Identification and structural characterisation of a picornavirus integrin receptor with an essential role of two distinct glycans for virus infection

Identification and structural characterisation of a picornavirus integrin receptor with an essential role of two distinct glycans for virus infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Identification and structural characterisation of a picornavirus integrin receptor with an essential role of two distinct glycans for virus infection Frank van Kuppeveld, Collins Owino, Giann Dellosa, Rutger Luteijn, and 19 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9053284/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract Equine rhinitis A virus (ERAV), a picornavirus closely related to foot-and-mouth disease virus, causes respiratory infections in horses. We performed a HEK293T CRISPRi screen and identified integrin ⍺2β1 as a protein receptor for ERAV. Using knock-out cells and by pretreating cells with an antibody or soluble receptor, we confirmed the importance of this integrin for infection of multiple cell types, including equine fibroblasts. Cryo-EM and glycoproteomics analyses revealed that ERAV binds integrin ⍺2β1 in its closed conformation by attaching to the β-propeller of the ⍺2 chain, independent of divalent cations, as well as to a high-mannose glycan on ⍺2 N112 and a sialylated glycan on β1 N269. Using glycan knockout and knock-in cells and by reconstituting integrin ⍺2β1-depleted cells with mutant receptors, we demonstrated the importance of these glycans for virus entry. Our results identify a hitherto unseen combination of protein and glycan interactions between a virus and its receptor. Biological sciences/Microbiology/Virology/Virus–host interactions Biological sciences/Microbiology/Virology/Virus structures Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The family Picornaviridae comprises a large group of (+) strand RNA viruses that infect humans (e.g. poliovirus, rhinovirus) and animals (e.g. foot-and-mouth disease virus, FMDV), with huge medical and socio-economic impact. The icosahedral capsid of these non-enveloped viruses directly interacts with specific host cell surface-displayed receptors, thereby determining cell tropism and pathogenesis. For many of them, these interactions lead to endocytic uptake. During endocytosis, receptor and/or pH-induced structural rearrangements in the capsid 1–3 may facilitate the formation of a pore 4 in the endosomal membrane through which the viral genome is released into the cytoplasm 4,5 . The receptors used by picornaviruses are often categorised as either ‘attachment’ or ‘uncoating’ receptors. Attachment receptors are thought to facilitate cell attachment and/or promote virus uptake; in contrast, uncoating receptors induce conformational changes in the viral capsids that mediate the uncoating process. Receptors mediating uncoating are typically proteins, which often bind in the canyon (a depression around the icosahedral 5-fold axis of symmetry) found in some picornavirus capsids, whereas attachment receptors can either be a protein (e.g. decay-accelerating factor) 6 or a glycan (e.g. sialic acid, heparan sulphate) 7 . However, this distinction is not absolute since EV-D68, an emerging respiratory enterovirus, has been shown to bind protein receptor MFSD6 8 whilst it also binds sialylated glycans via its canyon, the latter being sufficient to trigger conformational changes that initiate uncoating 9 . Equine rhinitis A virus (ERAV), a member of the genus Aphthovirus , causes acute respiratory infections in horses worldwide 10–12 . ERAV is phylogenetically most closely related to FMDV, with which it shares many features of virus structure as well as cell entry (and often used as a surrogate requiring lower containment); both viruses require endocytosis and low pH for entry, and both are sensitive to low pH capsid dissociation 13 . FMDV enters cells upon binding to protein attachment receptors like integrins αVβ3, αVβ6, αVβ1, and αVβ8 14–18 . Additionally, FMDV has been suggested to use heparan sulphate as a receptor, but this is likely a cell culture adaptation 19–23 . No specific protein has been identified as a receptor for ERAV so far, with only α2-3 linked sialic acids (2-3Sia) having been identified as important for virus entry 24–26 . Integrins are heterodimeric transmembrane glycoproteins that mediate cell-adhesion. They comprise α and β subunits, the N-terminal domains of which form a large ectodomain structure while the C-terminal domains comprise hydrophobic membrane-spanning helices. Integrin α2β1 interacts with extracellular matrix proteins, primarily collagen. Half of the known α chains, including α2, contain the “inserted” I (α-I) domain (aka A-domain) 27 , which is absent in the arginine-glycine-aspartic acid (RGD)-binding integrins such as αV 27–31 . Integrin α2β1 harbours an α-I domain inserted between blades 2 and 3 of the highly conserved β-propeller domain. Furthermore, integrin α and β subunits can bind several divalent cations, which stabilise protein structure and modulate ligand binding 32,33 . a-I-domain integrins show Mg 2+ -dependent binding to physiological ligands, which is enhanced by Mn 2+ through the conserved metal ion-dependent adhesion site (MIDAS) motif in the α-I domain 34 . Here, using a CRISPR interference (CRISPRi) screen, we report the identification of integrin ⍺2β1 as a receptor for ERAV. Using a combination of virological, genetic, structural, and glycoproteomic approaches, we show that ERAV utilises integrin ⍺2β1 as a receptor in a cation-independent manner, facilitated by binding to the β-propeller of the integrin ⍺2 chain. The cryo-EM reconstruction of the virus-receptor complex shows that interactions of ERAV to the integrin occur via three distinct points of attachment, a high mannose glycan on the integrin ⍺-chain, a sialylated N-glycan on the β-chain and protein-protein interactions with the β-propeller of the ⍺2 chain, so that the integrin caps a 5-fold axis of the virus. Using knock-out cells that cannot make sialic acid and by reconstituting integrin ⍺2β1-depleted cells with mutant receptors, we demonstrate the functional importance of these glycans for efficient infection. Our results identify an unprecedented combination of protein-protein and protein-glycan interactions between a virus and its receptor and provide unique structural insight into the role of clustered saccharide patches, an emerging concept that a higher level of glycan organization, can create a distinct recognition motif. Results Identification of integrin ⍺ 2 β 1 as an ERAV host factor To identify host factors regulating ERAV infection, we performed a CRISPRi screen in HEK293T cells ( Fig. S1A ). A genome-wide CRISPRi gRNA library was introduced into cultures of HEK293T such that expression of a single gene was repressed in each cell. Cells were infected with ERAV and after 3 days the cell population surviving infection was harvested and processed to identify gRNA abundance. We identified numerous enriched and depleted gRNAs ( Supplementary Excel file ). The group of enriched gRNAs, which likely target host susceptibility factors ( Fig. 1A ), included the glycosyltransferases ST3GAL4 and B4GALT1 , which play important roles in sialic acid biology 35,36 . Moreover, it included p roliferation-associated protein 2G4 ( PA2G4 ), which was recently described to bind to type II internal ribosome entry site (IRES) elements which occur in the 5’ UTR of aphthoviruses and cardioviruses to regulate viral translation 37 , confirming the validity of our CRISPRi screen. The top hits also included integrin ⍺ 2 ( ITGA2 ) and integrin β1 ( ITGB1 ). To investigate the importance of these hits, we generated ITGA2 , ITGB1 and PA2G4 knockdown (KD) cells in 293T cells using the two most enriched gRNAs for each host factor in the virus-exposed population. The knockdown was confirmed by FACS staining with integrin ⍺2 antibody and RT-qPCR ( Fig. S1B ). Knockdown of ITGA2 , ITGB1 , and PA2G4 strongly reduced ERAV replication, as determined by endpoint titration ( Fig. S1C ). However, knockdown of these genes did not affect replication of other picornaviruses such as coxsackievirus B3 (CVB3), an enterovirus, or encephalomyocarditis virus (EMCV), a cardiovirus ( Fig. S1C ). Follow-up experiments were performed with one KD cell line for each factor. Analysis of replication by determining virus-induced CPE ( Fig. 1B ) or measuring virus titers at different time points in a low MOI multi-cycle infection ( Fig. 1C ) showed that viral growth was significantly reduced in the KD cell lines, further supporting the importance of these genes for ERAV replication. By transfecting ERAV RNA into ITGA2 and ITGB1 KD cells ( Fig. S1D ), we demonstrated that bypassing receptor-mediated entry and uncoating abolished the requirement for these integrins, indicating that they play a role in the entry/early stages of the ERAV infection cycle ( Fig. 1D ). In contrast, and in line with its role in enhancing IRES-mediated viral RNA translation, ERAV replication was significantly inhibited following RNA transfection in the PA2G4 KD cells ( Fig. 1D ). I ntegrin ⍺2β1 is required for the entry stage of ERAV infection To evaluate a role for integrin ⍺2β1 in ERAV entry in other cell types, we tested whether an integrin ⍺2 antibody or a soluble form of the ⍺2β1 heterodimer could neutralise ERAV infection in another human cell line, HeLa-R19. Pretreatment of HeLa cells with an integrin ⍺2 antibody inhibited ERAV infection but not CVB3 ( Fig. 1E ). Additionally, preincubating ERAV with recombinant human integrin ⍺2β1 inhibited ERAV infection in a dose-dependent manner, while CVB3 infection was unaffected ( Fig. 1F) . We also investigated the role of integrin ⍺2β1 in the infection of primary equine lung fibroblast (ELF) cells. Pretreatment of ELF cells with recombinant integrin ⍺2β1 inhibited ERAV infection in a dose-dependent manner, similar to HeLa R19 cells ( Fig. 1G ) . To dissect the importance of integrin ⍺2β1 in ERAV attachment and internalisation, we generated HeLa R19 I TGA2 KO cells ( Fig. S1E ). As expected, these cells were resistant to infection with ERAV, but not CVB3 ( Fig. 1H ), while EV-1 infection was also inhibited, consistent with its dependence on integrin ⍺2β1 as the receptor ( Fig. 1I ) 38 . To determine the role of the integrin ⍺2β1 complex in ERAV entry, we measured virus binding of ERAV and CVB3 (as a control) to HeLa R19 I TGA2 KO cells at 4°C. ERAV and CVB3 RNA were measured by RT-qPCR using virus-specific primers. Knockout of ITGA2 disturbed binding of ERAV, but not of CVB3 ( Fig. 1J ). Altogether, our data suggest that integrin ⍺2β1 acts as a receptor mediating attachment and entry of ERAV. Mg 2+ -independent binding of integrin ⍺2 β 1 to ERAV along the 5-fold axis of symmetry Using single-particle analysis, we determined a high-resolution icosahedrally averaged reconstruction of ERAV alone (global resolution = 2.3 Å), and ERAV complexed with ⍺2β1, either in the presence or absence of Mg 2+ (the latter using EDTA as a chelating agent), with global resolutions of 2.0 Å and 2.1 Å, respectively ( Table 1 ). All maps showed clear density for the capsid proteins, whilst the maps of virus complexed with receptor showed additional diffuse density centred above each of the twelve 5-fold symmetry axes ( Fig. 2A-C ), indicating the presence of bound receptor and suggesting that there are a total of twelve integrin binding sites, one at each of the twelve 5-fold symmetry axes, in contrast to the situation for FMDV 39 (and poliovirus 40 ) where there are sixty receptor binding sites, one on each of the 60 icosahedral symmetry units. The structure of the virus particle was identical in all three maps and was largely indistinguishable from the previously determined crystal structure of ERAV 41 , except for a stretch of ~20 residues in the VP2 EF-loop (residues 131-153), which in our reconstructions deviates significantly from the crystal structure (C ⍺ shifts of up to 4.0 Å, Fig. S2 ). Since this conformation is present in all three reconstructions, it is independent of divalent cation or receptor-induced conformational changes. Most likely, it is due to differences between the crystallisation conditions (PDB:2WFF) and the physiological buffer conditions used in our cryo-EM experiments. To deconvolute the receptor density, we performed symmetry expansion followed by focused 3D classification. This yielded a high-quality reconstruction (Table S1 ) revealing a single integrin molecule bound above each 5-fold axis at full occupancy (Fig. 2B,C ). The two symmetry-expanded integrin-bound structures, one with Mg 2+ and one lacking divalent cations, were indistinguishable (a 5-Å resolution difference map showed no significant differences, Fig. S3 ). Importantly, the capsid-proximal domains of the integrin were better resolved than the rest of the molecule. The structure of the integrin was modelled and hybrid-refined based on an initial AlphaFold model 42 . Overall, the integrin molecule adopts a bent conformation, and the density is sufficiently detailed to enable the modelling of the ectodomains of both the ⍺ and β chain ( Fig. 2B-D ). The integrin binds slightly off-centre from the virus 5-fold axis, with the β-propeller domain of the α2 chain situated directly above the 5-fold and the β1 chain offset to the side. The protein-protein interactions between the integrin and ERAV are limited. Furthermore, the maps reveal two separate strands of glycan density, one extending ~35 Å from α2 N112 and the other extending ~20 Å from β1 N269 of the integrin, both reaching down in the manner of guy ropes to contact VP1 ( Fig. 2D ). Glycoproteomic analysis shows that α2 N112 predominantly carries high-mannose glycans with 6 - 9 mannose units ( Fig. 2E ). In contrast, β1 N269 bears a diantennary glycan whose antennae terminate in galactose with partial capping by sialic acids ( Fig. 2F ). ERAV binds to the integrin in the closed conformation with minor conformational changes To investigate if binding to ERAV had induced conformational changes to the integrin, we determined the structure of apo integrin ⍺2β1 by cryo-EM (Table 1). Both the ERAV-bound ( Fig. 3A,D ) and apo-integrin ⍺2β1 ( Fig 3B,E ), are in the closed form, as defined by analogy with the closed ⍺-I containing integrin, ⍺Eβ7 (PDB: 9P97), in which a series of domain and secondary structure arrangements in both the ⍺ and the β chains distinguish the closed and open forms ( Fig. 3F,G ) 43 . Comparing the overall structure of the bound and unbound integrin, there are modest rearrangements of the domains corresponding to minor movements of just a few Angstroms. For both apo- and bound forms, the α chain I domain is angled somewhat towards the β-I domain (Fig. 3A-E). Upon binding, the thigh domain is slightly displaced from the main axis of the integrin where binding pulls the β chain hybrid domain slightly towards the virus-facing side of the integrin ( Fig. 3C ), perhaps making room, so that the ⍺2 high mannose structure, which lies in a depression between the ⍺ and β chains, can rearrange and bind ERAV. The most striking change on binding is that the glycans that bind ERAV become much better ordered ( Fig. 3A,B ), reflecting the tensioning role of the glycans noted above. For the ⍺2 N112 high-mannose glycan, the 9-mannose core is selectively bound by the virus, and the tension is sufficient that all mannoses are well-resolved, allowing reliable building of a full atomic model. Similarly, for the β1 N269 diantennary glycan, the complete antennae that terminate with the ERAV-binding sialic acid residue are well defined ( Fig. 3A ). In contrast, both the ⍺2 N112 and β1 N269 glycans in the apo integrin are poorly ordered, with only the first N-acetylglucosamine subunit being resolved ( Fig. 3B ). Protein-protein interactions between ERAV and the integrin ⍺ 2 β-propeller The integrin makes protein-protein and glycan-protein contacts with four of the five VP1 subunits surrounding the virus 5-fold axis ( Fig. 4A ). The rather sparse protein-protein interactions, which include in total seven hydrogen bonds, occur between the α2 β-propeller domain and the DE and HI loops of one VP1 protomer and the DE loop of an adjacent VP1 protomer ( Fig. 4B-C ). The total interface excluded area for the integrin-capsid interaction is 1630 Å 2 , with the protein-protein component (730 Å 2 ) making up less than one-half of this and less than a typical antibody footprint, suggesting that the glycan interactions detailed below are key to robust and specific receptor recognition 46 . ERAV interacts with a high-mannose glycan on the integrin ⍺ 2 β-propeller The glycan of ⍺2 N112 lies on the virus-facing side of the integrin ⍺2 β-propeller and extends to a distal VP1 