SQSTM1/p62 Protein Oxidation Facilitates Nrf2 Activation and Pro-survival Autophagy under Therapeutic Oxidative Stress

SQSTM1/p62 Protein Oxidation Facilitates Nrf2 Activation and Pro-survival Autophagy under Therapeutic Oxidative Stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article SQSTM1/p62 Protein Oxidation Facilitates Nrf2 Activation and Pro-survival Autophagy under Therapeutic Oxidative Stress Benyi Li, Wang Liu, Jiang Zhao, Changlin Li, Haixia Xu, Ruibao Chen, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8586285/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Alternol, a natural compound, exhibits potent anti-tumor activity by selectively inducing oxidative stress in prostate cancer cells; however, the molecular mechanisms that coordinate adaptive survival responses to this stress remain poorly defined. In this study, we demonstrate that Alternol treatment triggers a robust, ROS-dependent autophagic response and Nrf2 transactivation in both cell lines and xenograft models. We identify that Alternol specifically drives the rapid, large-scale aggregation of SQSTM1/p62 through direct protein oxidation at Cys105 and Cys113. Distinct from traditional kinase-driven models, this structural aggregation is a primary redox-sensing event that occurs independently of, and prior to, p62 phosphorylation at Ser349 and Ser403. These oxidized p62 aggregates function as a signaling platform that sequesters KEAP1 for autophagic degradation, thereby liberating Nrf2 for nuclear translocation and the induction of downstream antioxidant genes such as AOX1 . Genetic depletion of p62 or disruption of its aggregation capacity via C105/113A mutation blunts KEAP1 turnover and Nrf2 activation, significantly sensitizing cancer cells to Alternol-induced apoptosis. Collectively, our findings define a novel "oxidation-aggregation" axis of p62 as a pivotal survival mechanism, suggesting that targeting the physical aggregation of p62 could provide a promising strategy to overcome adaptive resilience and enhance the efficacy of pro-oxidant cancer therapies. Biological sciences/Cancer/Urological cancer/Prostate cancer Biological sciences/Cell biology/Cell death/Autophagy p62/SQSTM1 autophagy Nrf-2 oxidative stress p62 protein aggregation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 INTRODUCTION Sequestosome 1 (SQSTM1/p62) protein has multiple functions involved in various cellular processes, such as autophagy, protein quality control, and antioxidant signaling [ 1 ]. Autophagy is a cellular process involved in the degradation of cellular components and is mediated by ROS-dependent pathways via ROS-FOXO3-LC3/BNIP3 or ROS-Nrf2-SQSTM1/p62 mechanisms in human cancer cells [ 2 – 4 ]. Its oxidation due to oxidative stress was recently shown as a critical regulatory switch influencing its functions and impacting cellular health [ 5 – 7 ]. SQSTM1/p62 protein contains several cysteine residues susceptible to oxidation by ROS. These modifications can generate sulfenic acid, disulfide bonds, or other oxidized forms, altering the structure and function of SQSTM1/p62. Oxidized p62 exhibits enhanced interaction with ubiquitinated proteins, promoting their recruitment to autophagosomes for degradation [ 5 ]. This can be beneficial in clearing damaged proteins and maintaining cellular homeostasis under stress conditions [ 5 ]. Furthermore, SQSTM1/p62 oxidation might modulate its interaction with signaling proteins, affecting cell survival, inflammation, and stress response pathways. Alternol is a small natural compound derived from the fermented extracts of a mutant fungus Alternaria alternate var. monosporus [ 8 ]. Our previous studies demonstrated that Alternol elicited a significant ROS accumulation and triggered apoptotic cell death preferentially in prostate cancer cells while leaving benign prostate epithelial cells [ 8 , 9 ]. We also demonstrated that Alternol-induced ROS accumulation was responsible for eliciting ER stress response and triggering immunogenic cell death [ 10 , 11 ]. In this report, we examined the cellular responses at the transcriptional level induced by Alternol treatment. Our findings revealed a dramatic transcriptome alteration related to autophagy induction. Further investigation revealed that the autophagic receptor SQSTM1/p62 protein was oxidized via a superoxide-dependent mechanism, resulting in p62 protein aggregation and autophagy induction. In addition, SQSTM1/p62 protein oxidation was linked to KEAP1 degradation and subsequent Nrf2 pathway activation, leading to pro-survival autophagy. RESULTS Alternol treatment elicited selective autophagy and the Nrf2 antioxidant pathway in prostate cancer cells We previously reported that Alternol induced cell death preferentially in malignant cells via superoxide-dependent apoptosis, triggered ER stress-related immunogenic cell death (ICD), and disturbed mitochondrial ATP production in xenograft tumor models [ 8 – 15 ]. To investigate the molecular mechanisms underlying Alternol’s anti-tumor effects, we analyzed the transcriptomic alterations in Alternol-treated xenograft tumor tissues derived from prostate cancer PC-3 cells [ 8 ]. There were 101 upregulated and 66 downregulated genes exceeding the log 2 FC > 2-fold level (Table S1 ). Gene set enrichment analysis (GSEA) revealed that Alternol treatment activated the oxidative stress response (Fig. 1 A), proinflammatory (Fig. 1 B), and IL10 signaling pathways (Fig. 1 C), in addition to danger signal response pathways (Fig. 1 D). These findings are consistent with our recent reports indicating that Alternol induces ICD mediated by oxidative stress and proinflammatory mediators/danger signal response pathways in prostate cancer cells [ 10 , 11 ]. Crucially, the GSEA also revealed the elicitation of selective autophagy (Fig. 1 E) and the Nrf2 antioxidant pathway (Fig. 1 F), both of which were selected for detailed investigation in the current study. To validate these transcriptomic findings, we verified the autophagy response in PC-3 cells using three complementary approaches. First, we utilized the tandem fluorescent probe (pMXs/GFP-LC3-RFP [ 16 ]), a standard marker for monitoring autophagy flux, to distinguish between early (GFP/RFP colocalization) and late (RFP-only) autophagic phases [ 17 ]. Following transient transfection and Alternol treatment for 4–8 hours, we observed a significant accumulation of both GFP/RFP puncta at 4 hours (Fig. 1 G), which is characteristic of an early autophagic response [ 17 ]. The subsequent increase in RFP-only puncta at 8 hours provided clear evidence of an active autophagy flux in Alternol-treated cells [ 17 ]. The quantitative data of LC-3 puncta were summarized in Fig. 1 H. Second, transmission electron microscopy (TEM) was performed to analyze the morphological autophagy features after Alternol treatment. TEM images clearly displayed the massive formation of cytoplasmic vacuoles, a morphological feature of autophagy, which was completely abolished in cells pretreated with the reactive oxygen species (ROS) scavenger N-Ac (Fig. 1 I). Thirdly, we analyzed the processing of microtubule-associated protein 1A/1B-light chain-3 (LC-3), a critical component in autophagy induction [ 17 ]. Our results showed clear evidence of LC-3 biosynthesis (increased LC-3β-I) and processing (increased LC-3β-II) after Alternol treatment in a ROS-dependent manner (Fig. 1 J). This autophagy response was accompanied by PARP cleavage and caspase-3 processing at the late time point (Fig. 1 J), consistent with our previous report [ 8 ]. Taken altogether, these data suggest that Alternol treatment triggers an oxidative stress-dependent autophagy response in prostate cancer cells. LKB1-AMPK pathway activation was responsible for Alternol-induced autophagy To elucidate the underlying mechanism responsible for the Alternol-induced autophagic response, we first examined the LKB1-AMPK signaling pathway, a key modulator of cellular autophagy induction [ 18 – 20 ]. Our results revealed that Alternol treatment dramatically increased the phosphorylation of LKB1 at the activating Ser307 site [ 21 ], while concurrently decreasing the phosphorylation level at the inhibitory Ser428 site [ 22 ]. Consistent with LKB1 activation, we observed a parallel increase in the phosphorylation of its downstream effector, AMPK, at the active Thr172 site [ 23 ] (Fig. 2 A). Simultaneously, phosphorylation at the inhibitory Ser487 site of AMPK [ 24 ] was markedly decreased in a time-dependent manner after Alternol treatment (Fig. 3 A). Quantitative densitometry analysis supported these alterations in LKB1/AMPK phosphorylation status (Fig. 2 B & 2 C). Furthermore, pretreatment with N-Ac fully reversed all Alternol-induced alterations in LKB1 and AMPK phosphorylation (Fig. 2 D- 2 F). These data suggest that Alternol treatment activates the LKB1-AMPK pathway in an oxidative stress-dependent manner, serving as an upstream signal for autophagy induction. To determine if Ca 2+ /Calmodulin-dependent protein kinase kinase (CaMKK) contributed to LKB1/AMPK pathway activation [ 25 ], we tested the effects of the CaMKK inhibitor, STO-609 [ 26 ], and the calcium-specific chelator, BAPTA [ 27 ], on Alternol-induced AMPK phosphorylation. Our results showed that STO-609 pretreatment largely reduced the basal level of AMPK Thr172 phosphorylation, it had no significant inhibitory effect on the Alternol-induced increase in AMPK Thr172 phosphorylation (Fig. 2 G & 2 H). Conversely, BAPTA pretreatment significantly reduced the Alternol-induced AMPK Thr172 phosphorylation (Fig. 2 G). These data indicate that while CaMKK may be responsible for maintaining basal AMPK activity, cellular calcium signaling is specifically and critically involved in the Alternol-induced activation of AMPK Thr172 phosphorylation. It was reported that protein kinase C ζ (PKC ζ ) modulated LKB1-AMPK activation [ 28 ]. We assessed the effect of a myristylated PKC ζ pseudo-substrate inhibitor [ 29 ] on Alternol-induced AMPK phosphorylation. As shown in Fig. 2 G, pretreatment with the PKC ζ pseudo-substrate inhibitor had no obvious inhibitory effect on Alternol-induced AMPK phosphorylation at the Thr172 site, suggesting that PKC ζ was not involved in Alternol-induced AMPK activation. This indicates that PKC ζ is not involved in the mechanism of Alternol-induced AMPK activation in PC-3 cells. Alternol induced p62 protein aggregation in response to oxidative stress. SQSTM1/p62 protein is a well-known selective autophagy receptor that is typically degraded alongside its cargo proteins upon autophagy induction [ 17 , 30 ]. We examined SQSTM1/p62 protein levels during Alternol-induced autophagy and, unexpectedly, detected a significant accumulation of high-molecular-weight bands containing the p62 protein. These aggregates appeared in Alternol-treated cells starting at 4 hours post-treatment (Fig. 3 A). The formation of these high-molecular-weight p62 bands was abolished by N-Ac pretreatment, indicating an oxidative stress-mediated response, as previously reported [ 5 ]. Alternol induced p62 protein aggregation in a dose-dependent manner (Fig. 3 B). Similarly, Alternol induced p62 aggregation in DU145 cells (Fig. 3 C), despite these cells being relatively insensitive to Alternol-induced cell death [ 8 ]. Consistently, similar high-molecular-weight bands of p62 protein aggregates were observed in PC-3 cell-derived xenografts following Alternol treatment. This was accompanied by increased LC-3 protein biosynthesis (LC-3β-I) and processing (LC-3β-II) compared to the solvent control (Fig. 3 D). Notably, these high-molecular-weight bands were resistant to detergent and reducing agent DTT treatment (Fig. 3 E). These data indicated an attenuated consequence of SQSTM1/p62 protein during Alternol-induced ROS-dependent autophagic response in vitro and in vivo . We further investigated whether other ROS inducers could trigger similar SQSTM1/p62 aggregation. Our results showed that hydrogen peroxide (H 2 O 2 ) induced the accumulation of p62 aggregates, whereas the nitric oxide inducer L-arginine did not (Fig. 3 F). Surprisingly, the inhibitor of redox-maintaining enzyme thioredoxin reductase (TrxR) Auranofin, a strong ROS-inducer [ 31 , 32 ], also did not cause p62 protein aggregation (Fig. 3 G). Furthermore, Rapamycin, the mTOR inhibitor and autophagy inducer [ 33 ], did not cause p62 protein aggregation in malignant PC-3 cells but in benign prostatic cells BPH1 (Fig. 3 H), consistent with previous studies [ 7 ]. Combining Rapamycin with the autophagy blocker Chloroquine only slightly increased p62 aggregates in both cell lines (Fig. 3 H). Collectively, these data suggest that Alternol treatment induces robust SQSTM1/p62 protein aggregation specifically due to superoxide-related oxidative stress in malignant cells. The different responses between malignant and benign cells following Alternol or Rapamycin treatment deserve further mechanistic investigation. p62 protein aggregation is driven by protein oxidation rather than phosphorylation, ubiquitination, or impaired degradation A previous report showed that p62 phosphorylation at the Ser403 site was linked to protein aggregation with polyubiquitinated proteins [ 34 ], while phosphorylation of p62 protein at Ser349 increased its affinity for the cargo KEAP1 protein [ 35 , 36 ]. We investigated whether SQSTM1/p62 phosphorylation was involved in Alternol treatment-induced aggregation. As shown in Fig. 4 A, p62 protein monomers were strongly phosphorylated at both S349 and S403 sites at a very late time point (about 12 h) after Alternol treatment, which was completely different from the protein aggregation pattern starting at 4 h. In addition, p62 phosphorylation at S349 but not S403 was observed in the aggregates (Fig. 4 A). Similar results were also observed in PC-3 xenograft tissues (Fig. 3 D). Interestingly, N-Ac pre-treatment enhanced the phosphorylation at both sites on the monomers but abolished S349 phosphorylation on the aggregates (Fig. 4 A). These results indicated that while S349 phosphorylation occurs within the aggregates, it is not the primary driver of aggregate formation, as the timeline of phosphorylation succeeds the initial aggregation event. The significance of enhanced SQSTM1/p62 monomer phosphorylation at S349/S403 by N-Ac pretreatment is under further investigation. To identify the signal pathways responsible for Alternol-induced p62 phosphorylation, we tested a few pharmacological inhibitors for their effect on p62 aggregation and phosphorylation. As shown in Fig. 4 B, the pan-PI3K inhibitor BKM120 [ 37 ], pan-MAPK inhibitor PD184161 [ 38 ], and GSK-3 inhibitor TDZD8 [ 39 ] remarkably increased the levels of p62 protein aggregation and S349 phosphorylation, of which TDZD8 exhibited the strongest effect on both events. These inhibitors had only a very weak effect on p62S403 phosphorylation (Fig. 4 B). These data suggest that PI3K, MAPK, and GSK-3 pathways are negative regulators for p62 protein aggregation and S349 phosphorylation in response to Alternol-induced oxidative stress. We further examined if calcium-dependent signaling was involved in p62 protein aggregation since our data showed calcium signaling involvement in Alternol-induced activation of the LKB1-AMPK pathway (Fig. 4 C). Our results showed that BATPA pre-treatment slightly enhanced Alternol-induced p62 protein aggregation, while CAMKK inhibitor STO-609 and PKCζ peptide inhibitor had no obvious effect on p62 aggregation. To examine if SQSTM1/p62 aggregation was due to polyubiquitination, we conducted a co-immunoprecipitation assay. Co-immunoprecipitation showed that Alternol-induced p62 aggregates did not contain high-molecular-weight ubiquitin bands (Fig. 4 D). It was reported that SQSTM1/p62 protein forms self-oligomers via its Phox and Bem1p (PB1) domain during autophagy induction [ 40 ]. We then used a mutant p62 protein with a defect in oligomerization (p62/K7A.D69A) [ 41 ] and examined its effect on Alternol-induced p62 aggregation. After transient transfection overnight, Alternol treatment strongly induced p62 protein aggregates in p62K7A/D69A mutant-transfected cells compared to the p62 wild-type (p62/WT) transfected cells (Fig. 4 E). Rapamycin did not cause p62 aggregation (Fig. 4 E), similar to the previous results (Fig. 3 H). These data suggest that p62 protein oligomerization was not involved in Alternol-induced aggregation. Furthermore, blocking the autophagic (Chloroquine) or proteasomal (MG132) degradation machineries did not increase aggregate levels, confirming that the accumulation is not due to a defect in protein clearance (Fig. 4 F). Given recent findings that SQSMT1/p62 protein oxidation at cystine-105/113 (C105/113) residues, leading to p62 aggregation and autophagy activation in the Drosophila system [ 5 – 7 ], we used a biotin derivatization-based protein carbonylation assay to assess cellular protein oxidation, as described by our recent publication [ 13 ] and others [ 42 ]. The SQSTM1/p62 gene mutation on the C105/113A plasmid was used to examine the mutation’s effect on p62 protein oxidation and aggregation. Our results showed that Alternol treatment caused a dramatic accumulation of oxidized cellular proteins, which was largely reduced by N-Ac pre-treatment (Fig. 4 G upper panel & H). These data were in line with our recent publication [ 13 ]. Crucially, the p62/C105/113A mutation abolished p62 aggregation even without NAC (Fig. 4 G lower panel & H). These data were in line with the recent report for the involvement of p62 cystine-105/113 residues in protein oxidation and aggregation [ 7 ]. We observed similar results with H 2 O 2 treatment, where the C105/113A mutation largely prevented aggregation (Fig. 4 I & J). Lastly, we examined the functional impact of the C105/113A mutation on Alternol-induced autophagic response. While Alternol induced a robust, time-dependent increase in LC3 protein processing in wild-type cells, this response was significantly attenuated in cells overexpressing the C105/113A mutant (Fig. 4 K & L). These data collectively demonstrate that Alternol-induced p62 aggregation is mediated by direct protein oxidation at Cys105/113, a process essential for the subsequent activation of the autophagic response. Oxidation of p62 protein facilitates KEAP1 degradation and Nrf2 activation. It is well known that the SQSTM1/p62 protein is involved in Nrf2-mediated antioxidant protection [ 3 ]. Since our GSEA analysis showed Nrf2 pathway activation in Alternol-treated xenografts (Fig. 1 F), we verified the Nrf2 pathway activation induced by Alternol treatment. Our results demonstrated that Alternol treatment induced rapid Nrf2 activation, characterized by the accumulation of high-molecular-weight Nrf2 complexes [ 43 ], and a concomitant reduction in KEAP1 protein levels (Fig. 5 A), possibly due to enhanced protein degradation [ 36 ]. Notably, these events synchronized with LC3 biosynthesis and processing, suggesting a functional link between Nrf2 activation and autophagy induction. To investigate the involvement of SQSTM1/p62 in KEAP1 degradation, we performed an anti-p62 co-immunoprecipitation (Co-IP) assay. In control cells, KEAP1 protein was robustly pulled down with p62; however, Alternol treatment led to a drastic reduction of KEAP1 in the p62-precipitated eluates (Fig. 5 B, the upper panels). This reduction occurred in parallel with p62 aggregation (Fig. 5 B, the lower panels). Subsequent Nrf2 transactivation was confirmed by an Nrf2-responsive luciferase reporter assay (Fig. 5 C & 5 D) and further validated by the upregulation of the Nrf2 target gene AOX1 (Fig. 5 E & 5 F) [ 44 , 45 ]. Critically, compared to the wild-type p62 protein, C105/113A mutant overexpression blunted Nrf2 transactivation, as documented in the Nrf2-driven luciferase reporter assay (Fig. 5 C & 5 D). Furthermore, overexpression of p62C105/113A mutants also largely reduced Alternol-induced Nrf2 activation and delayed KEAP1 protein degradation (Fig. 5 G & 5 H). Collectively, these data suggest that p62 protein oxidation is a pivotal event in Altetnol-induced Nrf2 pathway activation under oxidative stress. Oxidation of p62 protein is involved in pro-survival autophagic response. To evaluate the functional significance of the Alternol-induced autophagic response, the autophagy blocker chloroquine (CQ) was used together with Alternol treatment. Apoptotic cell death was evaluated with the commonly used markers, caspase-3 processing and PARP cleavage [ 8 ]. Consistent with our previous report [ 8 ], caspase-3 processing and PARP cleavage were observed at 8 h after Alternol treatment (Fig. 6 A). Notably, the combination of CQ and Alternol accelerated the apoptotic response, with markers appearing as early as 4 hours post-treatment, indicating that autophagy inhibition sensitizes cells to Alternol-induced apoptosis (Fig. 6 A). We further investigated the role of p62 oxidation in cell survival by overexpressing the p62-C105/113A mutant. Compared to p62/WT overexpression of the C105/113A mutant significantly sensitized PC-3 cells to a sublethal dose of Alternol (Fig. 6 B). These results suggest that p62 protein oxidation at these specific cysteine residues exerts a protective, pro-survival effect against Alternol-induced stress. To further evaluate the pro-survival effect of p62 protein, we generated SQSTM1/p62 gene knockout (p62KO) subline PC-3 and C4-2B cells (Fig. 6 C). As expected, p62 deficiency blunted Alternol-induced Nrf2 transactivation (Fig. 6 D) and markedly increased the sensitivity of PC-3 cells to Alternol-induced cell death at a sublethal (2.5 µM) concentration (Fig. 6 E & 6 F). This sensitization was further evidenced by the absence of p62 protein aggregates and a concomitant increase in caspase-3 processing and PARP cleavage in p62-KO cells compared to p62-WT cells (Fig. 6 G). Collectively, these data demonstrated that p62 protein oxidation at the C105/113 sites is a critical pro-survival event that drives Nrf2 activation and the autophagic response to counteract excessive oxidative stress induced by Alternol. DISCUSSION In our previous studies, we established that Alternol induces profound oxidative stress and preferential apoptotic cell death in cancer cells [ 8 , 10 ], alongside proinflammatory secretion and ICD [ 11 ]. In the present study, GSEA analysis of in vivo xenograft transcriptomes not only corroborated these inflammatory signatures but also revealed significant enrichment in Nrf2 transactivation and autophagy pathways. These findings prompted a deeper investigation into the molecular bridge between oxidative stress and adaptive survival signaling. To characterize this autophagy response, we utilized multiple experimental approaches across both cancer cell lines and xenograft models. A pivotal and unexpected discovery of this study is the rapid and massive aggregation of SQSTM1/p62 following Alternol treatment. While the oxidation of SQSTM1/p62 at residues Cys105 and Cys113 has been recently identified as an evolutionary adaptive event under aging-related oxidative conditions [ 5 , 6 , 46 ], our data uniquely demonstrate that Alternol-induced oxidative stress drives these modifications into a robust, high-molecular-weight protein aggregation—a structural transition not previously characterized in this context. This aggregation was independent of poly-ubiquitination, phosphorylation, or proteasomal impairment, as evidenced by its resistance to reducing agents and its occurrence in the absence of traditional degradative blocks. Critically, we have identified this p62 aggregation as a pro-survival functional platform. Our results show that the physical formation of p62 aggregates is required for the efficient sequestration and subsequent degradation of KEAP1, which in turn facilitates rapid Nrf2 transactivation. By utilizing the p62 C105/113A oxidation-deficient mutant, we demonstrated that the loss of aggregation capacity blunts Nrf2 signaling and sensitizes cells to Alternol-induced death. This suggests that p62 oxidation-driven aggregation acts as a "redox-shield," enabling cancer cells to clear damaged organelles and activate antioxidant defenses to withstand lethal therapeutic stress. Furthermore, our study reveals a distinct temporal and functional decoupling between p62 oxidation/aggregation and its phosphorylation. Although p62 phosphorylation at Ser349 and Ser403 is traditionally linked to Nrf2 activation and ubiquitin-cargo binding [ 35 , 47 – 49 ], our results show that Alternol-induced Ser349 phosphorylation is a late-stage event (8 h), occurring significantly after the peak of Nrf2 activation (1–2 h). Furthermore, the ROS scavenger N-Ac enhanced rather than abolished S349 phosphorylation on SQSTM1/p62 protein monomers. This suggests that while p62 oxidation and subsequent aggregation drive early Nrf2-mediated antioxidant responses, Ser349/S403 phosphorylation may represent a secondary or distinct regulatory phase. The potential role of kinases like TBK1 or CK2 in this context, and how phosphatases modulate these sites under Alternol-induced stress, warrants further investigation [ 34 , 50 , 51 ]. In conclusion, we have defined the survival significance of the p62 "oxidation-aggregation" axis under Alternol-induced stress. The fact that p62 knockout or the loss of its aggregation capacity (C105/113) significantly sensitizes prostate cancer cells to sublethal doses of Alternol suggests that this pathway is a major determinant of cancer cell resilience [ 30 , 36 , 52 – 56 ]. Although the precise molecular mechanism by which oxidized p62 aggregates facilitate KEAP1 turnover remains to be fully elucidated, our study provides a novel mechanistic rationale for targeting p62-mediated proteostasis to overcome adaptive resistance in pro-oxidant cancer therapies. CONCLUSION In summary, this study identifies Alternol as a potent inducer of a coordinated p62-Nrf2-autophagy survival axis in prostate cancer cells. The centerpiece of our findings is the discovery that Alternol-induced oxidative stress at Cys105/113 drives a rapid, large-scale aggregation of p62—a structural transition that serves as a vital signaling platform for KEAP1 degradation. Unlike previously reported oxidation events, this p62 aggregation occurs independently of phosphorylation and serves as a primary "redox sensor" to activate antioxidant defenses. Our results demonstrate that genetic depletion of p62 or disruption of its aggregation capacity (C105/113) significantly sensitizes cancer cells to Alternol, shifting the cellular balance from adaptive survival toward apoptosis. These insights underscore p62 protein aggregation as a critical determinant of cancer cell resilience and a promising target for enhancing pro-oxidant therapeutic strategies (Fig. 6 H). MATERIAL AND METHODS Cell culture, special chemical reagents, plasmid constructs, and antibodies Benign prostatic hyperplasia-1 (BPH1), human embryonic kidney (HEK)-293T, prostate cancer PC-3, DU145, 22RV1, and C4-2B cell lines were obtained from ATCC (Manassas, VA) as described [ 57 ]. BPH1, PC-3, 22RV1, and C4-2B cells were cultured in RPMI 1640 media containing 10% fetal bovine serum and 1% penicillin/ streptomycin in a 5% CO 2 humidified atmosphere at 37°C. HEK-293T and DU145 cells were cultured in DMEM media containing 10% fetal bovine serum and 1% penicillin/streptomycin in a 5% CO 2 humidified atmosphere at 37°C. Alternol was obtained from Sungen Biosciences (Shantou, China). Chemicals of n-acetylcysteine (N-Ac), Chloroquine, STO-609, L-Arginine, PKC-ζ-inhibitor peptide, BATPA, Auranofin, and rapamycin were obtained from Cayman Chemicals (Arbor, MI, USA). The Luciferase assay system (E1501) was purchased from Promega (Madison, WI, USA). Hydrogen peroxide (H 2 O 2 ) and Annexin V-FITC Apoptosis Detection Kit were obtained from Sigma-Aldrich (St Louis, MO, USA). The pGL4.27_ARE/NRF2-SPE luciferase reporter construct [ 58 ] was a gift from Michael Ristow (Addgene plasmid # 177775). The pMXs-puroGFP-p62/K7A-D69A (Addgene#38281), pMXs-puroGFP-p62 [ 41 ](Addgene#38277), and pMXs-GFP-LC3-RFP [ 59 ] (Addgene#117413) plasmids were a gift from Noboru Mizushima, who deposited them on Addgene (Watertown, Mass, USA). The plasmid constructs harboring the SQSTM1/p62WildType or C105/113A mutations were provided by Dr. Viktor Korolchuk (Newcastle University). The iScript cDNA Synthesis kit (1708891) and iTaq SYBR Green Supermix (1725121) were purchased from Bio-Rad (Hercules, CA, USA). Gentian Violet and TRIzol RNA isolation reagents were obtained from Thermo Fisher (Waltham, MA, USA). SQSTM1/p62 (sc-28359), LKB1 (sc-32245), and β-Actin (sc-4778) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). PARP (CST-9532), Caspase-3 (CST-9662), LC-3β (CST-3868), AMPK (CST-5831), p-AMPK (T172) (CST-2535), p-AMPK(S485) (CST-2537), KEAP1 (CST-8047), Nrf-2 (CST-12721), p-LKB1/S428 (CST-3482), phospho-SQSTM1/p62 (Ser403) (CST-39786), phospho-SQSTM1/p62 (Ser349) (CST-16177) and anti-Biotin (CST-5597) were purchased from Cell signaling Technology (Danvers, MA, USA). p-LKB1/S307 (EMD:09478) was purchased from Merk Millipore (Burlington, MA, USA). Western blot, qPCR, and protein carbonylation assay Cells were washed twice with cold PBS solution, then lysed with RIPA Buffer with phosphorylase and protease inhibitor (Cell Signaling Technologies, Danvers, MA, USA). Protein concentrations were determined with the Standard BCA Protein Assay Kit (Thermo Fisher, Waltham, MA, USA). The lysed samples were boiled and subjected to separation with 8% or 12% SDS-PAGE gel at 70-120V. Proteins were transferred to the PVDF membrane. The membranes were blocked for 60 min with 5% no-fat milk solutions prepared in phosphate-buffered saline (PBS) with 0.1% Tween 20, incubated overnight at 4°C with 1:1000 dilutions of the primary antibodies, and washed three times for 10 min each time with Tween 20 (1:1000 dilution) in PBS. Appropriate peroxidase-conjugated secondary antibody (1:5000 dilution) was used for 2 h at room temperature. Membranes were washed with Tween 20-PBS three times for 10 min. Protein bands were visualized using an ECL solution from Santa Cruz Biotech (CA, United States). Total RNA samples were isolated using TRIzol RNA isolation reagents (Invitrogen). Gene expression was assessed using a SYBR Green-based quantitative RT-PCR assay. qPCR experiment and analysis were tested as described in our previous report [ 60 ]. PCR primer pair for the human AOX1 is forward 5′- ATGCCTGTCTGATTCCCATCT − 3’, reverse 5′- CATGACACTTGGCAATCCTCT − 3’. The human 18S rRNA primer pair is forward 5′-CTACCACATCC AAGGAAGCA-3′ and reverse 5′-TTTTTCGTCA CTACCTCCCCG-3′. Protein carbonylation was evaluated using a biotin derivatization assay as described [ 42 ]. In brief, the treated cells were harvested in cold PBS and cellular proteins were extracted under native conditions in G-lysis buffer (Guanidine HCl 6.0 M, Tris 50 mM, pH 8.3, EDTA 3.0 mM, Triton-X100 0.5% (v/v), and sodium iodoacetate 50 mM), as described [ 61 ]. Subsequently, the protein lysate was incubated in the dark with 5.0 mM biotin hydrazide for 2 h at room temperature. Biotin-conjugated proteins were reduced with 10.0 mM NaBH4 for 1 hr. The excessively salty chemicals were removed with the Ultracel®-3K centrifugal filter (Merk Millipore). The eluted proteins were loaded onto an SDS-PAGE gel, and carbonylated proteins on the PVDF membrane were detected using the HRP-linked anti-Biotin antibodies. Protein band density was acquired using NIH ImageJ software. CRISPR/Cas9 knockout (KO) system stable cell line and small interfering RNAs SQSTM1/p62 knockout (KO) stable cell lines were established in C4-2B and PC-3 cells using the SQSTM1/p62 CRISPR plasmid system (sc-400099) obtained from Santa Cruz (Santa Cruz, CA, USA). The protocol provided by Santa Cruz Biotech was followed to generate the SQSTM1/p62 KO cell lines. Stable subline cells were established with the wild-type or C105/113A mutant SQSMT1/p62 plasmids in C4-2B and PC-3 cells. The small interfering RNAs (siRNAs) for the SQSTM1 gene (a set of 4 ON-TARGETplus siRNAs) were purchased from Horizon Discovery Inc. A negative control siRNA was also included in the cell-based assays. Lipofectamine RNAiMAX transfection reagent was purchased from ThermoFisher Scientific Inc. The transfection procedure was performed according to the manufacturer’s manual. Flow cytometry analysis PC-3 cells were cultured in a 6-well plate (1 x 10 5 /well) and then treated as indicated for 16 h. Apoptotic cell death was evaluated with flow cytometry as described in our previous publication [ 62 ]. Briefly, cells were harvested and washed with cold PBS, and then incubated with annexin V-binding buffer and 1 mg/ml propidium iodide for 10 min at room temperature according to the assay kit protocols (Thermo Fisher, Waltham, MA, USA). Flow cytometry data were analyzed by FlowJo software. Electron microscope (EM) analysis PC-3 cells were seeded on 0.2% gelatin-precoated 10-mm coverslips in p100 dishes and then treated as indicated for 16 h. The cells were fixed with freshly prepared 2.5% glutaraldehyde in PBS at 4°C for 3 h. And then washed twice with cold PBS. Dehydration was carried out sequentially in the dishes with methanol at different concentrations (20%, 40%, and 60%) for 5 min each, followed by an 80% methanol wash for 3 min and then a 100% methanol wash for 30 s, repeated five times. The coverslips with dishes were dried in vacuum-assisted desiccators overnight. The surface of the coverslip was sputter-coated in a vacuum with an electrically conductive 5 nm thick layer of gold-palladium alloy precision etching coating system. The EM images were recorded with a scanning electron microscope (FEI Quanta 200) at a lower voltage (∼1 kV) and low vacuum mode with a tilt of 30° [ 63 ]. Co-Immunoprecipitation C4-2B or PC-3 cells (9 ~ 10 × 10 6 ) were grown in 145-mm dishes, followed by the indicated treatments. Cells were washed twice with cold PBS on ice and then collected in CHAPS lysis buffer [40 mM HEPES pH7.4, 120 mM NaCl, 1 mM EDTA, 10 mM pyrophosphate, 10 mM glycerophosphate, 50 mM NaF, 1.5 mM Na3VO4, 0.3% (w/v) CHAPS], and a cocktail of protease inhibitors (1:1,000, Sigma). The samples were sonicated for 20 seconds and then centrifuged at 12,000 rpm for 30 min at 4°C. Supernatants were transferred to new tubes. Protein concentration was determined with a standard BCA protein assay kit (Thermo Fisher, Waltham, MA, USA). Cell lysates were incubated with 3 µg primary antibodies for 1 hr before adding 30 µl of protein A/G agarose