HuD and Alpha-crystallin A Axis Protects Neuro-Retinal Cells in Early Diabetes

HuD and Alpha-crystallin A Axis Protects Neuro-Retinal Cells in Early Diabetes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article HuD and Alpha-crystallin A Axis Protects Neuro-Retinal Cells in Early Diabetes Chongtae Kim, Subeen Oh, Young-Hoon Park This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5756583/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Aug, 2025 Read the published version in Molecular and Cellular Biochemistry → Version 1 posted 4 You are reading this latest preprint version Abstract Diabetic retinopathy (DR) is a prevalent microvascular complication of diabetes; however, neuro-retinal degeneration is also observed in patients with diabetes without signs of DR. The mechanisms leading to neuro-retinal cell loss before vascular complications manifest in diabetes remain poorly understood. In this study, we investigated the neuronal RNA-binding protein HuD as a novel regulator of neuro-retinal degeneration in the early stage of diabetes. We determined the expression of HuD and alpha-crystallin A (CRYAA) in the retinal ganglion cell layer. HuD and CRYAA were down-regulated in the retinas of streptozotocin-induced diabetic rats and in neuro-retinal cells (R-28) treated with high glucose. Cryaa mRNA was identified as a novel target transcript of HuD, and we demonstrated that HuD post-transcriptionally regulates the expression of Cryaa mRNA by binding to its 3′-untranslated region. Silencing and overexpression of HuD positively regulated the expressions of Cryaa mRNA and protein. We demonstrated that the increase in inflammatory cytokines such as TNFα, IL-1β, and IL-6 in R-28 cells under hyperglycemic conditions was a result of both CRYAA and HuD levels. Silencing HuD and CRYAA enhanced high glucose-induced R-28 cell death, whereas their overexpression alleviated this effect. HuD post-transcriptionally regulates CRYAA expression, influencing the function and viability of neuro-retinal cells under diabetic conditions. Our results suggest that the HuD/CRYAA axis plays a crucial role in neuro-retinal cells and has the potential to serve as a prognostic factor and therapeutic target for diabetic neuro-retinal degeneration. HuD CRYAA retina diabetic retinopathy ganglion cells Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 INTRODUCTION Diabetic retinopathy (DR) is a common microvascular complication of diabetes mellitus and a significant cause of vision loss, particularly in middle-aged and older populations. The progression of DR is classified into various levels of severity, including mild, moderate, and severe non-proliferative DR (NPDR) and proliferative DR (PDR), based on the extent of vascular lesions [ 1 ]. Vascular abnormalities are the most apparent signs for diagnosing and treating DR; however, these phenotypes manifest in the later stages of the disease. An increasing number of studies have emphasized that neuronal cells in the retina are affected during early diabetes, leading to the degeneration of neuro-retinal cells, such as retinal ganglion cells (RGCs) [ 2 ]. Even patients with diabetes without DR exhibit neuro-retinal alterations, including ganglion cell-inner plexiform layer (GC-IPL) loss [ 3 , 4 ], thinning of the macular ganglion cell complex thickness [ 5 , 6 ], and changes in RGCs [ 7 ]. Although neuro-retinal degeneration is observed in patients with early diabetes without any signs of DR, the precise molecular mechanism yet remains to be elucidated. HuD is an RNA-binding protein that regulates mRNA stability and translation by binding to AU-rich elements in target mRNAs [ 8 ]. In many cases, the role of HuD in neuronal function, maintenance, and development has been revealed because its predominant expression in neuronal cells [ 9 , 10 ]. However, its role in insulin synthesis has also been reported [ 11 ], and successive functional studies for HuD have been prolonged in β cells, suggesting a pivotal role of HuD in β cells, such as autophagosome formation, lipid metabolism, cell cycle, and mitochondrial dynamics [ 12 ]. Although the retina is composed of diverse neuronal cells in ocular tissue, the expression and role of HuD have not yet been elucidated in detail and remain poorly studied. Crystallins are water-soluble structural proteins found in lenses. Since their discovery in the lens, crystallins have been identified in various tissues, including the retina, heart, skeletal muscles, skin, brain, and others [ 13 ]. Crystallins are classified into three main types: alpha-, beta-, and gamma-crystallins. Alpha-crystallins possess chaperone-like properties, preventing the precipitation of denatured proteins and enhancing cellular tolerance to diverse cellular stresses [ 14 ]. Several studies have clarified the implications of crystallin expression in DR. The levels of αA-crystallin are significantly down-regulated in the retinal tissues of streptozotocin (STZ)-induced diabetic mice [ 15 ] and STZ-induced rats [ 16 ]. Fort et al. demonstrated that the protein synthesis of alpha-crystallin A ( Cryaa ) mRNA is down-regulated in the retina of diabetic rats using polysome fractionation assays [ 17 ]. However, the molecular mechanism underlying CRYAA expression in diabetic retinal tissue has not yet been fully elucidated. Here, we identified the presence of HuD expression in retinal ganglion cells. Both HuD and CRYAA were downregulated in diabetic retinal tissues and neuro-retinal cells. Cryaa mRNA was identified as a novel downstream target of HuD. Our results elucidate the molecular mechanism linking HuD and CRYAA under diabetic conditions and the potential role in ameliorating the degeneration of neuro-retinal cells. MATERIALS AND METHODS Cell culture, treatment, and transfection of siRNAs and plasmids The immortalized rat retinal precursor cell line, R-28 cells were grown in Dulbecco’s modified eagle’s medium (DMEM; Welgene, Gyeongsan-si, South Korea) and supplemented with 10% fetal bovine serum (FBS; HyClone, UT, USA) and 1% penicillin (Welgene) in a humidified atmosphere of 5% CO 2 at 37 ºC. Cells were treated with glucose solution (Sigma-Aldrich, St. Louis, MO, USA). The plasmids, pcDNA, myc-tagged HuD (pHuD), myc-tagged CRYAA (pCRYAA), and enhanced green fluorescent protein reporter (pEGFP), were transfected with Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA). Small interfering RNAs [siRNAs; control siRNA (siCtrl), HuD siRNA (siHuD), and Cryaa siRNA (siCryaa); Genolution Pharmaceuticals, Seoul Korea] were transfected with Lipofectamine™ RNAiMAX (Invitrogen). EGFP reporters were cloned by inserting 3′UTR (3U) fragments of Cryaa mRNA into pEGFP-C1 (BD Bioscience, Heidelberg, Germany). Animals Four-week-old male albino Wistar rats were used in this study. The rats were purchased from Orient Bio (Seongnam, Korea), and maintained in a plastic cage in a climate-controlled laboratory on a 12-h light/12-h dark cycle at 22°C, 34–48% relative humidity. Food and water were available ad libitum. All procedure of animal research was provided in accordance with the Laboratory Animals Welfare Act, the Guide for the Care and Use of Laboratory Animals and the Guidelines and Policies for Rodent experiment provided by the IACUC (Institutional Animal Care and Use Committee) in school of medicine, The Catholic University of Korea (Approval number: CUMC-2021-0144-03). This study was carried out in compliance with the ARRIVE guideline. IACUC and Department of Laboratory Animal (DOLA) in Catholic University of Korea, Songeui Campus accredited the Korea Excellence Animal Laboratory Facility from Korea Food and Drug Administration in 2017 and reaccredited​ in 2021. And also acquired AAALAC International full accreditation in 2018 and reaccredited​ in 2022. A diabetic rat model was induced through a single intraperitoneal injection of streptozotocin (STZ; Sigma-Aldrich; 60 mg/kg body weight) dissolved in 0.05 M HCl-sodium citrate buffer solution (pH 5.5). This injection was administered to the rats, defined as day one, after placing them in a gas chamber with 2% isoflurane in oxygen until unconsciousness. Subsequently, the rats were removed from the chamber and maintained under anesthesia with a mask (1.5% isoflurane in oxygen). Serum glucose levels were measured from the tail vein using an automated Accu-Check glucometer (Roche Diagnostics Ltd., Indianapolis, IN) three days post-diabetes induction. Confirmation of diabetes development occurred when serum glucose levels exceeded 250 mg/dL on day 3, at which point the rats were selected for further experiments. Body weight and serum glucose levels were subsequently recorded on a weekly basis post-diabetes induction. Western blot analysis Whole-cell lysates were prepared using RIPA buffer [10 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 1 mM EDTA, and 0.1% SDS], separated by SDS-PAGE, and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Belfor, MA, USA). Incubation with primary antibodies to detect HuD (Santa Cruz Biotechnology, Dallas, TX, USA), CRYAA (Santa Cruz Biotechnology), EGFP (Santa Cruz Biotechnology), TNFα (Millipore), IL-1β (Abcam, Cambridge, MA, USA), IL-6 (Abcam) and β-actin (Abcam) was followed by incubation with the appropriate secondary antibodies conjugated with horseradish peroxidase (HRP) (Cell Signaling Technology, Beverly, MA, USA) and detection using the WestGlow™ FEMTO ECL Chemiluminescent Substrate Kit (Biomax, Seoul, Korea) RNA analysis and ribonucleoprotein (RNP) immunoprecipitation (RIP) analysis Total RNA was prepared from whole cells using RNAiso™ Plus (TaKaRa, Shiga, Japan). After reverse transcription (RT) using ReverTra Ace® qPCR RT Kit (Toyobo, Osaka, Japan), the transcripts were assessed by real-time quantitative (q)PCR analysis using SensiFAST™ SYBR® No-ROX Mix (Bioline, MA, USA) and gene-specific primer sets (Table 1 ). RT-qPCR was performed on CFX Connect™ Real-Time System (Bio-Rad, CA, USA). RIP analysis was performed using the primary antibodies anti-HuD or control IgG (Santa Cruz Biotechnology) [ 11 ]. In brief, RNP complexes were immunoprecipitated using anti-HuD or control IgG antibodies and incubated with DNase I and proteinase K; RNA in the IP samples was isolated and further analyzed by RT-qPCR using the primers listed in Table 1 . Table 1 Primer sequences used in this study Primers for EGFP-reporter Sequences rat Cryaa-3U-F 5'- AAAAAGATCTTAAGCAGGCCTCGCCTTGG − 3' rat Cryaa-3U-R 5'- AAAAGGTACCGCTTGTCACCTGCTCT − 3' Primers for PCR Sequences Product size References (primer bank number) rat HuD-F 5'- GCCTCAGGTGTCAAATGGACC − 3' 243 bp N.S. rat HuD-R 5'- CCATACCCTAAACTCTGTCCTGT − 3' rat Cryaa-F 5'- CCTGCTGCCCTTCCTGTCGT − 3' 210 bp N.S. rat Cryaa -R 5'- TCCTGGCGCTCGTTGTGCT − 3' rat IL-1β-F 5'- CTCACAGCAGCATCTCGACAAGAG − 3' 95 bp doi.org/10.1155/2021/6657673 rat IL-1β-R 5'- TCCACGGGCAAGACATAGGTAGC − 3' rat IL-6-F 5'- TCCTACCCCAACTTCCAATGCTC − 3' 79 bp J Hazard Master (2015) 287;392 rat IL-6-R 5'- TTGGATGGTCTTGGTCCTTAGCC − 3' rat Tnfα-F 5'- CCAGGTTCTCTTCAAGGGACAA − 3' 80 bp doi.org/10.1155/2021/6657673 rat Tnfα-R 5'- GGTATGAAATGGCAAATCGGCT − 3' rat Gapdh-F 5'- TGCCACTCAGAAGACTGTGG − 3' 123 bp J Neurosci (2010) 30;15007 rat Gapdh-R 5'- TTCAGCTCTGGGATGACCTT − 3' Immunohistochemistry Cryosections of the eyes were air-dried and washed twice with PBS. The slides were washed with 0.5% H 2 O 2 in MeOH for 30 min, and twice with PBS. The nonspecific binding activity of the sections was blocked using 2% bovine serum albumin (BSA) in PBS for 1 hr. The slides were subsequently incubated with the primary antibodies, anti-HuD and anti-CRYAA, diluted in 2% BSA overnight at 4°C. After washing three times for 5 min each with PBS, the slides were incubated with the secondary antibody conjugated with the enzyme diluted in PBS for 1 h at room temperature. Cell viability assay Cell viability was measured by the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Invitrogen, Carlsbad, CA). R-28 cells were seeded into 96-well plates, and incubated for 24 h in a humidified atmosphere of 5% CO 2 at 37°C. MTT solution (5 mg/ml) was added to each well, and the cells were incubated for 2 h at 37°C. Afterward, the medium was removed, and MTT was solubilized by adding 100 µl of 0.04 N acid isopropanol and 100 µl of distilled water to each well. The plates were agitated for 10 min, after which the optical density of the solubilized crystals was measured at 570 nm using an automated microplate reader. Statistical analysis All the experiments were conducted at least three times, and all the samples were analyzed in triplicate. The results are presented as the mean ± SEM. The statistical significance was calculated by an unpaired Student’s t -test. A p-value less than 0.05 was considered statistically significant. RESULTS HuD expression in neuro-retinal cells The roles of HuD have been revealed in neuronal function, maintenance, and development, owing to its predominant expression in neuronal cells [ 9 , 10 ]. Since the role of HuD in insulin synthesis has been reported [ 11 ], its function has also been studied in neuro-endocrinal β cells such as autophagy, lipid metabolism, cell cycle, and mitochondrial dynamics [ 12 ]. However, the role of HuD in the retina has not been examined. To determine whether HuD functions in the retina, we first examined the presence of HuD expression in retinal tissues by immunostaining. As shown in Fig. 1 , HuD was predominantly expressed in ganglion cells and the inner nuclear layers of both rat and mouse retinal tissues. These findings suggest that, unlike its role in neural and neuroendocrine cells, HuD may have a distinct and important function in neuro-retinal cells. Down-regulations of HuD and CRYAA in the retina of STZ-induced diabetic rats It is well-established that HuD expression is down-regulated in β-cells of diabetic mice ( db/db ) [ 18 ]. These findings led us to hypothesize that HuD may also be regulated in retinal cells under diabetic conditions. To investigate this possibility, we examined HuD expression in the retinas of normal and STZ-induced diabetic rats (STZ-rat). As shown in Fig. 2 A, HuD expression was significantly down-regulated in both the GCL and INL of the retina in STZ-rats compared to normal rats. Additionally, the HuD mRNA level