subunit by passing underneath the βA domain of the integrin β1 chain ( Fig. 2D ), binding close to the 5-fold axis of symmetry at the interface between adjacent VP1 subunits (Fig 4A) , with an interface of ~540 Å 2 . There is compelling density for 9 mannose units, with one trisaccharide branch and two disaccharide branches, allowing an atomic model to be built ( Figs. 2D, 3A, 4D ). The density levels and occupancy analysis 44 indicate that the 9-mannose glycan is preferentially bound by the virus through an interaction with the terminal mannose residues of the two branches. These terminal mannose residues hydrogen bond with amino acid residues on VP1 loops, one binding G98, T92, and F90 from the DE loop and the other (probably weaker interaction) binding N126 from the EF loop ( Fig. 4D ). The predilection of this depression on the virus surface for saccharide units is demonstrated by the presence of additional density, consistent with mannose, in all 4 of the VP1 DE binding sites not occupied by mannose from the β1 integrin around each 5-fold axis ( Fig. S4 ). This density was observed only in the integrin complexes and not in the unbound virus, suggesting that the density is due to a soluble contaminant of the commercially obtained integrin. Depressions on the ERAV surface bind integrin β1 through a 2-3 sialic acid In contrast to the mannose-specificity of the integrin ⍺2 N112 glycan, the β1 N269 glycan attaches to ERAV via a terminal sialic acid residue of the complex biantennary N-glycan. N269 extends from the β-I domain downwards and across the surface of one VP1 subunit to bind this sialic acid residue in a depression between strand B and the DE loop of one subunit and the EF loop β-hairpin of the clockwise related VP1 molecule (Figs. 2D, 3A, 4A, 4E ). Fry et al (2010) 26 previously reported a crystal structure of 2-3Sia bound to ERAV, and the sialic acid binding we observe is essentially identical ( Fig. 4F ). Although the electron potential density of the sialic acid is insufficiently resolved to unambiguously assign the sialic acid linkage, a modelled N-glycan with a 2-3Sia fits the density well. By far the strongest interactions are made with the EF loop, with the terminal sialic acid residue interacting with A118, R129, and Q120 through the N-acetyl group nitrogen, the C1 oxygen, and the C8 and C9 oxygens, respectively ( Fig. 4E ). The overall footprint is ~320 Å 2 ( Fig. 4F ). The observation that the EF loop plays a central role in integrin binding implies that antibodies binding here would block both the protein-protein and glycan-protein interactions necessary for attachment. Indeed, this binding site explains previous observations that ERAV VP1 harbours key neutralisation sites 45–49 , sera raised against the VP1 EF loop can neutralise 49 , and the K114R mutation on the EF loop can escape neutralisation 45 . The glycans on integrin ⍺2 N112 and integrin β 1 N269 are essential for ERAV entry Our cryoEM results indicate that in addition to protein-protein interactions between ERAV and integrin, a sialylated diantennary N-glycan and a high-mannose glycan also contribute to the formation of the virus-receptor complex. To investigate the involvement of different glycans, we made use of a recently developed set of isogenic HEK293 cells that are genetically engineered to selectively display individual types of glycoconjugates with elaborated glycans e.g. capped by 2-3Sia or 2-6Sia on Galβ-4GlcNAc units (HEK-N, only elaborate N-glycans; HEK-O, only elaborate O-glycans; HEK-GSL, only elaborate glycosphingolipids) 50 . Upon ERAV infection of HEK293 expressing elaborated glycans only on specific sialoglycoconjugate classes (i.e. HEK N , HEK O , HEK GSL ), we observed efficient infection only in cells expressing N-glycans ( Fig. 5A ). To investigate the involvement of sialic acids, we first demonstrated that HEK ΔSia cells without any a2-3 and a2-6 sialylation capacities did not support virus replication ( Fig. 5B ). Subsequently, we identified the specific sialyltransferases (STs) required for ERAV infection by knocking in single STs, including ST3Gal1-6 and ST6Gal1, in HEK ΔSia cells. Our data confirmed that 2-3Sia is absolutely required; we observed infection of cells expressing ST3Gal4 and ST3Gal6, both of which install 2-3Sia on N-glycans, and cells expressing select types of O-glycans and GSLs ( Fig. 5B ). ST3Gal3, which displays largely the same substrate specificity as ST3Gal4 and ST3Gal6, less efficiently supported infection. A low level of infection was observed upon reintroduction of ST3Gal1 which, besides using O-glycans as its major substrate, has been reported to also sialylate N -glycans at low levels 51 . CVB3, which was included as a control, showed efficient replication on all cell lines tested ( Fig. S5A,B ). Together, these data demonstrate that ERAV strongly relies on 2-3Sia acid displayed on N-linked glycans. Consistently, virus replication curves showed that ERAV infection was abrogated in HEK ΔSia cells, which lack sialic acid at N-glycans, O-glycans and specific GSLs, as well as in HEK cells lacking elaborated complex N-glycans due to the knockout of MGAT1 , the enzyme that is essential for the conversion of high-mannose into hybrid and complex types of N-glycans ( Fig. 5C ). In cells lacking MGAT1 , N-glycans still contain high-mannose but lack sialic acid, but other types of glycoconjugates (O-glycans and GSLs) are elaborated and contain sialic acids in contrast to HEK N cells. Next, we set out to dissect the role of the integrin-⍺2β1 complex in ERAV attachment and subsequent internalization. For this, we determined binding of ERAV on cells at 4°C or we proceeded with an incubation step for 1 h at 37°C to allow virus internalization. Bound and internalized virus levels were measured by RT-qPCR. In the MGAT1 KO cells, efficient virus binding, but a strong defect in internalization, was observed ( Fig. 5C ). In the HEK ΔSia cells, a relatively minor reduction in virus binding (about 30%) but a strong defect in virus internalization was observed ( Fig. 5C ). Similar results were obtained with double KO cells lacking both sialic acid and MGAT1 . Together, these data suggest that the sialic acid on N-glycans is essential for ERAV internalization. To validate the importance of the glycan on integrins shown in the cryo-EM data, we mutated N112 on the α2 chain and N269 on the β1 chain to alanine and expressed the plasmids in ITGA2 or ITGB1 KD cells, respectively, to specifically prevent introduction of N-glycans at these sites. The knock-ins were validated by FACS staining, although reconstitution with integrin β1 was only partial ( Fig. S5C, S5D ). Reconstitution of the ITGB1 KD cells with integrin β1-N269A failed to rescue ERAV replication, while reconstitution with wt integrin β1 did ( Fig. 5E ). In the ITGB1 KD cells, binding of ERAV was strongly reduced. Reconstitution of these cells with integrin β1 restored virus binding and internalization. Upon reconstitution with integrin β1-N269A, partial restoration of virus binding was observed (to ~50% compared to wt integrin β1), but this mutant integrin failed to restore internalization ( Fig. 5F ). These data are in line with the data shown above ( Fig. 5A-D ) and emphasize the importance of the sialic acid on the N269 glycan on the β1 chain for efficient infection. Similarly, we tested the role of the glycan on integrin α2 by evaluating the consequences of mutation N112A. Reconstitution of the ITGA2 KD cells with mutant integrin α2-N112A failed to rescue virus replication ( Fig. 5G ). As for the ITGB1 KD cells, binding of ERAV was strongly reduced in the ITGA2 KD cells. Reconstitution of these cells with mutant integrin α2-N112A partially restored virus binding (to ~50%) but failed to restore internalization ( Fig. 5H ). In contrast, integrin α2-N96A, a control in which an Asn not implicated in the interaction with ERAV is mutated, efficiently restored virus replication, virus binding and internalisation. Taken together, these data show that the sialylated glycan on integrin β1 N269 as well as the high-mannose glycan on integrin ⍺2 N112 not only contribute to receptor binding but are also critical for virus internalization. Discussion Here, using a CRISPRi screen, we identified in tegrin a 2 b 1 as a receptor for ERAV and confirmed that this molecule serves as a receptor in both human and equine cell lines. Through an integrative structural biology approach, involving cryo-EM and glyoproteomics, we showed that a single integrin a 2 b 1 attaches to ERAV at the 5-fold apices, straddling four of the five VP1 molecules assembled at the 5-fold. Strikingly, the structure of the virus-receptor complex revealed that major parts of the virus-receptor interface ( Fig 2D, 4D,E ) are formed by two distinct N-glycans positioned on the integrin a2 chain (N112) and b1 chain (N269) with high-mannose and sialyl- d iantennary structures, respectively ( Fig 2E,F ). Remarkably, the interactions with terminal mannose and sialic acid residues on these two N-glycans contribute more than half of the total interface surface area between ERAV and integrin a 2 b 1 with the rest provided by protein-protein interactions with the integrin ⍺2 β-propeller. Using isogenic HEK293 cells that selectively display specific glycoconjugates or express individual 2-3/6 STs, and by reconstituting integrin knockdown cells with α2 N112A and β1 N269A mutant integrins, we demonstrated that both glycans contribute to receptor binding and that they play a critical role in subsequent step(s) leading to cell entry and productive infection. The complex interaction of ERAV with integrin a 2 b 1 is without precedence and points to the importance of studying microbial receptors in their full natural presentation on target cells. While sialic acid was previously found to be important for ERAV entry 24–26 and the structural basis determined by crystallography 21 , our study clearly demonstrates that sialic acid is only part of the ERAV receptor, which comprises further interactions with both another glycan and the a2 protein surface. Direct binding studies with individual glycans or proteins using glycan and protein arrays are unlikely to uncover such complex interactions 52–54 , and only through genetic dissection in cell systems and follow-up structural studies, can the full nature be elucidated 55 . The protein specificity often observed in glycan interactions may reflect the presence of multiple glycans on a given protein that together constitute the functional epitope, a phenomenon referred to as “clustered saccharide patches” 56 . These have been proposed to be organized through specific spacing, arrangement, and interaction of multiple glycans on a protein or cell surface, creating unique, high-avidity binding sites for proteins, antibodies and pathogens. Examples of microbial proteins with selectivity for specific glycoproteins include the P. falciparum protein EBA-175, which binds multiple sialic acids on the red cell glycoprotein Glycophorin A 57 , and the MARTX toxins produced by Gram-negative bacteria, which bind multiple biantennary N-glycans selectively on ICAM1 58 . However, structural insight into the organization of clustered saccharide patches has remained scarce. The first molecular structure of a higher-order glycan epitope was elucidated only recently, the mucin-binding X409 module of Vibrio cholerae biofilm matrix adhesion protein RbmC, which revealed recognition of monosaccharide moieties across four O-glycans and interactions with the backbone amino acids 59 . The ERAV-integrin complex reveals a distinctive mode of viral receptor engagement, integrating extensive protein-glycan interactions involving both sialylated and mannosylated glycans with direct protein-protein contacts. The use of two distinct glycans likely increases the specificity of the interaction, resulting in efficient and highly specific attachment. The involvement of a high-mannose glycan on the integrin α2 chain in the interaction of ERAV was surprising. Terminally located mannose residues of high-mannose N-glycans have been hardly, if at all, observed in virus-cell surface interactions. This may reflect the relatively low abundance of high-mannose N-glycans on the extracellular surface of mammalian cells compared with complex N-glycans. Moreover, N-glycans that resist conversion into complex, sialylated antennary structures during ER–Golgi trafficking are typically buried within the folded protein, limiting their accessibility to α-mannosidases required for generating substrates for N-glycan branching 60,61 . Although not buried, the α2 high mannose sugar is located in a depression between the α and b chains and attachment of the sugar under tension prises open this interface a little, suggesting possible shielding of the sugar in the unbound closed form of the integrin. Another interesting feature is that ERAV binds at the β-propeller of the integrin ⍺2 chain rather than the α-I domain that is involved in binding cellular ligands 62 . In the bent, closed form of the integrin, the β-propeller points away from the membrane, well-positioned for viral attachment. Thus, by interacting with a non-ligand binding domain and with glycans, the virus bypasses the divalent cation dependency of binding. Integrin α2β1 also serves as a receptor for enteroviruses echovirus 1 (EV-1) and 8. These viruses also attach to the inactive closed conformation, but in this case via the ligand-binding α-I domain 63 . The orientation and stoichiometry of integrin binding also vary markedly between ERAV and EV-1, the latter binding up to 60 integrins per particle compared to 12 for ERAV. The interaction of ERAV with the bent-closed, inactive conformation may reflect a preference for the specific positioning of glycans. Precedent for distinct N-glycan positioning in the bent-closed conformation of integrins was recently established for the α5β1 integrin, where the spatial arrangement of multiple N-glycans promoted oligomerisation of the glycan-binding protein galectin-3, thereby regulating integrin endocytosis and retrograde trafficking 64 . Like ERAV, the closely related FMDV also uses an integrin as a receptor, but there are some notable differences in the mode of interaction. FMDV primarily binds integrin αvβ6 through an RGD motif on the extended disordered VP1 GH loop, resulting in a distribution of different binding poses 39 . In contrast to ERAV, there are 60 possible binding sites, the integrin is observed bound in the fully open conformation and the binding depends on cations, with the D of the RGD motif apparently coordinating the MIDAS Mg 2+ . In addition, an N-glycan of this integrin attaches to the virus, specifically at the region where upon cell culture adaptation a heparan sulfate binding site was formed 39 , although a functional role of this N-glycan for FMDV infection remains to be established. The VP1 GH loop is much shorter on ERAV, does not harbour an RGD and packs well-ordered against the virus surface (Fig. 4A). In contrast, the region around the 5-fold axes where ERAV attaches to integrin a 2 b 1 is highly elaborated compared to FMDV ( Fig. 4A ). Four loops (BC, HI, DE, FG) are found proximal to the 5-fold axis, and all are longer in ERAV. The most notable change is in the EF loop which is positioned at the end of the jelly roll distal from the 5-fold axis. In ERAV, it is greatly extended to include a β-hairpin which folds back along the capsid surface towards the 5-fold axis creating a ‘blade’ against which the sialic acid nestles ( Fig. 4F,G ). Thus, the surface architecture of each of these viruses is sculpted to allow very different modes of integrin recognition and glycans play a role in both interactions, although more dominantly in the case ERAV. The data presented here argue against the idea that there is a clear distinction between attachment and uncoating receptors. Instead, they suggest that picornaviruses may interact with multiple host cell membrane moieties, being proteins and/or glycans, with overlapping functions in primary cell attachment, induction of endocytosis and/or triggering of uncoating. Picornaviruses employ diverse mechanisms to enter host cells. Enteroviruses undergo a well-characterised cascade of conformational changes following receptor binding, ultimately leading to uncoating. For EV-D68, sialic acid facilitates this process by triggering the release of the pocket factor 9 . In contrast, minor group rhinoviruses and aphthoviruses do not require receptor-induced conformational changes for infection 65 , instead they rely on low pH and possibly other factors for entry 15,66,67 . In line with this, we observed no conformational changes in ERAV upon binding integrin ⍺2β1. Our data show that, in addition to supporting ERAV binding, the sialylated and