beads (sc-2003, Santa Cruz Biotechnology). After incubation at 4°C overnight, the samples were centrifuged at 5000 rpm for 3 min to pellet the beads. The beads were washed with CHAPS lysis buffer 3 times, followed by western blot analysis. Fluorescence microscopy Cells were seeded in a 6-well plate overnight and then transfected with the plasmids for 48 h. The cells were treated as indicated at different times. After washing with cold PBS three times, the cells were incubated with Hoechst 33342 dye (Thermo Fisher, Waltham, MA, USA) for 15 min at room temperature. Images were acquired with a Nikon Confocal Microscope. Gentian violet assay C4-2B and PC-3 cells were seeded in a 6-well plate (1 × 10 5 /well), grown overnight, and then treated with Alternol (0, 2.5, 5.0, 10 µM) for 24 h. After fixation in cold acetone, cells were stained with 0.2% gentian violet for 5 min. Cells were washed with distilled water for photos. Statistical analysis Quantitative data were presented as the mean ± SEM from at least three experiments. Representative images of non-quantitative data were shown from multiple experiments. Statistical analysis was performed using ANOVA followed by a Student's t -test to compare two groups with SPSS software (Chicago, IL). A p -value less than 0.05 was considered statistically significant. Declarations Ethics approval and consent to participate : N/A Consent for publication : All authors agreed to publication. Availability of data and material: N/A Competing interest: None Funding : This work was partially supported by GuangDong Basic and Applied Basic Research Foundation (General Project #2024A1515010342 to Dr. Xiangwei Wang). Author Contribution: W.L., H.X., C.L., R. C., X. Z., and J. Y. conducted the cell culture-based experiments. C.Z. and J.Z. performed the bioinformatic analysis. X.W. and B.L. wrote the manuscript. All authors reviewed the manuscript. Acknowledgments We are very grateful for the generous gift of Alternol reagent from Dr Jiepeng Chen at Sungen Biosciences (Shantou, China). We also thank Dr. Viktor Korolchuk from Newcastle University (United Kingdom) for the SQSTM1 wild-type and C105/113A mutant plasmids. References Liu WJ, Ye L, Huang WF, Guo LJ, Xu ZG, Wu HL, Yang C, Liu HF: p62 links the autophagy pathway and the ubiqutin-proteasome system upon ubiquitinated protein degradation. Cellular & molecular biology letters 2016, 21:29. Li L, Tan J, Miao Y, Lei P, Zhang Q: ROS and Autophagy: Interactions and Molecular Regulatory Mechanisms. Cell Mol Neurobiol 2015, 35(5):615–621. Ning B, Hang S, Zhang W, Mao C, Li D: An update on the bridging factors connecting autophagy and Nrf2 antioxidant pathway. Front Cell Dev Biol 2023, 11:1232241. Hseu YC, Vudhya Gowrisankar Y, Wang LW, Zhang YZ, Chen XZ, Huang PJ, Yen HR, Yang HL: The in vitro and in vivo depigmenting activity of pterostilbene through induction of autophagy in melanocytes and inhibition of UVA-irradiated alpha-MSH in keratinocytes via Nrf2-mediated antioxidant pathways. Redox Biol 2021, 44:102007. Otten EG, Stefanatos R, Carroll B, Korolchuk VI: Oxidation of p62 as an evolutionary adaptation to promote autophagy in stress conditions. Cell Stress 2018, 2(4):91–93. Kelly G, Kataura T, Panek J, Ma G, Salmonowicz H, Davis A, Kendall H, Brookes C, Ayine-Tora DM, Banks P et al : Suppressed basal mitophagy drives cellular aging phenotypes that can be reversed by a p62-targeting small molecule. Dev Cell 2024, 59(15):1924–1939 e1927. Carroll B, Otten EG, Manni D, Stefanatos R, Menzies FM, Smith GR, Jurk D, Kenneth N, Wilkinson S, Passos JF et al : Oxidation of SQSTM1/p62 mediates the link between redox state and protein homeostasis. Nat Commun 2018, 9(1):256. Tang Y, Chen R, Huang Y, Li G, Huang Y, Chen J, Duan L, Zhu BT, Thrasher JB, Zhang X et al : Natural compound Alternol induces oxidative stress-dependent apoptotic cell death preferentially in prostate cancer cells. Mol Cancer Ther 2014, 13(6):1526–1536. Liu W, Li JC, Huang J, Chen J, Holzbeierlein J, Li B: Alternol/Alteronol: Potent Anti-cancer Compounds With Multiple Mechanistic Actions. Front Oncol 2020, 10:568110. Liu W, He C, Li C, Ye S, Zhao J, Zhu C, Wang X, Ma Q, Li B: Natural compound Alternol actives multiple endoplasmic reticulum stress-responding pathways contributing to cell death. Front Pharmacol 2024, 15:1397116. Li C, Zhang Y, Yan S, Zhang G, Wei W, Qi Z, Li B: Alternol triggers immunogenic cell death via reactive oxygen species generation. Oncoimmunology 2021, 10(1):1952539. Li C, He C, Xu Y, Xu H, Tang Y, Chavan H, Duan S, Artigues A, Forrest ML, Krishnamurthy P et al : Alternol eliminates excessive ATP production by disturbing Krebs cycle in prostate cancer. Prostate 2019, 79(6):628–639. Xu H, Li C, Mozziconacci O, Zhu R, Xu Y, Tang Y, Chen R, Huang Y, Holzbeierlein JM, Schoneich C et al : Xanthine oxidase-mediated oxidative stress promotes cancer cell-specific apoptosis. Free Radic Biol Med 2019, 139:70–79. Xu H, Zhou Z, Li B: Natural compound Alternol as a novel therapeutic for prostate cancer treatment. Am J Clin Exp Urol 2020, 8(3):76–80. He C, Ma L, Hirst J, Li F, Wu H, Liu W, Zhao J, Xu F, Godwin AK, Wang X et al : Natural compound Alternol exerts a broad anti-cancer spectrum and a superior therapeutic safety index in vivo. Front Pharmacol 2024, 15:1409506. Kimura S, Noda T, Yoshimori T: Dissection of the autophagosome maturation process by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy 2007, 3(5):452–460. Klionsky DJ, Abdel-Aziz AK, Abdelfatah S, Abdellatif M, Abdoli A, Abel S, Abeliovich H, Abildgaard MH, Abudu YP, Acevedo-Arozena A et al : Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)(1). Autophagy 2021, 17(1):1-382. Vargas JNS, Hamasaki M, Kawabata T, Youle RJ, Yoshimori T: The mechanisms and roles of selective autophagy in mammals. Nature reviews Molecular cell biology 2023, 24(3):167–185. He J, Dong L, Luo L, Wang K: Redox Regulation of Autophagy in Cancer: Mechanism, Prevention and Therapy. Life (Basel) 2022, 13(1). Xiang H, Zhang J, Lin C, Zhang L, Liu B, Ouyang L: Targeting autophagy-related protein kinases for potential therapeutic purpose. Acta Pharm Sin B 2020, 10(4):569–581. Xie Z, Dong Y, Zhang J, Scholz R, Neumann D, Zou MH: Identification of the serine 307 of LKB1 as a novel phosphorylation site essential for its nucleocytoplasmic transport and endothelial cell angiogenesis. Mol Cell Biol 2009, 29(13):3582–3596. Lo AK, Lo KW, Ko CW, Young LS, Dawson CW: Inhibition of the LKB1-AMPK pathway by the Epstein-Barr virus-encoded LMP1 promotes proliferation and transformation of human nasopharyngeal epithelial cells. J Pathol 2013, 230(3):336–346. Hawley SA, Davison M, Woods A, Davies SP, Beri RK, Carling D, Hardie DG: Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates AMP-activated protein kinase. J Biol Chem 1996, 271(44):27879–27887. Hawley SA, Ross FA, Gowans GJ, Tibarewal P, Leslie NR, Hardie DG: Phosphorylation by Akt within the ST loop of AMPK-alpha1 down-regulates its activation in tumour cells. Biochem J 2014, 459(2):275–287. Hawley SA, Pan DA, Mustard KJ, Ross L, Bain J, Edelman AM, Frenguelli BG, Hardie DG: Calmodulin-dependent protein kinase kinase-beta is an alternative upstream kinase for AMP-activated protein kinase. Cell Metab 2005, 2(1):9–19. Tokumitsu H, Inuzuka H, Ishikawa Y, Ikeda M, Saji I, Kobayashi R: STO-609, a specific inhibitor of the Ca(2+)/calmodulin-dependent protein kinase kinase. J Biol Chem 2002, 277(18):15813–15818. Billman GE: Intracellular calcium chelator, BAPTA-AM, prevents cocaine-induced ventricular fibrillation. Am J Physiol 1993, 265(5 Pt 2):H1529-1535. Xie Z, Dong Y, Scholz R, Neumann D, Zou MH: Phosphorylation of LKB1 at serine 428 by protein kinase C-zeta is required for metformin-enhanced activation of the AMP-activated protein kinase in endothelial cells. Circulation 2008, 117(7):952–962. Lee-Rivera I, Lopez E, Alvarez-Arce A, Lopez-Colome AM: The PKC-zeta pseudosubstrate peptide induces glutamate release from retinal pigment epithelium cells through kinase- independent activation of Best1. Life Sci 2021, 265:118860. Fan X, Huang T, Tong Y, Fan Z, Yang Z, Yang D, Mao X, Yang M: p62 works as a hub modulation in the ageing process. Ageing Res Rev 2022, 73:101538. Bai D, Zhou C, Du J, Zhao J, Gu C, Wang Y, Zhang L, Lu N, Zhao Y: TrxR1 is involved in the activation of Caspase-11 by regulating the oxidative-reductive status of Trx-1. Redox Biol 2024, 75:103277. Xia Y, Chen J, Yu Y, Wu F, Shen X, Qiu C, Zhang T, Hong L, Zheng P, Shao R et al : Compensatory combination of mTOR and TrxR inhibitors to cause oxidative stress and regression of tumors. Theranostics 2021, 11(9):4335–4350. Kim YC, Guan KL: mTOR: a pharmacologic target for autophagy regulation. J Clin Invest 2015, 125(1):25–32. Matsumoto G, Wada K, Okuno M, Kurosawa M, Nukina N: Serine 403 phosphorylation of p62/SQSTM1 regulates selective autophagic clearance of ubiquitinated proteins. Mol Cell 2011, 44(2):279–289. Ichimura Y, Waguri S, Sou YS, Kageyama S, Hasegawa J, Ishimura R, Saito T, Yang Y, Kouno T, Fukutomi T et al : Phosphorylation of p62 activates the Keap1-Nrf2 pathway during selective autophagy. Mol Cell 2013, 51(5):618–631. Komatsu M, Kurokawa H, Waguri S, Taguchi K, Kobayashi A, Ichimura Y, Sou YS, Ueno I, Sakamoto A, Tong KI et al : The selective autophagy substrate p62 activates the stress responsive transcription factor Nrf2 through inactivation of Keap1. Nat Cell Biol 2010, 12(3):213–223. Buonamici S, Williams J, Morrissey M, Wang A, Guo R, Vattay A, Hsiao K, Yuan J, Green J, Ospina B et al : Interfering with resistance to smoothened antagonists by inhibition of the PI3K pathway in medulloblastoma. Sci Transl Med 2010, 2(51):51ra70. Yung HW, Wyttenbach A, Tolkovsky AM: Aggravation of necrotic death of glucose-deprived cells by the MEK1 inhibitors U0126 and PD184161 through depletion of ATP. Biochem Pharmacol 2004, 68(2):351–360. Chen G, Bower KA, Ma C, Fang S, Thiele CJ, Luo J: Glycogen synthase kinase 3beta (GSK3beta) mediates 6-hydroxydopamine-induced neuronal death. Faseb J 2004, 18(10):1162–1164. Lamark T, Perander M, Outzen H, Kristiansen K, Overvatn A, Michaelsen E, Bjorkoy G, Johansen T: Interaction codes within the family of mammalian Phox and Bem1p domain-containing proteins. J Biol Chem 2003, 278(36):34568–34581. Itakura E, Mizushima N: p62 Targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding. J Cell Biol 2011, 192(1):17–27. Colombo G, Clerici M, Garavaglia ME, Giustarini D, Rossi R, Milzani A, Dalle-Donne I: A step-by-step protocol for assaying protein carbonylation in biological samples. J Chromatogr B Analyt Technol Biomed Life Sci 2016, 1019:178–190. Hsieh CY, Hsiao HY, Wu WY, Liu CA, Tsai YC, Chao YJ, Wang DL, Hsieh HJ: Regulation of shear-induced nuclear translocation of the Nrf2 transcription factor in endothelial cells. J Biomed Sci 2009, 16(1):12. Maeda K, Ohno T, Igarashi S, Yoshimura T, Yamashiro K, Sakai M: Aldehyde oxidase 1 gene is regulated by Nrf2 pathway. Gene 2012, 505(2):374–378. Shintani Y, Maruoka S, Gon Y, Koyama D, Yoshida A, Kozu Y, Kuroda K, Takeshita I, Tsuboi E, Soda K et al : Nuclear factor erythroid 2-related factor 2 (Nrf2) regulates airway epithelial barrier integrity. Allergol Int 2015, 64 Suppl:S54-63. Kataura T, Wilson N, Ma G, Korolchuk VI: Mitophagy as a guardian against cellular aging. Autophagy 2025, 21(1):249–251. Jiang X, Bao Y, Liu H, Kou X, Zhang Z, Sun F, Qian Z, Lin Z, Li X, Liu X et al : VPS34 stimulation of p62 phosphorylation for cancer progression. Oncogene 2017, 36(50):6850–6862. Su X, Li T, Liu Z, Huang Q, Liao K, Ren R, Lu L, Qi X, Wang M, Chen J et al : Licochalcone A activates Keap1-Nrf2 signaling to suppress arthritis via phosphorylation of p62 at serine 349. Free Radic Biol Med 2018, 115:471–483. Pan M, Hu T, Lyu J, Yin Y, Sun J, Wang Q, Xu L, Hu H, Wang C: CSNK1A1/CK1alpha suppresses autoimmunity by restraining the CGAS-STING1 signaling. Autophagy 2024, 20(2):311–328. Pilli M, Arko-Mensah J, Ponpuak M, Roberts E, Master S, Mandell MA, Dupont N, Ornatowski W, Jiang S, Bradfute SB et al : TBK-1 promotes autophagy-mediated antimicrobial defense by controlling autophagosome maturation. Immunity 2012, 37(2):223–234. Schlutermann D, Berleth N, Deitersen J, Wallot-Hieke N, Friesen O, Wu W, Stuhldreier F, Sun Y, Berning L, Friedrich A et al : FIP200 controls the TBK1 activation threshold at SQSTM1/p62-positive condensates. Sci Rep 2021, 11(1):13863. Lau A, Wang XJ, Zhao F, Villeneuve NF, Wu T, Jiang T, Sun Z, White E, Zhang DD: A noncanonical mechanism of Nrf2 activation by autophagy deficiency: direct interaction between Keap1 and p62. Mol Cell Biol 2010, 30(13):3275–3285. Jain A, Lamark T, Sjottem E, Larsen KB, Awuh JA, Overvatn A, McMahon M, Hayes JD, Johansen T: p62/SQSTM1 is a target gene for transcription factor NRF2 and creates a positive feedback loop by inducing antioxidant response element-driven gene transcription. J Biol Chem 2010, 285(29):22576–22591. Kaarniranta K, Blasiak J, Liton P, Boulton M, Klionsky DJ, Sinha D: Autophagy in age-related macular degeneration. Autophagy 2023, 19(2):388–400. Zhang W, Feng C, Jiang H: Novel target for treating Alzheimer's Diseases: Crosstalk between the Nrf2 pathway and autophagy. Ageing Res Rev 2021, 65:101207. Sanchez-Martin P, Saito T, Komatsu M: p62/SQSTM1: 'Jack of all trades' in health and cancer. FEBS J 2019, 286(1):8–23. Chen R, Zhao Y, Huang Y, Yang Q, Zeng X, Jiang W, Liu J, Thrasher JB, Forrest ML, Li B: Nanomicellar TGX221 blocks xenograft tumor growth of prostate cancer in nude mice. Prostate 2015, 75(6):593–602. Grigolon G, Araldi E, Erni R, Wu JY, Thomas C, La Fortezza M, Laube B, Pohlmann D, Stoffel M, Zarse K et al : Grainyhead 1 acts as a drug-inducible conserved transcriptional regulator linked to insulin signaling and lifespan. Nat Commun 2022, 13(1):107. Morita K, Hama Y, Izume T, Tamura N, Ueno T, Yamashita Y, Sakamaki Y, Mimura K, Morishita H, Shihoya W et al : Genome-wide CRISPR screen identifies TMEM41B as a gene required for autophagosome formation. J Cell Biol 2018, 217(11):3817–3828. Chen R, Zeng X, Zhang R, Huang J, Kuang X, Yang J, Liu J, Tawfik O, Thrasher JB, Li B: Cav1.3 channel α1D protein is overexpressed and modulates androgen receptor transactivation in prostate cancers. Urol Oncol 2014, 32(5):524–536. Watson WH, Pohl J, Montfort WR, Stuchlik O, Reed MS, Powis G, Jones DP: Redox potential of human thioredoxin 1 and identification of a second dithiol/disulfide motif. J Biol Chem 2003, 278(35):33408–33415. Liao X, Tang S, Thrasher JB, Griebling TL, Li B: Small-interfering RNA-induced androgen receptor silencing leads to apoptotic cell death in prostate cancer. Mol Cancer Ther 2005, 4(4):505–515. Eugenin von Bernhardi J, Dimou L: Recent Advances in Live Imaging of Cells of the Oligodendrocyte Lineage. Methods Mol Biol 2019, 1936:275–294. Additional Declarations (Not answered) Supplementary Files TableS1PC3XenoRNAseqDEG.xlsx Tables S1: RNA sequencing analysis results of Alternol-treated xenograft tumor tissues derived from prostate cancer PC-3 cells Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8586285","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":573850428,"identity":"02caeadd-016e-4b79-8fc2-814425a94bfa","order_by":0,"name":"Benyi Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAlElEQVRIiWNgGAWjYBACA3bGxocNUDaRWpgZmw1J1cLAJkmaFnNm5rbKmW3b5BnYm7dJEKXFspmx7ebGttuGDTzHyojTYnAYqOVh2+0EBokcM+K1FIK1yL8hQQvjRrAtPERqAfqlWXLGuduGbTxpxRZEaTFnb3/4safstjw/++GNN4jSAgdspCkfBaNgFIyCUYAXAAB7NCwh6WQDNQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0001-6242-5117","institution":"KUMC","correspondingAuthor":true,"prefix":"","firstName":"Benyi","middleName":"","lastName":"Li","suffix":""},{"id":573850429,"identity":"f95ef7a9-045e-48e4-98a0-6a8ca17cec7c","order_by":1,"name":"Wang Liu","email":"","orcid":"https://orcid.org/0009-0002-9698-9599","institution":"KUMC","correspondingAuthor":false,"prefix":"","firstName":"Wang","middleName":"","lastName":"Liu","suffix":""},{"id":573850430,"identity":"f308bfab-29ce-4af7-8817-3594dff692a5","order_by":2,"name":"Jiang Zhao","email":"","orcid":"","institution":"The Affiliated Hospital of Guangdong Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jiang","middleName":"","lastName":"Zhao","suffix":""},{"id":573850431,"identity":"557c7305-3ef8-4959-a460-390973f34c2e","order_by":3,"name":"Changlin Li","email":"","orcid":"","institution":"The Second Hospital of Tianjin Medical University","correspondingAuthor":false,"prefix":"","firstName":"Changlin","middleName":"","lastName":"Li","suffix":""},{"id":573850432,"identity":"37d0a387-0776-4eb9-898e-e034cbe122fc","order_by":4,"name":"Haixia Xu","email":"","orcid":"","institution":"KUMC","correspondingAuthor":false,"prefix":"","firstName":"Haixia","middleName":"","lastName":"Xu","suffix":""},{"id":573850433,"identity":"79f340c7-fd32-40f5-a8cd-472b0dfb71a9","order_by":5,"name":"Ruibao Chen","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ruibao","middleName":"","lastName":"Chen","suffix":""},{"id":573850434,"identity":"81b879e9-f03e-4a51-b751-6981040449c9","order_by":6,"name":"Xing Zeng","email":"","orcid":"","institution":"KUMC","correspondingAuthor":false,"prefix":"","firstName":"Xing","middleName":"","lastName":"Zeng","suffix":""},{"id":573850435,"identity":"f9f5c30f-a860-4a45-aed3-ea7e00db183b","order_by":7,"name":"Jun