Results
The presence and homogeneous distribution of all expected elements in the structure of bioactive glass, which includes Si, Na, P, Ca, and Li, is given in Table 4 . The resulting mass results are the result of ICP-OES measurements, which show a relatively good agreement between the compositions of all prepared bioactive glass and the designed bioactive glass. Table 4 Measured compositions of bioactive glass nanoparticles in wt% determined by ICP-OES Sample code Weight percentage of elements Si Ca Na P Li B0 44.2 ± 0.10 24.1 ± 0.08 24.8 ± 0.16 6.9 ± 0.23 0 B1 45.9 ± 0.15 24.6 ± 0.17 22.1 ± 0.25 6.3 ± 0.27 1.1 ± 0.09 B3 45.6 ± 0.07 23.7 ± 0.14 21.3 ± 0.31 6.2 ± 0.18 3.2 ± 0.22 B5 45.3 ± 0.2 23.1 ± 0.11 19.8 ± 0.23 7.1 ± 0.08 4.7 ± 0.10
Measured compositions of bioactive glass nanoparticles in wt% determined by ICP-OES
The XRD spectra before and after immersion of bioactive glasses in SBF are shown in Fig. 1 . The wide peaks in (Fig. 1 a and b) indicate the amorphous structure of the synthesized glass prior to SBF exposure. The appearance of peaks at 2 θ = 25.8° and 2 θ = 31.89° indicates the formation of crystalline hydroxyapatite (HCA) on the surface of the bioactive glass after seven days of immersion in SBF. However, with the increasing amount of lithium in the structure of bioactive glass, the intensity of peaks has decreased. Fig. 1 XRD patterns, and SEM images of bioactive glasses. XRD patterns of the Li-doped bioactive glasses before ( a ) and after ( b ) immersion in SBF for 7 days (7D). The marked crystalline peaks in ( b ) indicate HCA. SEM images of bioactive glasses before immersion in SBF, c B0, d B1, e B3, f B5. Changes in grains morphology by adding lithium to their structure can be seen obviously
XRD patterns, and SEM images of bioactive glasses. XRD patterns of the Li-doped bioactive glasses before ( a ) and after ( b ) immersion in SBF for 7 days (7D). The marked crystalline peaks in ( b ) indicate HCA. SEM images of bioactive glasses before immersion in SBF, c B0, d B1, e B3, f B5. Changes in grains morphology by adding lithium to their structure can be seen obviously
The antibacterial activity of bioglasses with different percentages of Li 2 O against Escherichia coli (gram-negative) and Staphylococcus aureus (gram-positive) as a zone of inhibition of bacterial growth is shown in Table 5 . Examination of the growth inhibition zone of bacteria in both types shows an increase of the inhibitory zone up to 3% wt (B3) and then a decrease in 5% wt of Li 2 O (B5) in the structure of bioactive glass. Therefore, B3 contains in terms of optimal antibacterial properties. Table 5 Antibacterial properties of synthesized bioactive glass nanoparticles Sample code Zone of Inhibition (mm) Escherichia coli Staphylococcus aureus B0 12 11 B1 14 13 B3 18 16 B5 13 12
Antibacterial properties of synthesized bioactive glass nanoparticles
Examination of SEM images of glass synthesized before immersion in SBF shows that, firstly, in all four groups, the synthesized nanoparticles have a size below 100 nm (Fig. 1 c–f). Secondly, by adding lithium to the structure of bioactive glass, first, the morphology of the grains containing nanoparticles changed from round to plate. So, in the B3 sample, a plate structure was observed. But again in the B5 sample, the morphology of grain returns to spherical. Also, microstructure images of pure gelatin scaffolds in which prepared by solving 5, 7.5, and 10% wt/v of gelatin in water showed that scaffolds prepared with 5% wt of gelatin, have homogeneous pore size, higher porosity, and better interconnectivity (Fig. 2 a–c). Moreover, the examination of the cell adhesion of scaffolds by SEM revealed the proper adhesion of the cells on the scaffold. However, in the groups containing bioactive glass, or PRGF lonely, or in combining groups, more pseudopods protruded emerged. So, better cell adhesion can be observed (Fig. 2 e–l). Fig. 2 SEM images of neat gelatin scaffolds prepared by different content of gelatin, and human endometrial stem cells (hEnSCs) attachment on scaffolds. SEM images of neat gelatin scaffolds containing a 5% wt/v, b 7.5% wt/v and c 10% wt/v of gelatin in water. Regularity and interconnectivity is higher in ( a ). Stem cells have shown good attachment on scaffolds, especially those containing bioactive glass and PRGF or both of them. d GP0B30, e GP0B35, f GP0B310, g GP0B320, h GP50B30, i GP50B35, j GP50B310, k GP50B320, l GP25B30, m GP0B010