was also decreased in the retinal tissues of STZ-rats (Fig. 2 C). Interestingly, we observed parallel decreases in the protein and mRNA levels of CRYAA in the retinas of STZ-rats (Fig. 2 B and D). These findings collectively implicate the down-regulation of HuD and CRYAA in the pathophysiology of diabetic retinal degeneration. Down-regulations of HuD and CRYAA in neuro-retinal cells by high glucose The diminished levels of HuD and CRYAA in the retinas of diabetic rats strongly suggest that their expression may be influenced by glucose levels. To investigate this possibility, we exposed neuro-retinal R-28 cells to high glucose for 72 h and performed RT-qPCR and Western blotting analyses. As expected, both HuD and Cryaa mRNA and protein expression levels were significantly down-regulated in neuro-retinal cells exposed to high glucose (Fig. 3 A and B). Therefore, these results underscore the potential of HuD and CRYAA to regulate the crucial functions of neuro-retinal cells under hyperglycemic conditions. Regulation of Cryaa mRNA expression by HuD via its 3′-untranslated region binding Next, we tested whether HuD is an upstream regulator of CRYAA expression in neuro-retinal cells by transient silencing or overexpressing HuD and then measuring Cryaa mRNA and protein levels using RT-qPCR and Western blotting analysis, respectively. HuD silencing reduced both Cryaa mRNA and protein levels (Fig. 4 A and B), whereas HuD overexpression induced this effect (Fig. 4 C and D), suggesting that HuD regulates the stability and translation of Cryaa mRNA. To further elucidate the regulation of Cryaa mRNA by HuD, we performed RNP-IP using an anti-HuD antibody. As shown in Fig. 5 A, the enriched Cryaa mRNA was assessed in the HuD-bound RNP complex. These results indicate that Cryaa mRNA has a binding site for HuD on its nucleic acid sequence. HuD is a turnover- and translation-regulatory RNA-binding protein that regulates the expression of target mRNAs by binding to their 3′UTR. To further determine whether HuD could directly regulate Cryaa mRNA, EGFP reporter constructs were generated by inserting the 3′UTR of Cryaa mRNA (Fig. 5 B). EGFP reporter plasmids were transfected into neuro-retinal cells, with HuD either silenced or overexpressed. Relative GFP expression was then analyzed via Western blotting (Fig. 5 C). HuD silencing specifically down-regulated GFP expression in cells transfected with pEGFP + Cryaa 3U, but not in those with control reporter (pEGFP). Conversely, HuD overexpression up-regulated GFP expression in pEGFP + Cryaa 3U. These results collectively suggest that HuD binds to the 3′UTR of Cryaa mRNA to regulate its expression. Inflammatory cytokine expression by HuD-CRYAA axis in neuro-retinal cells Abundant evidence indicates that inflammation contributes to the development of DR [ 19 ]. The levels of several inflammatory cytokines, such as TNF-α, IL-1β, and IL-6, are elevated in the vitreous, aqueous humor, and ocular tissues of diabetic patients with DR [ 20 ]. We investigated whether diabetic conditions induce the expression of inflammatory cytokines in neuro-retinal cells. As shown in Fig. 6 A, the expression of TNF-α, IL-1β , and IL- 6 mRNAs was upregulated in R-28 cells under high glucose treatment. Moreover, the protein expressions levels of TNF-α and IL-1β increased, coinciding with the decreased levels of HuD and CRYAA (Fig. 6 B). We further investigated the involvement of HuD in the regulation of inflammatory cytokines in neuro-retinal cells. R-28 cells were transfected with siRNA targeting HuD (siHuD) or overexpression plasmids for HuD (pHuD) for 48 h, after which the relative levels of TNF-α , IL-1β , and IL-6 mRNAs were assessed by RT-qPCR. As shown in Fig. 6 C and 6 E, HuD silencing induced the expression of all inflammatory cytokines in neuro-retinal cells, whereas their levels were reduced by HuD overexpression. Additionally, we examined whether CRYAA plays a role in the elevated expression of inflammatory cytokines in R-28 cells (Fig. 6 D and F). As expected, Cryaa silencing significantly increased the levels of TNF-α , IL-1β , and IL-6 mRNAs in neuro-retinal cells, whereas Cryaa overexpression reduced their expressions. Furthermore, the levels of TNF-α and IL-1β proteins were concordant with mRNA expressions upon HuD and Cryaa silencing and overexpression (Fig. 6 G and H). Collectively, these results suggest that the reduction in HuD and CRYAA levels under diabetic conditions contributes to elevated inflammatory cytokine levels during the development of DR. Alleviative role of HuD and CRYAA in neuro-retinal cell viability. Hyperglycemia induces oxidative stress, which affects various aspects of cell viability. To assess the influence of HuD and CRYAA on neuro-retinal cell viability, R-28 cells were transfected with siHuD or siCryaa and then exposed to high glucose for 72 h, followed by MTT analysis. Although HuD and Cryaa silencing had no effect on cells under normal glucose conditions, the reduction in R-28 cell viability was exacerbated by HuD and Cryaa silencing (Fig. 7 A and C) under high glucose. To elucidate the role of HuD and CRYAA in mitigating the decrease in cell viability caused by high glucose levels, cell viability assays were conducted by transfecting R-28 cells with overexpression plasmids for HuD (pHuD) or Cryaa (pCRYAA). Intriguingly, overexpression of HuD and Cryaa alleviated the decrease in neuro-retinal cell viability induced by high glucose (Fig. 7 B and D). Taken together, these results strongly suggest that the regulation of the HuD-CRYAA axis plays a crucial role in the survival and function of neuro-retinal cells during the development of DR. DISCUSSION Although microvascular complications are a major consideration in DR, neuro-retinal degeneration is recognized as the leading cause of vision loss. Several studies have reported that neuro-retinal damage with structural changes is priorly observed in the retina of patients with diabetes without any signs of DR. Barber et al. demonstrated a decrease in the GC-IPL [ 21 ], and Carpineto et al. showed a significant reduction in the GC-IPL and retinal nerve fiber layer thickness in type 2 diabetes patients with no DR or mild NPDR [ 22 ]. Although these reports suggest that ganglion cells are the primary cells influenced by neuro-retinal degeneration developed at the early stage of DM before DR diagnosis, the precise molecular mechanism leading to the decrease in ganglion cells has not yet been fully understood. In this study, we demonstrated that an RNA binding protein, HuD is expressed in neuro-retinal cells, specifically in ganglion cells, and plays a novel role in neuro-retinal degeneration via post-transcriptional regulation of Cryaa mRNA. Additionally, we observed a significant decrease in both HuD and CRYAA levels in the GCL of STZ-induced diabetic rats. Deficiencies in these proteins were implicated in the reduced viability of neuro-retinal cells under hyperglycemic conditions. These results suggest that both HuD and CRYAA have potential roles in the pathological processes of neuro-retinal degeneration during the early stage of diabetes. Crystallins were first identified as major structural components of the lens [ 23 ]. Additionally, alpha-crystallins has also been found in the retina, cornea, optic nerve, astrocytes, and Müller cells in ocular tissue [ 24 ]. Alpha-crystallins possess a chaperone-like function, preventing apoptosis by avoiding aberrant protein interaction and degradation [ 25 ]. Several studies have reported a reduction in alpha-crystallin levels in various retinal degenerations, leading to reduced survival of retinal ganglion cells [ 26 ]. Although the up-regulation of CRYAA has been observed in the eyes of humans with diabetes [ 27 ], STZ-induced diabetic rats [ 28 ], high fat/STZ-induced diabetic rats [ 29 ], and Ins2 Akita diabetic mice [ 30 ], several studies have also reported diminished levels of CRYAA in diabetic retinas. Kim et al. determined that the levels of Cryaa mRNA and protein were significantly reduced in the retina of STZ-induced diabetic mice [ 15 ]. Moreover, down-regulated transcriptional level and translational efficiency of Cryaa mRNA have also been demonstrated in the retinas of STZ-induced diabetic rat models [ 16 , 17 ]. In the present study, we observed decreased levels of CRYAA in the retinal GCL of STZ-induced diabetic rats (Fig. 2 A). Furthermore, CRYAA knock-down promoted a reduction in neuro-retinal cell viability under high glucose treatment (Fig. 7 C). These findings strongly suggest that decreased levels of CRYAA are closely associated with the viability of neuro-retinal cells under hyperglycemic conditions, indicating the potential of CRYAA as a specific indicator for diagnosing neuro-retinal degeneration in the early stage of diabetes. Alpha-crystallins prevent apoptosis induced by several factors, such as etoposide, staurosporine, and sorbitol [ 31 ], UV [ 32 ], TNFα [ 33 ], hydrogen peroxide [ 34 ], and okadaic acid [ 35 ]. They inhibit apoptosis by directly interacting with caspase-3, Bcl-x(s) and Bax [ 31 , 36 ], upregulating PI3 kinase activity [ 25 ], as well as regulating PKCα, RAF/MEK, ERK, and AKT signaling [ 32 ]. The reduced chaperone function of alpha-crystallin due to mutation has been shown to result in a loss of its protective ability against apoptosis [ 37 ]. Moreover, the absence of alpha-crystallin has been demonstrated to enhance retinal degeneration in chemically induced hypoxia [ 38 ] and in sodium iodate-induced AMD models [ 39 ]. Conversely, alpha-crystallin has been shown to improve the viability of retinal ganglion cells [ 40 ] and optic nerve axons after optic nerve crush [ 41 ]. Additionally, intravitreal injection of CRYAA via an adenovirus ameliorated apoptotic cell death and vascular leakage in the diabetic retina [ 15 ]. In this study, we further demonstrated that overexpression of CRYAA alleviated the viability of neuro-retinal cells under high glucose conditions (Fig. 7 D), indicating that restoring CRYAA expression under hyperglycemic conditions might be an effective therapeutic strategy for preventing neuro-retinal cell degeneration at the early stage of diabetes. The protective function of CRYAA is regulated by various regulatory factors. The expression of crystallins is controlled by several transcription factors including Pax-6, Maf, Sox, neural retina leucine zipper (NLR), retinoic acid receptors (RARs), Prox1, Six3, γFBP-B, HSF2, HSF4, CREB, and AP-1 [ 42 – 46 ]. Additionally, alpha-crystallins are regulated by phosphorylation via cyclic adenosine monophosphate (cAMP) and dephosphorylation [ 47 , 48 ]. It has also been reported that the chaperone activity of alpha-crystallin is regulated by glycation and acetylation [ 49 – 51 ]. That is, understanding the detailed regulatory mechanism for CRYAA expression and its chaperone activity is necessary to establish therapeutic strategies targeting the degeneration of neuro-retinal cells. In this study, we verified that HuD is a crucial upstream regulator of Cryaa mRNA. Using RNP-IP and EGFP-reporter analyses, we demonstrated that the expression CRYAA is controlled by binding between HuD and the 3′UTR of Cryaa mRNA (Fig. 5 ). HuD silencing decreased the levels of Cryaa mRNA and protein, whereas HuD overexpression significantly increased these levels in neuro-retinal R-28 cells. Although our results suggest that HuD is a positive post-transcriptional regulator for Cryaa mRNA, whether HuD regulates the stability, translational efficiency, or both of Cryaa mRNA needs to be further elucidated. HuD is an RNA binding protein predominantly expressed in neuronal cells. Increasing evidence suggests that HuD plays crucial roles in several types of endocrine and cancer cells [ 12 ]. Although some studies have reported the direct or indirect regulation of HuD during neuronal and endocrine disease development, the molecular mechanisms controlling HuD gene expression have not yet been fully examined. Three molecular pathways regulating the function and abundance of HuD have been elucidated: protein kinase C (PKC) [ 52 , 53 ], coactivator associated arginine methytransferase 1 (CARM1) [ 54 ], and protein kinase B (PKB/AKT) [ 55 ]. Other studies have determined the transcriptional and post-transcriptional control of HuD gene expression. The expression of HuD mRNA is upregulated during neuronal differentiation by thyroid hormone (T3) [ 56 ], and Ngn2 has been identified as a transcription factor responsible for increasing HuD mRNA expression [ 57 ]. Forkhead box O1 (Foxo1) negatively affects the transcription of HuD in pancreatic β cells under low glucose conditions [ 11 ], and miR-375 also negatively controls both the stability and translation of HuD mRNA [ 58 ]. Special adenine–thymine (AT)-rich DNA-binding protein 1 (SATB1) was recently identified as an activator of the HuD promoter during neuronal differentiation [ 59 ]. Here in, we revealed the presence of HuD expression in neuro-retinal ganglion cells (Fig. 1 ). Furthermore, HuD expression was found to be regulated under hyperglycemic conditions, including in the retinas of STZ-induced diabetic rats and neuro-retinal cells under high glucose treatment. While these findings suggest that HuD may be an essential factor for maintaining the homeostasis of neuro-retinal cells, further elucidation of the molecular regulatory mechanism of HuD expression is needed to protect neuro-retinal cells from hyperglycemia-induced degeneration. Inflammation is a significant feature in DR pathogenesis observed in both animal models and patients with diabetes. Elevated glucose levels lead to metabolic dysfunction, oxidative stress, and the production of reactive oxygen species, resulting in inflammatory responses. Several studies have demonstrated increased levels of pro-inflammatory cytokines, including TNFα, IL-1β, and IL-6, in the serum, vitreous and aqueous humor, as well as in the retinal tissues of patients with DR [ 60 ]. Up-regulated pro-inflammatory cytokines promote inflammatory responses through various pathways, leading to neuro-retinal degeneration such as cell apoptosis. In this study, we demonstrated increased levels of TNFα, IL-1β, and IL-6 in neuro-retinal cells under high glucose treatment and found that their