Yang","email":"","orcid":"","institution":"KUMC","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Yang","suffix":""},{"id":573850436,"identity":"bbbbcdde-b009-4f7c-940b-8617e7340144","order_by":8,"name":"Cuncong Zhong","email":"","orcid":"","institution":"KU","correspondingAuthor":false,"prefix":"","firstName":"Cuncong","middleName":"","lastName":"Zhong","suffix":""},{"id":573850437,"identity":"e63705e4-b178-467b-89ec-6b7cd5a443c1","order_by":9,"name":"Xiangwei Wang","email":"","orcid":"","institution":"Shenzhen University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xiangwei","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2026-01-13 02:20:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8586285/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8586285/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100682217,"identity":"13195bcb-7162-472b-8c55-714032c6fee8","added_by":"auto","created_at":"2026-01-20 12:20:16","extension":"jpg","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2078891,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/56a7d12542067dce2ed1bc0e.jpg"},{"id":100682223,"identity":"7e22d1db-9182-4a6e-b5ed-337c529dd96d","added_by":"auto","created_at":"2026-01-20 12:20:25","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":960220,"visible":true,"origin":"","legend":"","description":"","filename":"SQSTM1ProteinOxidationWLforCCD.docx","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/64db72c1717887501dc6f2c3.docx"},{"id":100682322,"identity":"147f165e-f935-4ad0-9472-c2787e629160","added_by":"auto","created_at":"2026-01-20 12:21:24","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1321030,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/0205637ac6b6dd4a53e3e704.jpg"},{"id":100682096,"identity":"735a8f88-fcfa-4565-b78c-de9e59c3c666","added_by":"auto","created_at":"2026-01-20 12:19:36","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1276944,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/c6c6048120d7a500792d235c.jpg"},{"id":100682051,"identity":"015baf5b-dbee-4263-a768-b5de2b6fc747","added_by":"auto","created_at":"2026-01-20 12:18:24","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2203129,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/33ecf2f90de60be731655244.jpg"},{"id":100682146,"identity":"c7706b50-b382-4728-9aa1-5d7278d91647","added_by":"auto","created_at":"2026-01-20 12:19:58","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2611538,"visible":true,"origin":"","legend":"","description":"","filename":"Fig5X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/0046e514a52c9db4f7cbb924.jpg"},{"id":100682354,"identity":"f91c8eef-97ee-409c-8026-122cae907c70","added_by":"auto","created_at":"2026-01-20 12:22:06","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2242762,"visible":true,"origin":"","legend":"","description":"","filename":"Fig6X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/ad5a5a9b1d6771aa19dc7865.jpg"},{"id":100682063,"identity":"789609ee-e9e5-431a-89a7-3fa6277990a3","added_by":"auto","created_at":"2026-01-20 12:18:27","extension":"json","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10355,"visible":true,"origin":"","legend":"","description":"","filename":"CDDIS260293.json","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/aefb524b5b8ba02719464ce0.json"},{"id":100682662,"identity":"8287b21c-a05f-43e2-bee3-54511abfb942","added_by":"auto","created_at":"2026-01-20 12:24:04","extension":"xlsx","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5209938,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1PC3XenoRNAseqDEG.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/cdfe9b63deadb8a15aff5c30.xlsx"},{"id":100682090,"identity":"791c5f37-40a3-4d16-a548-9af2341e34d2","added_by":"auto","created_at":"2026-01-20 12:19:22","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":176999,"visible":true,"origin":"","legend":"","description":"","filename":"CDDIS2602930enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/7e8dd391ff23f25967999c32.xml"},{"id":100682065,"identity":"a7437387-de5e-48bd-8d17-ae22390fcb9c","added_by":"auto","created_at":"2026-01-20 12:18:29","extension":"jpg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2078891,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/f1091a19b591d40d8e9c83da.jpg"},{"id":100682095,"identity":"c867f685-9e3c-437d-a58a-02736e65abd7","added_by":"auto","created_at":"2026-01-20 12:19:30","extension":"jpg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1321030,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/4c1c191d810c533a72e2336e.jpg"},{"id":100682344,"identity":"42a29777-7f9f-49c4-82b9-0f7dca7f76ad","added_by":"auto","created_at":"2026-01-20 12:21:59","extension":"jpg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1276944,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/725713197f73943bd4d073d6.jpg"},{"id":100682093,"identity":"4049ef92-26e2-4a81-9fa6-35f3c4aafd0c","added_by":"auto","created_at":"2026-01-20 12:19:28","extension":"jpg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2203129,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/ffc0883300e41afde319103f.jpg"},{"id":100682123,"identity":"8ca1596f-d619-4d70-a2aa-b2c8f40c9b00","added_by":"auto","created_at":"2026-01-20 12:19:54","extension":"jpg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2611538,"visible":true,"origin":"","legend":"","description":"","filename":"Fig5X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/d3122759e9aec7f28a5516a1.jpg"},{"id":100682219,"identity":"a116372a-8af4-488b-bfee-bd1388c62145","added_by":"auto","created_at":"2026-01-20 12:20:21","extension":"jpg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2242762,"visible":true,"origin":"","legend":"","description":"","filename":"Fig6X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/fbe87ad893c7a51b5f8481b7.jpg"},{"id":100682347,"identity":"2ffb8667-1869-4638-8155-16983d9df580","added_by":"auto","created_at":"2026-01-20 12:22:03","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":251862,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig1X4x100.png","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/c2a1da24a17d15540f527658.png"},{"id":100682348,"identity":"858ac995-8aa3-4f63-8425-549ac2a10d72","added_by":"auto","created_at":"2026-01-20 12:22:03","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":159529,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig2X4x100.png","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/b938f12df8345a396bc70b9c.png"},{"id":100682271,"identity":"89cd91bd-b08b-47cd-b01f-84885fd3e971","added_by":"auto","created_at":"2026-01-20 12:20:47","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":193808,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig3X4x100.png","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/e7d2c61aa338e9760ba3f11a.png"},{"id":100681984,"identity":"47ca646d-4e65-4c1b-83b2-4bd2379c3611","added_by":"auto","created_at":"2026-01-20 12:16:56","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":275662,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig4X4x100.png","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/ffc2ac10bf569bd58a20436c.png"},{"id":100682220,"identity":"817a108e-9998-4771-8bec-4a468051a854","added_by":"auto","created_at":"2026-01-20 12:20:21","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":207039,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig5X4x100.png","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/3cea4d71ddaf5b47149ab5e5.png"},{"id":100682124,"identity":"9ffe3970-63d0-4f11-a6db-616128f4f44d","added_by":"auto","created_at":"2026-01-20 12:19:56","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":253667,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig6X4x100.png","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/f897a380d082cb36ef73539a.png"},{"id":100682151,"identity":"c7323605-1237-482a-a146-0131672392fd","added_by":"auto","created_at":"2026-01-20 12:20:04","extension":"xml","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":175446,"visible":true,"origin":"","legend":"","description":"","filename":"CDDIS2602930structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/71ac60000a3509bdd860ec4b.xml"},{"id":100682046,"identity":"620fedfd-2f19-4312-bcce-590940fff4b1","added_by":"auto","created_at":"2026-01-20 12:18:08","extension":"html","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":190945,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/8c35619be50214f0e826e700.html"},{"id":100682050,"identity":"944bda4c-70a2-494a-9846-0bf7ee80d42e","added_by":"auto","created_at":"2026-01-20 12:18:24","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2078891,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAlternol treatment induces multiple transcriptomic alterations.\u003c/strong\u003e (A-F) GSEA analysis was performed using the RNA-seq dataset obtained from Alternol-treated PC-3 cell-derived xenografts, as reported previously [11]. The visualization of the results was conducted at the web-based bioinformatic platform Xiantao Scholar (\u003ca href=\"http://www.xiantaozi.com/\"\u003ewww.xiantaozi.com\u003c/a\u003e). (G) PC-3 cells were transfected with the pMXs-GFP-LC3-RFP plasmid for 48 h and then treated with Alternol (10 μM) for 4-8 h. Fluorescent microscopic images were taken under a confocal microscope. (H) Quantitative data for the LC3 puncta per cell (LC3 dots) were summarized. ** p \u0026lt; 0.01, Student t-test. (I) PC-3 cells were treated with Alternol (10 μM) with/without N-Ac (5 mM) for 6 h, followed by transmission electron microscopy. (J) PC-3 cells were treated with Alternol (10 μM) with/without N-Ac (5 mM) for 4, 8, 16 h. Cells were harvested for Western blot analysis with the indicated antibodies. An actin blot was used for protein loading control.\u003c/p\u003e","description":"","filename":"Fig1X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/fa5197c28ff4a2f346e0e0a7.jpg"},{"id":100682072,"identity":"026ad5ef-fcd8-4b1c-9b45-7996a3cdc0d6","added_by":"auto","created_at":"2026-01-20 12:18:35","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1321030,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAlternol treatment activated the LKB1/AMPK pathway.\u003c/strong\u003e (A) PC-3 cells were treated with Alternol (10 μM) at different times (0, 4, 8, 16 h). Protein band density data were generated using the NIH ImageJ software. (B \u0026amp; C) The relative values of protein band density were calculated after normalization against Actin bands. The solvent control was set to a value of 1. (D) PC-3 cells were treated with Alternol (10 μM) with/without N-Ac for 6 h, as indicated, followed by Western blot assay. (E \u0026amp; F) The relative values of protein band density were calculated after normalization against Actin blot bands. The solvent control was set to a value of 1. (G) PC-3 cells were treated as indicated for 4 h, followed by a Western blot assay. Note: Alternol (10 mM), STO-609 (10 mM), BATPA (10 mM), PKCz-I (10 mM). (H) The relative values of pAMPK (T172) protein band density were calculated after normalization against AMPK and Actin bands. The solvent control was set to a value of 1.\u003c/p\u003e","description":"","filename":"Fig2X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/553b11bfef32e0806ff656cb.jpg"},{"id":100682088,"identity":"95e4a0ce-7ee7-49a5-a945-b5f79d183d9e","added_by":"auto","created_at":"2026-01-20 12:19:21","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1276944,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAlternol induces p62 protein aggregation.\u003c/strong\u003e\u0026nbsp; (A) PC-3 cells were treated with Alternol (10 μM) for different periods as indicated (the first half panel). PC-3 cells were pre-treated with N-Ac (5 mM) for 30 min, followed by Alternol (10 mM) for 4 h (the second half panel).(B) PC-3 cells were treated with Alternol at different concentrations as indicated for 4 h. (C) DU145 cells were treated with Alternol (10 mM) for up to 8 h and were harvested for western blot assay. (D) Protein lysates extracted from PC-3 cell-derived xenograft tissues of the solvent control group (C1-C3) and Alternol-treated group (T1-T4) were used for the western blot assays. Xenograft establishment and treatment were described in our previous publication [12]. (E)\u0026nbsp;\u0026nbsp; PC-3 cells treated with or without Alternol (10 μM) for 4 h. The RIPA buffer-based cellular lysates were heated in PBS or DTT (100 mM) at 95 ℃ for 5 min before the Western blot assay. (F) PC-3 cells were pre-treated with N-Ac (5 mM) for 30 min, followed by the solvent, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2 \u003c/sub\u003e(200 mM), or L-Arginine (0.5 mM) treatment for 6 h. (G) PC-3 cells were treated with the solvent DMSO, Alternol (10 mM), or Auranofin (5 mM) for 6 h. Whole cell lysates were subjected to a Western blot assay. (H) PC-3 or BPH1 cells were treated with chloroquine (5 μM) or rapamycin (0.5 μM) as indicated for 6 h.\u0026nbsp;\u003c/p\u003e","description":"","filename":"Fig3X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/6317ee2639b96ef8a26f3b31.jpg"},{"id":100682148,"identity":"38d9f212-9126-4d8a-99bb-1bb8f3e8fd62","added_by":"auto","created_at":"2026-01-20 12:20:01","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2203129,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ep62 protein aggregation is driven by protein oxidation rather than phosphorylation, ubiquitination, or impaired degradation.\u003c/strong\u003e (A) PC-3 cells were pre-treated with N-Ac (5 mM) for 30 min, followed by Alternol (10 mM) for the periods as indicated. (B) PC-3 cells were pre-treated with the solvent DMSO, BKM120 (5 mM), PD184161 (10 mM), or TDZD8 (5 mM) for 30 min, followed by Alternol (10 mM) for 6 h. (C) PC-3 cells were pre-treated with the solvent DMSO, STO-609 (10 mM), BAPTA (20 mM), or PKCz-i (5 mM) for 30 min, followed by Alternol (10 mM) for 6 h. (D) PC-3 cells were treated with the solvent DMSO or Alternol (10 mM) for 4 h. Equal amounts of cellular proteins were used for anti-p62 immunoprecipitation followed by anti-ubiquitin (anti-Ub) immunoblotting (middle panel). Whole cellular proteins were used for western blot assays with the antibodies for p62 (left panel) or ubiquitin (right panel), as indicated. (E) PC-3 cells were transiently transfected with p62WT or p62K7A/D69A mutant constructs, as indicated. Mock transfection was conducted as the control. Transfected cells were treated with the solvent DMSO, Alternol (10 mM), or Rapamycin (0.25 mM) for 6 h. (F) PC-3 cells were pre-treated with the solvent DMSO, chloroquine (CQ, 5 mM), N-Ac (5 mM), or MG132 (10 μM) for 30 min, followed by Alternol treatment (10 μM) for 6 h. (G) HEK-293T cells were transiently transfected with the constructs as indicated. After treatment with N-Ac or Alternol alone or in combination, cells were subjected to protein carbonylation assay. \u003cu\u003eThe upper panel\u003c/u\u003e: equal amounts of cellular proteins were subjected to anti-Biotin blotting, Actin blot served as the protein loading control; \u003cu\u003eThe lower panel\u003c/u\u003e: equal amounts of proteins were subjected to streptavidin pulldown, followed by anti-p62 blotting. (H) The relative band density for oxidized proteins or p62 levels was calculated against the Alternol treatment samples (set a value of 100). (I) PC-3 cells stably transfected with p62 wild-type or C105/113A mutant constructs were treated with N-Ac, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (200 mM), or in combination for 4 h. (J) The relative band density for p62 aggregates was calculated against H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e-treated p62/WT samples (set as value of 100). (K) PC-3 cells stably transfected with p62/WT or C105/113A mutant constructs were treated with the solvent DMSO or Alternol (10 mM) for the periods as indicated.\u0026nbsp; (L) The relative band density for LC-3b proteins was calculated against Alternol-treated p62/WT for 2 h samples (set as value of 10).\u003c/p\u003e","description":"","filename":"Fig4X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/32b49baf014bebd528464358.jpg"},{"id":100682082,"identity":"1ff3667b-9787-4701-9a4b-1aa564c346f9","added_by":"auto","created_at":"2026-01-20 12:19:07","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2611538,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSQSMT1/p62C105/133 mutation attenuates Nrf2 activation.