SEM images of neat gelatin scaffolds prepared by different content of gelatin, and human endometrial stem cells (hEnSCs) attachment on scaffolds. SEM images of neat gelatin scaffolds containing a 5% wt/v, b 7.5% wt/v and c 10% wt/v of gelatin in water. Regularity and interconnectivity is higher in ( a ). Stem cells have shown good attachment on scaffolds, especially those containing bioactive glass and PRGF or both of them. d GP0B30, e GP0B35, f GP0B310, g GP0B320, h GP50B30, i GP50B35, j GP50B310, k GP50B320, l GP25B30, m GP0B010
The effects of bioactive glass ion extracts containing different amounts of lithium at 24, 72, and 120 h on endometrial stem cell proliferation are shown in Fig. 3 a. The cell survival of the control group during each period was higher than the experimental group. However, with increasing the amount of lithium in the structure of bioactive glass up to 3% wt (B3), cell survival is significantly increased but decreased in B5, which contains 5% wt. These observed trends are valid in all time intervals. Also, cytotoxicity has been reduced by increasing the time of exposure of cells to bioactive glass extracts. Therefore, in this study, considering the results of cytotoxicity and antibacterial properties, B3 was selected as the bioactive glass with the optimal amount of lithium. Hence, B3 was used to prepare nanocomposite hybrid scaffolds. Fig. 3 Cell viability (MTT) results of bioactive glasses and scaffolds in 24, 72, and 120 h. a B3 shows higher cell viability comparing other bioglasses in all time intervals. b Cell viability significantly is higher in GP50B310 than all other scaffolds ( p -value = p , * p < 0.05, ** p < 0.01, *** p < 0.001)
Cell viability (MTT) results of bioactive glasses and scaffolds in 24, 72, and 120 h. a B3 shows higher cell viability comparing other bioglasses in all time intervals. b Cell viability significantly is higher in GP50B310 than all other scaffolds ( p -value = p , * p < 0.05, ** p < 0.01, *** p < 0.001)
Also, the cell viability results of gelatin/PRGF/lithium-doped bioactive glass scaffolds at similar time intervals are shown in Fig. 3 b. Similarly, it is observed here that the cell survival rate on all scaffolds and at all-time intervals is lower than in the control group. However, adding bioactive glass, or PRGF, led to a significant increase in cell viability compared to scaffolds of neat gelatin. Furthermore, samples containing 10% by weight of bioactive glass B3 have higher cell survival than samples containing 20% by weight of B3. Therefore, the optimal amount of B3 in the structure is 10% wt. moreover, the addition of PRGF has led to an increase in cell viability. Also, comparing the results of scaffolds containing 10% of bioactive glass B0 and B3 (GP0B010, and GP0B310) also indicates the positive effect of lithium on cell survival. Moreover, comparing the results of different groups shows the synergistic effect of lithium-ion and PRGF in the scaffold in improving the survival of endometrial stem cells cultured on the scaffolds (especially in GP50B310).
Measured values of alkaline phosphatase activity on days 7, 14, and 21 of endometrial stem cells cultured on scaffolds have been presented in Fig. 4 . On all days, the volume of ALP production (ALP activity) in hybrid nanocomposite scaffolds, or scaffolds containing PRGF or bioactive glass lonely, significantly was higher than the control group and neat gelatin group. Also, alkaline phosphatase in all groups increased significantly from day 7 to day 14 and decreased significantly on day 21 compared to day 14. Moreover, an accurate investigation of the diagram shows that bioactive glass had a more effect on increasing ALP activity than PRGF. Fig. 4 ALP activity of results in 7, 14, and 21 Days. Li-doped bioglass, and PRGF both increase ALP activity. Although bioactive glass is more effective in increasing ALP activity ( p -value = p , * p < 0.05, ** p < 0.01, *** p < 0.001)
ALP activity of results in 7, 14, and 21 Days. Li-doped bioglass, and PRGF both increase ALP activity. Although bioactive glass is more effective in increasing ALP activity ( p -value = p , * p < 0.05, ** p < 0.01, *** p < 0.001)
qRT-PCR was utilized on days 14 and 21 to assess the expression of osteoblast markers, including Runx2, osteocalcin (OC), and osteopontin (OP) (Fig. 5 ). An evaluation of the acquired data reveals a considerable increase in Runx2 on day 14, followed by a drop on day 21 in scaffolds containing Li-doped bioactive glass. In addition, a comparison of the effects of Li-doped bioactive glass and PRGF on Runx2 expression reveals a statistically significant difference and a larger effect of bioactive glass in increasing the expression level of Runx2. Moreover, osteocalcin (OC) and osteopontin (OP) expression levels on day 21 were higher than on day 14. Comparatively, a closer examination reveals that PRGF was more successful at boosting osteocalcin (OC) and osteopontin (OP) levels than Li-doped bioactive. Fig. 5 Gen expression of results in 14, and 21 Days. Li-doped bioglass increased Runx2 drastically, but PRGF is more effective in increasing OC, and OP expression ( p -value = p , * p < 0.05, ** p < 0.01, *** p < 0.001)