levels were negatively regulated by both HuD and CRYAA expression. These results suggest that HuD and CRYAA have the potential to inhibit inflammatory responses, thereby alleviating cell death. However, further studies are needed to determine whether TNFα , IL-1β , and IL-6 mRNAs are molecular targets of HuD and how their expression is regulated by CRYAA to prevent neuro-retinal inflammatory responses in DR. In summary, we propose a novel molecular mechanism and role of the HuD/CRYAA axis in neuro-retinal degeneration during the early stages of diabetes. Our results indicated that HuD expression is down-regulated in neuro-retinal cells under hyperglycemic conditions, leading to a decrease in CRYAA expression through post-transcriptional regulation. Downregulation of HuD and CRYAA is highly implicated in cellular inflammation, affecting neuro-retinal cell death under hyperglycemic conditions. Restoration of HuD and CRYAA expression is beneficial for improving neuro-retinal cell survival and overcoming neuro-retinal degeneration in DR. Abbreviations CRYAA alpha-crystallin A DR diabetic retinopathy EGFP enhanced green fluorescence protein GCL ganglion cell layer GC-IPL ganglion cell-inner plexiform layer HuD Hu-antigen D INL inner nuclear layer NPDR non-proliferative diabetic retinopathy PDR proliferative diabetic retinopathy RGC retinal ganglion cell RNP ribonucleoprotein complex STZ streptozotocin Declarations ACKNOWLEDGMENTS Not applicable. FUNDING This work was supported by the Basic Science Research Programs through the National Research Foundation of Korea (NRF) grants funded by the Korean government (MSIT) (2019R1I1A1A01059394, 2022R1I1A1A01055331). AUTHOR CONTRIBUTIONS C.K., S.O., and Y.H.P. performed study concept and design; C.K. performed experiments, analysis and interpretation of data, and statistical analysis; S.O. provided technical support; C.K. wrote original draft and revised and edited the manuscript. Y.H.P. reviewed the manuscript. All authors read and approved the final manuscript. CONFLICT OF INTEREST The authors declare that they have no competing interests. CONSENT FOR PUBLICATION Not applicable. ETHICS APPROVAL AND CONSENT TO PARTICIPATE This study was approved by the IACUC (Institutional Animal Care and Use Committee) in school of medicine, The Catholic University of Korea (Approval number: CUMC-2021-0144-03). DATA AVAILABILTY The data that support the findings of this study are available from the corresponding author upon reasonable request. References Abcouwer SF and Gardner TW (2014) Diabetic retinopathy: loss of neuroretinal adaptation to the diabetic metabolic environment. Ann N Y Acad Sci 1311:174-90. doi: 10.1111/nyas.12412 Fudalej E, Justyniarska M, Kasarełło K, Dziedziak J, Szaflik JP and Cudnoch-Jędrzejewska A (2021) Neuroprotective Factors of the Retina and Their Role in Promoting Survival of Retinal Ganglion Cells: A Review. Ophthalmic Res 64:345-355. doi: 10.1159/000514441 Lim HB, Shin YI, Lee MW, Koo H, Lee WH and Kim JY (2020) Ganglion Cell - Inner Plexiform Layer Damage in Diabetic Patients: 3-Year Prospective, Longitudinal, Observational Study. Sci Rep 10:1470. doi: 10.1038/s41598-020-58465-x Jia X, Zhong Z, Bao T, Wang S, Jiang T, Zhang Y, Li Q and Zhu X (2020) Evaluation of Early Retinal Nerve Injury in Type 2 Diabetes Patients Without Diabetic Retinopathy. Front Endocrinol (Lausanne) 11:475672. doi: 10.3389/fendo.2020.475672 Gundogan FC, Akay F, Uzun S, Yolcu U, Çağıltay E and Toyran S (2016) Early Neurodegeneration of the Inner Retinal Layers in Type 1 Diabetes Mellitus. Ophthalmologica 235:125-32. doi: 10.1159/000442826 Pollreisz A, Desissaire S, Sedova A, Hajdu D, Datlinger F, Schwarzhans F, Steiner S, Steiner I, Vass C, Hitzenberger CK, Pircher M and Schmidt-Erfurth U (2021) Early Identification of Retinal Neuropathy in Subclinical Diabetic Eyes by Reduced Birefringence of the Peripapillary Retinal Nerve Fiber Layer. Invest Ophthalmol Vis Sci 62:24. doi: 10.1167/iovs.62.4.24 Ng DS, Chiang PP, Tan G, Cheung CG, Cheng CY, Cheung CY, Wong TY, Lamoureux EL and Ikram MK (2016) Retinal ganglion cell neuronal damage in diabetes and diabetic retinopathy. Clin Exp Ophthalmol 44:243-50. doi: 10.1111/ceo.12724 Good PJ (1995) A conserved family of elav-like genes in vertebrates. Proc Natl Acad Sci U S A 92:4557-61. doi: 10.1073/pnas.92.10.4557 Deschênes-Furry J, Perrone-Bizzozero N and Jasmin BJ (2006) The RNA-binding protein HuD: a regulator of neuronal differentiation, maintenance and plasticity. Bioessays 28:822-33. doi: 10.1002/bies.20449 Bronicki LM and Jasmin BJ (2013) Emerging complexity of the HuD/ELAVl4 gene; implications for neuronal development, function, and dysfunction. Rna 19:1019-37. doi: 10.1261/rna.039164.113 Lee EK, Kim W, Tominaga K, Martindale JL, Yang X, Subaran SS, Carlson OD, Mercken EM, Kulkarni RN, Akamatsu W, Okano H, Perrone-Bizzozero NI, de Cabo R, Egan JM and Gorospe M (2012) RNA-binding protein HuD controls insulin translation. Mol Cell 45:826-35. doi: 10.1016/j.molcel.2012.01.016 Jung M and Lee EK (2021) RNA-Binding Protein HuD as a Versatile Factor in Neuronal and Non-Neuronal Systems. Biology (Basel) 10. doi: 10.3390/biology10050361 Andley UP (2007) Crystallins in the eye: Function and pathology. Prog Retin Eye Res 26:78-98. doi: 10.1016/j.preteyeres.2006.10.003 Augusteyn RC (2004) alpha-crystallin: a review of its structure and function. Clin Exp Optom 87:356-66. doi: 10.1111/j.1444-0938.2004.tb03095.x Kim YH, Park SY, Park J, Kim YS, Hwang EM, Park JY, Roh GS, Kim HJ, Kang SS, Cho GJ and Choi WS (2012) Reduction of experimental diabetic vascular leakage and pericyte apoptosis in mice by delivery of αA-crystallin with a recombinant adenovirus. Diabetologia 55:2835-2844. doi: 10.1007/s00125-012-2625-y Liu YJ, Lian ZY, Liu G, Zhou HY and Yang HJ (2016) RNA sequencing reveals retinal transcriptome changes in STZ-induced diabetic rats. Mol Med Rep 13:2101-9. doi: 10.3892/mmr.2016.4793 Fort PE, Losiewicz MK, Pennathur S, Jefferson LS, Kimball SR, Abcouwer SF and Gardner TW (2014) mTORC1-independent reduction of retinal protein synthesis in type 1 diabetes. Diabetes 63:3077-90. doi: 10.2337/db14-0235 Kim C, Lee H, Kang H, Shin JJ, Tak H, Kim W, Gorospe M and Lee EK (2016) RNA-binding protein HuD reduces triglyceride production in pancreatic β cells by enhancing the expression of insulin-induced gene 1. Biochim Biophys Acta 1859:675-85. doi: 10.1016/j.bbagrm.2016.02.017 Kern TS (2007) Contributions of inflammatory processes to the development of the early stages of diabetic retinopathy. Exp Diabetes Res 2007:95103. doi: 10.1155/2007/95103 Wu H, Hwang DK, Song X and Tao Y (2017) Association between Aqueous Cytokines and Diabetic Retinopathy Stage. J Ophthalmol 2017:9402198. doi: 10.1155/2017/9402198 Barber AJ, Lieth E, Khin SA, Antonetti DA, Buchanan AG and Gardner TW (1998) Neural apoptosis in the retina during experimental and human diabetes. Early onset and effect of insulin. J Clin Invest 102:783-91. doi: 10.1172/jci2425 Carpineto P, Toto L, Aloia R, Ciciarelli V, Borrelli E, Vitacolonna E, Di Nicola M, Di Antonio L and Mastropasqua R (2016) Neuroretinal alterations in the early stages of diabetic retinopathy in patients with type 2 diabetes mellitus. Eye (Lond) 30:673-9. doi: 10.1038/eye.2016.13 Bhat SP and Nagineni CN (1989) alpha B subunit of lens-specific protein alpha-crystallin is present in other ocular and non-ocular tissues. Biochem Biophys Res Commun 158:319-25. doi: 10.1016/s0006-291x(89)80215-3 Srinivasan AN, Nagineni CN and Bhat SP (1992) alpha A-crystallin is expressed in non-ocular tissues. J Biol Chem 267:23337-41. Pasupuleti N, Matsuyama S, Voss O, Doseff AI, Song K, Danielpour D and Nagaraj RH (2010) The anti-apoptotic function of human αA-crystallin is directly related to its chaperone activity. Cell Death Dis 1:e31. doi: 10.1038/cddis.2010.3 Piri N, Kwong JM and Caprioli J (2013) Crystallins in retinal ganglion cell survival and regeneration. Mol Neurobiol 48:819-28. doi: 10.1007/s12035-013-8470-2 Kase S, Ishida S and Rao NA (2011) Increased expression of αA-crystallin in human diabetic eye. Int J Mol Med 28:505-11. doi: 10.3892/ijmm.2011.708 Kumar PA, Haseeb A, Suryanarayana P, Ehtesham NZ and Reddy GB (2005) Elevated expression of alphaA- and alphaB-crystallins in streptozotocin-induced diabetic rat. Arch Biochem Biophys 444:77-83. doi: 10.1016/j.abb.2005.09.021 Wang YD, Wu JD, Jiang ZL, Wang YB, Wang XH, Liu C and Tong MQ (2007) Comparative proteome analysis of neural retinas from type 2 diabetic rats by two-dimensional electrophoresis. Curr Eye Res 32:891-901. doi: 10.1080/02713680701593702 Losiewicz MK and Fort PE (2011) Diabetes impairs the neuroprotective properties of retinal alpha-crystallins. Invest Ophthalmol Vis Sci 52:5034-42. doi: 10.1167/iovs.10-6931 Mao YW, Liu JP, Xiang H and Li DW (2004) Human alphaA- and alphaB-crystallins bind to Bax and Bcl-X(S) to sequester their translocation during staurosporine-induced apoptosis. Cell Death Differ 11:512-26. doi: 10.1038/sj.cdd.4401384 Liu JP, Schlosser R, Ma WY, Dong Z, Feng H, Lui L, Huang XQ, Liu Y and Li DW (2004) Human alphaA- and alphaB-crystallins prevent UVA-induced apoptosis through regulation of PKCalpha, RAF/MEK/ERK and AKT signaling pathways. Exp Eye Res 79:393-403. Andley UP, Song Z, Wawrousek EF, Fleming TP and Bassnett S (2000) Differential protective activity of alpha A- and alphaB-crystallin in lens epithelial cells. J Biol Chem 275:36823-31. doi: 10.1074/jbc.M004233200 Mao YW, Xiang H, Wang J, Korsmeyer S, Reddan J and Li DW (2001) Human bcl-2 gene attenuates the ability of rabbit lens epithelial cells against H2O2-induced apoptosis through down-regulation of the alpha B-crystallin gene. J Biol Chem 276:43435-45. doi: 10.1074/jbc.M102195200 Li DW, Xiang H, Mao YW, Wang J, Fass U, Zhang XY and Xu C (2001) Caspase-3 is actively involved in okadaic acid-induced lens epithelial cell apoptosis. Exp Cell Res 266:279-91. doi: 10.1006/excr.2001.5223 Hu WF, Gong L, Cao Z, Ma H, Ji W, Deng M, Liu M, Hu XH, Chen P, Yan Q, Chen HG, Liu J, Sun S, Zhang L, Liu JP, Wawrousek E and Li DW (2012) αA- and αB-crystallins interact with caspase-3 and Bax to guard mouse lens development. Curr Mol Med 12:177-87. doi: 10.2174/156652412798889036 Andley UP, Patel HC and Xi JH (2002) The R116C mutation in alpha A-crystallin diminishes its protective ability against stress-induced lens epithelial cell apoptosis. J Biol Chem 277:10178-86. doi: 10.1074/jbc.M109211200 Yaung J, Kannan R, Wawrousek EF, Spee C, Sreekumar PG and Hinton DR (2008) Exacerbation of retinal degeneration in the absence of alpha crystallins in an in vivo model of chemically induced hypoxia. Exp Eye Res 86:355-65. doi: 10.1016/j.exer.2007.11.007 Zhou P, Kannan R, Spee C, Sreekumar PG, Dou G and Hinton DR (2014) Protection of retina by αB crystallin in sodium iodate induced retinal degeneration. PLoS One 9:e98275. doi: 10.1371/journal.pone.0098275 Wu N, Yu J, Chen S, Xu J, Ying X, Ye M, Li Y and Wang Y (2014) α-Crystallin protects RGC survival and inhibits microglial activation after optic nerve crush. Life Sci 94:17-23. doi: 10.1016/j.lfs.2013.10.034 Ying X, Zhang J, Wang Y, Wu N, Wang Y and Yew DT (2008) Alpha-crystallin protected axons from optic nerve degeneration after crushing in rats. J Mol Neurosci 35:253-8. doi: 10.1007/s12031-007-9010-1 Cvekl A, Yang Y, Chauhan BK and Cveklova K (2004) Regulation of gene expression by Pax6 in ocular cells: a case of tissue-preferred expression of crystallins in lens. Int J Dev Biol 48:829-44. doi: 10.1387/ijdb.041866ac Cui W, Tomarev SI, Piatigorsky J, Chepelinsky AB and Duncan MK (2004) Mafs, Prox1, and Pax6 can regulate chicken betaB1-crystallin gene expression. J Biol Chem 279:11088-95. doi: 10.1074/jbc.M312414200 Somasundaram T and Bhat SP (2004) Developmentally dictated expression of heat shock factors: exclusive expression of HSF4 in the postnatal lens and its specific interaction with alphaB-crystallin heat shock promoter. J Biol Chem 279:44497-503. doi: 10.1074/jbc.M405813200 Cvekl A, Sax CM, Bresnick EH and Piatigorsky J (1994) A complex array of positive and negative elements regulates the chicken alpha A-crystallin gene: involvement of Pax-6, USF, CREB and/or CREM, and AP-1 proteins. Mol Cell Biol 14:7363-76. doi: 10.1128/mcb.14.11.7363-7376.1994 Cvekl A and Piatigorsky J (1996) Lens development and crystallin gene expression: many roles for Pax-6. Bioessays 18:621-30. doi: 10.1002/bies.950180805 Spector A, Chiesa R, Sredy J and Garner W (1985) cAMP-dependent phosphorylation of bovine lens alpha-crystallin. Proc Natl Acad Sci U S A 82:4712-6. doi: 10.1073/pnas.82.14.4712 Voorter CE, Mulders JW, Bloemendal H and de Jong WW (1986) Some aspects of the phosphorylation of alpha-crystallin A. Eur J Biochem 160:203-10. doi: 10.1111/j.1432-1033.1986.tb09958.x Datta P, Kallur L and Abraham EC (2008) Reversal of chaperone activity loss of glycated alphaA-crystallin by a crosslink breaker. Mol Cell Biochem 315:137-42. doi: 10.1007/s11010-008-9797-2 Nagaraj RH, Nahomi RB, Shanthakumar S, Linetsky M, Padmanabha S, Pasupuleti N, Wang B, Santhoshkumar P, Panda AK and Biswas A (2012) Acetylation of αA-crystallin in the human lens: effects on structure and chaperone function. Biochim Biophys Acta 1822:120-9. doi: 10.1016/j.bbadis.2011.11.011 Nahomi RB, Huang R, Nandi SK, Wang B, Padmanabha S, Santhoshkumar P, Filipek S, Biswas A and Nagaraj RH (2013) Acetylation of lysine 92 improves the chaperone and anti-apoptotic activities of human αB-crystallin. Biochemistry 52:8126-38. doi: 10.1021/bi400638s Pascale A, Amadio M, Scapagnini G, Lanni C, Racchi M, Provenzani A, Govoni S, Alkon DL and Quattrone A (2005) Neuronal ELAV proteins enhance mRNA stability by a PKCalpha-dependent pathway. Proc Natl Acad Sci U S A 102:12065-70. doi: 10.1073/pnas.0504702102 Lim CS and Alkon DL (2012) Protein kinase C stimulates HuD-mediated mRNA stability and protein expression of neurotrophic factors and enhances dendritic maturation of hippocampal neurons in culture. Hippocampus 22:2303-19. doi: 10.1002/hipo.22048 Fujiwara T, Mori Y, Chu DL, Koyama Y, Miyata S, Tanaka H, Yachi K, Kubo T, Yoshikawa H and Tohyama M (2006) CARM1 regulates proliferation of PC12 cells by methylating HuD. Mol Cell Biol 26:2273-85. doi: 10.1128/mcb.26.6.2273-2285.2006 Fujiwara T, Fukao