\u003c/strong\u003e (A) C4-2B cells were pre-treated with the solvent DMSO or Alternol (10 μM) for different periods, as indicated. (B) PC-3 or C4-2B cells were treated with the solvent or Alternol (10 μM) for 4 h, as indicated. The upper panel: Equal amounts of cellular proteins were subjected to anti-p62 immunoprecipitation, followed by anti-KEAP1 western blots; The lower panel: whole cell lysates were subjected to regular western blot assay. (C \u0026amp; D) C4-2B or PC-3 cells stably transfected with p62/WT or C105/113A mutant constructs were transiently transfected with the Nrf2-LUC reporter plasmid for 48 h, followed by treatment with the solvent DMSO or Alternol (10 mM) for 2-4 h. Cells were harvested and lysed in a lysis buffer. Luciferase reporter activity was measured with the Luciferase Assay System (Promega E1501). * p \u0026lt; 0.05; ** p \u0026lt; 0.01, student t-test. The relative Nrf2-LUC reporter activity was calculated against the DMSO-treated p62/WT cells. (E \u0026amp; F) C4-2B or PC-3 cells stably transfected with p62/WT or p62C105/113A constructs, as indicated, were treated with the solvent DMSO or Alternol (10 μM) for 2-8 h. Cells were treated with Alternol (10 μM) for 2-8 h. Total cellular RNAs were extracted for real-time qPCR assays with the primers for the AOX1 gene. (G)22RV1 cells stably transfected with p62/WT or p62C105/113A constructs, as indicated, were treated with Alternol (10 μM) for different periods (2, 4, 8 h). (H) The relative protein band density for Nrf-2 or KEAP1 was calculated against the p62/WT 2 h treatment samples (set the value of 100).\u003c/p\u003e","description":"","filename":"Fig5X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/9b5eaf90e23241de0d80b67e.jpg"},{"id":100682352,"identity":"eb079551-49f7-43d1-9402-2127922352cb","added_by":"auto","created_at":"2026-01-20 12:22:04","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2242762,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSQSTM1/p62 knockout abolishes Nrf2 activation and sensitizes Alternol-induced cell death.\u003c/strong\u003e (A) PC-3 cells were pre-treated with the solvent DMSO or chloroquine for 30 min, followed by Alternol (10 μM) for the periods, as indicated. (B) C4-2B cells stably transfected with p62/WT or p62C105/113A construct were seeded in a 6-well plate, grown overnight, and then treated with Alternol (0, 2.5, 5.0 μM) for 24 h. After fixation, cells were stained with 0.2% gentian violet for 5 min and washed with double-distilled water 3 times.(C) PC-3 or C4-2B cells were transfected with CRISPR/Cas9 plasmids for gene editing. Stable clones with successful selection. SQSTM1/p62 gene knockout was confirmed in the western blot assay. (D) PC-3 stable p62/KO or p62/WT subline cells were transiently transfected with the Nrf2-LUC reporter constructs for 48 h, followed by treatment with the solvent DMSO or Alternol (sublethal concentration at 5 μM) for 4 h. Cellular proteins were harvested for luciferase assays. The data were representative of three independent experiments. *** p \u0026lt; 0.001, Student t-test. (E) Stable PC-3 subline cells with p62/KO or p62/WT were treated with the solvent DMSO or Alternol (2.5 μM) for 16 h. Apoptotic cell death was assessed with an Annexin V/PI staining assay. Representative images were shown (panel C), and quantitative data were summarized in panel (F) Quantitative data from the Annexin-V/PI assay were summarized. * p \u0026lt; 0.05, Student t-test. (G) The p62/WT and p62 KO subline C4-2B cells were treated with the solvent or Alternol (10 μM) for 16 h. Cellular proteins were subjected to Western blot assays with the antibodies as indicated. (H)Mechanism of Alternol-induced pro-survival autophagic response via p62 C105/113 oxidation and aggregation\u003c/p\u003e","description":"","filename":"Fig6X4x100.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/f7121f5bf76cf274fe164882.jpg"},{"id":102295709,"identity":"4d896f87-d781-4a8b-8f4d-c0674f19c940","added_by":"auto","created_at":"2026-02-10 10:14:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7725427,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/aa4d6b4b-f42b-409b-bed4-db71c4ca7825.pdf"},{"id":100682084,"identity":"9d16dfda-4d67-4a53-b1f5-6f60df7e0e1f","added_by":"auto","created_at":"2026-01-20 12:19:14","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":5209938,"visible":true,"origin":"","legend":"Tables S1: RNA sequencing analysis results of Alternol-treated xenograft tumor tissues derived from prostate cancer PC-3 cells","description":"","filename":"TableS1PC3XenoRNAseqDEG.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8586285/v1/bcafe2cbe9929b537df0f522.xlsx"}],"financialInterests":"(Not answered)","formattedTitle":"SQSTM1/p62 Protein Oxidation Facilitates Nrf2 Activation and Pro-survival Autophagy under Therapeutic Oxidative Stress","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eSequestosome 1 (SQSTM1/p62) protein has multiple functions involved in various cellular processes, such as autophagy, protein quality control, and antioxidant signaling [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Autophagy is a cellular process involved in the degradation of cellular components and is mediated by ROS-dependent pathways \u003cem\u003evia\u003c/em\u003e ROS-FOXO3-LC3/BNIP3 or ROS-Nrf2-SQSTM1/p62 mechanisms in human cancer cells [\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Its oxidation due to oxidative stress was recently shown as a critical regulatory switch influencing its functions and impacting cellular health [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. SQSTM1/p62 protein contains several cysteine residues susceptible to oxidation by ROS. These modifications can generate sulfenic acid, disulfide bonds, or other oxidized forms, altering the structure and function of SQSTM1/p62. Oxidized p62 exhibits enhanced interaction with ubiquitinated proteins, promoting their recruitment to autophagosomes for degradation [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. This can be beneficial in clearing damaged proteins and maintaining cellular homeostasis under stress conditions [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Furthermore, SQSTM1/p62 oxidation might modulate its interaction with signaling proteins, affecting cell survival, inflammation, and stress response pathways.\u003c/p\u003e \u003cp\u003eAlternol is a small natural compound derived from the fermented extracts of a mutant fungus \u003cem\u003eAlternaria alternate var. monosporus\u003c/em\u003e [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Our previous studies demonstrated that Alternol elicited a significant ROS accumulation and triggered apoptotic cell death preferentially in prostate cancer cells while leaving benign prostate epithelial cells [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. We also demonstrated that Alternol-induced ROS accumulation was responsible for eliciting ER stress response and triggering immunogenic cell death [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In this report, we examined the cellular responses at the transcriptional level induced by Alternol treatment. Our findings revealed a dramatic transcriptome alteration related to autophagy induction. Further investigation revealed that the autophagic receptor SQSTM1/p62 protein was oxidized \u003cem\u003evia\u003c/em\u003e a superoxide-dependent mechanism, resulting in p62 protein aggregation and autophagy induction. In addition, SQSTM1/p62 protein oxidation was linked to KEAP1 degradation and subsequent Nrf2 pathway activation, leading to pro-survival autophagy.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAlternol treatment elicited selective autophagy and the Nrf2 antioxidant pathway in prostate cancer cells\u003c/h2\u003e \u003cp\u003eWe previously reported that Alternol induced cell death preferentially in malignant cells \u003cem\u003evia\u003c/em\u003e superoxide-dependent apoptosis, triggered ER stress-related immunogenic cell death (ICD), and disturbed mitochondrial ATP production in xenograft tumor models [\u003cspan additionalcitationids=\"CR9 CR10 CR11 CR12 CR13 CR14\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo investigate the molecular mechanisms underlying Alternol\u0026rsquo;s anti-tumor effects, we analyzed the transcriptomic alterations in Alternol-treated xenograft tumor tissues derived from prostate cancer PC-3 cells [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. There were 101 upregulated and 66 downregulated genes exceeding the log\u003csub\u003e2\u003c/sub\u003eFC\u0026thinsp;\u0026gt;\u0026thinsp;2-fold level (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Gene set enrichment analysis (GSEA) revealed that Alternol treatment activated the oxidative stress response (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), proinflammatory (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), and IL10 signaling pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), in addition to danger signal response pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). These findings are consistent with our recent reports indicating that Alternol induces ICD mediated by oxidative stress and proinflammatory mediators/danger signal response pathways in prostate cancer cells [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Crucially, the GSEA also revealed the elicitation of selective autophagy (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE) and the Nrf2 antioxidant pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF), both of which were selected for detailed investigation in the current study.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo validate these transcriptomic findings, we verified the autophagy response in PC-3 cells using three complementary approaches. First, we utilized the tandem fluorescent probe (pMXs/GFP-LC3-RFP [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]), a standard marker for monitoring autophagy flux, to distinguish between early (GFP/RFP colocalization) and late (RFP-only) autophagic phases [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Following transient transfection and Alternol treatment for 4\u0026ndash;8 hours, we observed a significant accumulation of both GFP/RFP puncta at 4 hours (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG), which is characteristic of an early autophagic response [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The subsequent increase in RFP-only puncta at 8 hours provided clear evidence of an active autophagy flux in Alternol-treated cells [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The quantitative data of LC-3 puncta were summarized in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH.\u003c/p\u003e \u003cp\u003eSecond, transmission electron microscopy (TEM) was performed to analyze the morphological autophagy features after Alternol treatment. TEM images clearly displayed the massive formation of cytoplasmic vacuoles, a morphological feature of autophagy, which was completely abolished in cells pretreated with the reactive oxygen species (ROS) scavenger N-Ac (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI).\u003c/p\u003e \u003cp\u003eThirdly, we analyzed the processing of microtubule-associated protein 1A/1B-light chain-3 (LC-3), a critical component in autophagy induction [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Our results showed clear evidence of LC-3 biosynthesis (increased LC-3β-I) and processing (increased LC-3β-II) after Alternol treatment in a ROS-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ). This autophagy response was accompanied by PARP cleavage and caspase-3 processing at the late time point (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ), consistent with our previous report [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Taken altogether, these data suggest that Alternol treatment triggers an oxidative stress-dependent autophagy response in prostate cancer cells.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eLKB1-AMPK pathway activation was responsible for Alternol-induced autophagy\u003c/h3\u003e\n\u003cp\u003eTo elucidate the underlying mechanism responsible for the Alternol-induced autophagic response, we first examined the LKB1-AMPK signaling pathway, a key modulator of cellular autophagy induction [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Our results revealed that Alternol treatment dramatically increased the phosphorylation of LKB1 at the activating Ser307 site [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], while concurrently decreasing the phosphorylation level at the inhibitory Ser428 site [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Consistent with LKB1 activation, we observed a parallel increase in the phosphorylation of its downstream effector, AMPK, at the active Thr172 site [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Simultaneously, phosphorylation at the inhibitory Ser487 site of AMPK [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] was markedly decreased in a time-dependent manner after Alternol treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Quantitative densitometry analysis supported these alterations in LKB1/AMPK phosphorylation status (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB \u0026amp; \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Furthermore, pretreatment with N-Ac fully reversed all Alternol-induced alterations in LKB1 and AMPK phosphorylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). These data suggest that Alternol treatment activates the LKB1-AMPK pathway in an oxidative stress-dependent manner, serving as an upstream signal for autophagy induction.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo determine if Ca\u003csup\u003e2+\u003c/sup\u003e/Calmodulin-dependent protein kinase kinase (CaMKK) contributed to LKB1/AMPK pathway activation [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], we tested the effects of the CaMKK inhibitor, STO-609 [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and the calcium-specific chelator, BAPTA [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], on Alternol-induced AMPK phosphorylation. Our results showed that STO-609 pretreatment largely reduced the basal level of AMPK Thr172 phosphorylation, it had no significant inhibitory effect on the Alternol-induced increase in AMPK Thr172 phosphorylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG \u0026amp; \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). Conversely, BAPTA pretreatment significantly reduced the Alternol-induced AMPK Thr172 phosphorylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). These data indicate that while CaMKK may be responsible for maintaining basal AMPK activity, cellular calcium signaling is specifically and critically involved in the Alternol-induced activation of AMPK Thr172 phosphorylation.\u003c/p\u003e \u003cp\u003eIt was reported that protein kinase C\u003csub\u003eζ\u003c/sub\u003e (PKC\u003csub\u003eζ\u003c/sub\u003e) modulated LKB1-AMPK activation [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. We assessed the effect of a myristylated PKC\u003csub\u003eζ\u003c/sub\u003e pseudo-substrate inhibitor [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] on Alternol-induced AMPK phosphorylation. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG, pretreatment with the PKC\u003csub\u003eζ\u003c/sub\u003e pseudo-substrate inhibitor had no obvious inhibitory effect on Alternol-induced AMPK phosphorylation at the Thr172 site, suggesting that PKC\u003csub\u003eζ\u003c/sub\u003e was not involved in Alternol-induced AMPK activation. This indicates that PKC\u003csub\u003eζ\u003c/sub\u003e is not involved in the mechanism of Alternol-induced AMPK activation in PC-3 cells.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAlternol induced p62 protein aggregation in response to oxidative stress.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSQSTM1/p62 protein is a well-known selective autophagy receptor that is typically degraded alongside its cargo proteins upon autophagy induction [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. We examined SQSTM1/p62 protein levels during Alternol-induced autophagy and, unexpectedly, detected a significant accumulation of high-molecular-weight bands containing the p62 protein. These aggregates appeared in Alternol-treated cells starting at 4 hours post-treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The formation of these high-molecular-weight p62 bands was abolished by N-Ac pretreatment, indicating an oxidative stress-mediated response, as previously reported [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Alternol induced p62 protein aggregation in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Similarly, Alternol induced p62 aggregation in DU145 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), despite these cells being relatively insensitive to Alternol-induced cell death [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Consistently, similar high-molecular-weight bands of p62 protein aggregates were observed in PC-3 cell-derived xenografts following Alternol treatment. This was accompanied by increased LC-3 protein biosynthesis (LC-3β-I) and processing (LC-3β-II) compared to the solvent control (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Notably, these high-molecular-weight bands were resistant to detergent and reducing agent DTT treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). These data indicated an attenuated consequence of SQSTM1/p62 protein during Alternol-induced ROS-dependent autophagic response \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eWe further investigated whether other ROS inducers could trigger similar SQSTM1/p62 aggregation. Our results showed that hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) induced the accumulation of p62 aggregates, whereas the nitric oxide inducer L-arginine did not (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Surprisingly, the inhibitor of redox-maintaining enzyme thioredoxin reductase (TrxR) Auranofin, a strong ROS-inducer [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], also did not cause p62 protein aggregation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Furthermore, Rapamycin, the mTOR inhibitor and autophagy inducer [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], did not cause p62 protein aggregation in malignant PC-3 cells but in benign prostatic cells BPH1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH), consistent with previous studies [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Combining Rapamycin with the autophagy blocker Chloroquine only slightly increased p62 aggregates in both cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). Collectively, these data suggest that Alternol treatment induces robust SQSTM1/p62 protein aggregation specifically due to superoxide-related oxidative stress in malignant cells. The different responses between malignant and benign cells following Alternol or Rapamycin treatment deserve further mechanistic investigation.