Gen expression of results in 14, and 21 Days. Li-doped bioglass increased Runx2 drastically, but PRGF is more effective in increasing OC, and OP expression ( p -value = p , * p < 0.05, ** p < 0.01, *** p < 0.001)
The results related to the measurement of compressive properties and glass transition temperature of scaffolds, as well as their porosity, are given in Table 6 . The results show a significant increase in modulus with an increasing amount of bioactive glass. However, only increasing the amount of bioactive glass up to 10% wt has increased the strength, but the sample containing 20% wt of bioactive glass has decreased. Also, there is no discernible trend in the strain at break. In addition, the glass transition temperature increased slightly as the amount of bioactive glass in the structure increased. However, the presence of PRGF did not affect the mechanical properties and T g of the samples. Table 6 Mechanical properties, T g , and porosity of scaffolds Sample code Mechanical properties T g (°C) Porosity (%) Strength (MPa) Modulus (MPa) Max. strain (%) GP0B30 1.34 ± 0.17 5.11 ± 0.23 40.17 ± 12.31 61.8 96.4 ± 1.3 GP50B30 1.35 ± 0.22 4.97 ± 0.28 26.25 ± 3.2 60.7 96.5 ± 1.7 GP0B35 1.94 ± 0.27 11.43 ± 0.45 27.45 ± 3.37 63.4 94.1 ± 0.8 GP0B310 2.69 ± 0.4 18.17 ± 0.38 18.88 ± 4.81 67.3 92.6 ± 1.2 GP50B310 2.64 ± 0.38 18.19 ± 0.58 26.16 ± 2.23 67.5 91.9 ± 0.5 GP0B320 2.61 ± 0.61 23.58 ± 0.87 12.61 ± 2.13 70.9 90.9 ± 0.6
Mechanical properties, T g , and porosity of scaffolds
Materials
The sol–gel method has been used to synthesize bioactive glass particles [ 54 , 55 ]. Briefly, based on 10 g bioactive glass 0.5 ml of nitric acid (HNO 3 65% MERK) was first added to 19.5 ml of distilled water (H 2 O) and stirred for 10 min. Then 16.7 ml of tetraethyl orthosilicate (TEOS, Si (OC 2 H 5 ) 4 , Merck) was added to the acidic solution and stirred for acid hydrolysis for one hour. Following 1.5 mL of three ethyl phosphate (TEP, (C 2 H 5 ) 3 PO 4 Merck) is added to the material and left to stir for 25 min. Afterward, with a time interval of 20 min for each component, 10.5 g calcium nitrate (Ca (NO 3 ) 2 , MERK), (6.72 g, 6.45 g, 5.9 g, 5.35 g) of sodium nitrate (NaNO 3 , MERK), and (0 g, 0.46 g, 1.38 g, 2.31 g) of lithium nitrate (LiNO 3 , MERK) are added, respectively. Lithium nitrate, used with 0, 1, 3, and 5 wt%, substitutes the sodium nitrates. Then whole material was stirred for one hour and stored at room temperature for 96 h. After 96 h, the obtained gel was first placed in the oven for 24 h at 70 °C and then kept at 120 °C for 48 h. The obtained precursor was ground by a hand mill. Subsequently, it is heated by the ratio of 10 °C/min and sintered at 750 °C to degrade alkoxides and remove nitrates. Bioactive glasses prepared with weight percentages of 0, 1, 3, and 5% Li 2 O in their structures are named B0, B1, B3, and B5, respectively (Table 1 ). Table 1 Compositions of synthesized bioactive glass nanoparticles Sample code Components (%wt) SiO 2 CaO Na 2 O Li 2 O P 2 O 5 B0 45 24.5 24.5 0 6.0 B1 45 24.5 23.5 1 6.0 B3 45 24.5 21.5 3 6.0 B5 45 24.5 19.5 5 6.0
Compositions of synthesized bioactive glass nanoparticles
In this study, scaffolds were prepared by the freeze-drying method [ 56 ]. In preparing hybrid scaffolds, human-based PRGF was purchased from Noavaran Andish Pajoh. Briefly, they reported that collected blood from healthy volunteers poured into sterile test tubes having anticoagulants including 0.4 mL of 3.8% sodium citrate (Na 3 C 6 H 5 O 7 , MERK). Then tubes were centrifuged at 1400 rpm for 8 min. tubes now consist of three distinguished regions; red blood cells were precipitated at the bottom of the tube. A thin layer of leucocytes is located above red blood cells. The plasma region is above the leucocytes’ layer. However, plasma region is divided into two regions. The first 0.5 ml upper of the leucocytes’ layer is collected as PRGF; the rest was nominated as plasma poor in growth factors (PPGF). Subsequently, to activate PRGF, 50 µl of 10% calcium chloride (CaCl 2 MERK) was poured into PRGF, and after 15 min, the final product was achieved [ 57 – 61 ].