A, Sasano Y, Matsuzaki H, Kikkawa U, Imataka H, Inoue K, Endo S, Sonenberg N, Thoma C and Sakamoto H (2012) Functional and direct interaction between the RNA binding protein HuD and active Akt1. Nucleic Acids Res 40:1944-53. doi: 10.1093/nar/gkr979 Cuadrado A, Navarro-Yubero C, Furneaux H and Muñoz A (2003) Neuronal HuD gene encoding a mRNA stability regulator is transcriptionally repressed by thyroid hormone. J Neurochem 86:763-73. doi: 10.1046/j.1471-4159.2003.01877.x Bronicki LM, Bélanger G and Jasmin BJ (2012) Characterization of multiple exon 1 variants in mammalian HuD mRNA and neuron-specific transcriptional control via neurogenin 2. J Neurosci 32:11164-75. doi: 10.1523/jneurosci.2247-12.2012 Abdelmohsen K, Hutchison ER, Lee EK, Kuwano Y, Kim MM, Masuda K, Srikantan S, Subaran SS, Marasa BS, Mattson MP and Gorospe M (2010) miR-375 inhibits differentiation of neurites by lowering HuD levels. Mol Cell Biol 30:4197-210. doi: 10.1128/mcb.00316-10 Wang F, Tidei JJ, Polich ED, Gao Y, Zhao H, Perrone-Bizzozero NI, Guo W and Zhao X (2015) Positive feedback between RNA-binding protein HuD and transcription factor SATB1 promotes neurogenesis. Proc Natl Acad Sci U S A 112:E4995-5004. doi: 10.1073/pnas.1513780112 Kaštelan S, Orešković I, Bišćan F, Kaštelan H and Gverović Antunica A (2020) Inflammatory and angiogenic biomarkers in diabetic retinopathy. Biochem Med (Zagreb) 30:030502. doi: 10.11613/bm.2020.030502 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 12 Aug, 2025 Read the published version in Molecular and Cellular Biochemistry → Version 1 posted Editorial decision: Revision requested 29 Jan, 2025 Editor assigned by journal 28 Jan, 2025 Submission checks completed at journal 03 Jan, 2025 First submitted to journal 03 Jan, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5756583","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":397355202,"identity":"fe683781-485f-47dd-ba26-534455ff2250","order_by":0,"name":"Chongtae Kim","email":"","orcid":"","institution":"The Catholic University of Korea","correspondingAuthor":false,"prefix":"","firstName":"Chongtae","middleName":"","lastName":"Kim","suffix":""},{"id":397355203,"identity":"43e0688f-660a-4193-aed1-833f3a8376bc","order_by":1,"name":"Subeen Oh","email":"","orcid":"","institution":"The Catholic University of Korea","correspondingAuthor":false,"prefix":"","firstName":"Subeen","middleName":"","lastName":"Oh","suffix":""},{"id":397355204,"identity":"b39fb7cf-0f16-41fd-8d95-9b689b364033","order_by":2,"name":"Young-Hoon Park","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIiWNgGAWjYHACZgbGBhsgzcPA8MAAKkKEljQGBjaglgQStByGaoGJ4APm7GcfG/PuOC/PP7/34IOEAjsG/vYDzMYVeLRY9qQbJ/OeuW044xhfskGCQTKDxJkE5sQzeLQYHEhjPszbdjuB4RiPmUSCwQEGhhsMzAcb8Gk5/wyk5VyCPEyLPEEtN9KYk3nbDiQYwLQYALUk4tNiOeMZs+HctmTDjcdyjEF+4TE8k9hsiE+LOX8as8TbNjt5ucNnDB98+GMnJ3f88GFJvA4DYiYeJAEgmxGfBogWxh94lYyCUTAKRsGIBwB+NEfHXIPWnQAAAABJRU5ErkJggg==","orcid":"","institution":"The Catholic University of Korea","correspondingAuthor":true,"prefix":"","firstName":"Young-Hoon","middleName":"","lastName":"Park","suffix":""}],"badges":[],"createdAt":"2025-01-03 08:23:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5756583/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5756583/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11010-025-05364-2","type":"published","date":"2025-08-12T15:57:18+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":73051295,"identity":"0b959509-ea62-40bf-b1a6-3e727d1d2d2b","added_by":"auto","created_at":"2025-01-06 09:24:58","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":903308,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuD is expressed in neuro-retinal cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression of HuD was analyzed by immunostaining in retinas of rats and mice. The nuclei were stained with DAPI solution. Ganglion cell (Gcg), inner nuclear layer (INL), inner plexiform layer (IPL), outer nuclear layer (ONL), and outer plexiform layer (OPL). Scale bar, 20 µm.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5756583/v1/1cd3c3b151251cf037f01f64.png"},{"id":73051697,"identity":"9d94b887-4c4b-425f-b61c-312ab8925f5e","added_by":"auto","created_at":"2025-01-06 09:32:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":769369,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuD and CRYAA are down-regulated in neuro-retinal cells of diabetic rats.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A and B) The expression levels of HuD and CRYAA were analyzed by immunofluorescence microscope in the retinas of normal (Nor) and Streptozotocin-induced diabetic (STZ) rats. Ganglion cell (Gcg), inner nuclear layer (INL), inner plexiform layer (IPL), outer plexiform layer (OPL), and outer nuclear layer (ONL). Scale bar, 20 µm. (C and D) The relative levels of \u003cem\u003eHuD\u003c/em\u003e and \u003cem\u003eCryaa \u003c/em\u003emRNAs in retinal tissues from Nor- and STZ-rats were analyzed by RT-qPCR. \u003cem\u003eGapdh\u003c/em\u003e mRNA was used for normalization. Data represent the means ± SEM from three independent experiments. *, \u003cem\u003ep \u0026lt; 0.05\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5756583/v1/29f246d65ad68552899870d6.png"},{"id":73051696,"identity":"19a61407-1e45-484d-9db0-267a041fe2ad","added_by":"auto","created_at":"2025-01-06 09:32:58","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":136166,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuD and CRYAA are down-regulated in neuro-retinal cells by high glucose.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter incubation of R-28 cells with 5.5 or 25 mM of glucose for 72 h, the mRNA and protein levels of HuD and CRYAA were analyzed by RT-qPCR (A) and Western blotting (B), respectively. \u003cem\u003eGapdh\u003c/em\u003emRNA was used for normalization, and β-actin was used as a loading control. Data represent the means ± SEM from three independent experiments. Images (B) are representative from three independent experiments. *, \u003cem\u003ep \u0026lt; 0.05\u003c/em\u003e; ***, \u003cem\u003ep \u0026lt; 0.001\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5756583/v1/0a92c6f1f984b042fe6da480.png"},{"id":73051698,"identity":"d1dec83b-cdb1-4753-b1cc-cbe893c65d70","added_by":"auto","created_at":"2025-01-06 09:32:59","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":289601,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuD positively regulates CRYAA expression in neuro-retinal cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eForty-eight hours after transfection of R-28 cells with either of HuD siRNA (siHuD) or the HuD overexpression plasmid (pHuD) along with the appropriate controls (siCtrl and pCtrl, respectively), levels of \u003cem\u003eHuD\u003c/em\u003eand \u003cem\u003eCryaa\u003c/em\u003e mRNA and protein were assessed by RT-qPCR (A and C) and Western blotting (B and D), respectively. \u003cem\u003eGapdh\u003c/em\u003e mRNA was used for normalization, and β-actin was used as a loading control. Data represent the means ± SEM from three independent experiments. Images in (B and D) are representative from three independent experiments. *, \u003cem\u003ep \u0026lt; 0.05\u003c/em\u003e; ***, \u003cem\u003ep \u0026lt; 0.001\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5756583/v1/f3ede8ae2286b6a5ba644ed8.png"},{"id":73051304,"identity":"299e93a8-c87e-435c-9bb1-4d0a3aa248e7","added_by":"auto","created_at":"2025-01-06 09:25:01","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":304753,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuD regulates the expression of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCryaa\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mRNA by binding to its 3’UTR.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) The RNP complex in R-28 cells was isolated by immunoprecipitation using anti-HuD antibody and enriched \u003cem\u003eCryaa\u003c/em\u003emRNA in HuD-IP was analyzed by RT-qPCR. Data represent the means ± SEM from three independent experiments. *, \u003cem\u003ep \u0026lt; 0.05\u003c/em\u003e. (B) Schematic of reporter plasmids, 3’UTR region of \u003cem\u003eCryaa\u003c/em\u003e mRNA (3U) was inserted into the pEGFP vector. (C) After transfection of HuD siRNA or the overexpression plasmid along with appropriate controls, R-28 cells were sequentially transfected with reporter plasmids. Relative expression of GFP and HuD was analyzed by western blotting. β-actin was used as a loading control. Images are representative from three independent experiments.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5756583/v1/33edb9cb38d3df532af20da4.png"},{"id":73051297,"identity":"aa0e3095-02b5-4bc9-88a6-36fff4f6d02f","added_by":"auto","created_at":"2025-01-06 09:24:58","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":622704,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNeuro-retinal inflammation is regulated by HuD-CRYAA axis on high glucose.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A and B) After incubation of R-28 cells with 5.5 and 25 mM of glucose for 72 h, mRNA levels of \u003cem\u003eTnfα,\u003c/em\u003e \u003cem\u003eIL-1β\u003c/em\u003e, and \u003cem\u003eIL-6\u003c/em\u003e were analyzed by RT-qPCR (A), as well as protein levels of HuD, CRYAA, TNFα, and IL-1β by western blotting (B). (C - H) After transfection of R-28 cells with either of \u003cem\u003eHuD\u003c/em\u003e or \u003cem\u003eCryaa\u003c/em\u003e siRNAs (siHuD or siCryaa) or \u003cem\u003eHuD\u003c/em\u003e or \u003cem\u003eCryaa\u003c/em\u003e overexpression plasmids (pHuD or pCryaa) along with appropriate controls (siCtrl and pCtrl, respectively), the mRNA levels of \u003cem\u003eTnfα\u003c/em\u003e, \u003cem\u003eIL-1β\u003c/em\u003e, and \u003cem\u003eIL-6\u003c/em\u003e were analyzed by RT-qPCR (C – F), as well as protein levels of HuD, CRYAA, TNFα, and IL-1β by western blotting (G and H). \u003cem\u003eGapdh\u003c/em\u003emRNA was used for normalization, and β-actin was used as a loading control. The images in (B, G, and H) are representative from three independent experiments. Data represent the means ± SEM from three independent experiments. *, \u003cem\u003ep \u0026lt; 0.05\u003c/em\u003e, **; \u003cem\u003ep \u0026lt; 0.01\u003c/em\u003e, ***; \u003cem\u003ep \u0026lt; 0.001\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5756583/v1/f9d5cf35840cddd2ad507430.png"},{"id":73051302,"identity":"75b3933e-4c40-44cc-9591-66e78e814cbe","added_by":"auto","created_at":"2025-01-06 09:25:01","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":162276,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuD and CRYAA alleviate high glucose-induced R-28 cell death.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter transfection with \u003cem\u003eHuD\u003c/em\u003e or \u003cem\u003eCryaa\u003c/em\u003e siRNA (siHuD or siCryaa) (A and C) or \u003cem\u003eHuD\u003c/em\u003e or \u003cem\u003eCryaa\u003c/em\u003eoverexpression plasmids (pHuD or pCryaa) (B and D) along with appropriate controls (siCtrl or pCtrl), R-28 cells were incubated with 5.5 or 25 mM of glucose for 72 h, followed by cell viability assay using MTT assay. Data represent the means ± SEM from three independent experiment. *, \u003cem\u003ep \u0026lt; 0.05\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5756583/v1/d15f0a7bf4d794bd2b1b8976.png"},{"id":73051307,"identity":"c21869f3-8b85-4ae9-a673-d26b16c52f6b","added_by":"auto","created_at":"2025-01-06 09:25:01","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":180279,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic diagram of CRYAA regulation by HuD in neuro-retinal cells under hyperglycemic conditions.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-5756583/v1/e45029e8adf72c8577c620cb.png"},{"id":89310648,"identity":"03896c68-23b6-4a34-9495-6c31ede97949","added_by":"auto","created_at":"2025-08-18 16:09:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5367618,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5756583/v1/015c1e08-e77b-4420-8f4c-4f5d225e49ac.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"HuD and Alpha-crystallin A Axis Protects Neuro-Retinal Cells in Early Diabetes","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eDiabetic retinopathy (DR) is a common microvascular complication of diabetes mellitus and a significant cause of vision loss, particularly in middle-aged and older populations. The progression of DR is classified into various levels of severity, including mild, moderate, and severe non-proliferative DR (NPDR) and proliferative DR (PDR), based on the extent of vascular lesions [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Vascular abnormalities are the most apparent signs for diagnosing and treating DR; however, these phenotypes manifest in the later stages of the disease. An increasing number of studies have emphasized that neuronal cells in the retina are affected during early diabetes, leading to the degeneration of neuro-retinal cells, such as retinal ganglion cells (RGCs) [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Even patients with diabetes without DR exhibit neuro-retinal alterations, including ganglion cell-inner plexiform layer (GC-IPL) loss [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], thinning of the macular ganglion cell complex thickness [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], and changes in RGCs [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Although neuro-retinal degeneration is observed in patients with early diabetes without any signs of DR, the precise molecular mechanism yet remains to be elucidated.\u003c/p\u003e \u003cp\u003eHuD is an RNA-binding protein that regulates mRNA stability and translation by binding to AU-rich elements in target mRNAs [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In many cases, the role of HuD in neuronal function, maintenance, and development has been revealed because its predominant expression in neuronal cells [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. However, its role in insulin synthesis has also been reported [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], and successive functional studies for HuD have been prolonged in β cells, suggesting a pivotal role of HuD in β cells, such as autophagosome formation, lipid metabolism, cell cycle, and mitochondrial dynamics [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Although the retina is composed of diverse neuronal cells in ocular tissue, the expression and role of HuD have not yet been elucidated in detail and remain poorly studied.