\u003c/p\u003e\n\u003ch3\u003ep62 protein aggregation is driven by protein oxidation rather than phosphorylation, ubiquitination, or impaired degradation\u003c/h3\u003e\n\u003cp\u003eA previous report showed that p62 phosphorylation at the Ser403 site was linked to protein aggregation with polyubiquitinated proteins [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], while phosphorylation of p62 protein at Ser349 increased its affinity for the cargo KEAP1 protein [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. We investigated whether SQSTM1/p62 phosphorylation was involved in Alternol treatment-induced aggregation. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, p62 protein monomers were strongly phosphorylated at both S349 and S403 sites at a very late time point (about 12 h) after Alternol treatment, which was completely different from the protein aggregation pattern starting at 4 h. In addition, p62 phosphorylation at S349 but not S403 was observed in the aggregates (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Similar results were also observed in PC-3 xenograft tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Interestingly, N-Ac pre-treatment enhanced the phosphorylation at both sites on the monomers but abolished S349 phosphorylation on the aggregates (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). These results indicated that while S349 phosphorylation occurs within the aggregates, it is not the primary driver of aggregate formation, as the timeline of phosphorylation succeeds the initial aggregation event. The significance of enhanced SQSTM1/p62 monomer phosphorylation at S349/S403 by N-Ac pretreatment is under further investigation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo identify the signal pathways responsible for Alternol-induced p62 phosphorylation, we tested a few pharmacological inhibitors for their effect on p62 aggregation and phosphorylation. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, the pan-PI3K inhibitor BKM120 [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], pan-MAPK inhibitor PD184161 [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], and GSK-3 inhibitor TDZD8 [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] remarkably increased the levels of p62 protein aggregation and S349 phosphorylation, of which TDZD8 exhibited the strongest effect on both events. These inhibitors had only a very weak effect on p62S403 phosphorylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). These data suggest that PI3K, MAPK, and GSK-3 pathways are negative regulators for p62 protein aggregation and S349 phosphorylation in response to Alternol-induced oxidative stress.\u003c/p\u003e \u003cp\u003eWe further examined if calcium-dependent signaling was involved in p62 protein aggregation since our data showed calcium signaling involvement in Alternol-induced activation of the LKB1-AMPK pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Our results showed that BATPA pre-treatment slightly enhanced Alternol-induced p62 protein aggregation, while CAMKK inhibitor STO-609 and PKCζ peptide inhibitor had no obvious effect on p62 aggregation.\u003c/p\u003e \u003cp\u003eTo examine if SQSTM1/p62 aggregation was due to polyubiquitination, we conducted a co-immunoprecipitation assay. Co-immunoprecipitation showed that Alternol-induced p62 aggregates did not contain high-molecular-weight ubiquitin bands (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). It was reported that SQSTM1/p62 protein forms self-oligomers \u003cem\u003evia\u003c/em\u003e its Phox and Bem1p (PB1) domain during autophagy induction [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. We then used a mutant p62 protein with a defect in oligomerization (p62/K7A.D69A) [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] and examined its effect on Alternol-induced p62 aggregation. After transient transfection overnight, Alternol treatment strongly induced p62 protein aggregates in p62K7A/D69A mutant-transfected cells compared to the p62 wild-type (p62/WT) transfected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Rapamycin did not cause p62 aggregation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE), similar to the previous results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). These data suggest that p62 protein oligomerization was not involved in Alternol-induced aggregation. Furthermore, blocking the autophagic (Chloroquine) or proteasomal (MG132) degradation machineries did not increase aggregate levels, confirming that the accumulation is not due to a defect in protein clearance (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003eGiven recent findings that SQSMT1/p62 protein oxidation at cystine-105/113 (C105/113) residues, leading to p62 aggregation and autophagy activation in the Drosophila system [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], we used a biotin derivatization-based protein carbonylation assay to assess cellular protein oxidation, as described by our recent publication [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] and others [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. The SQSTM1/p62 gene mutation on the C105/113A plasmid was used to examine the mutation\u0026rsquo;s effect on p62 protein oxidation and aggregation. Our results showed that Alternol treatment caused a dramatic accumulation of oxidized cellular proteins, which was largely reduced by N-Ac pre-treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG upper panel \u0026amp; H). These data were in line with our recent publication [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Crucially, the p62/C105/113A mutation abolished p62 aggregation even without NAC (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG lower panel \u0026amp; H). These data were in line with the recent report for the involvement of p62 cystine-105/113 residues in protein oxidation and aggregation [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. We observed similar results with H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e treatment, where the C105/113A mutation largely prevented aggregation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI \u0026amp; J).\u003c/p\u003e \u003cp\u003eLastly, we examined the functional impact of the C105/113A mutation on Alternol-induced autophagic response. While Alternol induced a robust, time-dependent increase in LC3 protein processing in wild-type cells, this response was significantly attenuated in cells overexpressing the C105/113A mutant (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK \u0026amp; L). These data collectively demonstrate that Alternol-induced p62 aggregation is mediated by direct protein oxidation at Cys105/113, a process essential for the subsequent activation of the autophagic response.\u003c/p\u003e \u003cp\u003e \u003cb\u003eOxidation of p62 protein facilitates KEAP1 degradation and Nrf2 activation.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIt is well known that the SQSTM1/p62 protein is involved in Nrf2-mediated antioxidant protection [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Since our GSEA analysis showed Nrf2 pathway activation in Alternol-treated xenografts (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF), we verified the Nrf2 pathway activation induced by Alternol treatment. Our results demonstrated that Alternol treatment induced rapid Nrf2 activation, characterized by the accumulation of high-molecular-weight Nrf2 complexes [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], and a concomitant reduction in KEAP1 protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), possibly due to enhanced protein degradation [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Notably, these events synchronized with LC3 biosynthesis and processing, suggesting a functional link between Nrf2 activation and autophagy induction.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate the involvement of SQSTM1/p62 in KEAP1 degradation, we performed an anti-p62 co-immunoprecipitation (Co-IP) assay. In control cells, KEAP1 protein was robustly pulled down with p62; however, Alternol treatment led to a drastic reduction of KEAP1 in the p62-precipitated eluates (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, the upper panels). This reduction occurred in parallel with p62 aggregation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, the lower panels). Subsequent Nrf2 transactivation was confirmed by an Nrf2-responsive luciferase reporter assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC \u0026amp; \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD) and further validated by the upregulation of the Nrf2 target gene \u003cem\u003eAOX1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE \u0026amp; \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF) [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Critically, compared to the wild-type p62 protein, C105/113A mutant overexpression blunted Nrf2 transactivation, as documented in the Nrf2-driven luciferase reporter assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC \u0026amp; \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Furthermore, overexpression of p62C105/113A mutants also largely reduced Alternol-induced Nrf2 activation and delayed KEAP1 protein degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG \u0026amp; \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH). Collectively, these data suggest that p62 protein oxidation is a pivotal event in Altetnol-induced Nrf2 pathway activation under oxidative stress.\u003c/p\u003e \u003cp\u003e \u003cb\u003eOxidation of p62 protein is involved in pro-survival autophagic response.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo evaluate the functional significance of the Alternol-induced autophagic response, the autophagy blocker chloroquine (CQ) was used together with Alternol treatment. Apoptotic cell death was evaluated with the commonly used markers, caspase-3 processing and PARP cleavage [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Consistent with our previous report [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], caspase-3 processing and PARP cleavage were observed at 8 h after Alternol treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Notably, the combination of CQ and Alternol accelerated the apoptotic response, with markers appearing as early as 4 hours post-treatment, indicating that autophagy inhibition sensitizes cells to Alternol-induced apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe further investigated the role of p62 oxidation in cell survival by overexpressing the p62-C105/113A mutant. Compared to p62/WT overexpression of the C105/113A mutant significantly sensitized PC-3 cells to a sublethal dose of Alternol (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). These results suggest that p62 protein oxidation at these specific cysteine residues exerts a protective, pro-survival effect against Alternol-induced stress.\u003c/p\u003e \u003cp\u003eTo further evaluate the pro-survival effect of p62 protein, we generated SQSTM1/p62 gene knockout (p62KO) subline PC-3 and C4-2B cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). As expected, p62 deficiency blunted Alternol-induced Nrf2 transactivation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD) and markedly increased the sensitivity of PC-3 cells to Alternol-induced cell death at a sublethal (2.5 \u0026micro;M) concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE \u0026amp; \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). This sensitization was further evidenced by the absence of p62 protein aggregates and a concomitant increase in caspase-3 processing and PARP cleavage in p62-KO cells compared to p62-WT cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). Collectively, these data demonstrated that p62 protein oxidation at the C105/113 sites is a critical pro-survival event that drives Nrf2 activation and the autophagic response to counteract excessive oxidative stress induced by Alternol.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eIn our previous studies, we established that Alternol induces profound oxidative stress and preferential apoptotic cell death in cancer cells [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], alongside proinflammatory secretion and ICD [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In the present study, GSEA analysis of \u003cem\u003ein vivo\u003c/em\u003e xenograft transcriptomes not only corroborated these inflammatory signatures but also revealed significant enrichment in Nrf2 transactivation and autophagy pathways. These findings prompted a deeper investigation into the molecular bridge between oxidative stress and adaptive survival signaling.\u003c/p\u003e \u003cp\u003eTo characterize this autophagy response, we utilized multiple experimental approaches across both cancer cell lines and xenograft models. A pivotal and unexpected discovery of this study is the rapid and massive aggregation of SQSTM1/p62 following Alternol treatment. While the oxidation of SQSTM1/p62 at residues Cys105 and Cys113 has been recently identified as an evolutionary adaptive event under aging-related oxidative conditions [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], our data uniquely demonstrate that Alternol-induced oxidative stress drives these modifications into a robust, high-molecular-weight protein aggregation\u0026mdash;a structural transition not previously characterized in this context. This aggregation was independent of poly-ubiquitination, phosphorylation, or proteasomal impairment, as evidenced by its resistance to reducing agents and its occurrence in the absence of traditional degradative blocks.\u003c/p\u003e \u003cp\u003eCritically, we have identified this p62 aggregation as a pro-survival functional platform. Our results show that the physical formation of p62 aggregates is required for the efficient sequestration and subsequent degradation of KEAP1, which in turn facilitates rapid Nrf2 transactivation. By utilizing the p62 C105/113A oxidation-deficient mutant, we demonstrated that the loss of aggregation capacity blunts Nrf2 signaling and sensitizes cells to Alternol-induced death. This suggests that p62 oxidation-driven aggregation acts as a \"redox-shield,\" enabling cancer cells to clear damaged organelles and activate antioxidant defenses to withstand lethal therapeutic stress.\u003c/p\u003e \u003cp\u003eFurthermore, our study reveals a distinct temporal and functional decoupling between p62 oxidation/aggregation and its phosphorylation. Although p62 phosphorylation at Ser349 and Ser403 is traditionally linked to Nrf2 activation and ubiquitin-cargo binding [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan additionalcitationids=\"CR48\" citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], our results show that Alternol-induced Ser349 phosphorylation is a late-stage event (8 h), occurring significantly after the peak of Nrf2 activation (1\u0026ndash;2 h). Furthermore, the ROS scavenger N-Ac enhanced rather than abolished S349 phosphorylation on SQSTM1/p62 protein monomers. This suggests that while p62 oxidation and subsequent aggregation drive early Nrf2-mediated antioxidant responses, Ser349/S403 phosphorylation may represent a secondary or distinct regulatory phase. The potential role of kinases like TBK1 or CK2 in this context, and how phosphatases modulate these sites under Alternol-induced stress, warrants further investigation [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn conclusion, we have defined the survival significance of the p62 \"oxidation-aggregation\" axis under Alternol-induced stress. The fact that p62 knockout or the loss of its aggregation capacity (C105/113) significantly sensitizes prostate cancer cells to sublethal doses of Alternol suggests that this pathway is a major determinant of cancer cell resilience [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan additionalcitationids=\"CR53 CR54 CR55\" citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Although the precise molecular mechanism by which oxidized p62 aggregates facilitate KEAP1 turnover remains to be fully elucidated, our study provides a novel mechanistic rationale for targeting p62-mediated proteostasis to overcome adaptive resistance in pro-oxidant cancer therapies.