In order to find the optimal amount of gelatin, first solutions containing 5, 7.5, and 10% wt of gelatin were prepared and freeze-dried, then based on the obtained morphology, 5% was selected as the optimal amount for constructing hybrid scaffolds. So, an aqueous gelatin (Merck, microbiology grade, catalog number 104,070) solution was prepared at 25 °C. PRGF with the ratios (1: 1 and 3: 1 Gelatin: PRGF ratio wt/wt) and added to the gelatin solution and stirred for 10 min. Then the B3 (0, 5, 10, and 20% w/w) is added to the gelatin solution and stirred for 1.5 h. Following the mixture was molded and kept at 2 °C overnight to gel. Afterward, the molded materials were frozen at − 20 °C and − 80 °C for 48 h and 24 h, respectively. Subsequently, nanocomposites were lyophilized for 48 h at − 50 °C in a freezer dryer to obtain porous nanocomposites. The samples were then immersed in a solution of 0.5% glutaraldehyde in ethanol (%volume/volume) for 24 h to cross-link [ 62 ]. The samples were then washed with pure ethanol and immersed in distilled water to remove excess glutaraldehyde. Table 2 shows the sample code and their combinations. Table 2 Compositions of prepared scaffolds Sample code Components weight ratio B0 B3 Gelatin PRGF GP0B30 0 0 1 0 GP25B30 0 0 1.5 0.5 GP50B30 0 0 1 1 GP0B35 0 0.05 0.95 0 GP0B310 0 0.10 0.90 0 GP0B010 0.10 0 0.90 0 GP0B320 0 0.20 0.80 0 GP50B35 0 0.05 0. 95 1 GP50B310 0 0.10 0.90 1 GP50B320 0 0.20 0.80 1
Compositions of prepared scaffolds
By scanning electron microscopy (SEM, TESCAN-Vega3), we explored the morphology of bioactive glasses and scaffolds. Also measured the crystals with X-ray diffraction using a copper anode and a deflector at 40 kV and 2 θ between 0° and 120°. Bioactivity was measured by immersing 10 mg of each bioactive glass in simulated body fluid (SBF) for seven days at 37 °C. Apatite on the samples was determined by X-ray diffraction after they had been washed with deionized water. We calculated the scaffold's porosity using Archimedes' law: \documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$${\text{Percentage}}\;{\text{of}}\;{\text{porosity}}\; = \;\left( {{\text{M2}} - {\text{M3}} - {\text{Md}}} \right)/\left( {{\text{M1}} - {\text{M3}}} \right) \times {1}00.$$\end{document} Percentage of porosity = M2 - M3 - Md / M1 - M3 × 100 .
M1 refers to the weight of the container filled with alcohol, M2 refers to the container filled with alcohol after the scaffold is suspended, and M3 refers to the weight of the container filled with alcohol after the scaffold is removed. The scaffold's weight in the air is Md. The scaffolds' mechanical properties were evaluated on the Santam machine with a rate of 1 mm/min and a load cell of N 100. Each test examined 5 cylindrical specimens measuring 9 mm in diameter and 20 mm in height. Modulus is calculated based on the slope from the linear region of the stress–strain curve, and the strength equivalent to the maximum stress carried by each scaffold. Using a Dynamic Mechanical Thermal Analysis (DMTA) device (DMTA-PL, Model: Polymer Laboratory), we tested scaffolds at 1 Hz in the compressive mood and a temperature range of 0–150 °C, to measure their T g . Also, Using an Inductively Coupled Plasma Optical Emission Spectrometry device (Varian-ES-730), we investigated the chemical composition of bioactive glass. Using the acid digestion approach, samples were processed by dissolving 100 mg of each bioactive glass in a digestion media made of 6 ml of HCl (ACS 37%, MERCK), 2 ml of HNO 3 (65%, MERCK), and 0.5 mL of HF (38–40%, MERCK). Then, 5 ml of 99.5% MERCK H 3 BO 3 was added to the acid mixture. Since silica cannot be quantified because it generates volatile compounds (such as H 2 SiF 6 ) in the presence of HF, its content could not be measured and was calculated by adding 100% to the measured value [ 63 – 66 ].
The sink method was used to evaluate the antibacterial properties of bioactive glass. Briefly, one gram of bioactive glass was first mixed with 1 ml of distilled water. The resulting extract was then diluted twice with distilled water to reach the concentration of 100 mg/ml. Then EMB culture medium was prepared for Gram-negative bacteria (ATCC 9637 Escherichia coli ) and a Blood Agar culture medium for Gram-positive bacteria (Staphylococcus aureus ATCC 23235) was prepared. Using sterile swabs, the bacteria were removed from the suspensions prepared and cultured on the culture medium. The number of concentrations prepared from the extract plus one was created as a negative control well using a sterile pipette. 200 μl of each concentration was added to each well, and the only solvent was added to the negative control well. The media were then incubated in the incubator for 48 h. Finally, the zone of inhibitions was measured and reported.
In this study, we used human endometrial stem cells obtained from the National Center for Genetic Resources of Iran (IBRC C1120). The morphology of the cells cultured on the scaffold was examined by SEM. In summary, human endometrial stem cells were cultured in 12 DMEM/F (Gibco) medium supplemented with 10% FBS, 50 units/ml penicillin, 50 units/ml streptomycin, 5% CO 2 , and the medium changed every day. Cells were then trypsinized to create a suspension of individual cells. The scaffolds were previously immersed in 70% ethanol, washed with PBS, and exposed to ultraviolet (UV) radiation overnight before the 3D culture of cells. 96 h after placing the suspension on the scaffold, the cells were fixed. For 1 h, the samples were immersed in 2.5% glutaraldehyde solution (Merck). The dehydration process uses alcohol with percentages of 10, 30, 70, 90, and 100%. Finally, the scaffolds were dried under the hood, exposed to dry air, and then covered with gold for vacuum SEM testing.
We evaluated the cellular compatibility of synthesized bioactive glass and scaffolds containing them 1, 3, and 5 days after culture using the Calorimetric Method of 3- (4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium Bromide (MTT). Bioglass extract (10 mg/ml) was added to cells, or scaffolds were used to culture the cells. So, 4 × 10 4 cells were placed on each scaffold and incubated at 37 °C and 5% CO 2 . Incubation was conducted for four hours with 200 μl of MTT solution at each interval. The crystals are then dissolved in the dimethyl sulfoxide (Merck) after removing the culture medium. Using the Expert 96 microplate reader (Asys Hitch, Ec Austria), we determined the amount of light absorption at 570 nm.