\u003c/p\u003e \u003cp\u003eCrystallins are water-soluble structural proteins found in lenses. Since their discovery in the lens, crystallins have been identified in various tissues, including the retina, heart, skeletal muscles, skin, brain, and others [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Crystallins are classified into three main types: alpha-, beta-, and gamma-crystallins. Alpha-crystallins possess chaperone-like properties, preventing the precipitation of denatured proteins and enhancing cellular tolerance to diverse cellular stresses [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSeveral studies have clarified the implications of crystallin expression in DR. The levels of αA-crystallin are significantly down-regulated in the retinal tissues of streptozotocin (STZ)-induced diabetic mice [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] and STZ-induced rats [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Fort \u003cem\u003eet al.\u003c/em\u003e demonstrated that the protein synthesis of \u003cem\u003ealpha-crystallin A\u003c/em\u003e (\u003cem\u003eCryaa\u003c/em\u003e) mRNA is down-regulated in the retina of diabetic rats using polysome fractionation assays [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. However, the molecular mechanism underlying CRYAA expression in diabetic retinal tissue has not yet been fully elucidated.\u003c/p\u003e \u003cp\u003eHere, we identified the presence of HuD expression in retinal ganglion cells. Both HuD and CRYAA were downregulated in diabetic retinal tissues and neuro-retinal cells. \u003cem\u003eCryaa\u003c/em\u003e mRNA was identified as a novel downstream target of HuD. Our results elucidate the molecular mechanism linking HuD and CRYAA under diabetic conditions and the potential role in ameliorating the degeneration of neuro-retinal cells.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture, treatment, and transfection of siRNAs and plasmids\u003c/h2\u003e \u003cp\u003eThe immortalized rat retinal precursor cell line, R-28 cells were grown in Dulbecco\u0026rsquo;s modified eagle\u0026rsquo;s medium (DMEM; Welgene, Gyeongsan-si, South Korea) and supplemented with 10% fetal bovine serum (FBS; HyClone, UT, USA) and 1% penicillin (Welgene) in a humidified atmosphere of 5% CO\u003csub\u003e2\u003c/sub\u003e at 37 \u0026ordm;C. Cells were treated with glucose solution (Sigma-Aldrich, St. Louis, MO, USA). The plasmids, pcDNA, myc-tagged HuD (pHuD), myc-tagged CRYAA (pCRYAA), and enhanced green fluorescent protein reporter (pEGFP), were transfected with Lipofectamine\u0026trade; 2000 (Invitrogen, Carlsbad, CA, USA). Small interfering RNAs [siRNAs; control siRNA (siCtrl), HuD siRNA (siHuD), and Cryaa siRNA (siCryaa); Genolution Pharmaceuticals, Seoul Korea] were transfected with Lipofectamine\u0026trade; RNAiMAX (Invitrogen). EGFP reporters were cloned by inserting 3\u0026prime;UTR (3U) fragments of \u003cem\u003eCryaa\u003c/em\u003e mRNA into pEGFP-C1 (BD Bioscience, Heidelberg, Germany).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAnimals\u003c/h3\u003e\n\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eFour-week-old male albino Wistar rats were used in this study. The rats were purchased from Orient Bio (Seongnam, Korea), and maintained in a plastic cage in a climate-controlled laboratory on a 12-h light/12-h dark cycle at 22\u0026deg;C, 34\u0026ndash;48% relative humidity. Food and water were available ad libitum. All procedure of animal research was provided in accordance with the Laboratory Animals Welfare Act, the Guide for the Care and Use of Laboratory Animals and the Guidelines and Policies for Rodent experiment provided by the IACUC (Institutional Animal Care and Use Committee) in school of medicine, The Catholic University of Korea (Approval number: CUMC-2021-0144-03). This study was carried out in compliance with the ARRIVE guideline. IACUC and Department of Laboratory Animal (DOLA) in Catholic University of Korea, Songeui Campus accredited the Korea Excellence Animal Laboratory Facility from Korea Food and Drug Administration in 2017 and reaccredited​ in 2021. And also acquired AAALAC International full accreditation in 2018 and reaccredited​ in 2022.\u003c/p\u003e\u003cp\u003eA diabetic rat model was induced through a single intraperitoneal injection of streptozotocin (STZ; Sigma-Aldrich; 60 mg/kg body weight) dissolved in 0.05 M HCl-sodium citrate buffer solution (pH 5.5). This injection was administered to the rats, defined as day one, after placing them in a gas chamber with 2% isoflurane in oxygen until unconsciousness. Subsequently, the rats were removed from the chamber and maintained under anesthesia with a mask (1.5% isoflurane in oxygen). Serum glucose levels were measured from the tail vein using an automated Accu-Check glucometer (Roche Diagnostics Ltd., Indianapolis, IN) three days post-diabetes induction. Confirmation of diabetes development occurred when serum glucose levels exceeded 250 mg/dL on day 3, at which point the rats were selected for further experiments. Body weight and serum glucose levels were subsequently recorded on a weekly basis post-diabetes induction.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eWestern blot analysis\u003c/h3\u003e\n\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eWhole-cell lysates were prepared using RIPA buffer [10 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 1 mM EDTA, and 0.1% SDS], separated by SDS-PAGE, and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Belfor, MA, USA). Incubation with primary antibodies to detect HuD (Santa Cruz Biotechnology, Dallas, TX, USA), CRYAA (Santa Cruz Biotechnology), EGFP (Santa Cruz Biotechnology), TNFα (Millipore), IL-1β (Abcam, Cambridge, MA, USA), IL-6 (Abcam) and β-actin (Abcam) was followed by incubation with the appropriate secondary antibodies conjugated with horseradish peroxidase (HRP) (Cell Signaling Technology, Beverly, MA, USA) and detection using the WestGlow\u0026trade; FEMTO ECL Chemiluminescent Substrate Kit (Biomax, Seoul, Korea)\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eRNA analysis and ribonucleoprotein (RNP) immunoprecipitation (RIP) analysis\u003c/h3\u003e\n\u003cp\u003eTotal RNA was prepared from whole cells using RNAiso\u0026trade; Plus (TaKaRa, Shiga, Japan). After reverse transcription (RT) using ReverTra Ace\u0026reg; qPCR RT Kit (Toyobo, Osaka, Japan), the transcripts were assessed by real-time quantitative (q)PCR analysis using SensiFAST\u0026trade; SYBR\u0026reg; No-ROX Mix (Bioline, MA, USA) and gene-specific primer sets (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). RT-qPCR was performed on CFX Connect\u0026trade; Real-Time System (Bio-Rad, CA, USA). RIP analysis was performed using the primary antibodies anti-HuD or control IgG (Santa Cruz Biotechnology) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In brief, RNP complexes were immunoprecipitated using anti-HuD or control IgG antibodies and incubated with DNase I and proteinase K; RNA in the IP samples was isolated and further analyzed by RT-qPCR using the primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers for EGFP-reporter\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eSequences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat Cryaa-3U-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e5'- AAAAAGATCTTAAGCAGGCCTCGCCTTGG \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat Cryaa-3U-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e5'- AAAAGGTACCGCTTGTCACCTGCTCT \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePrimers for PCR\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eSequences\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eProduct size\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eReferences (primer bank number)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat HuD-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- GCCTCAGGTGTCAAATGGACC \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e243 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eN.S.\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat HuD-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- CCATACCCTAAACTCTGTCCTGT \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat Cryaa-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- CCTGCTGCCCTTCCTGTCGT \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e210 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eN.S.\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat Cryaa -R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- TCCTGGCGCTCGTTGTGCT \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat IL-1β-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- CTCACAGCAGCATCTCGACAAGAG \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e95 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edoi.org/10.1155/2021/6657673\u003c/span\u003e\u003cspan address=\"10.1155/2021/6657673\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat IL-1β-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- TCCACGGGCAAGACATAGGTAGC \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat IL-6-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- TCCTACCCCAACTTCCAATGCTC \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e79 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eJ Hazard Master (2015) 287;392\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat IL-6-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- TTGGATGGTCTTGGTCCTTAGCC \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat Tnfα-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- CCAGGTTCTCTTCAAGGGACAA \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e80 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edoi.org/10.1155/2021/6657673\u003c/span\u003e\u003cspan address=\"10.1155/2021/6657673\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat Tnfα-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- GGTATGAAATGGCAAATCGGCT \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat Gapdh-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- TGCCACTCAGAAGACTGTGG \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e123 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eJ Neurosci (2010) 30;15007\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erat Gapdh-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5'- TTCAGCTCTGGGATGACCTT \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eImmunohistochemistry\u003c/h3\u003e\n\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eCryosections of the eyes were air-dried and washed twice with PBS. The slides were washed with 0.5% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e in MeOH for 30 min, and twice with PBS. The nonspecific binding activity of the sections was blocked using 2% bovine serum albumin (BSA) in PBS for 1 hr. The slides were subsequently incubated with the primary antibodies, anti-HuD and anti-CRYAA, diluted in 2% BSA overnight at 4\u0026deg;C. After washing three times for 5 min each with PBS, the slides were incubated with the secondary antibody conjugated with the enzyme diluted in PBS for 1 h at room temperature.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell viability assay\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eCell viability was measured by the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Invitrogen, Carlsbad, CA). R-28 cells were seeded into 96-well plates, and incubated for 24 h in a humidified atmosphere of 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C. MTT solution (5 mg/ml) was added to each well, and the cells were incubated for 2 h at 37\u0026deg;C. Afterward, the medium was removed, and MTT was solubilized by adding 100 \u0026micro;l of 0.04 N acid isopropanol and 100 \u0026micro;l of distilled water to each well. The plates were agitated for 10 min, after which the optical density of the solubilized crystals was measured at 570 nm using an automated microplate reader.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll the experiments were conducted at least three times, and all the samples were analyzed in triplicate. The results are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. The statistical significance was calculated by an unpaired Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test. A p-value less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eHuD expression in neuro-retinal cells\u003c/h2\u003e \u003cp\u003eThe roles of HuD have been revealed in neuronal function, maintenance, and development, owing to its predominant expression in neuronal cells [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Since the role of HuD in insulin synthesis has been reported [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], its function has also been studied in neuro-endocrinal β cells such as autophagy, lipid metabolism, cell cycle, and mitochondrial dynamics [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. However, the role of HuD in the retina has not been examined. To determine whether HuD functions in the retina, we first examined the presence of HuD expression in retinal tissues by immunostaining. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, HuD was predominantly expressed in ganglion cells and the inner nuclear layers of both rat and mouse retinal tissues. These findings suggest that, unlike its role in neural and neuroendocrine cells, HuD may have a distinct and important function in neuro-retinal cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eDown-regulations of HuD and CRYAA in the retina of STZ-induced diabetic rats\u003c/h2\u003e \u003cp\u003eIt is well-established that HuD expression is down-regulated in β-cells of diabetic mice (\u003cem\u003edb/db\u003c/em\u003e) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. These findings led us to hypothesize that HuD may also be regulated in retinal cells under diabetic conditions. To investigate this possibility, we examined HuD expression in the retinas of normal and STZ-induced diabetic rats (STZ-rat). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, HuD expression was significantly down-regulated in both the GCL and INL of the retina in STZ-rats compared to normal rats. Additionally, the \u003cem\u003eHuD\u003c/em\u003e mRNA level was also decreased in the retinal tissues of STZ-rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Interestingly, we observed parallel decreases in the protein and mRNA levels of CRYAA in the retinas of STZ-rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and D). These findings collectively implicate the down-regulation of HuD and CRYAA in the pathophysiology of diabetic retinal degeneration.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eDown-regulations of HuD and CRYAA in neuro-retinal cells by high glucose\u003c/h2\u003e \u003cp\u003eThe diminished levels of HuD and CRYAA in the retinas of diabetic rats strongly suggest that their expression may be influenced by glucose levels. To investigate this possibility, we exposed neuro-retinal R-28 cells to high glucose for 72 h and performed RT-qPCR and Western blotting analyses. As expected, both \u003cem\u003eHuD\u003c/em\u003e and \u003cem\u003eCryaa\u003c/em\u003e mRNA and protein expression levels were significantly down-regulated in neuro-retinal cells exposed to high glucose (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and B). Therefore, these results underscore the potential of HuD and CRYAA to regulate the crucial functions of neuro-retinal cells under hyperglycemic conditions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRegulation of\u003c/b\u003e \u003cb\u003eCryaa\u003c/b\u003e \u003cb\u003emRNA expression by HuD via its 3\u0026prime;-untranslated region binding\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNext, we tested whether HuD is an upstream regulator of CRYAA expression in neuro-retinal cells by transient silencing or overexpressing \u003cem\u003eHuD\u003c/em\u003e and then measuring \u003cem\u003eCryaa\u003c/em\u003e mRNA and protein levels using RT-qPCR and Western blotting analysis, respectively. \u003cem\u003eHuD\u003c/em\u003e silencing reduced both \u003cem\u003eCryaa\u003c/em\u003e mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and B), whereas \u003cem\u003eHuD\u003c/em\u003e overexpression induced this effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and D), suggesting that HuD regulates the stability and translation of \u003cem\u003eCryaa\u003c/em\u003e mRNA. To further elucidate the regulation of \u003cem\u003eCryaa\u003c/em\u003e mRNA by HuD, we performed RNP-IP using an anti-HuD antibody. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, the enriched \u003cem\u003eCryaa\u003c/em\u003e mRNA was assessed in the HuD-bound RNP complex. These results indicate that \u003cem\u003eCryaa\u003c/em\u003e mRNA has a binding site for HuD on its nucleic acid sequence. HuD is a turnover- and translation-regulatory RNA-binding protein that regulates the expression of target mRNAs by binding to their 3\u0026prime;UTR. To further determine whether HuD could directly regulate \u003cem\u003eCryaa\u003c/em\u003e mRNA, EGFP reporter constructs were generated by inserting the 3\u0026prime;UTR of \u003cem\u003eCryaa\u003c/em\u003e mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). EGFP reporter plasmids were transfected into neuro-retinal cells, with \u003cem\u003eHuD\u003c/em\u003e either silenced or overexpressed. Relative GFP expression was then analyzed via Western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). \u003cem\u003eHuD\u003c/em\u003e silencing specifically down-regulated GFP expression in cells transfected with pEGFP\u0026thinsp;+\u0026thinsp;\u003cem\u003eCryaa\u003c/em\u003e 3U, but not in those with control reporter (pEGFP). Conversely, \u003cem\u003eHuD\u003c/em\u003e overexpression up-regulated GFP expression in pEGFP\u0026thinsp;+\u0026thinsp;\u003cem\u003eCryaa\u003c/em\u003e 3U. These results collectively suggest that HuD binds to the 3\u0026prime;UTR of \u003cem\u003eCryaa\u003c/em\u003e mRNA to regulate its expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eInflammatory cytokine expression by HuD-CRYAA axis in neuro-retinal cells\u003c/h2\u003e \u003cp\u003eAbundant evidence indicates that inflammation contributes to the development of DR [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The levels of several inflammatory cytokines, such as TNF-α, IL-1β, and IL-6, are elevated in the vitreous, aqueous humor, and ocular tissues of diabetic patients with DR [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. We investigated whether diabetic conditions induce the expression of inflammatory cytokines in neuro-retinal cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, the expression of \u003cem\u003eTNF-α, IL-1β\u003c/em\u003e, and \u003cem\u003eIL-\u003c/em\u003e6 mRNAs was upregulated in R-28 cells under high glucose treatment. Moreover, the protein expressions levels of TNF-α and IL-1β increased, coinciding with the decreased levels of HuD and CRYAA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). We further investigated the involvement of HuD in the regulation of inflammatory cytokines in neuro-retinal cells. R-28 cells were transfected with siRNA targeting \u003cem\u003eHuD\u003c/em\u003e (siHuD) or overexpression plasmids for \u003cem\u003eHuD\u003c/em\u003e (pHuD) for 48 h, after which the relative levels of \u003cem\u003eTNF-α\u003c/em\u003e, \u003cem\u003eIL-1β\u003c/em\u003e, and \u003cem\u003eIL-6\u003c/em\u003e mRNAs were assessed by RT-qPCR. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE, \u003cem\u003eHuD\u003c/em\u003e silencing induced the expression of all inflammatory cytokines in neuro-retinal cells, whereas their levels were reduced by \u003cem\u003eHuD\u003c/em\u003e overexpression. Additionally, we examined whether CRYAA plays a role in the elevated expression of inflammatory cytokines in R-28 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD and F). As expected, \u003cem\u003eCryaa\u003c/em\u003e silencing significantly increased the levels of \u003cem\u003eTNF-α\u003c/em\u003e, \u003cem\u003eIL-1β\u003c/em\u003e, and \u003cem\u003eIL-6\u003c/em\u003e mRNAs in neuro-retinal cells, whereas \u003cem\u003eCryaa\u003c/em\u003e overexpression reduced their expressions. Furthermore, the levels of TNF-α and IL-1β proteins were concordant with mRNA expressions upon \u003cem\u003eHuD\u003c/em\u003e and \u003cem\u003eCryaa\u003c/em\u003e silencing and overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG and H). Collectively, these results suggest that the reduction in HuD and CRYAA levels under diabetic conditions contributes to elevated inflammatory cytokine levels during the development of DR.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAlleviative role of HuD and CRYAA in neuro-retinal cell viability.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eHyperglycemia induces oxidative stress, which affects various aspects of cell viability. To assess the influence of HuD and CRYAA on neuro-retinal cell viability, R-28 cells were transfected with siHuD or siCryaa and then exposed to high glucose for 72 h, followed by MTT analysis. Although \u003cem\u003eHuD\u003c/em\u003e and \u003cem\u003eCryaa\u003c/em\u003e silencing had no effect on cells under normal glucose conditions, the reduction in R-28 cell viability was exacerbated by \u003cem\u003eHuD\u003c/em\u003e and \u003cem\u003eCryaa\u003c/em\u003e silencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA and C) under high glucose. To elucidate the role of HuD and CRYAA in mitigating the decrease in cell viability caused by high glucose levels, cell viability assays were conducted by transfecting R-28 cells with overexpression plasmids for \u003cem\u003eHuD\u003c/em\u003e (pHuD) or \u003cem\u003eCryaa\u003c/em\u003e (pCRYAA). Intriguingly, overexpression of \u003cem\u003eHuD\u003c/em\u003e and \u003cem\u003eCryaa\u003c/em\u003e alleviated the decrease in neuro-retinal cell viability induced by high glucose (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB and D). Taken together, these results strongly suggest that the regulation of the HuD-CRYAA axis plays a crucial role in the survival and function of neuro-retinal cells during the development of DR.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eAlthough microvascular complications are a major consideration in DR, neuro-retinal degeneration is recognized as the leading cause of vision loss. Several studies have reported that neuro-retinal damage with structural changes is priorly observed in the retina of patients with diabetes without any signs of DR. Barber \u003cem\u003eet al.\u003c/em\u003e demonstrated a decrease in the GC-IPL [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], and Carpineto \u003cem\u003eet al.\u003c/em\u003e showed a significant reduction in the GC-IPL and retinal nerve fiber layer thickness in type 2 diabetes patients with no DR or mild NPDR [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Although these reports suggest that ganglion cells are the primary cells influenced by neuro-retinal degeneration developed at the early stage of DM before DR diagnosis, the precise molecular mechanism leading to the decrease in ganglion cells has not yet been fully understood. In this study, we demonstrated that an RNA binding protein, HuD is expressed in neuro-retinal cells, specifically in ganglion cells, and plays a novel role in neuro-retinal degeneration via post-transcriptional regulation of \u003cem\u003eCryaa\u003c/em\u003e mRNA. Additionally, we observed a significant decrease in both HuD and CRYAA levels in the GCL of STZ-induced diabetic rats. Deficiencies in these proteins were implicated in the reduced viability of neuro-retinal cells under hyperglycemic conditions. These results suggest that both HuD and CRYAA have potential roles in the pathological processes of neuro-retinal degeneration during the early stage of diabetes.\u003c/p\u003e \u003cp\u003eCrystallins were first identified as major structural components of the lens [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Additionally, alpha-crystallins has also been found in the retina, cornea, optic nerve, astrocytes, and M\u0026uuml;ller cells in ocular tissue [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Alpha-crystallins possess a chaperone-like function, preventing apoptosis by avoiding aberrant protein interaction and degradation [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Several studies have reported a reduction in alpha-crystallin levels in various retinal degenerations, leading to reduced survival of retinal ganglion cells [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Although the up-regulation of CRYAA has been observed in the eyes of humans with diabetes [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], STZ-induced diabetic rats [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], high fat/STZ-induced diabetic rats [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], and Ins2\u003csup\u003e\u003cem\u003eAkita\u003c/em\u003e\u003c/sup\u003e diabetic mice [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], several studies have also reported diminished levels of CRYAA in diabetic retinas. Kim \u003cem\u003eet al.\u003c/em\u003e determined that the levels of \u003cem\u003eCryaa\u003c/em\u003e mRNA and protein were significantly reduced in the retina of STZ-induced diabetic mice [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Moreover, down-regulated transcriptional level and translational efficiency of \u003cem\u003eCryaa\u003c/em\u003e mRNA have also been demonstrated in the retinas of STZ-induced diabetic rat models [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. In the present study, we observed decreased levels of CRYAA in the retinal GCL of STZ-induced diabetic rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Furthermore, CRYAA knock-down promoted a reduction in neuro-retinal cell viability under high glucose treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). These findings strongly suggest that decreased levels of CRYAA are closely associated with the viability of neuro-retinal cells under hyperglycemic conditions, indicating the potential of CRYAA as a specific indicator for diagnosing neuro-retinal degeneration in the early stage of diabetes.\u003c/p\u003e \u003cp\u003eAlpha-crystallins prevent apoptosis induced by several factors, such as etoposide, staurosporine, and sorbitol [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], UV [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], TNFα [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], hydrogen peroxide [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], and okadaic acid [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. They inhibit apoptosis by directly interacting with caspase-3, Bcl-x(s) and Bax [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], upregulating PI3 kinase activity [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], as well as regulating PKCα, RAF/MEK, ERK, and AKT signaling [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The reduced chaperone function of alpha-crystallin due to mutation has been shown to result in a loss of its protective ability against apoptosis [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Moreover, the absence of alpha-crystallin has been demonstrated to enhance retinal degeneration in chemically induced hypoxia [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] and in sodium iodate-induced AMD models [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Conversely, alpha-crystallin has been shown to improve the viability of retinal ganglion cells [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] and optic nerve axons after optic nerve crush [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Additionally, intravitreal injection of CRYAA via an adenovirus ameliorated apoptotic cell death and vascular leakage in the diabetic retina [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In this study, we further demonstrated that overexpression of CRYAA alleviated the viability of neuro-retinal cells under high glucose conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD), indicating that restoring CRYAA expression under hyperglycemic conditions might be an effective therapeutic strategy for preventing neuro-retinal cell degeneration at the early stage of diabetes.