high-mannose integrin glycans play a critical role in subsequent steps leading to internalisation and cell entry. The mechanism by which they do so remains to be determined. N-linked glycosylation of integrins can affect their function by regulating conformational equilibria and interactions between domain interfaces 68 . Sialic acids can promote or inhibit integrin clustering, depending on the specific context and type of interaction 69,70 . Hence, it is conceivable that ERAV binding to sialylated and/or high-mannose glycans may promote receptor clustering on the cell surface, thereby stimulating endocytosis. In conclusion, our results reveal a previously unrecognised combination of protein-protein and protein-glycan interactions between a picornavirus and its receptor, supporting the concept that these viruses can engage multiple host cell surface moieties to promote attachment and trigger endocytosis, thereby establishing productive infection. Materials and Methods Cell culture and viruses. HEK293T (ATCC CRL-3216), HeLa-R19 (gift from G. Belov, University of Maryland and Virginia-Maryland Regional College of Veterinary Medicine), HeLa-Ohio (ECACC 84121901), equine lung fibroblasts (ELF cells, gift from M. Kikkert, Leiden University Medical Center, and Erwin van den Born, MSD Animal Health), HEK ΔSia (with Siaα2-3Gal and Siaα2-6Gal knock-ins) 50 , HEK N (ΔB4GALT5/6 and C1GALT1; expresses only N-linked glycans) 50 , HEK O (ΔB4GALT5/6 and MGAT1; express only O-linked glycans) 50 , HEK GSL (ΔC1GALT1 and MGAT1) 50 , and HEK ΔMGAT1 (ΔMGAT1) 50 were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco) supplemented with 10% (vol/vol) fetal calf serum (FCS; Gibco). All cells were tested for mycoplasma contamination. CVB3 (Nancy) was obtained by transfecting in vitro-transcribed RNA derived from full-length infectious clone p53CB3/T7 as previously described 71 . ERAV (NM11/67) was obtained from David Rowlands and Toby Tuthill (University of Leeds, Leeds, United Kingdom). Generation of a genome-wide CRISPRi library in HEK293T cells. HEK293T cells transduced with a lentiviral dCas9-HA-BFP-KRAB-NLS expression vector (Addgene plasmid #102244) were single cell sorted to select for a 293T cell clone with efficient dCas9-BFP-knockdown capacity. To test knockdown capacity, clones were transduced with lentiviral vectors encoding gRNAs targeting the cell surface receptors CD55 or CD59 . After 1 week on puromycin (2 µg/ml) selection, CD55 , CD59 and GFP expression were quantified using the BD FACS Canto flow cytometer. A clone that showed the highest reduction in both marker genes was selected for the screens. The selected 293T clone was expanded and transduced with the human genome-wide CRISPRi v2 library 72 . This library contains approximately 100,000 gRNAs targeting around 20,000 genes. Sufficient cells were transduced and propagated to maintain at least 5 x 10 7 transduced (BFP+) cells, representing 500x coverage of the gRNA library. The transduction efficiency was around 20% to minimize the chance of multiple lentiviral integrations per cell. Two days after transduction, cells were cultured in the presence of puromycin for two days and one additional day without puromycin. 5 x 10 7 cells were seeded to a density of 2.5 x 10 5 cells/ml in T225 flasks and the next day infected with ERAV at MOI of 1. After 80 % of the monolayer showed cytopathic effect (usually around day 3 post infection), surviving cells were harvested and counted. In addition, an uninfected control population of cells was harvested at the same time. Cells were washed in PBS, and cell pellets were stored at -80°C until further processing. All screens were done in duplicate. Purification of DNA and next-generation sequencing. DNA was isolated from collected cells using NucleoSpin Blood XL (Macherey Nagel) according to manufacturer’s recommendations. PCR was used to amplify gRNA cassettes with Illumina sequencing adapters and indexes as described by Luteijn et al 72 . Genomic DNA samples were digested with SbfI -HF (NEB) to liberate a ~500-bp fragment containing the gRNA cassette. The gRNA cassette was isolated by gel using NucleoSpin Gel and PCR Clean-up kits (Macherey-Nagel), and the eluted DNA was used for PCR using indexing primers. Indexed samples were pooled and sequenced on an Illumina Nextseq 500 using a 1:1 mix of two custom sequencing primers. Sequencing was performed at the Utrecht Sequencing Facility using an Illumina NextSeq 500 to generate 50bp single end sequencing reads. After demultiplexing, samples were analyzed using the MaGeCK pipeline using non-targeting control gRNAs for normalisation. MaGeCK generated p-values and false-discovery rates for each gene and a robust rank aggregation algorithm to identify positively or negatively selected genes. Generation of knockdown cell lines using CRISPR-dcas9. For screen validation, two of the most enriched gRNAs per gene targeting ITGA2 (gRNA#1: GGGAGGGTGCTTAACAGACA and gRNA#2: GGGTTTGCAGAGGTTTGCAG), ITGB1 (gRNA#1: GAGAGGCCCAGCGGGAGTCG and gRNA#2: GGCCGCGCCCGACACCCGGG ), and PA2G4 (gRNA#1: GCTAGAGTCTGGCGGCCGAG and gRNA#2: GCAGGTCCCAGGCGCGACAC) were cloned into the same expression plasmid used for the gRNA library (pCRISPRia-v2, Addgene plasmid no. 84832). The lentiviral gRNA plasmid co-expressed a puromycin resistance gene and blue fluorescence protein (BFP) via a T2A ribosomal skipping sequence controlled by the human EF1A promoter. The CRISPRi gRNAs introduced into this vector by Gibson assembly were expressed from a mouse U6 promoter. Third-generation lentiviruses were produced in HEK-293T cells in 24-well format using standard lentivirus production protocols. 293T cells were thereafter transduced using spin infection at 800 × g for 90m at 33°C in the presence of 8 μg/ml Polybrene. After 3 days, transduced cells were selected using puromycin (2 μg/ml). Knockdown was validated at mRNA level by qRT PCR and/or FACS staining. ITGA2 and ITGB1 plasmid construction and stable expression in 293T cells. For rescue and overexpression, ITGA2 or ITGB1 gBLOCK DNA fragments (IDT DNA) were cloned into a dual promoter lentiviral vector co-expressing the blasticidin resistance gene and the fluorescent gene mAmetrine 73 using NEBuilder HiFi plasmid assembly. ITGA2 and ITGB1 mutants were generated by PCR amplification with primers carrying the desired mutations, and the resulting fragments were assembled into the lentiviral vector backbone using the NEBuilder HiFi DNA Assembly Master Mix. Sequences were confirmed by Sanger sequencing (Macrogen). The constructs were used to generate third generation lentiviruses and introduced into 293T cells via lentiviral transduction protocols as described above (see Generation of knockdown cell lines using CRISPR-dcas9). Generation of HeLa integrin a2 knockout cell lines using CRISPR-Cas9. Two 20-nt guide RNA sequences targeting ITGA2 (gRNA: CTGGCTGAGAGCTGAAAATC) were selected from GeCKO (v.2) library b and cloned into library pSicoR-CRISPR-PuroR followed by transformation in competent DH5α E.coli cells. The plasmid DNA was extracted and sequenced to confirm the presence of the gRNA and thereafter transfected into HeLa-R19 cells. Subsequently, the cells were selected for 2 days using puromycin at 2 μg/ml. Thereafter, clonal cell lines were generated by limited dilution. Knockout was validated through FACS staining of the ITGA2 as well as sequencing. Virus growth curves. HEK-293T cells were infected with ERAV at MOI of 10 for 1 h, washed twice with PBS, supplemented with medium, and then further incubated for 0, 24, 48 or 72 h after which the plates were subjected to 3 cycles of freezing and thawing. The samples were titrated on 293T cells to determine virus titers. Crystal violet staining. This assay was performed as described earlier with some modifications to the protocol 74 . Cells were seeded in 24-well plates a day before infections. The following day, the cells were infected and incubated at 37°C. At 48 hpi, the cells were washed with PBS and fixed with 4% PFA in PBS. The cells were stained with crystal violet (0.5% crystal violet, 20% methanol in H 2 O). FACS staining. Adherent cells were washed once with PBS and then detached using 0.5% trypsin. The cells were resuspended in complete DMEM media and transferred to V-shaped bottom 96-well plate. The plate was centrifuged at 14,000 rpm for 4 min and the supernatant discarded, followed by washing of the cells with PBS once and centrifuged at 1400 rpm for 4 min. The supernatant was discarded, and the cells resuspend cells in 150 μL PBA (PBS supplemented with 0.5% BSA and 0.02% NaAzide, cold). Cells were centrifuged for 4 min at 1200 rpm and the supernatant was discarded. Cells were then fixed in 4% PFA for 10 min at room temperature, centrifuged at 1200 rpm for 4 min and washed with PBS. Cells were blocked and permeabilized with 100 μL FACS buffer (PBS supplemented with 0.5% saponin and 2% FCS) for 10 min at RT. After incubation, the cells were stained with mouse anti-dsRNA (1:1000; English & Scientific Consulting) and integrin ⍺2Β1 mouse monoclonal antibody (1:500, VLA2 clone AA10, a kind gift from Jeffrey M. Bergelson, University of Pennsylvania), ITGA2 P1E6 (1: 500, cat. no. sc53502) antibodies followed by secondary donkey anti-mouse Alexa 647 (1:1000, cat. no. A31571) antibodies. The fluorescence intensity was quantified by CytoFLEX LX flow cytometer (Beckman Coulter) and the data analyzed by FlowJo v10 software (BD Biosciences). Samples were gated for live single cell populations and then gated for either dsRNA positive or integrin ⍺2Β1 positive cells. Antibody blocking and pretreatment of ERAV with recombinant integrin ⍺2Β1. For the receptor blocking experiments, cells were pretreated with integrin ⍺2Β1 antibody or IgG2 control antibody for 2 h at 37°C and then infected with ERAV at an MOI of 10. After virus adsorption for 1 h, the inoculum was removed and the cells washed three times with DMEM. The cells were supplemented with DMEM and further incubated for 16 h. The plates were frozen and thawed three times and titrated to determine virus titers. To study the effect of recombinant receptor on virus infection, ERAV was pretreated with recombinant integrin α2β1 (catalog no. 5698-A2, R&D Systems) for 1 h at 37°C and thereafter used to infect HeLa cells. After virus adsorption, the inoculum was removed and cells washed three times with PBS and supplemented with complete DMEM media. At 16 hpi, the cells were harvested for FACS staining. CVB3 was included in these experiments as a control. Virus binding and internalisation assays. Virus binding and internalisation assays were performed as previously described with modification 8,74,75 . HeLa-ITGA2-KO, 293T-ITGA2 KD, and Sia-KO cells were seeded in 24-well plates overnight. After preincubation on ice for 10 min plates were incubated with ERAV/CVB3 virus for 1h on ice and washed five times with ice-cold PBS. Cells were lysed in RA1 buffer and RNA was isolated using the NucleoSpin RNA kit protocol (catalog no. 740955.250; Macherey-Nagel). For the internalisation assays, after five cycles of washing, the cells were incubated in medium supplemented with 2% FCS for 1 h at 37 °C. The cells were washed five times in ice-cold PBS and lysed in RA1 buffer for RNA extraction according to the manufacturers protocol. TaqMan reverse transcription kit (catalog no. N8080234; Applied Biosystems) was used to generate cDNA. Quantitative PCR was conducted using Roche Lightcycler 480 SYBR green I master mix kit (catalog no. 04 887 352 001; Roche), using the following primers: beta-actin: Fwd: CCTTCCTGGGCATGGAGTCCTG and Rev: GGAGCAATGATCTTGATCTTC and ERAV Fwd: CCAGGTAACCGGACAGCG; ERAV Rev: GGCAGCGCTACCACAGG, CVB3 Fwd: CGTGGGGCTACAATCAAGTT and CVB3 Rev: TAACAGGAGCTTTGGGCATC. Cell culture for large scale virus propagation. Low passage (<5) HeLa Ohio cells were cultured in T175 flasks at 37°C with 5% CO₂ to 80–90% confluency. The cells were maintained in DMEM supplemented with 10% FCS, 1% glutamine (Gibco) and 1% penicillin-streptomycin (Gibco). Once confluent, cells were transferred to expanded roller bottles (Corning) and incubated at 37°C in DMEM, 10% FCS, 1% glutamine and 1% penicillin-streptomycin supplemented with HEPES (Gibco) until confluence (~72-96h). Roller bottles were washed three times with PBS (Gibco), infected with ERAV and grown in 250 mL DMEM, 5% glutamine, 1% penicillin-streptomycin and HEPES. Infected roller bottles were incubated at 37°C, and cells were monitored for detachment (~48h). Virus purification. Supernatants were collected from infected HeLa Ohio cells and 0.5% w/v Nonidet P-40 substitute (Thermo) was added as a detergent. The samples then underwent three freeze-thaw cycles to ensure complete viral release from cells and lysates were centrifuged at 4000 x g for 30 min to remove cellular debris. Supernatants were then precipitated overnight at 4°C with 8% w/v PEG8000 (Sigma), centrifuged at 4000 x g for 1 h, and the resulting pellets solubilized in 10 mL PBS. Solubilized samples were stored at 4°C overnight and then centrifuged at 32,000 x g on a 30% sucrose cushion for 4 h at 4°C, using an SW32 Ti rotor. Following centrifugation, the supernatant was carefully removed, and excess liquid aspirated from the pellets. The pellets were resuspended in 0.5 mL PBS and stored at 4°C overnight. Solubilised pellets were clarified by centrifugation at 4,000 x g for 30mm, layered onto a 15–45% sucrose gradient and centrifuged at 32,000 x g for 4 h at 4°C using an SW32 Ti rotor. Following centrifugation, 1 mL fractions were collected, and OD 260 and OD 280 measurements taken to determine fractions containing intact ERAV, which were pooled and pelleted at 32,000 x g for 4 h at 4°C before resuspending in 10µL of PBS supplemented with 2mM of EDTA or MgCl 2 . Virus-integrin incubation for cryo-electron microscopy analysis. 50 µg of recombinant human integrin α2β1 (Bio-Techne cat. no. 5698-A2) in powder form was resuspended in concentrated ERAV (0.5 mg/mL) to yield a 300-fold molar excess of integrin to virus particles, to saturate potential binding sites. The ERAV-integrin complex was incubated at 4°C overnight. Cryo-electron microscopy and data collection. Quantifoil R2/1 2nm carbon-coated 200 mesh grids were glow discharged on high for 45s using a High Power Expanded Plasma Cleaner (Harrick, PDC-002-CE). 