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eIn summary, this study identifies Alternol as a potent inducer of a coordinated p62-Nrf2-autophagy survival axis in prostate cancer cells. The centerpiece of our findings is the discovery that Alternol-induced oxidative stress at Cys105/113 drives a rapid, large-scale aggregation of p62\u0026mdash;a structural transition that serves as a vital signaling platform for KEAP1 degradation. Unlike previously reported oxidation events, this p62 aggregation occurs independently of phosphorylation and serves as a primary \"redox sensor\" to activate antioxidant defenses. Our results demonstrate that genetic depletion of p62 or disruption of its aggregation capacity (C105/113) significantly sensitizes cancer cells to Alternol, shifting the cellular balance from adaptive survival toward apoptosis. These insights underscore p62 protein aggregation as a critical determinant of cancer cell resilience and a promising target for enhancing pro-oxidant therapeutic strategies (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH).\u003c/p\u003e"},{"header":"MATERIAL AND METHODS","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCell culture, special chemical reagents, plasmid constructs, and antibodies\u003c/h2\u003e \u003cp\u003eBenign prostatic hyperplasia-1 (BPH1), human embryonic kidney (HEK)-293T, prostate cancer PC-3, DU145, 22RV1, and C4-2B cell lines were obtained from ATCC (Manassas, VA) as described [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. BPH1, PC-3, 22RV1, and C4-2B cells were cultured in RPMI 1640 media containing 10% fetal bovine serum and 1% penicillin/ streptomycin in a 5% CO\u003csub\u003e2\u003c/sub\u003e humidified atmosphere at 37\u0026deg;C. HEK-293T and DU145 cells were cultured in DMEM media containing 10% fetal bovine serum and 1% penicillin/streptomycin in a 5% CO\u003csub\u003e2\u003c/sub\u003e humidified atmosphere at 37\u0026deg;C.\u003c/p\u003e \u003cp\u003eAlternol was obtained from Sungen Biosciences (Shantou, China). Chemicals of n-acetylcysteine (N-Ac), Chloroquine, STO-609, L-Arginine, PKC-ζ-inhibitor peptide, BATPA, Auranofin, and rapamycin were obtained from Cayman Chemicals (Arbor, MI, USA). The Luciferase assay system (E1501) was purchased from Promega (Madison, WI, USA). Hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) and Annexin V-FITC Apoptosis Detection Kit were obtained from Sigma-Aldrich (St Louis, MO, USA).\u003c/p\u003e \u003cp\u003eThe pGL4.27_ARE/NRF2-SPE luciferase reporter construct [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e] was a gift from Michael Ristow (Addgene plasmid # 177775). The pMXs-puroGFP-p62/K7A-D69A (Addgene#38281), pMXs-puroGFP-p62 [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e](Addgene#38277), and pMXs-GFP-LC3-RFP [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e] (Addgene#117413) plasmids were a gift from Noboru Mizushima, who deposited them on Addgene (Watertown, Mass, USA). The plasmid constructs harboring the SQSTM1/p62WildType or C105/113A mutations were provided by Dr. Viktor Korolchuk (Newcastle University). The iScript cDNA Synthesis kit (1708891) and iTaq SYBR Green Supermix (1725121) were purchased from Bio-Rad (Hercules, CA, USA). Gentian Violet and TRIzol RNA isolation reagents were obtained from Thermo Fisher (Waltham, MA, USA).\u003c/p\u003e \u003cp\u003eSQSTM1/p62 (sc-28359), LKB1 (sc-32245), and β-Actin (sc-4778) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). PARP (CST-9532), Caspase-3 (CST-9662), LC-3β (CST-3868), AMPK (CST-5831), p-AMPK (T172) (CST-2535), p-AMPK(S485) (CST-2537), KEAP1 (CST-8047), Nrf-2 (CST-12721), p-LKB1/S428 (CST-3482), phospho-SQSTM1/p62 (Ser403) (CST-39786), phospho-SQSTM1/p62 (Ser349) (CST-16177) and anti-Biotin (CST-5597) were purchased from Cell signaling Technology (Danvers, MA, USA). p-LKB1/S307 (EMD:09478) was purchased from Merk Millipore (Burlington, MA, USA).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eWestern blot, qPCR, and protein carbonylation assay\u003c/h3\u003e\n\u003cp\u003eCells were washed twice with cold PBS solution, then lysed with RIPA Buffer with phosphorylase and protease inhibitor (Cell Signaling Technologies, Danvers, MA, USA). Protein concentrations were determined with the Standard BCA Protein Assay Kit (Thermo Fisher, Waltham, MA, USA). The lysed samples were boiled and subjected to separation with 8% or 12% SDS-PAGE gel at 70-120V. Proteins were transferred to the PVDF membrane. The membranes were blocked for 60 min with 5% no-fat milk solutions prepared in phosphate-buffered saline (PBS) with 0.1% Tween 20, incubated overnight at 4\u0026deg;C with 1:1000 dilutions of the primary antibodies, and washed three times for 10 min each time with Tween 20 (1:1000 dilution) in PBS. Appropriate peroxidase-conjugated secondary antibody (1:5000 dilution) was used for 2 h at room temperature. Membranes were washed with Tween 20-PBS three times for 10 min. Protein bands were visualized using an ECL solution from Santa Cruz Biotech (CA, United States).\u003c/p\u003e \u003cp\u003eTotal RNA samples were isolated using TRIzol RNA isolation reagents (Invitrogen). Gene expression was assessed using a SYBR Green-based quantitative RT-PCR assay. qPCR experiment and analysis were tested as described in our previous report [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. PCR primer pair for the human \u003cem\u003eAOX1\u003c/em\u003e is forward 5\u0026prime;- ATGCCTGTCTGATTCCCATCT \u0026minus;\u0026thinsp;3\u0026rsquo;, reverse 5\u0026prime;- CATGACACTTGGCAATCCTCT \u0026minus;\u0026thinsp;3\u0026rsquo;. The human 18S rRNA primer pair is forward 5\u0026prime;-CTACCACATCC AAGGAAGCA-3\u0026prime; and reverse 5\u0026prime;-TTTTTCGTCA CTACCTCCCCG-3\u0026prime;.\u003c/p\u003e \u003cp\u003eProtein carbonylation was evaluated using a biotin derivatization assay as described [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. In brief, the treated cells were harvested in cold PBS and cellular proteins were extracted under native conditions in G-lysis buffer (Guanidine HCl 6.0 M, Tris 50 mM, pH 8.3, EDTA 3.0 mM, Triton-X100 0.5% (v/v), and sodium iodoacetate 50 mM), as described [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. Subsequently, the protein lysate was incubated in the dark with 5.0 mM biotin hydrazide for 2 h at room temperature. Biotin-conjugated proteins were reduced with 10.0 mM NaBH4 for 1 hr. The excessively salty chemicals were removed with the Ultracel\u0026reg;-3K centrifugal filter (Merk Millipore). The eluted proteins were loaded onto an SDS-PAGE gel, and carbonylated proteins on the PVDF membrane were detected using the HRP-linked anti-Biotin antibodies. Protein band density was acquired using NIH ImageJ software.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCRISPR/Cas9 knockout (KO) system stable cell line and small interfering RNAs\u003c/h2\u003e \u003cp\u003eSQSTM1/p62 knockout (KO) stable cell lines were established in C4-2B and PC-3 cells using the SQSTM1/p62 CRISPR plasmid system (sc-400099) obtained from Santa Cruz (Santa Cruz, CA, USA). The protocol provided by Santa Cruz Biotech was followed to generate the SQSTM1/p62 KO cell lines. Stable subline cells were established with the wild-type or C105/113A mutant SQSMT1/p62 plasmids in C4-2B and PC-3 cells.\u003c/p\u003e \u003cp\u003eThe small interfering RNAs (siRNAs) for the SQSTM1 gene (a set of 4 ON-TARGETplus siRNAs) were purchased from Horizon Discovery Inc. A negative control siRNA was also included in the cell-based assays. Lipofectamine RNAiMAX transfection reagent was purchased from ThermoFisher Scientific Inc. The transfection procedure was performed according to the manufacturer\u0026rsquo;s manual.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry analysis\u003c/h2\u003e \u003cp\u003ePC-3 cells were cultured in a 6-well plate (1 x 10\u003csup\u003e5\u003c/sup\u003e/well) and then treated as indicated for 16 h. Apoptotic cell death was evaluated with flow cytometry as described in our previous publication [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. Briefly, cells were harvested and washed with cold PBS, and then incubated with annexin V-binding buffer and 1 mg/ml propidium iodide for 10 min at room temperature according to the assay kit protocols (Thermo Fisher, Waltham, MA, USA). Flow cytometry data were analyzed by \u003cem\u003eFlowJo\u003c/em\u003e software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eElectron microscope (EM) analysis\u003c/h2\u003e \u003cp\u003ePC-3 cells were seeded on 0.2% gelatin-precoated 10-mm coverslips in p100 dishes and then treated as indicated for 16 h. The cells were fixed with freshly prepared 2.5% glutaraldehyde in PBS at 4\u0026deg;C for 3 h. And then washed twice with cold PBS. Dehydration was carried out sequentially in the dishes with methanol at different concentrations (20%, 40%, and 60%) for 5 min each, followed by an 80% methanol wash for 3 min and then a 100% methanol wash for 30 s, repeated five times. The coverslips with dishes were dried in vacuum-assisted desiccators overnight. The surface of the coverslip was sputter-coated in a vacuum with an electrically conductive 5 nm thick layer of gold-palladium alloy precision etching coating system. The EM images were recorded with a scanning electron microscope (FEI Quanta 200) at a lower voltage (\u0026sim;1 kV) and low vacuum mode with a tilt of 30\u0026deg; [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCo-Immunoprecipitation\u003c/h2\u003e \u003cp\u003eC4-2B or PC-3 cells (9\u0026thinsp;~\u0026thinsp;10 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e) were grown in 145-mm dishes, followed by the indicated treatments. Cells were washed twice with cold PBS on ice and then collected in CHAPS lysis buffer [40 mM HEPES pH7.4, 120 mM NaCl, 1 mM EDTA, 10 mM pyrophosphate, 10 mM glycerophosphate, 50 mM NaF, 1.5 mM Na3VO4, 0.3% (w/v) CHAPS], and a cocktail of protease inhibitors (1:1,000, Sigma). The samples were sonicated for 20 seconds and then centrifuged at 12,000 rpm for 30 min at 4\u0026deg;C. Supernatants were transferred to new tubes. Protein concentration was determined with a standard BCA protein assay kit (Thermo Fisher, Waltham, MA, USA). Cell lysates were incubated with 3 \u0026micro;g primary antibodies for 1 hr before adding 30 \u0026micro;l of protein A/G agarose beads (sc-2003, Santa Cruz Biotechnology). After incubation at 4\u0026deg;C overnight, the samples were centrifuged at 5000 rpm for 3 min to pellet the beads. The beads were washed with CHAPS lysis buffer 3 times, followed by western blot analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eFluorescence microscopy\u003c/h2\u003e \u003cp\u003eCells were seeded in a 6-well plate overnight and then transfected with the plasmids for 48 h. The cells were treated as indicated at different times. After washing with cold PBS three times, the cells were incubated with Hoechst 33342 dye (Thermo Fisher, Waltham, MA, USA) for 15 min at room temperature. Images were acquired with a Nikon Confocal Microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eGentian violet assay\u003c/h2\u003e \u003cp\u003eC4-2B and PC-3 cells were seeded in a 6-well plate (1 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e/well), grown overnight, and then treated with Alternol (0, 2.5, 5.0, 10 \u0026micro;M) for 24 h. After fixation in cold acetone, cells were stained with 0.2% gentian violet for 5 min. Cells were washed with distilled water for photos.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eQuantitative data were presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM from at least three experiments. Representative images of non-quantitative data were shown from multiple experiments. Statistical analysis was performed using ANOVA followed by a Student's \u003cem\u003et\u003c/em\u003e-test to compare two groups with SPSS software (Chicago, IL). A \u003cem\u003ep\u003c/em\u003e-value less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e: N/A\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e: All authors agreed to publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material:\u003c/strong\u003e N/A\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest:\u003c/strong\u003e None\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e: This work was partially supported by GuangDong Basic and Applied Basic Research Foundation (General Project #2024A1515010342 to Dr. Xiangwei Wang).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eW.L., H.X., C.L., R. C., X. Z., and J. Y. conducted the cell culture-based experiments. C.Z. and J.Z. performed the bioinformatic analysis. X.W. and B.L. wrote the manuscript. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are very grateful for the generous gift of Alternol reagent from Dr Jiepeng Chen at Sungen Biosciences (Shantou, China). We also thank Dr. Viktor Korolchuk from Newcastle University (United Kingdom) for the SQSTM1 wild-type and C105/113A mutant plasmids.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLiu WJ, Ye L, Huang WF, Guo LJ, Xu ZG, Wu HL, Yang C, Liu HF: p62 links the autophagy pathway and the ubiqutin-proteasome system upon ubiquitinated protein degradation. \u003cem\u003eCellular \u0026amp; molecular biology letters\u003c/em\u003e 2016, 21:29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi L, Tan J, Miao Y, Lei P, Zhang Q: ROS and Autophagy: Interactions and Molecular Regulatory Mechanisms. \u003cem\u003eCell Mol Neurobiol\u003c/em\u003e 2015, 35(5):615\u0026ndash;621.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNing B, Hang S, Zhang W, Mao C, Li D: An update on the bridging factors connecting autophagy and Nrf2 antioxidant pathway. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e 2023, 11:1232241.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHseu YC, Vudhya Gowrisankar Y, Wang LW, Zhang YZ, Chen XZ, Huang PJ, Yen HR, Yang HL: The in vitro and in vivo depigmenting activity of pterostilbene through induction of autophagy in melanocytes and inhibition of UVA-irradiated alpha-MSH in keratinocytes via Nrf2-mediated antioxidant pathways. \u003cem\u003eRedox Biol\u003c/em\u003e 2021, 44:102007.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtten EG, Stefanatos R, Carroll B, Korolchuk VI: Oxidation of p62 as an evolutionary adaptation to promote autophagy in stress conditions. \u003cem\u003eCell Stress\u003c/em\u003e 2018, 2(4):91\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKelly G, Kataura T, Panek J, Ma G, Salmonowicz H, Davis A, Kendall H, Brookes C, Ayine-Tora DM, Banks P \u003cem\u003eet al\u003c/em\u003e: Suppressed basal mitophagy drives cellular aging phenotypes that can be reversed by a p62-targeting small molecule. \u003cem\u003eDev Cell\u003c/em\u003e 2024, 59(15):1924\u0026ndash;1939 e1927.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarroll B, Otten EG, Manni D, Stefanatos R, Menzies FM, Smith GR, Jurk D, Kenneth N, Wilkinson S, Passos JF \u003cem\u003eet al\u003c/em\u003e: Oxidation of SQSTM1/p62 mediates the link between redox state and protein homeostasis. \u003cem\u003eNat Commun\u003c/em\u003e 2018, 9(1):256.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang Y, Chen R, Huang Y, Li G, Huang Y, Chen J, Duan L, Zhu BT, Thrasher JB, Zhang X \u003cem\u003eet al\u003c/em\u003e: Natural compound Alternol induces oxidative stress-dependent apoptotic cell death preferentially in prostate cancer cells. \u003cem\u003eMol Cancer Ther\u003c/em\u003e 2014, 13(6):1526\u0026ndash;1536.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu W, Li JC, Huang J, Chen J, Holzbeierlein J, Li B: Alternol/Alteronol: Potent Anti-cancer Compounds With Multiple Mechanistic Actions. \u003cem\u003eFront Oncol\u003c/em\u003e 2020, 10:568110.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu W, He C, Li C, Ye S, Zhao J, Zhu C, Wang X, Ma Q, Li B: Natural compound Alternol actives multiple endoplasmic reticulum stress-responding pathways contributing to cell death. \u003cem\u003eFront Pharmacol\u003c/em\u003e 2024, 15:1397116.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi C, Zhang Y, Yan S, Zhang G, Wei W, Qi Z, Li B: Alternol triggers immunogenic cell death via reactive oxygen species generation. \u003cem\u003eOncoimmunology\u003c/em\u003e 2021, 10(1):1952539.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi C, He C, Xu Y, Xu H, Tang Y, Chavan H, Duan S, Artigues A, Forrest ML, Krishnamurthy P \u003cem\u003eet al\u003c/em\u003e: Alternol eliminates excessive ATP production by disturbing Krebs cycle in prostate cancer. \u003cem\u003eProstate\u003c/em\u003e 2019, 79(6):628\u0026ndash;639.