\u003c/p\u003e \u003cp\u003eThe protective function of CRYAA is regulated by various regulatory factors. The expression of crystallins is controlled by several transcription factors including Pax-6, Maf, Sox, neural retina leucine zipper (NLR), retinoic acid receptors (RARs), Prox1, Six3, γFBP-B, HSF2, HSF4, CREB, and AP-1 [\u003cspan additionalcitationids=\"CR43 CR44 CR45\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Additionally, alpha-crystallins are regulated by phosphorylation via cyclic adenosine monophosphate (cAMP) and dephosphorylation [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. It has also been reported that the chaperone activity of alpha-crystallin is regulated by glycation and acetylation [\u003cspan additionalcitationids=\"CR50\" citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. That is, understanding the detailed regulatory mechanism for CRYAA expression and its chaperone activity is necessary to establish therapeutic strategies targeting the degeneration of neuro-retinal cells. In this study, we verified that HuD is a crucial upstream regulator of \u003cem\u003eCryaa\u003c/em\u003e mRNA. Using RNP-IP and EGFP-reporter analyses, we demonstrated that the expression CRYAA is controlled by binding between HuD and the 3\u0026prime;UTR of \u003cem\u003eCryaa\u003c/em\u003e mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). HuD silencing decreased the levels of \u003cem\u003eCryaa\u003c/em\u003e mRNA and protein, whereas HuD overexpression significantly increased these levels in neuro-retinal R-28 cells. Although our results suggest that HuD is a positive post-transcriptional regulator for \u003cem\u003eCryaa\u003c/em\u003e mRNA, whether HuD regulates the stability, translational efficiency, or both of \u003cem\u003eCryaa\u003c/em\u003e mRNA needs to be further elucidated.\u003c/p\u003e \u003cp\u003eHuD is an RNA binding protein predominantly expressed in neuronal cells. Increasing evidence suggests that HuD plays crucial roles in several types of endocrine and cancer cells [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Although some studies have reported the direct or indirect regulation of HuD during neuronal and endocrine disease development, the molecular mechanisms controlling \u003cem\u003eHuD\u003c/em\u003e gene expression have not yet been fully examined. Three molecular pathways regulating the function and abundance of HuD have been elucidated: protein kinase C (PKC) [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], coactivator associated arginine methytransferase 1 (CARM1) [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e], and protein kinase B (PKB/AKT) [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Other studies have determined the transcriptional and post-transcriptional control of \u003cem\u003eHuD\u003c/em\u003e gene expression. The expression of \u003cem\u003eHuD\u003c/em\u003e mRNA is upregulated during neuronal differentiation by thyroid hormone (T3) [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e], and Ngn2 has been identified as a transcription factor responsible for increasing \u003cem\u003eHuD\u003c/em\u003e mRNA expression [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Forkhead box O1 (Foxo1) negatively affects the transcription of \u003cem\u003eHuD\u003c/em\u003e in pancreatic β cells under low glucose conditions [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], and miR-375 also negatively controls both the stability and translation of \u003cem\u003eHuD\u003c/em\u003e mRNA [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Special adenine\u0026ndash;thymine (AT)-rich DNA-binding protein 1 (SATB1) was recently identified as an activator of the \u003cem\u003eHuD\u003c/em\u003e promoter during neuronal differentiation [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Here in, we revealed the presence of HuD expression in neuro-retinal ganglion cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Furthermore, HuD expression was found to be regulated under hyperglycemic conditions, including in the retinas of STZ-induced diabetic rats and neuro-retinal cells under high glucose treatment. While these findings suggest that HuD may be an essential factor for maintaining the homeostasis of neuro-retinal cells, further elucidation of the molecular regulatory mechanism of HuD expression is needed to protect neuro-retinal cells from hyperglycemia-induced degeneration.\u003c/p\u003e \u003cp\u003eInflammation is a significant feature in DR pathogenesis observed in both animal models and patients with diabetes. Elevated glucose levels lead to metabolic dysfunction, oxidative stress, and the production of reactive oxygen species, resulting in inflammatory responses. Several studies have demonstrated increased levels of pro-inflammatory cytokines, including TNFα, IL-1β, and IL-6, in the serum, vitreous and aqueous humor, as well as in the retinal tissues of patients with DR [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. Up-regulated pro-inflammatory cytokines promote inflammatory responses through various pathways, leading to neuro-retinal degeneration such as cell apoptosis. In this study, we demonstrated increased levels of TNFα, IL-1β, and IL-6 in neuro-retinal cells under high glucose treatment and found that their levels were negatively regulated by both HuD and CRYAA expression. These results suggest that HuD and CRYAA have the potential to inhibit inflammatory responses, thereby alleviating cell death. However, further studies are needed to determine whether \u003cem\u003eTNFα\u003c/em\u003e, \u003cem\u003eIL-1β\u003c/em\u003e, and \u003cem\u003eIL-6\u003c/em\u003e mRNAs are molecular targets of HuD and how their expression is regulated by CRYAA to prevent neuro-retinal inflammatory responses in DR.\u003c/p\u003e \u003cp\u003eIn summary, we propose a novel molecular mechanism and role of the HuD/CRYAA axis in neuro-retinal degeneration during the early stages of diabetes. Our results indicated that HuD expression is down-regulated in neuro-retinal cells under hyperglycemic conditions, leading to a decrease in CRYAA expression through post-transcriptional regulation. Downregulation of HuD and CRYAA is highly implicated in cellular inflammation, affecting neuro-retinal cell death under hyperglycemic conditions. Restoration of HuD and CRYAA expression is beneficial for improving neuro-retinal cell survival and overcoming neuro-retinal degeneration in DR.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCRYAA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;alpha-crystallin A\u003c/p\u003e\n\u003cp\u003eDR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;diabetic retinopathy\u003c/p\u003e\n\u003cp\u003eEGFP \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;enhanced green fluorescence protein\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGCL \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;ganglion cell layer\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGC-IPL \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;ganglion cell-inner plexiform layer\u003c/p\u003e\n\u003cp\u003eHuD \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Hu-antigen D\u003c/p\u003e\n\u003cp\u003eINL \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;inner nuclear layer\u003c/p\u003e\n\u003cp\u003eNPDR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;non-proliferative diabetic retinopathy\u003c/p\u003e\n\u003cp\u003ePDR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;proliferative diabetic retinopathy\u003c/p\u003e\n\u003cp\u003eRGC \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;retinal ganglion cell\u003c/p\u003e\n\u003cp\u003eRNP \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;ribonucleoprotein complex\u003c/p\u003e\n\u003cp\u003eSTZ \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;streptozotocin\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFUNDING\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Basic Science Research Programs through the National Research Foundation of Korea (NRF) grants funded by the Korean government (MSIT) (2019R1I1A1A01059394, 2022R1I1A1A01055331).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eC.K., S.O., and Y.H.P. performed study concept and design; C.K. performed experiments, analysis and interpretation of data, and statistical analysis; S.O. provided technical support; C.K. wrote original draft and revised and edited the manuscript. Y.H.P. reviewed the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICT OF INTEREST\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONSENT FOR PUBLICATION\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICS APPROVAL AND CONSENT TO PARTICIPATE\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the IACUC (Institutional Animal Care and Use Committee) in school of medicine, The Catholic University of Korea (Approval number: CUMC-2021-0144-03).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDATA AVAILABILTY\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbcouwer SF and Gardner TW (2014) Diabetic retinopathy: loss of neuroretinal adaptation to the diabetic metabolic environment. Ann N Y Acad Sci 1311:174-90. doi: 10.1111/nyas.12412\u003c/li\u003e\n\u003cli\u003eFudalej E, Justyniarska M, Kasarełło K, Dziedziak J, Szaflik JP and Cudnoch-Jędrzejewska A (2021) Neuroprotective Factors of the Retina and Their Role in Promoting Survival of Retinal Ganglion Cells: A Review. Ophthalmic Res 64:345-355. doi: 10.1159/000514441\u003c/li\u003e\n\u003cli\u003eLim HB, Shin YI, Lee MW, Koo H, Lee WH and Kim JY (2020) Ganglion Cell - Inner Plexiform Layer Damage in Diabetic Patients: 3-Year Prospective, Longitudinal, Observational Study. Sci Rep 10:1470. doi: 10.1038/s41598-020-58465-x\u003c/li\u003e\n\u003cli\u003eJia X, Zhong Z, Bao T, Wang S, Jiang T, Zhang Y, Li Q and Zhu X (2020) Evaluation of Early Retinal Nerve Injury in Type 2 Diabetes Patients Without Diabetic Retinopathy. Front Endocrinol (Lausanne) 11:475672. doi: 10.3389/fendo.2020.475672\u003c/li\u003e\n\u003cli\u003eGundogan FC, Akay F, Uzun S, Yolcu U, \u0026Ccedil;ağıltay E and Toyran S (2016) Early Neurodegeneration of the Inner Retinal Layers in Type 1 Diabetes Mellitus. Ophthalmologica 235:125-32. doi: 10.1159/000442826\u003c/li\u003e\n\u003cli\u003ePollreisz A, Desissaire S, Sedova A, Hajdu D, Datlinger F, Schwarzhans F, Steiner S, Steiner I, Vass C, Hitzenberger CK, Pircher M and Schmidt-Erfurth U (2021) Early Identification of Retinal Neuropathy in Subclinical Diabetic Eyes by Reduced Birefringence of the Peripapillary Retinal Nerve Fiber Layer. Invest Ophthalmol Vis Sci 62:24. doi: 10.1167/iovs.62.4.24\u003c/li\u003e\n\u003cli\u003eNg DS, Chiang PP, Tan G, Cheung CG, Cheng CY, Cheung CY, Wong TY, Lamoureux EL and Ikram MK (2016) Retinal ganglion cell neuronal damage in diabetes and diabetic retinopathy. Clin Exp Ophthalmol 44:243-50. doi: 10.1111/ceo.12724\u003c/li\u003e\n\u003cli\u003eGood PJ (1995) A conserved family of elav-like genes in vertebrates. Proc Natl Acad Sci U S A 92:4557-61. doi: 10.1073/pnas.92.10.4557\u003c/li\u003e\n\u003cli\u003eDesch\u0026ecirc;nes-Furry J, Perrone-Bizzozero N and Jasmin BJ (2006) The RNA-binding protein HuD: a regulator of neuronal differentiation, maintenance and plasticity. Bioessays 28:822-33. doi: 10.1002/bies.20449\u003c/li\u003e\n\u003cli\u003eBronicki LM and Jasmin BJ (2013) Emerging complexity of the HuD/ELAVl4 gene; implications for neuronal development, function, and dysfunction. Rna 19:1019-37. doi: 10.1261/rna.039164.113\u003c/li\u003e\n\u003cli\u003eLee EK, Kim W, Tominaga K, Martindale JL, Yang X, Subaran SS, Carlson OD, Mercken EM, Kulkarni RN, Akamatsu W, Okano H, Perrone-Bizzozero NI, de Cabo R, Egan JM and Gorospe M (2012) RNA-binding protein HuD controls insulin translation. Mol Cell 45:826-35. doi: 10.1016/j.molcel.2012.01.016\u003c/li\u003e\n\u003cli\u003eJung M and Lee EK (2021) RNA-Binding Protein HuD as a Versatile Factor in Neuronal and Non-Neuronal Systems. Biology (Basel) 10. doi: 10.3390/biology10050361\u003c/li\u003e\n\u003cli\u003eAndley UP (2007) Crystallins in the eye: Function and pathology. Prog Retin Eye Res 26:78-98. doi: 10.1016/j.preteyeres.2006.10.003\u003c/li\u003e\n\u003cli\u003eAugusteyn RC (2004) alpha-crystallin: a review of its structure and function. Clin Exp Optom 87:356-66. doi: 10.1111/j.1444-0938.2004.tb03095.x\u003c/li\u003e\n\u003cli\u003eKim YH, Park SY, Park J, Kim YS, Hwang EM, Park JY, Roh GS, Kim HJ, Kang SS, Cho GJ and Choi WS (2012) Reduction of experimental diabetic vascular leakage and pericyte apoptosis in mice by delivery of \u0026alpha;A-crystallin with a recombinant adenovirus. Diabetologia 55:2835-2844. doi: 10.1007/s00125-012-2625-y\u003c/li\u003e\n\u003cli\u003eLiu YJ, Lian ZY, Liu G, Zhou HY and Yang HJ (2016) RNA sequencing reveals retinal transcriptome changes in STZ-induced diabetic rats. Mol Med Rep 13:2101-9. doi: 10.3892/mmr.2016.4793\u003c/li\u003e\n\u003cli\u003eFort PE, Losiewicz MK, Pennathur S, Jefferson LS, Kimball SR, Abcouwer SF and Gardner TW (2014) mTORC1-independent reduction of retinal protein synthesis in type 1 diabetes. Diabetes 63:3077-90. doi: 10.2337/db14-0235\u003c/li\u003e\n\u003cli\u003eKim C, Lee H, Kang H, Shin JJ, Tak H, Kim W, Gorospe M and Lee EK (2016) RNA-binding protein HuD reduces triglyceride production in pancreatic \u0026beta; cells by enhancing the expression of insulin-induced gene 1. Biochim Biophys Acta 1859:675-85. doi: 10.1016/j.bbagrm.2016.02.017\u003c/li\u003e\n\u003cli\u003eKern TS (2007) Contributions of inflammatory processes to the development of the early stages of diabetic retinopathy. Exp Diabetes Res 2007:95103. doi: 10.1155/2007/95103\u003c/li\u003e\n\u003cli\u003eWu H, Hwang DK, Song X and Tao Y (2017) Association between Aqueous Cytokines and Diabetic Retinopathy Stage. J Ophthalmol 2017:9402198. doi: 10.1155/2017/9402198\u003c/li\u003e\n\u003cli\u003eBarber AJ, Lieth E, Khin SA, Antonetti DA, Buchanan AG and Gardner TW (1998) Neural apoptosis