3.5 µL of the prepared ERAV-integrin sample was pipetted onto the grids and blotted with blotting paper (Agar Scientific, AG47000-100) using the Vitrobot Mark IV System (ThermoFisher) (blot force +6, blot time 6s) maintained at 4˚C and 100% humidity. Grids were plunge-frozen into liquid ethane and stored in liquid nitrogen. Microscopy and data collection parameters are shown in Table 1. Data processing. Pre-processing, including patch-based motion correction and CTF estimation, was performed using the streaming functionality implemented in the live mode of cryoSPARC (v4.6.2) using default parameters 76 . Particles were then identified using the cryoSPARC blob picker on a subset of micrographs (n=1,000) which were extracted, downsampled and subjected to a round of 2D classification to generate a template for template picking. False positives were filtered by re-running 2D classification, cleaned particle stacks were re-extracted, and particle poses refined using homogeneous refinement with I2 symmetry. For the ERAV-integrin + MgCl 2 and ERAV-only datasets, homogeneous refinement yielded maps with 2.64 Å and 2.81 Å resolution, which were used as references for motion correction. For the apo integrin in MgCl 2 , pre-processing and refinement steps were processed similar as the ERAV-integrin dataset. This initially yield an anisotropic map which was rebalanced using the Rebalance Orientations function implemented in cryoSPARC. This map was used as a template for Topaz training and picking particles in denoised micrographs. Particles were extracted from the raw micrographs and particle stacks were cleaned by 2D classification and then running three rounds of Ab initio reconstruction with two classes until a 3.7 Å map was achieved by non-uniform refinement which was used as a reference for motion correction to ultimately achieve a 3.6 Å map. Reference-based motion correction of the ERAV-integrin + EDTA set-up did not yield any improvement in the 2.13 Å resolution map from homogeneous refinement, therefore downstream steps for this dataset used the maps generated from the uncorrected data. The motion-corrected icosahedral maps for the two complexes were then 60-fold symmetry expanded, and 3D classified without alignments into 6 classes using a tight mask on the 5-fold axis of symmetry to allow classification into 5 classes of redundant 72° rotations of integrin ⍺2Β1 and 1 empty class. Difference maps between the sub-particles of the MgCl 2 and EDTA setups were performed using the default settings of the Python package, Electron Microscopy Data Analysis 77 by filtering the maps to 5 Å. Model building and figure preparation. ERAV protomer models were initially built into the highest resolution map (the 2.03 Å resolution icosahedrally symmetric map of the MgCl 2 dataset) through iterative model building (starting from a previously published ERAV structure, PDB: 2WFF 41 ), using Coot (v0.9.8.95) 78 and refinement using Phenix (v.1.21.2) 79 . The integrin α2β1model was initially generated using AlphaFold3 42 with the default settings. The predicted integrin α2β1 model was initially rigid body fitted using Coot into the symmetry expanded cryo-EM map. Due to the variable quality of the integrin α2β1 density we used a hybrid strategy of refinement using Phenix, splitting the AlphaFold3-predicted model into blocks of domains for which the density was of similar quality. Regions of the integrin ⍺2Β1 for which the density was of high quality (α2: 31-168, 372-652; β1: 141-175, 180-378; high-mannose glycan; sialylated glycan) were subjected to full-atom refinement. Glycans were built by importing the monomers from the REFMAC (v.5) library 80 implemented on Coot. The monomers for the model were determined based on the results of the glycoproteomics data supported by the map density. Regions with poorly defined density (α2: 169-371, 653-1182; β1: 21-140, 176-179, 379-765) were refined as rigid domains. A final round of model building and refinement was performed using the well-ordered portion of the integrin with the modeled glycans along with the portion of the virus capsid that interacts with the integrin using full atom refinement to optimise small conformational adjustments of the virus in contact regions. For the apo-integrin, the model was built using the headpiece from the ERAV-bound integrin α2β1 and rigid body-fitted into the density. Refinement statistics for the ERAV protomer, integrin α2β1-ERAV complex, and apo-integrin are shown in Table S1. Final sharpened maps from cryoSPARC and refined models were imported to ChimeraX v.1.7.1 and used for generating the figures. We used OccuPy 44 to aid in the interpretation of the glycans. Analysis of contact surface area and interacting residues was performed using PISA 81 . The PDBePISA Search function was also used to look for similar binding interfaces across the PDB. Schematic representation of protein-ligand and protein-protein interactions were performed using LigPlot (v.2.2) 82 . Glycoproteomic MS. 5 µg of recombinant human integrin (Bio-Techne cat. no. 5698-A2) was mixed with 40 volumes of SDC-buffer (0.1 M Tris-HCl pH 8, 40 mM TCEP, 100 mM CAA, 1% SDC, v/v ) for denaturation, reduction and alkylation. To cover the N-glycosylation sites of interest, the digestion of the protein was divided into two batches. The first using Glu-C (enzyme-to-protein ratio 1:25) at 37 °C for 3 h followed by trypsin (enzyme-to-protein ratio 1:50) at 37 °C overnight, and the second using chymotrypsin (enzyme to protein ratio 1:25) at 37 °C for 3 h. The samples were quenched with 0.5% TFA. Then, samples were loaded onto Oasis PRiME HLB (10 mg) 96-wells plates (Waters), washed with 0.1% TFA, and peptides were eluted using 60% ACN/0.1% TFA. The samples were analyzed using an Orbitrap Exploris Mass Spectrometers (Thermo Fisher Scientific) operated in the data-dependent mode (DDA) coupled to an Ultimate3000 liquid chromatography system (Thermo Fisher Scientific) and separated on a 50 cm reversed phase column packed in-house (Poroshell EC-C18, 2.7 μm, 50 cm × 75 μm; Agilent Technologies). The samples were eluted over a linear gradient of a dual-buffer setup with buffer A (0.1% FA) and buffer B (80% ACN, 0.1% FA). The gradient used for separation was equilibration at 9% solvent B from 0 to 1 m, 9% to 13% sol B from 1 to 2 m, 13% to 44% sol B from 2 to 102 m, 44% to 99% sol B from 102 to 105 m, with a flow rate of 300 nl/min. MS scans were recorded at a resolution of 60,000, with an automatic gain control (AGC) target of 400,000, 50 ms maximum injection time (IT) and a scan range of m/z 350–2,000. Data-dependent MS2 scans were recorded at a resolution of 30,000, AGC target of 50,000, 50 ms maximum IT and a scan range of m/z 120–4,000. Dynamic exclusion was set to 30 s. Higher-energy collisional dissociation (HCD) at a normalized collision energy of 29 were applied. Database searching was performed using Byos 5.8.24. Glycan database containing 279 entries. Cleavage specificity was set to fully tryptic with 2 missed cleavages and precursor and fragment tolerance were set to 10 and 20 ppm. Cysteine carbamidomethylation was set as a fixed modification. Methionine and tryptophan oxidation, and N-terminal cyclisation of glutamine and glutamic acid to pyroglutamic acid were all included as rare variable modifications, whereas N -glycosylation was searched as a common variable modification. The results were manually checked and were used for quantification performed in Skyline 24.1.0.414. For quality control, the threshold for Idotp value was set to 0.85 and that of the mass error to 5 ppm. Peak areas for the same glycopeptides but different isotopic peaks, charge states, and modifications were summed. Statistical analysis. Data were analysed with GraphPad Prism 10 (GraphPad Software, LLC, San Diego, CA, USA) and expressed as mean ± SD. Two groups were compared by Student's t test (two-tailed). Multiple groups were compared by one-way ANOVA followed with the Tukey post hoc test. Data from different groups were compared by two-way ANOVA together with Tukey test. P value < 0.05 was considered statistically significant. Declarations Data availability. The atomic coordinates and cryo-EM density maps for the apo-integrin alpha 2 beta 1 and ERAV-integrin complex have been submitted to the Protein Data Bank with the accession numbers PDB: 28TP (EMD: 56814) and 28LV (EMD: 56603), respectively. All other relevant data are available from the authors upon request. Acknowledgments: We are thankful to Jeffrey Bergelson for sharing VLA2 antibody used in this study, and Marjolein Kikkert and Erwin van den Born for providing ELF cells. The authors thank Sypke van Terwisga, Niels Beringen, and Stan Droogh for their help in performing FACS staining and general cell culture. C.O.O., R.D.L, M.Z. and F.J.M.v.K. were supported by funding from the EC (ERC Advanced Grant to F.J.M.v.K, virLUMINOus, Grant Nr. 101053576). G.K.Y.D. was supported by funding from the Biotechnology and Biological Sciences Research Council (UKRI-BBSRC) [grant number BB/T008784/1]. J.T.K. and T.J.T. were supported by the UKRI-MRC (MR/S023402/1) and UKRI-BBSRC (BBS/E/PI/230001C). The Pirbright Institute is supported by UKRI-BBSRC (BBS/E/PI/23NB0003). H.M.E.D. is supported by Wellcome (101122/Z/13/Z), D.I.S., E.E.F. and P.N.M.S. by the UKRI MRC (MR/N00065X/1). C.P. is supported by a WHO/Bill and Melinda Gates Foundation award (R.G.IMCB.I8-TSA-083). D.I.S. is a Jenner Investigator. The Wellcome Centre for Human Genetics is supported by the Wellcome Trust (grant 090532/Z/09/Z). The computational aspects of this research were supported by the Wellcome Trust Core Award Grant Number 203141/Z/16/Z. We acknowledge eBIC at Diamond Light Source for time on December 2024 under session no. BI34631-25. Authors and affiliations These authors contributed to the work equally: Collins Oduor Owino, Giann Kerwin Y. Dellosa and Rutger D. Luteijn. Collins Oduor Owino , Rutger D. Luteijn, Marleen Zwaagstra, Jill E. Ver Eecke, Frank Buitenwerf, Wendy Meijer, Mengying Liu, Cornelis A.M. de Haan, Daniel L. Hurdiss, Erik de Vries, Frank J.M. van Kuppeveld : Section of Virology, Division of Infectious Diseases and Immunology, Department of Biomolecular Health Sciences, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands Giann Kerwin Y. Dellosa, Claudine Porta, Helen M.E. Duyvesteyn, Pranav N.M. Shah, Elizabeth E. Fry, David I. Stuart: Division of Structural Biology, Nuffield Department of Medicine, University of Oxford, The Henry Welcome Building for Genomic Medicine, Oxford, UK Giann Kerwin Y. Dellosa, James T. Kelly, Tobias J. Tuthill: The Pirbright Institute, Ash Road, Woking, UK Xue Yu, Karli R. Reiding: Biomolecular Mass Spectrometry and Proteomics, Bijvoet Center for Biomolecular Research and Utrecht Institute of Pharmaceutical Sciences, Utrecht University, Utrecht, The Netherlands Xue Yu: Netherlands Proteomics Center, Utrecht, The Netherlands Yoshiki Narimatsu, Henrik Clausen: Copenhagen Center for Glycomics, Department of Cellular and Molecular Medicine, Faculty of Health Sciences, University of Copenhagen, Blegdamsvej 3, Copenhagen, Denmark David I. Stuart: The CAMS Oxford Institute, The Henry Welcome Building for Genomic Medicine, Oxford, UK Contributions: COO, GKYD, RDL, DIS and FJMvK conceptualized the project; COO, RDL, ML, CAMdH, DLH, CP, HMEV, JTK, TJT, YN, HC, PNMS, EEF, KRR, EdV, DIS and FJMvK developed the methodology and provided reagents; COO, GKYD, RDL, MZ, XY, JEV, FB and WM performed the experiments; COO, GKYD, RDL, XY conducted data analysis; COO, GKYD and RDL wrote the original draft, which was reviewed and edited by all authors; RDL, JTK, TJT, EEF, PNMS, KRR, EdV, DIS and FJMvK supervised the work; FJMvK, TJT, EEF and DIS acquired funding. Corresponding author David I Stuart ( [email protected] ) and Frank JM van Kuppeveld ( [email protected] ) Lead contact: Frank JM van Kuppeveld ( [email protected] ) Ethics declarations Competing interests The authors declare no competing interests. References Ren, J. et al. Picornavirus uncoating intermediate captured in atomic detail. Nat. Commun. 4 , (2013). Butan, C., Filman, D. J. & Hogle, J. M. Cryo-electron microscopy reconstruction shows poliovirus 135S particles poised for membrane interaction and RNA release. J. Virol. 88 , 1758–1770 (2014). Strauss, M. et al. Nectin-like interactions between poliovirus and its receptor trigger conformational changes associated with cell entry. J. Virol. 89 , 4143–4157 (2015). Panjwani, A. et al. Capsid protein VP4 of human rhinovirus induces membrane permeability by the formation of a size-selective multimeric pore. PLoS Pathog. 10 , (2014). Strauss, M., Levy, H. C., Bostina, M., Filman, D. J. & Hogle, J. M. RNA transfer from poliovirus 135S particles across membranes is mediated by long umbilical connectors. J. Virol. 87 , 3903–3914 (2013). Baggen, J., Thibaut, H. J., Strating, J. R. P. M. & Van Kuppeveld, F. J. M. The life cycle of non-polio enteroviruses and how to target it. Nat. Rev. Microbiol. 16 , 368–381 (2018). Ramos-Martínez, I. E. et al. Heparan Sulfate and Sialic Acid in Viral Attachment: Two Sides of the Same Coin? Int. J. Mol. Sci. 23 , (2022). Varanese, L. et al. MFSD6 is an entry receptor for enterovirus D68. Nature 641 , 1268–1275 (2025). Liu, Y. et al. Sialic acid-dependent cell entry of human enterovirus D68. Nat. Commun. 6 , 8865 (2015). Stasiak, K., Dunowska, M. & Rola, J. Prevalence and Sequence Analysis of Equine Rhinitis Viruses among Horses in Poland. Viruses 16 , (2024). DITCHFIELD, J. & MACPHERSON, L. W. Upper Respiratory Disease in Thoroughbred Horses: studies of its viral etiology in the Toronto area, 1960 to 1963. Can. J. Comp. Med. Vet. Sci. 29 , 18 (1965). Horsington, J., Lynch, S. E., Gilkerson, J. R., Studdert, M. J. & Hartley, C. A. Equine picornaviruses: Well known but poorly understood. Vet. Microbiol. 167 , 78–85 (2013). Li, F., Browning, G. F., Studdert, M. J. & Crabb, B. S. Equine rhinovirus 1 is more closely related to foot-and-mouth disease virus than to other picornaviruses. Proceedings of the National Academy of Sciences 93 , 990–995 (1996). Jackson, T. et al. Integrin alphavbeta8 functions as a receptor for foot-and-mouth disease virus: role of the beta-chain cytodomain in integrin-mediated infection. J. Virol. 78 , 4533–4540 (2004). Berryman, S., Clark, S., Monaghan, P. & Jackson, T. Early Events in Integrin αvβ6-Mediated Cell Entry of Foot-and-Mouth Disease Virus. J. Virol. 79 , 8519–8534 (2005). Jackson, T., Mould, A. P., Sheppard, D. & King, A. M. Q. Integrin αvβ1 Is a Receptor for Foot-and-Mouth Disease Virus. J. Virol. 76 , 935 (2002). Jackson, T. et al. Foot-and-mouth disease virus is a ligand for the high-affinity binding conformation of integrin α5β1: Influence of the leucine residue within the RGDL motif on selectivity of integrin binding. Journal of General Virology 81 , 1383–1391 (2000). Neff, S., Mason, P. W. & Baxt, B. High-Efficiency Utilization of the Bovine Integrin αvβ3 as a Receptor for Foot-and-Mouth Disease Virus Is Dependent on the Bovine β3 Subunit. J. Virol. 74 , 7298 (2000). Baxt, B. & Bachrach, H. L. Early interactions of foot-and-mouth disease virus with cultured cells. Virology 104 , 42–55 (1980). Baranowski, E. et al. Cell recognition by foot-and-mouth disease virus that lacks the RGD integrin-binding motif: flexibility in aphthovirus receptor usage. J. Virol. 74 , 1641–1647 (2000). Jackson, T. et al. Efficient infection of cells in culture by type O foot-and-mouth disease virus requires binding to cell surface heparan sulfate. J. Virol. 70 , 5282–5287 (1996). Martínez, M. A., Verdaguer, N., Mateu, M. G. & Domingo, E. Evolution subverting essentiality: Dispensability of the cell attachment Arg-Gly-Asp motif in multiply passaged foot-and-mouth disease virus. Proc. Natl. Acad. Sci. U. S. A. 94 , 6798–6802 (1997). Baranowski, E. et al. Multiple virulence determinants of foot-and-mouth disease virus in cell culture. J. Virol. 72 , 6362–6372 (1998). Stevenson, R. A., Huang, J. A., Studdert, M. J. & Hartley, C. A. Sialic acid acts as a receptor for equine rhinitis A virus binding and infection. Journal of General Virology 85 , 2535–2543 (2004). Lonberg-Holm, K. & Philipson, L. Early interaction between animal viruses and cells. https://www.cabidigitallibrary.org/doi/full/10.5555/19762268769 (1974). Fry, E. E. et al. Crystal structure of equine rhinitis A virus in complex with its sialic acid receptor. Journal of General Virology 91 , 1971–1977 (2010). Arnaout, M. A. The Integrin Receptors: From Discovery to Structure to Medicines. Immunol. Rev. 329 , (2025). Arnaout, M. A., Mahalingam, B. & Xiong, J. P. Integrin structure, allostery, and bidirectional signaling. Annu. Rev. Cell Dev. Biol. 21 , 381–410 (2005). Stricker, T. P. et al. Structural analysis of the alpha(2) integrin I domain/procollagenase-1 (matrix metalloproteinase-1) interaction. J. Biol. Chem. 276 , 29375–29381 (2001). Javid, H. et al. RGD peptide in cancer targeting: Benefits, challenges, solutions, and possible integrin-RGD interactions. Cancer Med. 13 , (2024). Hughes, A. L. Evolution of the integrin alpha and beta protein families. J. Mol. Evol. 52 , 63–72 (2001). Staatz, W. D., Rajpara, S. M., Wayner, E. A., Carter, W. G. & Santoro, S. A. The membrane glycoprotein Ia-IIa (VLA-2) complex mediates the Mg++-dependent adhesion of platelets to collagen. J. Cell Biol. 108 , 1917–1924 (1989). Zhang, K. & Chen, J. F. The regulation of integrin function by divalent cations. Cell Adh. Migr. 6 , 20 (2012). Lee, J. O., Bankston, L. A. & Robert C Liddington, M. A. A. and. Two conformations of the integrin A-domain (I-domain): a pathway for activation? Structure 3 , 1333–1340 (1995). Tsukamoto, Y. & Okajima, T. O-GlcNAc glycans in the mammalian extracellular environment. Carbohydr. Res. 549 , (2025). Kofsky, J. M., Babulic, J. L., Boddington, M. E., De León González, F. V. & Capicciotti, C. J. Glycosyltransferases as versatile tools to study the biology of glycans. Glycobiology 33 , 888–910 (2023). Bellucci, M. A. et al. ITAF45 is a pervasive trans-acting factor for picornavirus Type II IRES elements. Proceedings of the National Academy of Sciences 122 , e2506281122 (2025). Bergelson, J. M., Shepley, M. P., Chan, B. M. C., Hemler, M. E. & Finberg, R. W. Identification of the Integrin VLA-2 as a Receptor for Echovirus 1. Science (1979). 255 , 1718–1720 (1992). Kotecha, A. et al. Rules of engagement between αvβ6 integrin and foot-and-mouth disease virus. Nat. Commun. 8 , (2017). Zhang, P. et al. Crystal structure of CD155 and electron microscopic studies of its complexes with polioviruses. Proceedings of the National Academy of Sciences 105 , 18284–18289 (2008). Tuthill, T. J. et al. Equine Rhinitis A Virus and Its Low pH Empty Particle: Clues Towards an Aphthovirus Entry Mechanism? PLoS Pathog. 5 , e1000620 (2009). Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021 596:7873 596 , 583–589 (2021). Hollis, J. A., Chan, M. C., Malik, H. S. & Campbell, M. G. мolecular exaptation by the integrin αI domain. Science Advances 11 , 9567 (2025). Forsberg, B. O., Shah, P. N. M. & Burt, A. A robust normalized local filter to estimate compositional heterogeneity directly from cryo-EM maps. Nature Communications 2023 14:1 14 , 1–11 (2023). Kriegshäuser, G. et al. Model of the equine rhinitis A virus capsid: identification of a major neutralizing immunogenic site. J. Gen. Virol. 