Following 14 and 21 days of induction of endometrial stem cells with osteogenic media on two-dimensional and three-dimensional tissue culture plates, qRT-PCR was used to measure the levels of Runx2, osteocalcin (OC), and osteopontin (OP) in the cultures. RNeasy Plus Mini Kit (Qiagen) was used for RNA extraction, and Easy cDNA Synthesis Kit (Cat.No.A101161) was used for complementary DNA synthesis. Real-time PCR analysis was performed to determine relative gene expression. In each PCR, 13 Power SYBRH Green PCR Master Mix (ABI PRISM, 4368702) was mixed with 12 ng cDNA and specific primers in a total volume of 20 μl. Table 3 lists the primer sequences designed and the temperatures for every gene observed during this reaction. In order to analyze the relative gene expression, we used the comparative method of Ct, 2 −ΔΔ C t
C t . C t values from the target genes were normalized to β-2-microglobulin (B2M) and calibrated with undifferentiated hEnSCs. A minimum of three independent experiments were conducted in each experiment, and the tests were repeated with the RiaGene6000 Qiagen. Table 3 Primers used in qRT-PCR B2M NM_004048.4 Homo sapiens beta-2-microglobulin (B2M) Forward primer CCACTGAAAAAGATGAGTATGCCT 126 bp 60 °C Reverse primer CCAATCCAAATGCGGCATCTTCA RUNX2 NM_001278478.2 Homo sapiens RUNX family transcription factor 2 (RUNX2) Forward primer TAGGCGCATTTCAGGTGCTT 105BP 60 °C Reverse primer TGCATTCGTGGGTTGGAGA Osteocalcin OC NM_199173.6 Homo sapiens bone gamma-carboxyglutamate protein (BGLAP) Forward primer CCTCACACTCCTCGCCCTATT 250 bp 60 °C Reverse primer GGTCAGCCAACTCGTCACA Osteopontin OP NM_000582.3 Homo sapiens secreted phosphoprotein 1 (SPP1) Forward primer GCCGAGGTGATAGTGTGGTT 149 bp 60 °C Reverse primer AACGGGGATGGCCTTGTATG
Primers used in qRT-PCR
ALP activity was determined by converting p-nitrophenyl phosphate to p-nitrophenol and phosphate on days 7, 14, and 21 using a commercial kinetics kit (Pars Azmoun, Iran). A spectrophotometer measured the absorption change at 405 nm at 37 °C. For statistical analysis, all tests were repeated three times ( n = 3), and SPSS software was used. A t -test was used to determine whether there was a significant difference between groups. A p -value of less than 0.05 was considered significant.
SPSS software was used for statistical analysis. Statistical differences between groups were assessed by analytical comparisons and analysis of variance. Statistical significance was considered in probability values of p < 0.05.
Conclusion
In this research, new hybrid nanocomposites based on gelatin/PRGF/Li-doped 45s5 bioactive glass nanoparticles were prepared by freeze-drying method. Characterization of the synthesized bioactive glass showed that adding 3% wt of lithium to the structure of the 45s5 bioactive glass prepared by the sol–gel method optimizes its biocompatibility and antibacterial properties. Also, interestingly, it was observed that lithium has antibacterial properties against both gram-positive and gram-negative bacteria. Also, the presence of bioactive glass and PRGF alone or in combination improves cell viability and cell adhesion. However, the optimal amount of bioactive glass in the scaffold structure is 10% wt, and cytotoxicity increases by 20% wt. Also, the synergistic effects of lithium ions and silicon ions can cause a significant increase in ALP activity and Runx-2 expression. While the growth factors in PRGF mainly increase the expression of OP and OC genes. In addition, the presence of bioactive glass increases the modulus and T g of scaffolds. While the presence of growth factor had little effect on the mechanical properties and T g . basically, it seems that the hybrid scaffold used was able to create the survival of endometrial stem cells and their adhesion to the surface and cause their osteogenic differentiation. Finally, a general review of the results of this study suggested that the strategy used in this study includes combining bioactive glass as a bone-inducing mineral phase, gelatin as a biocompatible polymer, PRGF as a source of growth factor, and lithium-ion as a bone-inducing agent as well as an antibacterial agent can be considered as a good approach to repair bone lesions.