in the retina during experimental and human diabetes. Early onset and effect of insulin. J Clin Invest 102:783-91. doi: 10.1172/jci2425\u003c/li\u003e\n\u003cli\u003eCarpineto P, Toto L, Aloia R, Ciciarelli V, Borrelli E, Vitacolonna E, Di Nicola M, Di Antonio L and Mastropasqua R (2016) Neuroretinal alterations in the early stages of diabetic retinopathy in patients with type 2 diabetes mellitus. Eye (Lond) 30:673-9. doi: 10.1038/eye.2016.13\u003c/li\u003e\n\u003cli\u003eBhat SP and Nagineni CN (1989) alpha B subunit of lens-specific protein alpha-crystallin is present in other ocular and non-ocular tissues. Biochem Biophys Res Commun 158:319-25. doi: 10.1016/s0006-291x(89)80215-3\u003c/li\u003e\n\u003cli\u003eSrinivasan AN, Nagineni CN and Bhat SP (1992) alpha A-crystallin is expressed in non-ocular tissues. J Biol Chem 267:23337-41. \u003c/li\u003e\n\u003cli\u003ePasupuleti N, Matsuyama S, Voss O, Doseff AI, Song K, Danielpour D and Nagaraj RH (2010) The anti-apoptotic function of human \u0026alpha;A-crystallin is directly related to its chaperone activity. Cell Death Dis 1:e31. doi: 10.1038/cddis.2010.3\u003c/li\u003e\n\u003cli\u003ePiri N, Kwong JM and Caprioli J (2013) Crystallins in retinal ganglion cell survival and regeneration. Mol Neurobiol 48:819-28. doi: 10.1007/s12035-013-8470-2\u003c/li\u003e\n\u003cli\u003eKase S, Ishida S and Rao NA (2011) Increased expression of \u0026alpha;A-crystallin in human diabetic eye. Int J Mol Med 28:505-11. doi: 10.3892/ijmm.2011.708\u003c/li\u003e\n\u003cli\u003eKumar PA, Haseeb A, Suryanarayana P, Ehtesham NZ and Reddy GB (2005) Elevated expression of alphaA- and alphaB-crystallins in streptozotocin-induced diabetic rat. Arch Biochem Biophys 444:77-83. doi: 10.1016/j.abb.2005.09.021\u003c/li\u003e\n\u003cli\u003eWang YD, Wu JD, Jiang ZL, Wang YB, Wang XH, Liu C and Tong MQ (2007) Comparative proteome analysis of neural retinas from type 2 diabetic rats by two-dimensional electrophoresis. Curr Eye Res 32:891-901. doi: 10.1080/02713680701593702\u003c/li\u003e\n\u003cli\u003eLosiewicz MK and Fort PE (2011) Diabetes impairs the neuroprotective properties of retinal alpha-crystallins. Invest Ophthalmol Vis Sci 52:5034-42. doi: 10.1167/iovs.10-6931\u003c/li\u003e\n\u003cli\u003eMao YW, Liu JP, Xiang H and Li DW (2004) Human alphaA- and alphaB-crystallins bind to Bax and Bcl-X(S) to sequester their translocation during staurosporine-induced apoptosis. Cell Death Differ 11:512-26. doi: 10.1038/sj.cdd.4401384\u003c/li\u003e\n\u003cli\u003eLiu JP, Schlosser R, Ma WY, Dong Z, Feng H, Lui L, Huang XQ, Liu Y and Li DW (2004) Human alphaA- and alphaB-crystallins prevent UVA-induced apoptosis through regulation of PKCalpha, RAF/MEK/ERK and AKT signaling pathways. Exp Eye Res 79:393-403. \u003c/li\u003e\n\u003cli\u003eAndley UP, Song Z, Wawrousek EF, Fleming TP and Bassnett S (2000) Differential protective activity of alpha A- and alphaB-crystallin in lens epithelial cells. J Biol Chem 275:36823-31. doi: 10.1074/jbc.M004233200\u003c/li\u003e\n\u003cli\u003eMao YW, Xiang H, Wang J, Korsmeyer S, Reddan J and Li DW (2001) Human bcl-2 gene attenuates the ability of rabbit lens epithelial cells against H2O2-induced apoptosis through down-regulation of the alpha B-crystallin gene. J Biol Chem 276:43435-45. doi: 10.1074/jbc.M102195200\u003c/li\u003e\n\u003cli\u003eLi DW, Xiang H, Mao YW, Wang J, Fass U, Zhang XY and Xu C (2001) Caspase-3 is actively involved in okadaic acid-induced lens epithelial cell apoptosis. Exp Cell Res 266:279-91. doi: 10.1006/excr.2001.5223\u003c/li\u003e\n\u003cli\u003eHu WF, Gong L, Cao Z, Ma H, Ji W, Deng M, Liu M, Hu XH, Chen P, Yan Q, Chen HG, Liu J, Sun S, Zhang L, Liu JP, Wawrousek E and Li DW (2012) \u0026alpha;A- and \u0026alpha;B-crystallins interact with caspase-3 and Bax to guard mouse lens development. Curr Mol Med 12:177-87. doi: 10.2174/156652412798889036\u003c/li\u003e\n\u003cli\u003eAndley UP, Patel HC and Xi JH (2002) The R116C mutation in alpha A-crystallin diminishes its protective ability against stress-induced lens epithelial cell apoptosis. J Biol Chem 277:10178-86. doi: 10.1074/jbc.M109211200\u003c/li\u003e\n\u003cli\u003eYaung J, Kannan R, Wawrousek EF, Spee C, Sreekumar PG and Hinton DR (2008) Exacerbation of retinal degeneration in the absence of alpha crystallins in an in vivo model of chemically induced hypoxia. Exp Eye Res 86:355-65. doi: 10.1016/j.exer.2007.11.007\u003c/li\u003e\n\u003cli\u003eZhou P, Kannan R, Spee C, Sreekumar PG, Dou G and Hinton DR (2014) Protection of retina by \u0026alpha;B crystallin in sodium iodate induced retinal degeneration. PLoS One 9:e98275. doi: 10.1371/journal.pone.0098275\u003c/li\u003e\n\u003cli\u003eWu N, Yu J, Chen S, Xu J, Ying X, Ye M, Li Y and Wang Y (2014) \u0026alpha;-Crystallin protects RGC survival and inhibits microglial activation after optic nerve crush. Life Sci 94:17-23. doi: 10.1016/j.lfs.2013.10.034\u003c/li\u003e\n\u003cli\u003eYing X, Zhang J, Wang Y, Wu N, Wang Y and Yew DT (2008) Alpha-crystallin protected axons from optic nerve degeneration after crushing in rats. J Mol Neurosci 35:253-8. doi: 10.1007/s12031-007-9010-1\u003c/li\u003e\n\u003cli\u003eCvekl A, Yang Y, Chauhan BK and Cveklova K (2004) Regulation of gene expression by Pax6 in ocular cells: a case of tissue-preferred expression of crystallins in lens. Int J Dev Biol 48:829-44. doi: 10.1387/ijdb.041866ac\u003c/li\u003e\n\u003cli\u003eCui W, Tomarev SI, Piatigorsky J, Chepelinsky AB and Duncan MK (2004) Mafs, Prox1, and Pax6 can regulate chicken betaB1-crystallin gene expression. J Biol Chem 279:11088-95. doi: 10.1074/jbc.M312414200\u003c/li\u003e\n\u003cli\u003eSomasundaram T and Bhat SP (2004) Developmentally dictated expression of heat shock factors: exclusive expression of HSF4 in the postnatal lens and its specific interaction with alphaB-crystallin heat shock promoter. J Biol Chem 279:44497-503. doi: 10.1074/jbc.M405813200\u003c/li\u003e\n\u003cli\u003eCvekl A, Sax CM, Bresnick EH and Piatigorsky J (1994) A complex array of positive and negative elements regulates the chicken alpha A-crystallin gene: involvement of Pax-6, USF, CREB and/or CREM, and AP-1 proteins. Mol Cell Biol 14:7363-76. doi: 10.1128/mcb.14.11.7363-7376.1994\u003c/li\u003e\n\u003cli\u003eCvekl A and Piatigorsky J (1996) Lens development and crystallin gene expression: many roles for Pax-6. Bioessays 18:621-30. doi: 10.1002/bies.950180805\u003c/li\u003e\n\u003cli\u003eSpector A, Chiesa R, Sredy J and Garner W (1985) cAMP-dependent phosphorylation of bovine lens alpha-crystallin. Proc Natl Acad Sci U S A 82:4712-6. doi: 10.1073/pnas.82.14.4712\u003c/li\u003e\n\u003cli\u003eVoorter CE, Mulders JW, Bloemendal H and de Jong WW (1986) Some aspects of the phosphorylation of alpha-crystallin A. Eur J Biochem 160:203-10. doi: 10.1111/j.1432-1033.1986.tb09958.x\u003c/li\u003e\n\u003cli\u003eDatta P, Kallur L and Abraham EC (2008) Reversal of chaperone activity loss of glycated alphaA-crystallin by a crosslink breaker. Mol Cell Biochem 315:137-42. doi: 10.1007/s11010-008-9797-2\u003c/li\u003e\n\u003cli\u003eNagaraj RH, Nahomi RB, Shanthakumar S, Linetsky M, Padmanabha S, Pasupuleti N, Wang B, Santhoshkumar P, Panda AK and Biswas A (2012) Acetylation of \u0026alpha;A-crystallin in the human lens: effects on structure and chaperone function. Biochim Biophys Acta 1822:120-9. doi: 10.1016/j.bbadis.2011.11.011\u003c/li\u003e\n\u003cli\u003eNahomi RB, Huang R, Nandi SK, Wang B, Padmanabha S, Santhoshkumar P, Filipek S, Biswas A and Nagaraj RH (2013) Acetylation of lysine 92 improves the chaperone and anti-apoptotic activities of human \u0026alpha;B-crystallin. Biochemistry 52:8126-38. doi: 10.1021/bi400638s\u003c/li\u003e\n\u003cli\u003ePascale A, Amadio M, Scapagnini G, Lanni C, Racchi M, Provenzani A, Govoni S, Alkon DL and Quattrone A (2005) Neuronal ELAV proteins enhance mRNA stability by a PKCalpha-dependent pathway. Proc Natl Acad Sci U S A 102:12065-70. doi: 10.1073/pnas.0504702102\u003c/li\u003e\n\u003cli\u003eLim CS and Alkon DL (2012) Protein kinase C stimulates HuD-mediated mRNA stability and protein expression of neurotrophic factors and enhances dendritic maturation of hippocampal neurons in culture. Hippocampus 22:2303-19. doi: 10.1002/hipo.22048\u003c/li\u003e\n\u003cli\u003eFujiwara T, Mori Y, Chu DL, Koyama Y, Miyata S, Tanaka H, Yachi K, Kubo T, Yoshikawa H and Tohyama M (2006) CARM1 regulates proliferation of PC12 cells by methylating HuD. Mol Cell Biol 26:2273-85. doi: 10.1128/mcb.26.6.2273-2285.2006\u003c/li\u003e\n\u003cli\u003eFujiwara T, Fukao A, Sasano Y, Matsuzaki H, Kikkawa U, Imataka H, Inoue K, Endo S, Sonenberg N, Thoma C and Sakamoto H (2012) Functional and direct interaction between the RNA binding protein HuD and active Akt1. Nucleic Acids Res 40:1944-53. doi: 10.1093/nar/gkr979\u003c/li\u003e\n\u003cli\u003eCuadrado A, Navarro-Yubero C, Furneaux H and Mu\u0026ntilde;oz A (2003) Neuronal HuD gene encoding a mRNA stability regulator is transcriptionally repressed by thyroid hormone. J Neurochem 86:763-73. doi: 10.1046/j.1471-4159.2003.01877.x\u003c/li\u003e\n\u003cli\u003eBronicki LM, B\u0026eacute;langer G and Jasmin BJ (2012) Characterization of multiple exon 1 variants in mammalian HuD mRNA and neuron-specific transcriptional control via neurogenin 2. J Neurosci 32:11164-75. doi: 10.1523/jneurosci.2247-12.2012\u003c/li\u003e\n\u003cli\u003eAbdelmohsen K, Hutchison ER, Lee EK, Kuwano Y, Kim MM, Masuda K, Srikantan S, Subaran SS, Marasa BS, Mattson MP and Gorospe M (2010) miR-375 inhibits differentiation of neurites by lowering HuD levels. Mol Cell Biol 30:4197-210. doi: 10.1128/mcb.00316-10\u003c/li\u003e\n\u003cli\u003eWang F, Tidei JJ, Polich ED, Gao Y, Zhao H, Perrone-Bizzozero NI, Guo W and Zhao X (2015) Positive feedback between RNA-binding protein HuD and transcription factor SATB1 promotes neurogenesis. Proc Natl Acad Sci U S A 112:E4995-5004. doi: 10.1073/pnas.1513780112\u003c/li\u003e\n\u003cli\u003eKa\u0026scaron;telan S, Ore\u0026scaron;ković I, Bi\u0026scaron;ćan F, Ka\u0026scaron;telan H and Gverović Antunica A (2020) Inflammatory and angiogenic biomarkers in diabetic retinopathy. Biochem Med (Zagreb) 30:030502. doi: 10.11613/bm.2020.030502\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-and-cellular-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcbi","sideBox":"Learn more about [Molecular and Cellular Biochemistry](https://www.springer.com/journal/11010)","snPcode":"11010","submissionUrl":"https://submission.nature.com/new-submission/11010/3","title":"Molecular and Cellular Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"HuD, CRYAA, retina, diabetic retinopathy, ganglion cells","lastPublishedDoi":"10.21203/rs.3.rs-5756583/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5756583/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDiabetic retinopathy (DR) is a prevalent microvascular complication of diabetes; however, neuro-retinal degeneration is also observed in patients with diabetes without signs of DR. The mechanisms leading to neuro-retinal cell loss before vascular complications manifest in diabetes remain poorly understood. In this study, we investigated the neuronal RNA-binding protein HuD as a novel regulator of neuro-retinal degeneration in the early stage of diabetes. We determined the expression of HuD and alpha-crystallin A (CRYAA) in the retinal ganglion cell layer. HuD and CRYAA were down-regulated in the retinas of streptozotocin-induced diabetic rats and in neuro-retinal cells (R-28) treated with high glucose. \u003cem\u003eCryaa\u003c/em\u003e mRNA was identified as a novel target transcript of HuD, and we demonstrated that HuD post-transcriptionally regulates the expression of \u003cem\u003eCryaa\u003c/em\u003e mRNA by binding to its 3\u0026prime;-untranslated region. Silencing and overexpression of HuD positively regulated the expressions of \u003cem\u003eCryaa\u003c/em\u003e mRNA and protein. We demonstrated that the increase in inflammatory cytokines such as TNFα, IL-1β, and IL-6 in R-28 cells under hyperglycemic conditions was a result of both CRYAA and HuD levels. Silencing HuD and CRYAA enhanced high glucose-induced R-28 cell death, whereas their overexpression alleviated this effect. HuD post-transcriptionally regulates CRYAA expression, influencing the function and viability of neuro-retinal cells under diabetic conditions. Our results suggest that the HuD/CRYAA axis plays a crucial role in neuro-retinal cells and has the potential to serve as a prognostic factor and therapeutic target for diabetic neuro-retinal degeneration.\u003c/p\u003e","manuscriptTitle":"HuD and Alpha-crystallin A Axis Protects Neuro-Retinal Cells in Early Diabetes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-06 09:24:49","doi":"10.21203/rs.3.rs-5756583/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-01-30T04:24:48+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-01-29T00:32:53+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-01-03T14:56:26+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular and Cellular Biochemistry","date":"2025-01-03T08:13:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-and-cellular-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcbi","sideBox":"Learn more about [Molecular and Cellular Biochemistry](https://www.springer.com/journal/11010)","snPcode":"11010","submissionUrl":"https://submission.nature.com/new-submission/11010/3","title":"Molecular and Cellular Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"a9951e84-a7b8-49c1-8152-3c32832123a7","owner":[],"postedDate":"January 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-18T16:04:27+00:00","versionOfRecord":{"articleIdentity":"rs-5756583","link":"https://doi.org/10.1007/s11010-025-05364-2","journal":{"identity":"molecular-and-cellular-biochemistry","isVorOnly":false,"title":"Molecular and Cellular Biochemistry"},"publishedOn":"2025-08-12 15:57:18","publishedOnDateReadable":"August 12th, 2025"},"versionCreatedAt":"2025-01-06 09:24:49","video":"","vorDoi":"10.1007/s11010-025-05364-2","vorDoiUrl":"https://doi.org/10.1007/s11010-025-05364-2","workflowStages":[]},"version":"v1","identity":"rs-5756583","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5756583","identity":"rs-5756583","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}