84 , 2365–2373 (2003). Warner, S. et al. Evidence that Equine Rhinitis A Virus VP1 Is a Target of Neutralizing Antibodies and Participates Directly in Receptor Binding. J. Virol. 75 , 9274 (2001). Varrasso, A. et al. Sequence Conservation and Antigenic Variation of the Structural Proteins of Equine Rhinitis A Virus. J. Virol. 75 , 10550 (2001). Hartley, C. A. et al. Equine rhinitis A virus: structural proteins and immune response. J. Gen. Virol. 82 , 1725–1728 (2001). Stevenson, R. A., Huang, J. A., Studdert, M. J. & Hartley, C. A. Identification of a neutralizing epitope in the betaE-betaF loop of VP1 of equine rhinitis A virus, defined by a neutralization-resistant variant. J. Gen. Virol. 85 , 2545–2553 (2004). Narimatsu, Y. et al. An Atlas of Human Glycosylation Pathways Enables Display of the Human Glycome by Gene Engineered Cells. Mol. Cell 75 , 394-407.e5 (2019). Liu, M. et al. Cell-based sialoglycan arrays for directly comparing influenza A virus receptor requirements for binding and infection. iScience 28 , 112549 (2025). Yu, X., Petritis, B., Duan, H., Xu, D. & LaBaer, J. Advances in cell-free protein array methods. Expert Rev. Proteomics 15 , 1–11 (2018). Heimburg-Molinaro, J., Mehta, A. Y., Tilton, C. A. & Cummings, R. D. Insights Into Glycobiology and the Protein-Glycan Interactome Using Glycan Microarray Technologies. Molecular and Cellular Proteomics 23 , (2024). Rillahan, C. D. & Paulson, J. C. Glycan microarrays for decoding the glycome. Annu. Rev. Biochem. 80 , 797–823 (2011). Narimatsu, Y. et al. Genetic glycoengineering in mammalian cells. J. Biol. Chem. 296 , 100448 (2021). Cohen, M. & Varki, A. Modulation of glycan recognition by clustered saccharide patches. Int. Rev. Cell Mol. Biol. 308 , 75–125 (2014). Tolia, N. H., Enemark, E. J., Sim, B. K. L. & Joshua-Tor, L. Structural basis for the EBA-175 erythrocyte invasion pathway of the malaria parasite Plasmodium falciparum. Cell 122 , 183–193 (2005). Chen, J. et al. Vibrio MARTX toxin binding of biantennary N-glycans at host cell surfaces. Sci. Adv. 11 , 63 (2025). Jaroentomeechai, T. et al. Microbial binding module employs sophisticated clustered saccharide patches to selectively adhere to mucins. Nat. Commun. 16 , (2025). Moremen, K. W., Tiemeyer, M. & Nairn, A. V. Vertebrate protein glycosylation: diversity, synthesis and function. Nat. Rev. Mol. Cell Biol. 13 , 448–462 (2012). Kornfeld, R. & Kornfeld, S. Assembly of asparagine-linked oligosaccharides. Annu. Rev. Biochem. 54 , 631–664 (1985). Cormier, A. et al. Cryo-EM structure of the αvβ8 integrin reveals a mechanism for stabilizing integrin extension. Nature Structural & Molecular Biology 2018 25:8 25 , 698–704 (2018). Jokinen, J. et al. Molecular mechanism of α2β1 integrin interaction with human echovirus 1. EMBO J. 29 , 196 (2009). Shafaq-Zadah, M. et al. Spatial N-glycan rearrangement on α5β1 integrin nucleates galectin-3 oligomers to determine endocytic fate. Nat. Commun. 16 , (2025). Baxt, B., Virology, P. M.- & 1995, undefined. Foot-and-mouth disease virus undergoes restricted replication in macrophage cell cultures following Fc receptor-mediated adsorption. ElsevierB Baxt, PW MasonVirology, 1995•Elsevier https://www.sciencedirect.com/science/article/pii/S0042682285711105. Groppelli, E., Tuthill, T. J. & Rowlands, D. J. Cell Entry of the Aphthovirus Equine Rhinitis A Virus Is Dependent on Endosome Acidification. J. Virol. 84 , 6235 (2010). O’Donnell, V., LaRocco, M., Duque, H. & Baxt, B. Analysis of Foot-and-Mouth Disease Virus Internalization Events in Cultured Cells. J. Virol. 79 , 8506–8518 (2005). Cai, X., Thinn, A. M. M., Wang, Z., Shan, H. & Zhu, J. The importance of N-glycosylation on β3 integrin ligand binding and conformational regulation. Scientific Reports 2017 7:1 7 , 1–14 (2017). Gu, J. & Taniguchi, N. Regulation of integrin functions by N-glycans. Glycoconj. J. 21 , 9–15 (2004). Pan, D. & Song, Y. Role of altered sialylation of the i-like domain of β1 integrin in the binding of fibronectin to β1 integrin: Thermodynamics and conformational analyses. Biophys. J. 99 , 208–217 (2010). Lanke, K. H. W. et al. GBF1, a Guanine Nucleotide Exchange Factor for Arf, Is Crucial for Coxsackievirus B3 RNA Replication. J. Virol. 83 , 11940 (2009). Luteijn, R. D. et al. SLC19A1 transports immunoreactive cyclic dinucleotides. Nature 573 , 434 (2019). Van De Weijer, M. L. et al. A high-coverage shRNA screen identifies TMEM129 as an E3 ligase involved in ER-associated protein degradation. Nat. Commun. 5 , 3832 (2014). Qiao, W. et al. MYADM binds human parechovirus 1 and is essential for viral entry. Nature Communications 2024 15:1 15 , 1–14 (2024). Ma, H. et al. LDLRAD3 is a receptor for Venezuelan equine encephalitis virus. Nature 2020 588:7837 588 , 308–314 (2020). Punjani, A., Rubinstein, J. L., Fleet, D. J. & Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nature Methods 2017 14:3 14 , 290–296 (2017). Warshamanage, R., Yamashita, K. & Murshudov, G. N. EMDA: A Python package for Electron Microscopy Data Analysis. J. Struct. Biol. 214 , 107826 (2022). Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66 , 486–501 (2010). Liebschner, D. et al. Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. Acta Crystallogr. D Struct. Biol. 75 , 861–877 (2019). Murshudov, G. N., Vagin, A. A. & Dodson, E. J. Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. D Biol. Crystallogr. 53 , 240–255 (1997). Krissinel, E. & Henrick, K. Inference of macromolecular assemblies from crystalline state. J. Mol. Biol. 372 , 774–797 (2007). Wallace, A. C., Laskowski, R. A. & Thornton, J. M. LIGPLOT: a program to generate schematic diagrams of protein-ligand interactions. Protein Eng. 8 , 127–134 (1995). Table Table 1. Cryo-EM data collection parameters ERAV only ERAV-Integrin + 2mM MgCl 2 ERAV-integrin + 2mM EDTA Apo integrin + 2mM MgCl 2 Microscope Titan Krios G3i Titan Krios G2 Titan Krios G3i Titan Krios G2 Detector Falcon 4i SelectrisX (ThermoFisher) BioQuantum K3 (Ametek-Gatan) Falcon 4i SelectrisX (ThermoFisher) BioQuantum K3 (Ametek-Gatan) Nominal Magnification 165,000x 105,000x 165,000x 105,000x Voltage (kV) 300 300 300 300 Movies collected (#) 1,000 14,405 16,799 7,172 Total dose (e - /Å 2 ) 50.5 40 50.5 50 Exposure time (s) 3.2 2.2 3.2 2.6 Dose rate (e - /pix/s) 8.5 9.5 8.5 9.0 Defocus range (µm) -3.0 to -1.0 -2.4 to -0.4 -3.0 to -1.0 -3.0 to -1.0 Pixel size (Å/pix) 0.7303 0.8250 0.7303 0.8290 Symmetry I2 I2 C1 I2 C1 C1 Initial particle count (#) 4,926 32,851 1,509,989 22,091 243,410 108,236 Final particle count (#) 2,108 25,170 266,365 22,091 42,755 55,595 Additional Declarations There is NO Competing Interest. Supplementary Files SupplementaryExcelFileERAVscreen.xlsx Supplemenrary ERAV CRISPRi screen data file TableS1.docx SupplFigurescombined.pdf Figure Legends – Supplementary Figures Figure S1. Overview of the genome-wide CRISPRi screen for host factors regulating ERAV infection. (A). HEK293T cells expressing a genome-wide library of CRISPRi guide RNAs (gRNAs) were infected with ERAV at MOI of 1 or mock-infected and incubated for 72 hpi. Cells were harvested, DNA extracted and deep sequenced to reveal gRNA enrichment in the two groups. (B) Knockdown validation of ITGA2 (left panel) and ITGB1 (middle panel) by FACS staining, and PA2G4 (right panel) by RT-qPCR of mRNA. (C). Knockdown of ITGA2 , ITGB1 and PA2G4 inhibits replication of ERAV (left panel) but not CVB3 (middle panel) and EMCV (right panel). ERAV, CVB3 and EMCV viruses were titrated directly on the KD cells and virus titers were scored after 6 days. (D). Experimental overview of the ERAV RNA transfection into the KD cells. Extracted ERAV RNA was transfected into the KD cells in the presence or absence of Lipofectamine 2000. At 16 h post-transfection, the plates were frozen and thawed three times followed by titrations and titer determination. The illustration was created in BioRender. (E). Validation of ITGA2 KO in HeLa cells by FACS staining. All P values were determined by One-way ANOVA and statistical significance compared to empty vector control with Dunnett post hoc test. *** p < 0.001, **** p<0.0001, ns; not significant. Figure S2. Comparison of ERAV Asymmetric Units (ASU) between our ERAV bound to integrin in MgCl2 and the previously published ERAV structure. (A) Our model of the ERAV bound to integrin in 2 mM MgCl2. (B) Previously published model of ERAV using x-ray crystallography, 2WFF (Tuthill et al., 2009). (C) Both models overlain on top of each other. The inset shows a significant deviation in the EF loop (residues 131-153) between our model and 2WFF. Figure S3. Difference maps between integrin ⍺2β1 bound to ERAV in 2mM EDTA or MgCl2. Difference maps were generated using the Python package, Electron Microscopy Data Analysis (Warshamanage et al., 2022)77 using maps filtered to 5Å. Differences are presented in relation to the head regions of the ⍺2 chain (A) or β1 chain (B). Difference maps are shown as the difference between the EDTA to MgCl2 (cyan) or vice versa (yellow). Figure S4. The ERAV DE loop binds to mannose. ERAV was incubated with 20 mM mannose in PBS for 24 h at 4℃, then subjected to cryo-EM as described in the Methods. Figure S5. Role of glycans for ERAV infection. (A). CVB3 replication in HEKΔSia with Siaα2-3Gal and Siaα2-6Gal knock-ins and (B) in HEKN (expressing only N-linked glycans), HEKO (expressing only O-linked glycans), or HEKGSL (expressing only glycosphingolipids). CVB3 was titrated directly on the indicated cells and virus titers were scored after 6 days. (C). Mean fluorescence intensity (MFI) for ITGA2 wt, N96A, N112A and empty vector (EV) KI in ITGA2 KD cells. (D). MFI for the ITGB1 wt, N269A and EV KI in ITGB1 KD cells. All P values were determined by One-way ANOVA and statistical significance compared to WT cells with Dunnett post hoc test. ns; not significant. Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9053284","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":605064718,"identity":"f46eec7c-97ff-4edf-ad1e-f97acddae42a","order_by":0,"name":"Frank van Kuppeveld","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIiWNgGAWjYBAC9gaGBAiLByrCx5B8AETL4NLCcwBdCxtDWgIyH5sWGAuuJccAvxYGhgdMNxgOy5vznDF7XFBxWI6NPeebNA/DHXxaEphzGA4b7uztMTeeceawMRvP221ALc9warGHaElj3HCex0yaty0tsU0iF6TlMCFb0uwhWv6l1bdJ5DwjRotN4oazPUAtDTYJbBI5bPi1MDMkHM4xsEnecOZYufGMYzaGbTzPjC3nGODRwt6T+DinQsJ2w5nkbY8LaiTk+dmTH954Aww6XFoYmHkSDjCAI4KBjRkhbIBTAxCwH4CxkLWMglEwCkbBKEAAAJ70R28xuQhLAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-5800-749X","institution":"Section of Virology, Division of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University","correspondingAuthor":true,"prefix":"","firstName":"Frank","middleName":"van","lastName":"Kuppeveld","suffix":""},{"id":605064719,"identity":"9de04b7b-0e65-4404-9195-c4c922b63ada","order_by":1,"name":"Collins Owino","email":"","orcid":"","institution":"Section of Virology, Division of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University","correspondingAuthor":false,"prefix":"","firstName":"Collins","middleName":"","lastName":"Owino","suffix":""},{"id":605064720,"identity":"bb41c609-e5a6-4e9a-9d0a-34bed1548ab5","order_by":2,"name":"Giann Dellosa","email":"","orcid":"","institution":"Division of Structural Biology, Nuffield Department of Medicine, University of Oxford, The Henry Welcome Building for Genomic Medicine, Oxford, UK and The Pirbright Institute, Ash Road, Woking, UK","correspondingAuthor":false,"prefix":"","firstName":"Giann","middleName":"","lastName":"Dellosa","suffix":""},{"id":605064721,"identity":"49c55320-96ba-4728-b834-3544fa81b365","order_by":3,"name":"Rutger Luteijn","email":"","orcid":"","institution":"Section of Virology, Division of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University","correspondingAuthor":false,"prefix":"","firstName":"Rutger","middleName":"","lastName":"Luteijn","suffix":""},{"id":605064722,"identity":"e4ffd09f-ba12-4af0-b09c-e5bca3e77010","order_by":4,"name":"Marleen Zwaagstra","email":"","orcid":"","institution":"Section of Virology, Division of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University","correspondingAuthor":false,"prefix":"","firstName":"Marleen","middleName":"","lastName":"Zwaagstra","suffix":""},{"id":605064723,"identity":"25297c14-de99-4259-8214-e6898dbf3211","order_by":5,"name":"Xue Yu","email":"","orcid":"","institution":"Biomolecular Mass Spectrometry and Proteomics, Bijvoet Center for Biomolecular Research and Utrecht Institute of Pharmaceutical Sciences, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Xue","middleName":"","lastName":"Yu","suffix":""},{"id":605064724,"identity":"b2867eb6-639c-4425-8e61-7d071696297e","order_by":6,"name":"Jill Ver Eecke","email":"","orcid":"","institution":"Section of Virology, Division of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University","correspondingAuthor":false,"prefix":"","firstName":"Jill","middleName":"Ver","lastName":"Eecke","suffix":""},{"id":605064725,"identity":"9c9ccbbf-c64b-4a5e-9414-786a89627762","order_by":7,"name":"Frank Buitenwerf","email":"","orcid":"","institution":"Section of Virology, Division of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University","correspondingAuthor":false,"prefix":"","firstName":"Frank","middleName":"","lastName":"Buitenwerf","suffix":""},{"id":605064726,"identity":"dcad7bf9-b973-4f9c-9b57-646e1b0993d0","order_by":8,"name":"Wendy Meijer","email":"","orcid":"","institution":"Section of Virology, Division of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University","correspondingAuthor":false,"prefix":"","firstName":"Wendy","middleName":"","lastName":"Meijer","suffix":""},{"id":605064727,"identity":"6da5a865-14a3-49ea-8c69-bf36272ed7bf","order_by":9,"name":"Mengying Liu","email":"","orcid":"https://orcid.org/0009-0008-2178-4867","institution":"Utrecht University","correspondingAuthor":false,"prefix":"","firstName":"Mengying","middleName":"","lastName":"Liu","suffix":""},{"id":605064728,"identity":"d876af50-66e2-4e89-b17b-8954a3cc5c75","order_by":10,"name":"Cornelis de Haan","email":"","orcid":"https://orcid.org/0000-0002-4459-9874","institution":"Utrecht University","correspondingAuthor":false,"prefix":"","firstName":"Cornelis","middleName":"","lastName":"de Haan","suffix":""},{"id":605064729,"identity":"81f8dcb0-be93-4923-9f93-a0cb0d5fec10","order_by":11,"name":"Daniel Hurdiss","email":"","orcid":"https://orcid.org/0000-0003-3834-5808","institution":"Utrecht University","correspondingAuthor":false,"prefix":"","firstName":"Daniel","middleName":"","lastName":"Hurdiss","suffix":""},{"id":605064730,"identity":"47eff534-2c56-4d01-8a8d-21000ca10a9c","order_by":12,"name":"Claudine Porta","email":"","orcid":"","institution":"Division of Structural Biology, Nuffield Department of Medicine, University of Oxford, The Henry Welcome Building for Genomic Medicine, Oxford, UK","correspondingAuthor":false,"prefix":"","firstName":"Claudine","middleName":"","lastName":"Porta","suffix":""},{"id":605064731,"identity":"8c74016b-3ff9-43d1-8bf5-b5d133f4f224","order_by":13,"name":"Helen Duyvesteyn","email":"","orcid":"","institution":"Division of Structural Biology, Nuffield Department of Medicine, University of Oxford, The Henry Welcome Building for Genomic Medicine, Oxford, UK","correspondingAuthor":false,"prefix":"","firstName":"Helen","middleName":"","lastName":"Duyvesteyn","suffix":""},{"id":605064732,"identity":"10048af8-9938-42ed-993f-5de2eb363149","order_by":14,"name":"James Kelly","email":"","orcid":"https://orcid.org/0000-0002-8307-507X","institution":"The Pirbright Institute","correspondingAuthor":false,"prefix":"","firstName":"James","middleName":"","lastName":"Kelly","suffix":""},{"id":605064733,"identity":"1975bef1-e584-41c6-81d4-664f0e2712f2","order_by":15,"name":"Tobias Tuthill","email":"","orcid":"https://orcid.org/0000-0002-6582-388X","institution":"Pirbright Institute","correspondingAuthor":false,"prefix":"","firstName":"Tobias","middleName":"","lastName":"Tuthill","suffix":""},{"id":605064734,"identity":"500ce94e-59a7-47b0-859f-13af1c331121","order_by":16,"name":"Yoshiki Narimatsu","email":"","orcid":"https://orcid.org/0000-0003-1428-5695","institution":"Copenhagen Center for Glycomics \u0026 Center for Glycocalyx Research","correspondingAuthor":false,"prefix":"","firstName":"Yoshiki","middleName":"","lastName":"Narimatsu","suffix":""},{"id":605064735,"identity":"c30c5ecf-990e-40df-89a7-6527f3df52b8","order_by":17,"name":"Henrik Clausen","email":"","orcid":"https://orcid.org/0000-0002-0915-5055","institution":"University of Copenhagen","correspondingAuthor":false,"prefix":"","firstName":"Henrik","middleName":"","lastName":"Clausen","suffix":""},{"id":605064736,"identity":"baaa354c-f3aa-43e7-9445-a85ade6f90a8","order_by":18,"name":"Pranav Shah","email":"","orcid":"","institution":"Division of Structural Biology, Nuffield Department of Medicine, University of Oxford, The Henry Welcome Building for Genomic Medicine, Oxford, UK","correspondingAuthor":false,"prefix":"","firstName":"Pranav","middleName":"","lastName":"Shah","suffix":""},{"id":605064737,"identity":"45465d86-36c5-4160-9e4b-6ec93bd4e233","order_by":19,"name":"Elizabeth Fry","email":"","orcid":"","institution":"University of Oxford","correspondingAuthor":false,"prefix":"","firstName":"Elizabeth","middleName":"","lastName":"Fry","suffix":""},{"id":605064738,"identity":"8f6b381e-a03b-47da-b48c-d48f8c0f77a3","order_by":20,"name":"Karli Reiding","email":"","orcid":"","institution":"Biomolecular Mass Spectrometry and Proteomics, Bijvoet Center for Biomolecular Research and Utrecht Institute of Pharmaceutical Sciences, Utrecht University, Utrecht, The Netherlands","correspondingAuthor":false,"prefix":"","firstName":"Karli","middleName":"","lastName":"Reiding","suffix":""},{"id":605064739,"identity":"88b5b5ac-499c-401e-b384-bd35176c6dfc","order_by":21,"name":"Erik de Vries","email":"","orcid":"https://orcid.org/0000-0003-0763-8202","institution":"Utrecht University","correspondingAuthor":false,"prefix":"","firstName":"Erik","middleName":"","lastName":"de Vries","suffix":""},{"id":605064740,"identity":"9dc1bd1a-3418-41b0-88ad-b12fd1c69948","order_by":22,"name":"David Stuart","email":"","orcid":"","institution":"Division of Structural Biology, Nuffield Department of Medicine, University of Oxford, The Henry Welcome Building for Genomic Medicine, Oxford, UK","correspondingAuthor":false,"prefix":"","firstName":"David","middleName":"","lastName":"Stuart","suffix":""}],"badges":[],"createdAt":"2026-03-06 18:40:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9053284/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9053284/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104819206,"identity":"7ec9fbf5-e9ea-4cc3-8b3a-6b807695cf35","added_by":"auto","created_at":"2026-03-17 14:07:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":272513,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGenome-wide CRISPRi screen identifies host factors regulating ERAV infection.