Discussion
More than 200 million individuals worldwide have osteoporosis, a disease characterized by a reduction in bone mineral density. The main factors that induce bone deterioration in the world are obesity, genetic disorders, accidents, and aging [ 67 ]. Despite being the gold standard in treating bone lesions, autografts are not always used because of limitations, shortage of access, and mortality rates. Immune response and disease transmission are also stimulated by allografts [ 68 , 69 ]. Hence, novel treatment approaches including tissue engineering, find emerging applications in bone repair. Tissue engineering research focuses on building scaffolds to support bone cells and encouraging and differentiating osteoblasts to regenerate bone. From a histological standpoint, bone tissue is a natural combination of bioceramic and polymer phases, principally apatite and collagen [ 70 ]. Therefore, nanocomposite polymer hybrid scaffolds have tremendous potential for bone tissue engineering [ 71 , 72 ]. Porous 3D polymeric Nanocomposite scaffolds have been repeatedly reported to provide a suitable matrix for connecting and expanding different cell types [ 73 ]. In this group of scaffolds, gelatin stands out polymer because of its high cell adherence, low cost, and good blending abilities [ 31 , 74 ]. Also, bioactive glasses are bioactive inorganic biomaterials that have been widely studied. These glasses are highly bioactive and have the capability that bonds with hard and soft tissues [ 75 ]. Gelatin/bioactive glass nanocomposites are usually bioresorbable scaffolds. Reviewing the in vitro degradation data of gelatin/bioactive glasses nanocomposites with different bioactive glasses showed that about 30% of the scaffolds' mass is resorbed at least 2 weeks after being put in SBF [ 76 , 77 ]. Furthermore, in an in vivo study, little degradation was observed two weeks after implantation. The degradation time, however, correlated well with the regeneration time of new bone [ 78 ]. Releasing alkaline ions (like Ca 2+ and Na + ) from bioactive glass and letting them dissolve neutralizes acidic byproducts of polymer degradation and slows down autocatalytic degradation [ 79 ]. The degradation times of lithium-doped bioactive glass nanocomposites may be slightly longer due to the densification of bioactive glass by lithium. Lithium doping in bioactive glass stimulates bone growth and inhibits its resorption, also giving it antibacterial properties [ 80 ].
Also, growth factors have also been shown to be crucial in the healing procedure of damaged tissues. Since platelet-derived extracts, especially plasma rich in growth factors (PRGF), are good sources of them. Therefore, in this work, PRGF has also been used in the scaffolding structure [ 58 ]. The main novelty of the present study is that we induced promising osteogenic differentiation in endometrial stem cells by combining PRGF's growth factors and lithium simultaneously. This research also compares the effectiveness of each component on each osteogenic biomarker. Bioactive glass has been synthesized using the sol–gel method in this research. Since this approach produces nanostructured bioactive glass [ 81 ]. The good compliance of ICP results with the designed formulations (Table 4 ) can indicate that the sol–gel method was a suitable method for their synthesis. These results may be due to the differing sizes and electrical charge densities of sodium and lithium ions when replaced in the bioactive glass structure. Li-doped bioactive glasses have also shown densification caused by this change [ 82 ].
The amorphous structure of bioactive glasses has been proved in their XRD spectra before exposure to SBF (Fig. 1 a). Additionally, the presence of characteristic HCA peaks (2 θ = 25.8° and 2 θ = 31.89°) after seven days of immersion in SBF may indicate that the synthesized glass is bioactive, and the reduction of HCA-related peaks may reflect the compactness of the structure of the bioglass due to the presence of lithium (Fig. 1 b).
Antibacterial results and cell viability evaluation of bioactive glass B0, B1, B3, and B5 show that the presence of lithium-ion in the structure of bioactive glass (up to 3% wt) is beneficial against both Staphylococcus aureus (gram-positive) and Escherichia coli (gram-negative) bacteria as well as cell survival (Table 5 and Fig. 3 a). As far as mentioned above, High-energy traumas may cause open fractures that may lead to fracture-related infections (FRI) [ 40 , 41 ]. Also, it has been reported that the vast majority of the cases of bone infections are due to different types of Staphylococcus aureus as a gram-positive bacteria [ 83 , 84 ]. Moreover, amongst gram negatives, Escherichia coli can cause bone infection [ 85 , 86 ]. Both of them are considered to cause hospital-acquired infections and can cause osteomyelitis [ 87 – 90 ]. So, B3, and its composites can be assumed as suitable choices for bone regeneration especially in open flaps. Hence, its antibacterial function against hospital-acquired infections can improve its potential clinical application [ 91 , 92 ].
Chemical-potential changes and pH changes lead to ion-channels function variations in bacteria and endometrial stem cells. These changes may have caused the aforementioned trend [ 37 ]. Other researchers have established that the ideal concentration of lithium in bioactive glass for antibacterial activities and cell survival is in the range of 2.5–5% wt. Therefore, there is a good agreement between the results of this research and their results [ 35 , 93 ]. Accordingly, in this study, B3 (as the optimized bioglass) was used to prepare hybrid scaffolds. In this study, sponge scaffolds were prepared by freeze-drying. The appropriate size and regularity of cavities, as well as their interconnectivity, are crucial parameters for preparing scaffolds [ 94 ]. According to the above criteria, 5% wt of gelatin was the optimal amount for making scaffolds. Comparing the size of the cavities of the synthesized scaffolds (near to 200 µm) with bone and stem cells (less than 20 µm) demonstrates the appropriate size of the formed scaffolds for cell homing. Additionally, SEM images of cell adhesion to scaffolds also demonstrated proper adhesion. Images showed that bioactive glass improved cell adhesion which may be due to the interaction between the HCA layer created by the bioglass and cell surface proteins, such as fibronectin and vitronectin. Cell adhesion is also affected by calcium, silicon, and lithium ions, especially calcium ions [ 95 – 100 ]. Furthermore, increasing the scaffold structure's modulus due to bioactive glass's presence may improve cell adhesion [ 101 ].
Also, scaffolds containing PRGF showed better cell adhesion, possibly because of playing a crucial role of growth factors in the structure of PRGF, especially platelet-derived growth factors (Fig. 2 e–l) [ 12 , 70 ]. Other researchers have confirmed these findings [ 102 , 103 ]. There is much interest today in using PRGF for bone repair in dentistry applications [ 104 ].