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu H, Li C, Mozziconacci O, Zhu R, Xu Y, Tang Y, Chen R, Huang Y, Holzbeierlein JM, Schoneich C \u003cem\u003eet al\u003c/em\u003e: Xanthine oxidase-mediated oxidative stress promotes cancer cell-specific apoptosis. \u003cem\u003eFree Radic Biol Med\u003c/em\u003e 2019, 139:70\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu H, Zhou Z, Li B: Natural compound Alternol as a novel therapeutic for prostate cancer treatment. \u003cem\u003eAm J Clin Exp Urol\u003c/em\u003e 2020, 8(3):76\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe C, Ma L, Hirst J, Li F, Wu H, Liu W, Zhao J, Xu F, Godwin AK, Wang X \u003cem\u003eet al\u003c/em\u003e: Natural compound Alternol exerts a broad anti-cancer spectrum and a superior therapeutic safety index in vivo. \u003cem\u003eFront Pharmacol\u003c/em\u003e 2024, 15:1409506.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKimura S, Noda T, Yoshimori T: Dissection of the autophagosome maturation process by a novel reporter protein, tandem fluorescent-tagged LC3. \u003cem\u003eAutophagy\u003c/em\u003e 2007, 3(5):452\u0026ndash;460.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlionsky DJ, Abdel-Aziz AK, Abdelfatah S, Abdellatif M, Abdoli A, Abel S, Abeliovich H, Abildgaard MH, Abudu YP, Acevedo-Arozena A \u003cem\u003eet al\u003c/em\u003e: Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)(1). \u003cem\u003eAutophagy\u003c/em\u003e 2021, 17(1):1-382.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVargas JNS, Hamasaki M, Kawabata T, Youle RJ, Yoshimori T: The mechanisms and roles of selective autophagy in mammals. \u003cem\u003eNature reviews Molecular cell biology\u003c/em\u003e 2023, 24(3):167\u0026ndash;185.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe J, Dong L, Luo L, Wang K: Redox Regulation of Autophagy in Cancer: Mechanism, Prevention and Therapy. \u003cem\u003eLife (Basel)\u003c/em\u003e 2022, 13(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiang H, Zhang J, Lin C, Zhang L, Liu B, Ouyang L: Targeting autophagy-related protein kinases for potential therapeutic purpose. \u003cem\u003eActa Pharm Sin B\u003c/em\u003e 2020, 10(4):569\u0026ndash;581.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie Z, Dong Y, Zhang J, Scholz R, Neumann D, Zou MH: Identification of the serine 307 of LKB1 as a novel phosphorylation site essential for its nucleocytoplasmic transport and endothelial cell angiogenesis. \u003cem\u003eMol Cell Biol\u003c/em\u003e 2009, 29(13):3582\u0026ndash;3596.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLo AK, Lo KW, Ko CW, Young LS, Dawson CW: Inhibition of the LKB1-AMPK pathway by the Epstein-Barr virus-encoded LMP1 promotes proliferation and transformation of human nasopharyngeal epithelial cells. \u003cem\u003eJ Pathol\u003c/em\u003e 2013, 230(3):336\u0026ndash;346.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHawley SA, Davison M, Woods A, Davies SP, Beri RK, Carling D, Hardie DG: Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates AMP-activated protein kinase. \u003cem\u003eJ Biol Chem\u003c/em\u003e 1996, 271(44):27879\u0026ndash;27887.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHawley SA, Ross FA, Gowans GJ, Tibarewal P, Leslie NR, Hardie DG: Phosphorylation by Akt within the ST loop of AMPK-alpha1 down-regulates its activation in tumour cells. \u003cem\u003eBiochem J\u003c/em\u003e 2014, 459(2):275\u0026ndash;287.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHawley SA, Pan DA, Mustard KJ, Ross L, Bain J, Edelman AM, Frenguelli BG, Hardie DG: Calmodulin-dependent protein kinase kinase-beta is an alternative upstream kinase for AMP-activated protein kinase. \u003cem\u003eCell Metab\u003c/em\u003e 2005, 2(1):9\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTokumitsu H, Inuzuka H, Ishikawa Y, Ikeda M, Saji I, Kobayashi R: STO-609, a specific inhibitor of the Ca(2+)/calmodulin-dependent protein kinase kinase. \u003cem\u003eJ Biol Chem\u003c/em\u003e 2002, 277(18):15813\u0026ndash;15818.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBillman GE: Intracellular calcium chelator, BAPTA-AM, prevents cocaine-induced ventricular fibrillation. \u003cem\u003eAm J Physiol\u003c/em\u003e 1993, 265(5 Pt 2):H1529-1535.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie Z, Dong Y, Scholz R, Neumann D, Zou MH: Phosphorylation of LKB1 at serine 428 by protein kinase C-zeta is required for metformin-enhanced activation of the AMP-activated protein kinase in endothelial cells. \u003cem\u003eCirculation\u003c/em\u003e 2008, 117(7):952\u0026ndash;962.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee-Rivera I, Lopez E, Alvarez-Arce A, Lopez-Colome AM: The PKC-zeta pseudosubstrate peptide induces glutamate release from retinal pigment epithelium cells through kinase- independent activation of Best1. \u003cem\u003eLife Sci\u003c/em\u003e 2021, 265:118860.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan X, Huang T, Tong Y, Fan Z, Yang Z, Yang D, Mao X, Yang M: p62 works as a hub modulation in the ageing process. \u003cem\u003eAgeing Res Rev\u003c/em\u003e 2022, 73:101538.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai D, Zhou C, Du J, Zhao J, Gu C, Wang Y, Zhang L, Lu N, Zhao Y: TrxR1 is involved in the activation of Caspase-11 by regulating the oxidative-reductive status of Trx-1. \u003cem\u003eRedox Biol\u003c/em\u003e 2024, 75:103277.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia Y, Chen J, Yu Y, Wu F, Shen X, Qiu C, Zhang T, Hong L, Zheng P, Shao R \u003cem\u003eet al\u003c/em\u003e: Compensatory combination of mTOR and TrxR inhibitors to cause oxidative stress and regression of tumors. \u003cem\u003eTheranostics\u003c/em\u003e 2021, 11(9):4335\u0026ndash;4350.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim YC, Guan KL: mTOR: a pharmacologic target for autophagy regulation. \u003cem\u003eJ Clin Invest\u003c/em\u003e 2015, 125(1):25\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsumoto G, Wada K, Okuno M, Kurosawa M, Nukina N: Serine 403 phosphorylation of p62/SQSTM1 regulates selective autophagic clearance of ubiquitinated proteins. \u003cem\u003eMol Cell\u003c/em\u003e 2011, 44(2):279\u0026ndash;289.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIchimura Y, Waguri S, Sou YS, Kageyama S, Hasegawa J, Ishimura R, Saito T, Yang Y, Kouno T, Fukutomi T \u003cem\u003eet al\u003c/em\u003e: Phosphorylation of p62 activates the Keap1-Nrf2 pathway during selective autophagy. \u003cem\u003eMol Cell\u003c/em\u003e 2013, 51(5):618\u0026ndash;631.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKomatsu M, Kurokawa H, Waguri S, Taguchi K, Kobayashi A, Ichimura Y, Sou YS, Ueno I, Sakamoto A, Tong KI \u003cem\u003eet al\u003c/em\u003e: The selective autophagy substrate p62 activates the stress responsive transcription factor Nrf2 through inactivation of Keap1. \u003cem\u003eNat Cell Biol\u003c/em\u003e 2010, 12(3):213\u0026ndash;223.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuonamici S, Williams J, Morrissey M, Wang A, Guo R, Vattay A, Hsiao K, Yuan J, Green J, Ospina B \u003cem\u003eet al\u003c/em\u003e: Interfering with resistance to smoothened antagonists by inhibition of the PI3K pathway in medulloblastoma. \u003cem\u003eSci Transl Med\u003c/em\u003e 2010, 2(51):51ra70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYung HW, Wyttenbach A, Tolkovsky AM: Aggravation of necrotic death of glucose-deprived cells by the MEK1 inhibitors U0126 and PD184161 through depletion of ATP. \u003cem\u003eBiochem Pharmacol\u003c/em\u003e 2004, 68(2):351\u0026ndash;360.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen G, Bower KA, Ma C, Fang S, Thiele CJ, Luo J: Glycogen synthase kinase 3beta (GSK3beta) mediates 6-hydroxydopamine-induced neuronal death. \u003cem\u003eFaseb J\u003c/em\u003e 2004, 18(10):1162\u0026ndash;1164.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLamark T, Perander M, Outzen H, Kristiansen K, Overvatn A, Michaelsen E, Bjorkoy G, Johansen T: Interaction codes within the family of mammalian Phox and Bem1p domain-containing proteins. \u003cem\u003eJ Biol Chem\u003c/em\u003e 2003, 278(36):34568\u0026ndash;34581.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eItakura E, Mizushima N: p62 Targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding. \u003cem\u003eJ Cell Biol\u003c/em\u003e 2011, 192(1):17\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColombo G, Clerici M, Garavaglia ME, Giustarini D, Rossi R, Milzani A, Dalle-Donne I: A step-by-step protocol for assaying protein carbonylation in biological samples. \u003cem\u003eJ Chromatogr B Analyt Technol Biomed Life Sci\u003c/em\u003e 2016, 1019:178\u0026ndash;190.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHsieh CY, Hsiao HY, Wu WY, Liu CA, Tsai YC, Chao YJ, Wang DL, Hsieh HJ: Regulation of shear-induced nuclear translocation of the Nrf2 transcription factor in endothelial cells. \u003cem\u003eJ Biomed Sci\u003c/em\u003e 2009, 16(1):12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaeda K, Ohno T, Igarashi S, Yoshimura T, Yamashiro K, Sakai M: Aldehyde oxidase 1 gene is regulated by Nrf2 pathway. \u003cem\u003eGene\u003c/em\u003e 2012, 505(2):374\u0026ndash;378.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShintani Y, Maruoka S, Gon Y, Koyama D, Yoshida A, Kozu Y, Kuroda K, Takeshita I, Tsuboi E, Soda K \u003cem\u003eet al\u003c/em\u003e: Nuclear factor erythroid 2-related factor 2 (Nrf2) regulates airway epithelial barrier integrity. \u003cem\u003eAllergol Int\u003c/em\u003e 2015, 64 Suppl:S54-63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKataura T, Wilson N, Ma G, Korolchuk VI: Mitophagy as a guardian against cellular aging. \u003cem\u003eAutophagy\u003c/em\u003e 2025, 21(1):249\u0026ndash;251.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang X, Bao Y, Liu H, Kou X, Zhang Z, Sun F, Qian Z, Lin Z, Li X, Liu X \u003cem\u003eet al\u003c/em\u003e: VPS34 stimulation of p62 phosphorylation for cancer progression. \u003cem\u003eOncogene\u003c/em\u003e 2017, 36(50):6850\u0026ndash;6862.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu X, Li T, Liu Z, Huang Q, Liao K, Ren R, Lu L, Qi X, Wang M, Chen J \u003cem\u003eet al\u003c/em\u003e: Licochalcone A activates Keap1-Nrf2 signaling to suppress arthritis via phosphorylation of p62 at serine 349. \u003cem\u003eFree Radic Biol Med\u003c/em\u003e 2018, 115:471\u0026ndash;483.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan M, Hu T, Lyu J, Yin Y, Sun J, Wang Q, Xu L, Hu H, Wang C: CSNK1A1/CK1alpha suppresses autoimmunity by restraining the CGAS-STING1 signaling. \u003cem\u003eAutophagy\u003c/em\u003e 2024, 20(2):311\u0026ndash;328.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePilli M, Arko-Mensah J, Ponpuak M, Roberts E, Master S, Mandell MA, Dupont N, Ornatowski W, Jiang S, Bradfute SB \u003cem\u003eet al\u003c/em\u003e: TBK-1 promotes autophagy-mediated antimicrobial defense by controlling autophagosome maturation. \u003cem\u003eImmunity\u003c/em\u003e 2012, 37(2):223\u0026ndash;234.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchlutermann D, Berleth N, Deitersen J, Wallot-Hieke N, Friesen O, Wu W, Stuhldreier F, Sun Y, Berning L, Friedrich A \u003cem\u003eet al\u003c/em\u003e: FIP200 controls the TBK1 activation threshold at SQSTM1/p62-positive condensates. \u003cem\u003eSci Rep\u003c/em\u003e 2021, 11(1):13863.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLau A, Wang XJ, Zhao F, Villeneuve NF, Wu T, Jiang T, Sun Z, White E, Zhang DD: A noncanonical mechanism of Nrf2 activation by autophagy deficiency: direct interaction between Keap1 and p62. \u003cem\u003eMol Cell Biol\u003c/em\u003e 2010, 30(13):3275\u0026ndash;3285.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJain A, Lamark T, Sjottem E, Larsen KB, Awuh JA, Overvatn A, McMahon M, Hayes JD, Johansen T: p62/SQSTM1 is a target gene for transcription factor NRF2 and creates a positive feedback loop by inducing antioxidant response element-driven gene transcription. \u003cem\u003eJ Biol Chem\u003c/em\u003e 2010, 285(29):22576\u0026ndash;22591.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaarniranta K, Blasiak J, Liton P, Boulton M, Klionsky DJ, Sinha D: Autophagy in age-related macular degeneration. \u003cem\u003eAutophagy\u003c/em\u003e 2023, 19(2):388\u0026ndash;400.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang W, Feng C, Jiang H: Novel target for treating Alzheimer's Diseases: Crosstalk between the Nrf2 pathway and autophagy. \u003cem\u003eAgeing Res Rev\u003c/em\u003e 2021, 65:101207.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanchez-Martin P, Saito T, Komatsu M: p62/SQSTM1: 'Jack of all trades' in health and cancer. \u003cem\u003eFEBS J\u003c/em\u003e 2019, 286(1):8\u0026ndash;23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen R, Zhao Y, Huang Y, Yang Q, Zeng X, Jiang W, Liu J, Thrasher JB, Forrest ML, Li B: Nanomicellar TGX221 blocks xenograft tumor growth of prostate cancer in nude mice. \u003cem\u003eProstate\u003c/em\u003e 2015, 75(6):593\u0026ndash;602.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrigolon G, Araldi E, Erni R, Wu JY, Thomas C, La Fortezza M, Laube B, Pohlmann D, Stoffel M, Zarse K \u003cem\u003eet al\u003c/em\u003e: Grainyhead 1 acts as a drug-inducible conserved transcriptional regulator linked to insulin signaling and lifespan. \u003cem\u003eNat Commun\u003c/em\u003e 2022, 13(1):107.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorita K, Hama Y, Izume T, Tamura N, Ueno T, Yamashita Y, Sakamaki Y, Mimura K, Morishita H, Shihoya W \u003cem\u003eet al\u003c/em\u003e: Genome-wide CRISPR screen identifies TMEM41B as a gene required for autophagosome formation. \u003cem\u003eJ Cell Biol\u003c/em\u003e 2018, 217(11):3817\u0026ndash;3828.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen R, Zeng X, Zhang R, Huang J, Kuang X, Yang J, Liu J, Tawfik O, Thrasher JB, Li B: Cav1.3 channel α1D protein is overexpressed and modulates androgen receptor transactivation in prostate cancers. \u003cem\u003eUrol Oncol\u003c/em\u003e 2014, 32(5):524\u0026ndash;536.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatson WH, Pohl J, Montfort WR, Stuchlik O, Reed MS, Powis G, Jones DP: Redox potential of human thioredoxin 1 and identification of a second dithiol/disulfide motif. \u003cem\u003eJ Biol Chem\u003c/em\u003e 2003, 278(35):33408\u0026ndash;33415.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao X, Tang S, Thrasher JB, Griebling TL, Li B: Small-interfering RNA-induced androgen receptor silencing leads to apoptotic cell death in prostate cancer. \u003cem\u003eMol Cancer Ther\u003c/em\u003e 2005, 4(4):505\u0026ndash;515.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEugenin von Bernhardi J, Dimou L: Recent Advances in Live Imaging of Cells of the Oligodendrocyte Lineage. \u003cem\u003eMethods Mol Biol\u003c/em\u003e 2019, 1936:275\u0026ndash;294.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"p62/SQSTM1, autophagy, Nrf-2, oxidative stress, p62 protein aggregation","lastPublishedDoi":"10.21203/rs.3.rs-8586285/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8586285/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAlternol, a natural compound, exhibits potent anti-tumor activity by selectively inducing oxidative stress in prostate cancer cells; however, the molecular mechanisms that coordinate adaptive survival responses to this stress remain poorly defined. In this study, we demonstrate that Alternol treatment triggers a robust, ROS-dependent autophagic response and Nrf2 transactivation in both cell lines and xenograft models. We identify that Alternol specifically drives the rapid, large-scale aggregation of SQSTM1/p62 through direct protein oxidation at Cys105 and Cys113. Distinct from traditional kinase-driven models, this structural aggregation is a primary redox-sensing event that occurs independently of, and prior to, p62 phosphorylation at Ser349 and Ser403. These oxidized p62 aggregates function as a signaling platform that sequesters KEAP1 for autophagic degradation, thereby liberating Nrf2 for nuclear translocation and the induction of downstream antioxidant genes such as \u003cem\u003eAOX1\u003c/em\u003e. Genetic depletion of p62 or disruption of its aggregation capacity \u003cem\u003evia\u003c/em\u003e C105/113A mutation blunts KEAP1 turnover and Nrf2 activation, significantly sensitizing cancer cells to Alternol-induced apoptosis. Collectively, our findings define a novel \"oxidation-aggregation\" axis of p62 as a pivotal survival mechanism, suggesting that targeting the physical aggregation of p62 could provide a promising strategy to overcome adaptive resilience and enhance the efficacy of pro-oxidant cancer therapies.\u003c/p\u003e","manuscriptTitle":"SQSTM1/p62 Protein Oxidation Facilitates Nrf2 Activation and Pro-survival Autophagy under Therapeutic Oxidative Stress","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-20 10:29:45","doi":"10.21203/rs.3.rs-8586285/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"13c3735b-a83d-4d80-a7cc-871799221a83","owner":[],"postedDate":"January 20th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":61057621,"name":"Biological sciences/Cancer/Urological cancer/Prostate cancer"},{"id":61057622,"name":"Biological sciences/Cell biology/Cell death/Autophagy"}],"tags":[],"updatedAt":"2026-02-06T10:27:43+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-20 10:29:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8586285","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8586285","identity":"rs-8586285","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}