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eDistribution of the robust rank aggregation (RRA) score in the comparison of hits enriched in ERAV-infected cells compared to uninfected cells. (\u003cstrong\u003eB\u003c/strong\u003e) Crystal violet staining of HEK293T \u003cem\u003eITGA2\u003c/em\u003e, \u003cem\u003eITGB1\u003c/em\u003e and \u003cem\u003ePA2G4\u003c/em\u003e KD cells following infection with ERAV or CVB3 at MOI of 10 and 1, respectively, at 48 hpi. EV, empty vector. (\u003cstrong\u003eC\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eERAV titers at 0, 24, 48 and 72 hpi in the cells lines mentioned in B. (\u003cstrong\u003eD\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eERAV RNA transfection on indicated HEK293T KD cells or EV control cells. ERAV RNA was extracted from ERAV infected 293T cells, followed by transfection in the presence or absence of Lipofectamine 2000. (\u003cstrong\u003eE\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eHeLa cells were incubated with integrin ⍺2-specific antibody for 2 h followed by infection with ERAV or CVB3, samples were harvested 16 hpi and stained for dsRNA by FACS.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eF\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eERAV was preincubated with recombinant ⍺2β1 protein for 1 h at 37°C, used to infect HeLa cells for 16 h, after which cells were harvested, stained for dsRNA and quantified by FACS. (\u003cstrong\u003eG\u003c/strong\u003e) Pretreatment of ERAV with integrin ⍺2-specific antibody reduces virus infection in a dose-dependent manner in equine lung fibroblast cells. (\u003cstrong\u003eH\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eCrystal violet staining of HeLa WT or ITGA2 KO cells infected with ERAV or CVB3 at MOI of 20 and 10, respectively, at 48 hpi. (\u003cstrong\u003eI\u003c/strong\u003e) Titration of ERAV, CVB3 and Echovirus 1 on the HeLa \u003cem\u003eITGA2 \u003c/em\u003eKO cells. (\u003cstrong\u003eJ\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eKnockout of \u003cem\u003eITGA2 \u003c/em\u003eaffects binding and internalisation of ERAV but not CVB3. Panels B-J show combined results of at least 2 independent experiments. The data represents the mean ± SEM of three independent experiements (\u003cstrong\u003eC-E\u003c/strong\u003e, and \u003cstrong\u003eI\u003c/strong\u003e) or two independent experiments (\u003cstrong\u003eF-G,\u003c/strong\u003e and \u003cstrong\u003eJ\u003c/strong\u003e). P values were determined by multiple two-tailed unpaired t-tests with Bonferroni-Dunn method (\u003cstrong\u003eC\u003c/strong\u003e), or One-way analysis of variance (ANOVA) (\u003cstrong\u003eD\u003c/strong\u003e) or two-way ANOVA with Dunnett post hoc test (\u003cstrong\u003eE-G\u003c/strong\u003e and \u003cstrong\u003eJ\u003c/strong\u003e). ** p \u0026lt; 0.01; *** p \u0026lt; 0.001, **** p\u0026lt;0.0001, ns; not significant.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-9053284/v1/1e1a7d2991dd6b85c9cee661.png"},{"id":104835481,"identity":"d7d086df-7277-4241-b620-2908e2693400","added_by":"auto","created_at":"2026-03-17 17:45:19","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":565719,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIcosahedral reconstruction of ERAV with integrin ⍺2β1 shows densities along the 5-fold axis of symmetry.\u003c/strong\u003e Purified ERAV in 1x PBS was incubated with or without integrin ⍺2β1 in 4°C overnight. (\u003cstrong\u003eA-C\u003c/strong\u003e) Shown in the top row are isosurface renderings of icosahedrally-averaged Coulomb potential maps, and purple densities show symmetry-expanded subparticles of the non-ERAV densities. \u003cstrong\u003e(A) \u003c/strong\u003eERAV in 1X PBS without integrin ⍺2β1. The particle is labelled with the 2-fold (ellipse), 3-fold (triangle), and 5-fold (pentagon) icosahedral axes of symmetry. Shown at the bottom is the ERAV asymmetric unit coloured by viral protein. (\u003cstrong\u003eB\u003c/strong\u003e) ERAV in PBS supplemented with 300-fold excess integrin ⍺2β1 and 2 mM MgCl\u003csub\u003e2\u003c/sub\u003e. (\u003cstrong\u003eC\u003c/strong\u003e) ERAV in PBS supplemented with 300-fold excess integrin ⍺2β1 and 2 mM EDTA. (\u003cstrong\u003eD\u003c/strong\u003e)The icosahedral reconstruction and symmetry expanded subparticles from Figure 3B were used for model building of integrin and ERAV. The models were then iteratively refined using Coot and Phenix. Model of the ERAV-receptor complex coloured by viral protein and integrin subunit. Glycans are shown as orange spheres. VP4 not shown. Glycoproteomics analysis of integrin ⍺2 N112 glycan (\u003cstrong\u003eE\u003c/strong\u003e) and β1 N269 glycan (\u003cstrong\u003eF\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9053284/v1/23536185c9a70ef271eb9bbd.png"},{"id":104835430,"identity":"3a5eb031-8160-40c0-b452-2a16cae055a0","added_by":"auto","created_at":"2026-03-17 17:44:48","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":391841,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eERAV-bound and soluble integrin are in the closed conformation. \u003c/strong\u003eSagittal view of the ERAV-bound integrin ⍺2β1 (\u003cstrong\u003eA\u003c/strong\u003e) and apo ⍺2β1 (\u003cstrong\u003eB\u003c/strong\u003e) with insets corresponding to the ⍺2 N112 and β1 N269 glycan. (\u003cstrong\u003eC\u003c/strong\u003e) Orthogonal views of the overlay of soluble and apo integrin ⍺2β1. The ⍺2 and β1 chains are separated to aid in viewing. Top view of the ERAV-bound integrin ⍺2β1 (\u003cstrong\u003eD\u003c/strong\u003e) and apo ⍺2β1 \u003cstrong\u003e(E)\u003c/strong\u003e with insets corresponding to the ⍺1 and ⍺7 helix of the β-I domain. (\u003cstrong\u003eF\u003c/strong\u003e) Previously published structure the integrin ⍺Eβ7 in the ligand-bound form (PDB: 9P99). Ligand not shown. (\u003cstrong\u003eG\u003c/strong\u003e) Previously published structure of the integrin ⍺Eβ7 in closed form (PDB: 9P97).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-9053284/v1/b80aab1b88858f8f481a476b.png"},{"id":104819200,"identity":"0833e608-a6dd-4cad-9796-0befa4a82563","added_by":"auto","created_at":"2026-03-17 14:07:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":477595,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eERAV binds integrin through VP1 using protein-protein and protein-glycan interactions. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Overview of the surface of an ERAV pentamer, showing the VP1 residues involved in receptor binding. Protein-protein interactions are shown in maroon and glycan-protein interactions in orange, the labels on the interaction sites denote the panel in which these interactions are detailed. (\u003cstrong\u003eB,C\u003c/strong\u003e) Protein-protein interactions between adjacent VP1 monomers and integrin ⍺2. Interacting residues were predicted using LigPlot\u003csup\u003e82\u003c/sup\u003e\u0026nbsp; and are shown as heteroatoms (red = oxygen, blue = nitrogen, yellow = sulphur) along with DIMPLOTs shown in the insets. (\u003cstrong\u003eD,E\u003c/strong\u003e) Coulombic electrostatic potential of ERAV pentamers (red = negative potential, white to blue = positive potential) are shown with the interacting glycans. LIGPLOTs are also provided in the inset. Shown in green text is the distance for LIGPLOT-predicted hydrogen bonds based on the model. (\u003cstrong\u003eF\u003c/strong\u003e) A comparison of the position of the terminal sialyllactose of N269 with previously published data (PDB: 2XBO, Fry et al., 2010)\u003csup\u003e26\u003c/sup\u003e using soluble sialyllactose. Our model and PDB:2XBO were aligned based on the full VP1 model. Shown in red is the position of the sialic acid and galactose as shown in Fry et al. (2010), and in orange is our observed position for the terminal sialic acid and galactose of the ⍺2 N112 glycan.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-9053284/v1/a858c98b70da140904311e56.png"},{"id":104835570,"identity":"a63c7a2d-968a-4112-b568-751c636f02f9","added_by":"auto","created_at":"2026-03-17 17:46:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":203736,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eN112 on the integrin ⍺2 chain and N269 on the β1 chain chain are essential for ERAV infection. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eERAV replication in HEK293 cells engineered with elaborated glycans only on N-glycans (HEK\u003csup\u003eN\u003c/sup\u003e), only on O-glycans (HEK\u003csup\u003eO\u003c/sup\u003e GalNAc-type), or only on glycosphingolipids (HEK\u003csup\u003eGSL\u003c/sup\u003e), as determined by endpoint titration. (\u003cstrong\u003eB\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eERAV replication in HEK293 cells engineered without sialyltransferases (HEK\u003csup\u003eΔSia\u003c/sup\u003e) or HEK\u003csup\u003eΔSia\u003c/sup\u003e with KI of individual a2-3 or a2-6 sialyltransferases, as determined by endpoint titration. (\u003cstrong\u003eC\u003c/strong\u003e) ERAV growth curve in HEK\u003csup\u003eΔSia \u003c/sup\u003eand HEK\u003csup\u003eΔMGAT1\u003c/sup\u003e cells. (\u003cstrong\u003eD\u003c/strong\u003e) Binding (left panel) and internalization assays (right panel) in HEK\u003csup\u003eΔSia\u003c/sup\u003e, HEK\u003csup\u003eΔMGAT1\u003c/sup\u003e and HEK\u003csup\u003eΔSia/MGAT1\u003c/sup\u003e double knockout (DKO) cells. \u003cstrong\u003e(E)\u003c/strong\u003e ERAV replication in ITGB1 KD cells transduced with lentiviruses expressing ITGB1 WT, ITGB1 N269A or empty vector (EV) as control. (\u003cstrong\u003eF\u003c/strong\u003e) Binding (left panel) and internalisation (right panel) of ERAV measured using cell lines described in E. (\u003cstrong\u003eG\u003c/strong\u003e) ERAV replication in ITGA2 KD cells transduced with lentiviruses expressing ITGA2 WT, ITGA1 N96A, ITGA1 N112A or EV as control. (\u003cstrong\u003eH\u003c/strong\u003e) Binding (left panel) and internalisation (right panel) of ERAV using cell lines described in G. Representative data are shown with each of the experiments performed at least two independent times each time in triplicates. P values were determined by One-way ANOVA and statistical significance compared to WT cells with Dunnett post hoc test (\u003cstrong\u003eA, B, D, F\u003c/strong\u003e and \u003cstrong\u003eH\u003c/strong\u003e) or multiple two-tailed unpaired t-tests with Bonferroni-Dunn method (\u003cstrong\u003eC,E\u003c/strong\u003e and \u003cstrong\u003eG\u003c/strong\u003e) using GraphPad Prism. * p \u0026lt; 0.05; ** p \u0026lt; 0.01; *** p \u0026lt; 0.001, **** p\u0026lt;0.0001, ns; not significant. \u0026nbsp;\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-9053284/v1/9cbb8ba906e5e086d0bb0d3d.png"},{"id":104836091,"identity":"b493528b-cd7e-4bb7-8fab-6fc231118f5a","added_by":"auto","created_at":"2026-03-17 17:51:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4277998,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9053284/v1/889373a3-b424-4b98-8d16-8eb717813db6.pdf"},{"id":104819202,"identity":"c930edb0-89cd-492d-a0b7-9841bb8b67ed","added_by":"auto","created_at":"2026-03-17 14:07:22","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1966155,"visible":true,"origin":"","legend":"Supplemenrary ERAV CRISPRi screen data file","description":"","filename":"SupplementaryExcelFileERAVscreen.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-9053284/v1/9a2322be9417109dbc8fd369.xlsx"},{"id":104819204,"identity":"11500571-defd-4fda-adff-97ca059a9a73","added_by":"auto","created_at":"2026-03-17 14:07:22","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":26565,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.docx","url":"https://assets-eu.researchsquare.com/files/rs-9053284/v1/e2a7d6290a1b0f0b9533b47d.docx"},{"id":104819207,"identity":"30624e1d-7330-4f28-9568-c75f2e1dcd89","added_by":"auto","created_at":"2026-03-17 14:07:22","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1540213,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure Legends – Supplementary Figures\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure S1. Overview of the genome-wide CRISPRi screen for host factors regulating ERAV infection.\u003c/strong\u003e (\u003cstrong\u003eA).\u003c/strong\u003e HEK293T cells expressing a genome-wide library of CRISPRi guide RNAs (gRNAs) were infected with ERAV at MOI of 1 or mock-infected and incubated for 72 hpi. Cells were harvested, DNA extracted and deep sequenced to reveal gRNA enrichment in the two groups.\u0026nbsp;(\u003cstrong\u003eB\u003c/strong\u003e) Knockdown validation of \u003cem\u003eITGA2 \u003c/em\u003e(left panel) and \u003cem\u003eITGB1\u003c/em\u003e (middle panel) by FACS staining, and \u003cem\u003ePA2G4\u003c/em\u003e (right panel) by RT-qPCR of mRNA. (\u003cstrong\u003eC). \u003c/strong\u003eKnockdown of \u003cem\u003eITGA2\u003c/em\u003e, \u003cem\u003eITGB1\u003c/em\u003e and \u003cem\u003ePA2G4\u003c/em\u003e inhibits replication of ERAV (left panel) but not CVB3 (middle panel) and EMCV (right panel). ERAV, CVB3 and EMCV viruses were titrated directly on the KD cells and virus titers were scored after 6 days. (\u003cstrong\u003eD)\u003c/strong\u003e. Experimental overview of the ERAV RNA transfection into the KD cells. Extracted ERAV RNA was transfected into the KD cells in the presence or absence of Lipofectamine 2000. At 16 h post-transfection, the plates were frozen and thawed three times followed by titrations and titer determination. The illustration was created in BioRender. (\u003cstrong\u003eE).\u003c/strong\u003e Validation of \u003cem\u003eITGA2 \u003c/em\u003eKO in HeLa cells by FACS staining. All P values were determined by One-way ANOVA and statistical significance compared to empty vector control with Dunnett post hoc test. *** p \u0026lt; 0.001, **** p\u0026lt;0.0001, ns; not significant.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure S2. Comparison of ERAV Asymmetric Units (ASU) between our ERAV bound to integrin in MgCl2 and the previously published ERAV structure. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Our model of the ERAV bound to integrin in 2 mM MgCl2. (\u003cstrong\u003eB\u003c/strong\u003e) Previously published model of ERAV using x-ray crystallography, 2WFF (Tuthill et al., 2009). (\u003cstrong\u003eC\u003c/strong\u003e) Both models overlain on top of each other. The inset shows a significant deviation in the EF loop (residues 131-153) between our model and 2WFF.