type":"reviewerAgreed","content":"197146563791454389081998725765532412464","date":"2026-05-11T00:13:56+00:00","index":23,"fulltext":""},{"type":"reviewerAgreed","content":"330606706945625624202151450286758901537","date":"2026-05-10T05:13:41+00:00","index":22,"fulltext":""},{"type":"reviewerAgreed","content":"160790001008431118434959737921829165254","date":"2026-05-08T20:46:51+00:00","index":21,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-08T14:28:17+00:00","index":20,"fulltext":""},{"type":"reviewerAgreed","content":"24334880999460049344023564263800713129","date":"2026-05-08T09:11:39+00:00","index":19,"fulltext":""},{"type":"reviewerAgreed","content":"187095873756451993184131124240210271349","date":"2026-05-08T00:57:48+00:00","index":18,"fulltext":""},{"type":"reviewerAgreed","content":"46273807564963182903619152283881354788","date":"2026-05-08T00:48:06+00:00","index":17,"fulltext":""},{"type":"reviewersInvited","content":"11","date":"2026-05-07T19:10:54+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-05-21T13:55:11+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-18 14:48:34","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9530592","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9530592","identity":"rs-9530592","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.