MTT results confirm this trend in cell adhesion. Also, reduced cell survival in scaffolds relative to controls may be attributed to the very small amount of residual glutaraldehyde in scaffolds structure or high ions concentrations of bioglasses [ 105 , 106 ].
It has also been observed that cell viability depends on peripheral ions, especially lithium-ion, and samples with 20% wt of bioactive glass have a lower survival rate than samples with 10% wt. However, lithium increases cell survival throughout the all-time intervals, a trend that can be attributed to the activation of the wnt signaling pathways and the wnt/β-catenin signaling pathway [ 107 ]. In addition, the increase in cell survival rate with PRGF in the structure can also be attributed to the presence of TGF- β, PDGF, and IGF [ 108 , 109 ].
The primary marker of osteoblasts, alkaline phosphatase, is a membrane enzyme that hydrolyzes phosphate ions, allowing the formation of hydroxyapatite crystals and stimulating mineralization. ALP plays a crucial role in bone regeneration and differentiation [ 110 ]. Compared to pure gelatin scaffold, Li-doped bioactive glass, PRGF, and a combination group showed a substantial increase in ALP activity with increasing culture time. ALP plays a role in ECM maturation, and the presence of bioactive components in scaffolds can enhance its production and activity [ 111 ]. Cell differentiation, bone protein expression, and ALP synthesis are affected by bioactive glass nanoparticles. Furthermore, researchers describe bioactive glass nanoparticles as bone differentiation factors due to the high concentration of silicate ions in their composition [ 112 ]. However, the presence of lithium-ion is also very effective in improving bone differentiation and increasing ALP activity due to its proven effect in activating wnt and wnt/β-catenin signaling pathways [ 113 – 115 ]. Also, BMP-2, IGF, and TGF-β that are found in the PRGF in the scaffolds structure enhance the activity of ALP [ 116 , 117 ]. Although, the results show that the role of bioactive glass in increasing ALP activity is more significant.
At 14 and 21 days, OC and OP proteins, and the transcription factor Runx2, which are primary biomarkers of bone formation, were examined. Osteocalcin is the primary non-collagenous protein, which is formed 1–2% of the total content of matrix proteins. It promotes mineralization and is commonly expressed in calcified bone and cartilage, whereas Runx2 is a major transcription factor for osteoblast differentiation [ 20 , 118 , 119 ]. Osteogenesis is committed by multiple cytokines, hormones, and signaling cascades e.g. wnt and β-catenin [ 120 , 121 ]. In particular, Runx2 plays a critical role in osteoblast differentiation by expressing osteoblastogenic markers like ALP, OC, and OP [ 122 ]. Runx2 is also known to modulate the transcription of mineralizing genes [ 123 ]. Runx2 has been shown to have a vital role to convert human fibroblasts into functional osteoblasts [ 124 ]. Various stimuli can also affect Runx2 post-translationally through phosphorylation, ubiquitination, and acetylation [ 125 ]. The level of Runx2 rises when osteoblasts are immature and decrease when they mature. In osteoblast maturation, its down-regulation may be beneficial [ 126 ]. By expressing transcription factors and bone matrix proteins, Runx2 has an autoregulatory mechanism [ 127 ]. Indeed, Runx2 controlled ALP promoter activity, establishing a positive feedback loop between ALP and Runx2 that controlled osteoblast development [ 122 ]. Also, in this research, the similarity of trends in ALP-activity results and Runx2 expressions on day 14 and day 21 was observed. Therefore, these investigations help explain the trends in ALP activity and Runx2 that have been noticed.
Also, OP affects osteoblast, and osteocyte adhesion and differentiation [ 128 ]. For 21 days, mRNA expression increased in all experimental groups. It is important to note that both OC and OP proteins indicate mineralization potential. However, OP protein was more expressed in this study than OC protein. Also, the presence of lithium-containing bioactive glass also increased drastically in Runx2. This trend may be owing to the synergistic action of lithium-ion and other ions (particularly Si ion) in bioactive glass, as well as lithium's activation and boosting of the Wnt signaling pathway, which increases Runx2 expression [ 129 – 131 ]. Like ALP activity, bioactive glass nanoparticles and PRGF increased OC and OP protein expression. PRGF growth factors increased OP and OC expression higher than Li-doped bioactive glass. The autocrine effect of PRGF's growth factors may explain the observed trend [ 132 ]. OC and OP proteins and Runx-2 transcription factors were more abundant in the hybrid sample containing both bioactive components. Lithium can also stimulate stem cells to secrete exosomes, affecting tissue repair [ 133 ]. In addition, since blood plasma is one of the main sources of exosome extraction, it seems that one of the main factors affecting the improvement of bone regeneration in this research is the presence of exosomes in PRGF [ 134 – 139 ].
Differentiation towards a bone category is significantly affected by the modulus and stiffness of the scaffold. According to the mechanical properties test, the presence of bioactive glass leads to a continuous increase in modulus due to its stiffness over gelatin. It is found that their strength only increases up to 10% wt of bioactive glass. This can be attributed to a lack of homogeneity and agglomeration of bioactive glass in the structure of the resulting nanocomposites, leading to stress concentration and early failure of the samples. The fluctuation trend of strain at the breaking point is also related to failure mechanics due to compression and separation of small parts from the specimens during the compression process, which lead to stress concentration and early failure [ 140 ]. Increases in glass transition temperature with increasing amounts of bioactive glass can be explained by inhibiting the mobility of gelatin polymer chains by bioactive glass nanoparticles. PRGF has minimal effect on mechanical behavior and glass transition temperature due to the small amount of growth factor small molecules it contains compared to gelatin polymer. Furthermore, the decreased porosity of structures prepared with increased bioactive glass may also be attributed to the formation of wholly closed cavities in bioactive glass [ 56 ].