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure S3. Difference maps between integrin ⍺2β1 bound to ERAV in 2mM EDTA or MgCl2. \u0026nbsp;\u003c/strong\u003eDifference maps were generated using the Python package, Electron Microscopy Data Analysis (Warshamanage et al., 2022)77 using maps filtered to 5Å. Differences are presented in relation to the head regions of the ⍺2 chain (\u003cstrong\u003eA\u003c/strong\u003e) or β1 chain (\u003cstrong\u003eB\u003c/strong\u003e). Difference maps are shown as the difference between the EDTA to MgCl2 (cyan) or vice versa (yellow).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure S4. The ERAV DE loop binds to mannose. \u003c/strong\u003eERAV was incubated with 20 mM mannose in PBS for 24 h at 4℃, then subjected to cryo-EM as described in the Methods.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure S5. Role of glycans for ERAV infection. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e. \u003c/strong\u003eCVB3 replication in HEKΔSia with Siaα2-3Gal and Siaα2-6Gal knock-ins and (\u003cstrong\u003eB\u003c/strong\u003e) in HEKN (expressing only N-linked glycans), HEKO (expressing only O-linked glycans), or HEKGSL (expressing only glycosphingolipids). CVB3 was titrated directly on the indicated cells and virus titers were scored after 6 days. \u0026nbsp;(\u003cstrong\u003eC\u003c/strong\u003e)\u003cstrong\u003e.\u003c/strong\u003e Mean fluorescence intensity (MFI) for \u003cem\u003eITGA2\u003c/em\u003e wt, N96A, N112A and empty vector (EV) KI in \u003cem\u003eITGA2 \u003c/em\u003eKD cells. (\u003cstrong\u003eD\u003c/strong\u003e). MFI for the \u003cem\u003eITGB1\u003c/em\u003e wt, N269A and EV KI in \u003cem\u003eITGB1\u003c/em\u003e KD cells. All P values were determined by One-way ANOVA and statistical significance compared to WT cells with Dunnett post hoc test. ns; not significant.\u003c/p\u003e","description":"","filename":"SupplFigurescombined.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9053284/v1/d39c99ba34817c20a91a0694.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Identification and structural characterisation of a picornavirus integrin receptor with an essential role of two distinct glycans for virus infection","fulltext":[{"header":"Introduction ","content":"\u003cp\u003eThe family \u003cem\u003ePicornaviridae\u0026nbsp;\u003c/em\u003ecomprises a large group of (+) strand RNA viruses that infect humans (e.g. poliovirus, rhinovirus) and animals (e.g. foot-and-mouth disease virus, FMDV), with huge medical and socio-economic impact. The icosahedral capsid of these non-enveloped viruses directly interacts with specific host cell surface-displayed receptors, thereby determining cell tropism and pathogenesis. For many of them, these interactions lead to endocytic uptake. During endocytosis, receptor and/or pH-induced structural rearrangements in the capsid\u003csup\u003e1–3\u003c/sup\u003e may facilitate the formation of a pore\u003csup\u003e4\u003c/sup\u003e in the endosomal membrane through which the viral genome is released into the cytoplasm\u003csup\u003e4,5\u003c/sup\u003e. The receptors used by picornaviruses are often categorised as either ‘attachment’ or ‘uncoating’ receptors. Attachment receptors are thought to facilitate cell attachment and/or promote virus uptake; in contrast, uncoating receptors induce conformational changes in the viral capsids that mediate the uncoating process. Receptors mediating uncoating are typically proteins, which often bind in the canyon (a depression around the icosahedral 5-fold axis of symmetry) found in some picornavirus capsids, whereas attachment receptors can either be a protein (e.g. decay-accelerating factor)\u003csup\u003e6\u003c/sup\u003e or a glycan (e.g. sialic acid, heparan sulphate)\u003csup\u003e7\u003c/sup\u003e. However, this distinction is not absolute since EV-D68, an emerging respiratory enterovirus, has been shown to bind protein receptor MFSD6\u003csup\u003e8\u003c/sup\u003e whilst it also binds sialylated glycans via its canyon, the latter being sufficient to trigger conformational changes that initiate uncoating\u003csup\u003e9\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEquine rhinitis A virus (ERAV), a member of the genus \u003cem\u003eAphthovirus\u003c/em\u003e, causes acute respiratory infections in horses worldwide\u003csup\u003e10–12\u003c/sup\u003e. ERAV is phylogenetically most closely related to FMDV, with which it shares many features of virus structure as well as cell entry (and often used as a surrogate requiring lower containment); both viruses require endocytosis and low pH for entry, and both are sensitive to low pH capsid dissociation\u003csup\u003e13\u003c/sup\u003e. FMDV enters cells upon binding to protein attachment receptors like integrins αVβ3, αVβ6, αVβ1, and αVβ8\u003csup\u003e14–18\u003c/sup\u003e. Additionally, FMDV has been suggested to use heparan sulphate as a receptor,\u0026nbsp;but this is likely a cell culture adaptation\u003csup\u003e19–23\u003c/sup\u003e.\u0026nbsp;No specific protein has been identified as a receptor for ERAV so far, with only α2-3 linked sialic acids (2-3Sia) having been identified as important for virus entry\u003csup\u003e24–26\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eIntegrins are\u0026nbsp;heterodimeric transmembrane glycoproteins that mediate cell-adhesion. They comprise α and β subunits, the N-terminal domains of which form a large ectodomain structure while the C-terminal domains comprise hydrophobic membrane-spanning helices. Integrin α2β1 interacts with extracellular matrix proteins, primarily collagen. Half of the known α chains, including α2, contain the “inserted” I (α-I) domain (aka A-domain)\u003csup\u003e27\u003c/sup\u003e, which is absent in the arginine-glycine-aspartic acid (RGD)-binding integrins such as αV\u003csup\u003e27–31\u003c/sup\u003e. Integrin\u0026nbsp;α2β1 harbours an\u0026nbsp;α-I domain inserted between blades 2 and 3 of the highly conserved\u0026nbsp;β-propeller domain. Furthermore, integrin\u0026nbsp;α\u0026nbsp;and\u0026nbsp;β\u0026nbsp;subunits can bind several divalent cations, which stabilise protein structure and modulate ligand binding\u003csup\u003e32,33\u003c/sup\u003e.\u0026nbsp;a-I-domain integrins show Mg\u003csup\u003e2+\u003c/sup\u003e-dependent binding to physiological ligands, which is enhanced by Mn\u003csup\u003e2+\u003c/sup\u003e through the conserved metal ion-dependent adhesion site (MIDAS) motif in the\u0026nbsp;α-I domain\u003csup\u003e34\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eHere, using a CRISPR interference (CRISPRi) screen, we report the identification of integrin ⍺2β1 as a receptor for ERAV. Using a combination of virological, genetic, structural, and glycoproteomic approaches, we show that ERAV utilises integrin ⍺2β1 as a receptor in a cation-independent manner, facilitated by binding to the β-propeller of the integrin ⍺2 chain. The cryo-EM reconstruction of the virus-receptor complex shows that interactions of ERAV to the integrin occur via three distinct points of attachment, a high mannose glycan on the integrin ⍺-chain, a sialylated N-glycan on the β-chain and protein-protein interactions with the β-propeller of the ⍺2 chain, so that the integrin caps a 5-fold axis of the virus. Using knock-out cells that cannot make sialic acid and by reconstituting integrin ⍺2β1-depleted cells with mutant receptors, we demonstrate the functional importance of these glycans for efficient infection. Our results identify an unprecedented combination of protein-protein and protein-glycan interactions between a virus and its receptor and provide unique structural insight into the role of clustered saccharide patches, an emerging concept that a higher level of glycan organization, can create a distinct recognition motif.\u0026nbsp;\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eIdentification of\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;integrin\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e⍺\u003c/strong\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003cstrong\u003eβ\u003c/strong\u003e\u003cstrong\u003e1\u003cstrong\u003e\u0026nbsp;as an ERAV host factor\u003c/strong\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTo\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;identify host factors regulating ERAV infection, we performed a CRISPRi screen in HEK293T cells (\u003c/strong\u003e\u003cstrong\u003eFig. S1A\u003c/strong\u003e\u003cstrong\u003e). A genome-wide CRISPRi gRNA library was introduced into cultures of HEK293T such that expression of a single gene was repressed in each cell. Cells were infected with ERAV and after 3 days the cell population surviving infection was harvested and processed to identify gRNA abundance. We identified numerous enriched and depleted gRNAs (\u003c/strong\u003e\u003cstrong\u003eSupplementary Excel file\u003c/strong\u003e\u003cstrong\u003e). The group of enriched gRNAs, which likely target host susceptibility factors\u0026nbsp;\u003c/strong\u003e(\u003cstrong\u003eFig. 1A\u003c/strong\u003e),\u003cstrong\u003e\u0026nbsp;included\u0026nbsp;\u003c/strong\u003ethe glycosyltransferases \u003cem\u003eST3GAL4\u003c/em\u003e and \u003cem\u003eB4GALT1\u003c/em\u003e, which play important roles in sialic acid biology\u003csup\u003e35,36\u003c/sup\u003e. Moreover, it included\u0026nbsp;\u003cstrong\u003ep\u003c/strong\u003eroliferation-associated protein 2G4 (\u003cem\u003ePA2G4\u003c/em\u003e), which was recently described to bind to type II internal ribosome entry site (IRES) elements which occur in the 5’ UTR of aphthoviruses and cardioviruses to regulate viral translation\u003csup\u003e37\u003c/sup\u003e, confirming the validity of our CRISPRi screen. The top hits also included\u0026nbsp;\u003cstrong\u003eintegrin\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e⍺\u003c/strong\u003e\u003cstrong\u003e2 (\u003cem\u003eITGA2\u003c/em\u003e)\u0026nbsp;\u003c/strong\u003eand integrin β1 (\u003cem\u003eITGB1\u003c/em\u003e). To investigate the importance of these hits,\u0026nbsp;\u003cstrong\u003ewe generated \u003cem\u003eITGA2\u003c/em\u003e, \u003cem\u003eITGB1\u003c/em\u003e and \u003cem\u003ePA2G4\u003c/em\u003e knockdown (KD) cells in 293T cells using the two most enriched gRNAs for each host factor in the virus-exposed population. The knockdown was confirmed by FACS staining with integrin\u0026nbsp;\u003c/strong\u003e⍺2 \u003cstrong\u003eantibody and RT-qPCR (\u003c/strong\u003e\u003cstrong\u003eFig. S1B\u003c/strong\u003e\u003cstrong\u003e). Knockdown of \u003cem\u003eITGA2\u003c/em\u003e, \u003cem\u003eITGB1\u003c/em\u003e, and \u003cem\u003ePA2G4\u003c/em\u003e strongly reduced ERAV replication, as determined by endpoint titration (\u003c/strong\u003e\u003cstrong\u003eFig. S1C\u003c/strong\u003e\u003cstrong\u003e). However, knockdown of these genes did not affect replication of other picornaviruses such as coxsackievirus B3 (CVB3), an enterovirus, or encephalomyocarditis virus (EMCV), a cardiovirus (\u003c/strong\u003e\u003cstrong\u003eFig. S1C\u003c/strong\u003e\u003cstrong\u003e). Follow-up experiments were performed with one KD cell line for each factor.\u0026nbsp;\u003c/strong\u003eAnalysis of replication by determining virus-induced CPE (\u003cstrong\u003eFig. 1B\u003c/strong\u003e) or measuring virus titers at different time points in a low MOI multi-cycle infection (\u003cstrong\u003eFig. 1C\u003c/strong\u003e) showed that viral growth was significantly reduced in the KD cell lines, further supporting the importance of these genes for ERAV replication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBy transfecting ERAV RNA into \u003cem\u003eITGA2\u003c/em\u003e and \u003cem\u003eITGB1\u003c/em\u003e KD cells (\u003c/strong\u003e\u003cstrong\u003eFig. S1D\u003c/strong\u003e\u003cstrong\u003e), we demonstrated that bypassing receptor-mediated entry and uncoating abolished the requirement for these integrins, indicating that they play a role in the entry/early stages of the ERAV infection cycle (\u003c/strong\u003e\u003cstrong\u003eFig. 1D\u003c/strong\u003e\u003cstrong\u003e). In contrast, and in line with its role in enhancing IRES-mediated viral RNA translation, ERAV replication was significantly inhibited following RNA transfection in the \u003cem\u003ePA2G4\u003c/em\u003e KD cells (\u003c/strong\u003e\u003cstrong\u003eFig. 1D\u003c/strong\u003e\u003cstrong\u003e).\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eI\u003c/strong\u003e\u003cstrong\u003entegrin ⍺2β1\u003cstrong\u003e\u0026nbsp;is required for the entry stage of ERAV infection\u003c/strong\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate a role for integrin ⍺2β1 in ERAV entry in other cell types, we tested whether an integrin ⍺2\u0026nbsp;antibody\u0026nbsp;or a\u0026nbsp;soluble form of the\u0026nbsp;⍺2β1\u0026nbsp;heterodimer could neutralise ERAV infection in another human cell line, HeLa-R19. Pretreatment of HeLa cells with an integrin ⍺2\u0026nbsp;antibody\u0026nbsp;inhibited ERAV infection but not CVB3 (\u003cstrong\u003eFig. 1E\u003c/strong\u003e).\u0026nbsp;Additionally, preincubating ERAV with recombinant human integrin ⍺2β1\u0026nbsp;inhibited ERAV infection in a dose-dependent\u0026nbsp;manner, while CVB3 infection was unaffected (\u003cstrong\u003eFig. 1F)\u003c/strong\u003e. We also investigated the role of integrin ⍺2β1\u0026nbsp;in the infection of primary equine lung fibroblast (ELF) cells. Pretreatment of ELF cells with recombinant integrin ⍺2β1\u0026nbsp;inhibited ERAV infection \u003cstrong\u003ein a dose-dependent manner,\u003c/strong\u003e similar to HeLa R19 cells \u003cstrong\u003e(\u003c/strong\u003e\u003cstrong\u003eFig. 1G\u003c/strong\u003e\u003cstrong\u003e)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eTo dissect the importance of\u0026nbsp;integrin ⍺2β1 in ERAV attachment and internalisation, we generated HeLa R19 \u003cem\u003eI\u003c/em\u003e\u003cem\u003eTGA2\u0026nbsp;\u003c/em\u003eKO cells (\u003cstrong\u003eFig. S1E\u003c/strong\u003e). As expected, these cells were resistant to infection with ERAV, but not CVB3 (\u003cstrong\u003eFig. 1H\u003c/strong\u003e), while EV-1 infection was also inhibited, consistent with its dependence on integrin ⍺2β1\u0026nbsp;as the receptor\u0026nbsp;(\u003cstrong\u003eFig. 1I\u003c/strong\u003e)\u003csup\u003e38\u003c/sup\u003e. To determine the role of the\u0026nbsp;integrin ⍺2β1 complex\u0026nbsp;in ERAV entry, we measured virus binding of ERAV and CVB3 (as a control) to\u0026nbsp;HeLa R19 \u003cem\u003eI\u003c/em\u003e\u003cem\u003eTGA2\u0026nbsp;\u003c/em\u003eKO cells at 4°C. ERAV and CVB3 RNA were measured by RT-qPCR using virus-specific primers. Knockout of \u003cem\u003eITGA2\u003c/em\u003e disturbed binding of ERAV, but not of CVB3 (\u003cstrong\u003eFig. 1J\u003c/strong\u003e). Altogether, our data suggest that integrin ⍺2β1 acts as a receptor mediating attachment and\u0026nbsp;entry of ERAV.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMg\u003csup\u003e2+\u003c/sup\u003e-independent binding of integrin ⍺2\u003c/strong\u003e\u003cstrong\u003eβ\u003c/strong\u003e\u003cstrong\u003e1 to ERAV along the 5-fold axis of symmetry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsing single-particle analysis, we determined a high-resolution icosahedrally averaged reconstruction of ERAV alone (global resolution = 2.3 Å), and ERAV complexed with\u0026nbsp;⍺2β1, either in the presence or absence of Mg\u003csup\u003e2+\u003c/sup\u003e (the latter using EDTA as a chelating agent), with global resolutions of 2.0 Å and 2.1 Å, respectively (\u003cstrong\u003eTable 1\u003c/strong\u003e). All maps showed clear density for the capsid proteins, whilst the maps of virus complexed with receptor showed additional diffuse density centred above each of the twelve 5-fold symmetry axes (\u003cstrong\u003eFig. 2A-C\u003c/strong\u003e), indicating the presence of bound receptor and suggesting that\u0026nbsp;there are a total of twelve integrin binding sites, one at each of the twelve 5-fold symmetry axes, in contrast to the situation for FMDV\u003csup\u003e39\u003c/sup\u003e (and poliovirus\u003csup\u003e40\u003c/sup\u003e) where there are sixty receptor binding sites, one on each of the 60 icosahedral symmetry units.\u003c/p\u003e\n\u003cp\u003eThe structure of the virus particle was identical in all three maps and was largely indistinguishable from the previously determined crystal structure of ERAV\u003csup\u003e41\u003c/sup\u003e, except for a stretch of ~20 residues in the VP2 EF-loop (residues 131-153), which in our reconstructions deviates significantly from the crystal structure (C\u003csub\u003e⍺\u003c/sub\u003e shifts of up to 4.0 Å, \u003cstrong\u003eFig. S2\u003c/strong\u003e). Since this conformation is present in all three reconstructions, it is independent of divalent cation or receptor-induced conformational changes. Most likely, it is due to differences between the crystallisation conditions (PDB:2WFF) and the physiological buffer conditions used in our cryo-EM experiments.