Introduction
Bone is the primary tissue in the skeletal organ, whose essential functions include mobility, protection of other organs, and ion storage. Due to its fragile nature, it is highly vulnerable to damage, and it has a spontaneous repair just in minor defects. However, in defects with more than the critical size common in traumas and accidents, this repair does not happen spontaneously and has created many challenges for patients and orthopedic surgeons [ 1 – 4 ]. The incidence of osteoporosis has also increased the need for bone regeneration [ 5 ]. Tissue engineering as a new method based on the use of growth factors, stem cells, and biomaterials as scaffolding has created new horizons for improving bone defects [ 6 ]. Stem cells with the ability to self-renewal, as well as high proliferation and differentiation, play the role of cell source to create target tissues such as bone. However, it should be noted that in some cases, stem cells are also involved as the primary source of cancer, and some other pathological cases, such as endometriosis, may lead to infertility [ 7 – 10 ]. Meanwhile, mesenchymal stem cells, especially endometrial stem cells, have a high ability to proliferate, differentiate, and angiogenesis. Also, their harvesting method, unlike bone marrow stem cells, is not difficult or painful [ 11 ]. So, regarding the benefits mentioned above, endometrial stem cells attract significant attention in bone regeneration [ 12 ].
Moreover, another vital component of tissue engineering is growth factors. Growth factors are small molecules that play an essential role in cell proliferation and differentiation into target tissue [ 13 , 14 ]. One of the most important sources is growth factors secreted by platelets. Hence, platelet concentrates such as platelet-rich plasma (PRP), platelet-rich fibrin (PRF), and plasma rich in growth factors (PRGF) have been widely used in tissue engineering, especially bone healing [ 15 – 18 ]. PRGF is a very small section of centrifuged blood containing Platelet-derived growth factors A and B (PDGF-A, PDGF-B), vascular endothelial growth factor (VEGF), BMP-2, transforming growth factor-beta (TGF-β), and insulin growth factor (IGF). These growth factors play a critical role in bone regeneration [ 19 – 21 ]. So, the application of PRGF in bone regeneration is increasing [ 22 ].
Furthermore, similarly to the natural tissues, stem cells need supportive materials for homing and delivering nutrients and growth factors. These materials should be biocompatible and have suitable interaction and affinity with cells, so they are called biomaterials [ 23 ]. Basically, biomaterials can be assumed as a temporary extracellular matrix for stem cells and play an essential role in proliferating, differentiating, and forming new tissue [ 24 ].Due to the predominantly mineral nature of bone tissue, ceramic biomaterials and especially bioactive glasses have been widely used in this field [ 25 – 29 ]. However, considering the organic phase of bone extracellular matrix (ECM), the application of biopolymers in bone regeneration is increasing [ 30 , 31 ]. Hence, organic–inorganic composites showed promising results in bone tissue engineering [ 32 ]. Amongst, gelatin has a great application in bone tissue engineering scaffolds due to its significant biocompatibility, cell adherence, low cost, and structural similarity to collagen as an organic phase of bone’s ECM. So, gelatin-bioactive glasses are promising scaffolds in bone regeneration [ 33 ].
Also, one of the most important aspects of research is doping ions with better bone formation ability to their structure. According to the existing reports on the effects of lithium in improving cell proliferation, osteogenesis, and angiogenesis, doping this ion in bioactive glass seems to be an excellent strategy to improve its efficiency [ 34 – 38 ]. Many bone defects are also associated with traumas such as car accidents. It is common for high-energy traumas to result in open fractures that are challenging injuries and are associated with an increased risk of complications, like an infection [ 39 ]. There can be permanent functional loss or amputation from fracture-related infections (FRIs). Additionally, open flaps can cause sepsis as a serious life-threatening consequence in severe cases [ 40 , 41 ]. Also, infections can deteriorate the bone healing process and delay it. Therefore, it is essential for scaffolds used for bone regeneration to be antibacterial [ 42 ]. Moreover, with the emerging COVID-19 pandemic and its significant effects on human life, the importance of antibacterial and antiviral materials has increased, and due to the antiviral and antibacterial properties of lithium, its addition to the biomaterial structure can improve its application [ 43 – 53 ].
So, it seems that scaffolds based on gelatin/PRGF/lithium-doped bioactive glasses seeded by endometrial cells can be considered a suitable approach for bone tissue engineering. In this study, first, 45s5 bioactive glass nanoparticles containing lithium with amounts of 1, 3, and 5% wt were prepared by the sol–gel method. Then, its optimal amount was determined based on its cell cytotoxicity and antibacterial properties. Then gelatin scaffolds Containing bioactive glass with the optimal amount of lithium and PRGF were prepared, and their ability to induce bone differentiation in endometrial stem cells was investigated. In addition, the effect of adding bioactive glass as well as PRGF on the mechanical properties of scaffolds was investigated.
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.