\u003c/p\u003e\n\u003cp\u003eTo deconvolute the receptor density, we performed symmetry expansion followed by focused 3D classification. This yielded a high-quality reconstruction (Table \u003cstrong\u003eS1\u003c/strong\u003e) revealing a single integrin molecule bound above each 5-fold axis at full occupancy (Fig. \u003cstrong\u003e2B,C\u003c/strong\u003e).\u0026nbsp;The two symmetry-expanded integrin-bound structures, one with Mg\u003csup\u003e2+\u003c/sup\u003e and one lacking divalent cations, were indistinguishable (a 5-Å resolution difference map showed no significant differences, \u003cstrong\u003eFig. S3\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eImportantly, the capsid-proximal domains of the integrin were better resolved than the rest of the molecule. The structure of the integrin was modelled and hybrid-refined based on an initial AlphaFold model\u003csup\u003e42\u003c/sup\u003e. Overall, the integrin molecule adopts a bent conformation, and the density is sufficiently detailed to enable the modelling of the ectodomains of both the\u0026nbsp;⍺\u0026nbsp;and β chain (\u003cstrong\u003eFig. 2B-D\u003c/strong\u003e). The integrin binds slightly off-centre from the virus 5-fold axis, with the β-propeller domain of the α2 chain situated directly above the 5-fold and the β1 chain offset to the side. The protein-protein interactions between the integrin and ERAV are limited.\u0026nbsp;Furthermore, the maps reveal two separate strands of glycan density, one extending ~35 Å from α2 N112 and the other extending ~20 Å from β1 N269 of the integrin, both reaching down in the manner of guy ropes to contact VP1 (\u003cstrong\u003eFig. 2D\u003c/strong\u003e). Glycoproteomic analysis shows that α2 N112 predominantly carries high-mannose glycans with 6 - 9 mannose units (\u003cstrong\u003eFig. 2E\u003c/strong\u003e). In contrast, β1 N269 bears a diantennary glycan whose antennae terminate in galactose with partial capping by sialic acids (\u003cstrong\u003eFig. 2F\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eERAV binds to the integrin in the closed conformation with minor conformational changes\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate if binding to ERAV had induced conformational changes to the integrin, we determined the structure of apo integrin ⍺2β1 by cryo-EM (Table 1). Both the ERAV-bound (\u003cstrong\u003eFig. 3A,D\u003c/strong\u003e) and apo-integrin ⍺2β1 (\u003cstrong\u003eFig 3B,E\u003c/strong\u003e), are in the closed form, as defined by analogy with the closed ⍺-I containing integrin, ⍺Eβ7 (PDB: 9P97), in which a series of domain and secondary structure arrangements in both the ⍺ and the β chains distinguish the closed and open forms (\u003cstrong\u003eFig. 3F,G\u003c/strong\u003e)\u003csup\u003e43\u003c/sup\u003e. Comparing the overall structure of the bound and unbound integrin, there are modest rearrangements of the domains corresponding to minor movements of just a few Angstroms. For both apo- and bound forms, the α chain I domain is angled somewhat towards the β-I domain \u003cstrong\u003e(Fig. 3A-E).\u003c/strong\u003e Upon binding, the thigh domain is slightly displaced from the main axis of the integrin where binding pulls the β chain hybrid domain slightly towards the virus-facing side of the integrin (\u003cstrong\u003eFig. 3C\u003c/strong\u003e), perhaps making room, so that the ⍺2 high mannose structure, which lies in a depression between the ⍺ and β chains, can rearrange and bind ERAV. The most striking change on binding is that the glycans that bind ERAV become much better ordered (\u003cstrong\u003eFig. 3A,B\u003c/strong\u003e), reflecting the tensioning role of the glycans noted above. For the ⍺2 N112 high-mannose glycan, the 9-mannose core is selectively bound by the virus, and the tension is sufficient that all mannoses are well-resolved, allowing reliable building of a full atomic model. Similarly, for the β1 N269 diantennary glycan, the complete antennae that terminate with the ERAV-binding sialic acid residue are well defined (\u003cstrong\u003eFig. 3A\u003c/strong\u003e). In contrast, both the ⍺2 N112 and β1 N269 glycans in the apo integrin are poorly ordered, with only the first N-acetylglucosamine subunit being resolved (\u003cstrong\u003eFig. 3B\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein-protein interactions between ERAV and the integrin\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e⍺\u003c/strong\u003e\u003cstrong\u003e2 β-propeller\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe integrin makes protein-protein and glycan-protein contacts with four of the five VP1 subunits surrounding the virus 5-fold axis (\u003cstrong\u003eFig. 4A\u003c/strong\u003e). The rather sparse protein-protein interactions, which include in total seven hydrogen bonds, occur between the α2 β-propeller domain and the DE and HI loops of one VP1 protomer and the DE loop of an adjacent VP1 protomer (\u003cstrong\u003eFig. 4B-C\u003c/strong\u003e). The total interface excluded area for the integrin-capsid interaction is 1630 Å\u003csup\u003e2\u003c/sup\u003e, with the protein-protein component (730 Å\u003csup\u003e2\u003c/sup\u003e) making up less than one-half of this and less than a typical antibody footprint, suggesting that the glycan interactions detailed below are key to robust and specific receptor recognition\u003csup\u003e46\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eERAV interacts with a high-mannose glycan on the integrin\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e⍺\u003c/strong\u003e\u003cstrong\u003e2\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eβ-propeller\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe glycan of\u0026nbsp;⍺2\u0026nbsp;N112 lies on the virus-facing side of the integrin\u0026nbsp;⍺2 β-propeller and extends to a distal VP1 subunit by passing underneath the βA domain of the integrin β1 chain (\u003cstrong\u003eFig. 2D\u003c/strong\u003e), binding close to the 5-fold axis of symmetry at the interface between adjacent VP1 subunits \u003cstrong\u003e(Fig 4A)\u003c/strong\u003e, with an interface of ~540 Å\u003csup\u003e2\u003c/sup\u003e. There is compelling density for 9 mannose units, with one trisaccharide branch and two disaccharide branches, allowing an atomic model to be built (\u003cstrong\u003eFigs. 2D, 3A, 4D\u003c/strong\u003e). The density levels and occupancy analysis\u003csup\u003e44\u003c/sup\u003e indicate that the 9-mannose glycan is preferentially bound by the virus through an interaction with the terminal mannose residues of the two branches. These terminal mannose residues hydrogen bond with amino acid residues on VP1 loops, one binding G98, T92, and F90 from the DE loop and the other (probably weaker interaction) binding N126 from the EF loop (\u003cstrong\u003eFig. 4D\u003c/strong\u003e). The predilection of this depression on the virus surface for saccharide units is demonstrated by the presence of additional density, consistent with mannose, in all 4 of the VP1 DE binding sites not occupied by mannose from the β1 integrin around each 5-fold axis (\u003cstrong\u003eFig. S4\u003c/strong\u003e). This density was observed only in the integrin complexes and not in the unbound virus, suggesting that the density is due to a soluble contaminant of the commercially obtained integrin.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDepressions on the ERAV surface bind integrin β1 through a 2-3 sialic acid\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn contrast to the mannose-specificity of the integrin\u0026nbsp;⍺2 N112 glycan, the β1 N269 glycan attaches to ERAV via a terminal sialic acid residue of the complex biantennary N-glycan. N269 extends from the β-I domain downwards and across the surface of one VP1 subunit to bind this sialic acid residue in a depression between strand B and the DE loop of one subunit and the EF loop β-hairpin of the clockwise related VP1 molecule \u003cstrong\u003e(Figs. 2D, 3A, 4A, 4E\u003c/strong\u003e). Fry et al (2010)\u003csup\u003e26\u003c/sup\u003e previously reported a crystal structure of 2-3Sia bound to ERAV, and the sialic acid binding we observe is essentially identical (\u003cstrong\u003eFig. 4F\u003c/strong\u003e). Although the electron potential density of the sialic acid is insufficiently resolved to unambiguously assign the sialic acid linkage, a modelled N-glycan with\u0026nbsp;a 2-3Sia fits the density well. By far the strongest interactions are made with the EF loop, with the terminal sialic acid residue interacting with A118, R129, and Q120 through the N-acetyl group nitrogen, the C1 oxygen, and the C8 and C9 oxygens, respectively (\u003cstrong\u003eFig.\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;4E\u003c/strong\u003e). The overall footprint is ~320 Å\u003csup\u003e2\u003c/sup\u003e (\u003cstrong\u003eFig. 4F\u003c/strong\u003e). The observation that the EF loop plays a central role in integrin binding implies that antibodies binding here would block both the protein-protein and glycan-protein interactions necessary for attachment. Indeed, this binding site explains previous observations that ERAV VP1 harbours key neutralisation sites\u003csup\u003e45–49\u003c/sup\u003e, sera raised against the VP1 EF loop can neutralise\u003csup\u003e49\u003c/sup\u003e, and the K114R mutation on the EF loop can escape neutralisation\u003csup\u003e45\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe glycans on integrin ⍺2 N112 and integrin\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eβ\u003c/strong\u003e\u003cstrong\u003e1 N269 are essential for ERAV entry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur cryoEM results indicate that in addition to protein-protein interactions between ERAV and integrin, a sialylated diantennary N-glycan and a high-mannose glycan also contribute to the formation of the virus-receptor complex. To investigate the involvement of different glycans, we made use of a recently developed set of isogenic HEK293 cells that are genetically engineered to selectively display individual types of glycoconjugates with elaborated glycans e.g. capped by \u0026nbsp;2-3Sia or 2-6Sia on Galβ-4GlcNAc units (HEK-N, only elaborate N-glycans; HEK-O, only elaborate O-glycans; HEK-GSL, only elaborate glycosphingolipids)\u003csup\u003e50\u003c/sup\u003e. Upon ERAV infection of HEK293 expressing elaborated glycans only on specific sialoglycoconjugate classes (i.e. HEK\u003csup\u003eN\u003c/sup\u003e, HEK\u003csup\u003eO\u003c/sup\u003e, HEK\u003csup\u003eGSL\u003c/sup\u003e), we observed efficient infection only in cells expressing N-glycans (\u003cstrong\u003eFig. 5A\u003c/strong\u003e). To investigate the involvement of sialic acids, we first demonstrated that HEK\u003csup\u003eΔSia\u003c/sup\u003e cells without any\u0026nbsp;a2-3 and\u0026nbsp;a2-6 sialylation capacities did not support virus replication (\u003cstrong\u003eFig. 5B\u003c/strong\u003e). Subsequently, we identified the specific sialyltransferases (STs) required for ERAV infection by knocking in single STs, including ST3Gal1-6 and ST6Gal1, in HEK\u003csup\u003eΔSia\u003c/sup\u003e cells. Our data confirmed that 2-3Sia is absolutely required; we observed infection of cells expressing ST3Gal4 and ST3Gal6, both of which install 2-3Sia on N-glycans, and cells expressing select types of O-glycans and GSLs (\u003cstrong\u003eFig. 5B\u003c/strong\u003e). ST3Gal3, which displays largely the same substrate specificity as ST3Gal4 and ST3Gal6, less efficiently supported infection. A low level of infection was observed upon reintroduction of ST3Gal1 which, besides using O-glycans as its major substrate, has been reported to also sialylate \u003cem\u003eN\u003c/em\u003e-glycans at low levels\u003csup\u003e51\u003c/sup\u003e. CVB3, which was included as a control, showed efficient replication on all cell lines tested (\u003cstrong\u003eFig. S5A,B\u003c/strong\u003e). Together, these data demonstrate that ERAV strongly relies on 2-3Sia acid displayed on N-linked glycans. Consistently, virus replication curves showed that ERAV infection was abrogated in HEK\u003csup\u003eΔSia\u003c/sup\u003e cells, which lack sialic acid at N-glycans, O-glycans and specific GSLs, as well as in HEK cells lacking elaborated complex N-glycans due to the knockout of \u003cem\u003eMGAT1\u003c/em\u003e , the enzyme that is essential for the conversion of high-mannose into hybrid and complex types of N-glycans (\u003cstrong\u003eFig. 5C\u003c/strong\u003e). In cells lacking \u003cem\u003eMGAT1\u003c/em\u003e, N-glycans still contain high-mannose but lack sialic acid, but other types of glycoconjugates (O-glycans and GSLs) are elaborated and contain sialic acids in contrast to HEK\u003csup\u003eN\u003c/sup\u003e cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNext, we set out to dissect the role of the integrin-⍺2β1 complex in ERAV attachment and subsequent internalization. For this, we determined binding of ERAV on cells at 4°C or we proceeded with an incubation step for 1 h at 37°C to allow virus internalization. Bound and internalized virus levels were measured by RT-qPCR. In the \u003cem\u003eMGAT1\u003c/em\u003e KO cells, efficient virus binding, but a strong defect in internalization, was observed (\u003cstrong\u003eFig. 5C\u003c/strong\u003e). In the HEK\u003csup\u003eΔSia\u003c/sup\u003e cells, a relatively minor reduction in virus binding (about 30%) but a strong defect in virus internalization was observed (\u003cstrong\u003eFig. 5C\u003c/strong\u003e). Similar results were obtained with double KO cells lacking both sialic acid and \u003cem\u003eMGAT1\u003c/em\u003e. Together, these data suggest that the sialic acid on N-glycans is essential for ERAV internalization.\u003c/p\u003e\n\u003cp\u003eTo validate the importance of the glycan on integrins shown in the cryo-EM data, we mutated N112 on the α2 chain and N269 on the β1 chain to alanine and expressed the plasmids in \u003cem\u003eITGA2\u003c/em\u003e or \u003cem\u003eITGB1\u003c/em\u003e KD cells, respectively, to\u0026nbsp;specifically prevent introduction of N-glycans at these sites. The knock-ins were validated by FACS staining, although reconstitution with integrin β1 was only partial\u0026nbsp;(\u003cstrong\u003eFig. S5C, S5D\u003c/strong\u003e). \u0026nbsp;Reconstitution of the \u003cem\u003eITGB1\u003c/em\u003e KD cells with integrin β1-N269A failed to rescue ERAV replication, while reconstitution with wt integrin\u0026nbsp;β1 did (\u003cstrong\u003eFig. 5E\u003c/strong\u003e). In the \u003cem\u003eITGB1\u0026nbsp;\u003c/em\u003eKD cells, binding of ERAV was strongly reduced.\u0026nbsp;Reconstitution of these cells with integrin\u0026nbsp;β1 restored virus binding and internalization. Upon reconstitution with integrin\u0026nbsp;β1-N269A, partial restoration of virus binding was observed (to ~50% compared to wt integrin\u0026nbsp;β1), but this mutant integrin failed to restore internalization (\u003cstrong\u003eFig. 5F\u003c/strong\u003e). These data are in line with the data shown above (\u003cstrong\u003eFig. 5A-D\u003c/strong\u003e) and emphasize the importance of the sialic acid on the N269 glycan on the β1 chain for efficient infection. Similarly, we tested the role of the glycan on integrin\u0026nbsp;α2 by evaluating the consequences of mutation N112A. Reconstitution of the \u003cem\u003eITGA2\u0026nbsp;\u003c/em\u003eKD cells with mutant integrin\u0026nbsp;α2-N112A failed to rescue virus replication (\u003cstrong\u003eFig. 5G\u003c/strong\u003e). As for the \u003cem\u003eITGB1\u0026nbsp;\u003c/em\u003eKD cells, binding of ERAV was strongly reduced in the \u003cem\u003eITGA2\u0026nbsp;\u003c/em\u003eKD cells. Reconstitution\u0026nbsp;of these cells with mutant integrin\u0026nbsp;α2-N112A partially restored virus binding (to ~50%) but failed to restore internalization (\u003cstrong\u003eFig. 5H\u003c/strong\u003e). In contrast, integrin α2-N96A, a control in which an Asn not implicated in the interaction with ERAV is mutated, efficiently restored virus replication, virus binding and internalisation. Taken together, these data show that the sialylated glycan on integrin β1 N269 as well as the high-mannose glycan on integrin ⍺2 N112 not only contribute to receptor binding but are also critical for virus internalization.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eHere, using a CRISPRi screen, we identified in\u003cstrong\u003etegrin\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ea\u003c/strong\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e \u003cstrong\u003eas a receptor for ERAV\u003c/strong\u003e and\u003cstrong\u003e\u0026nbsp;confirmed that this molecule serves as a receptor in both human and equine cell lines. Through an integrative structural biology approach, involving\u0026nbsp;\u003c/strong\u003ecryo-EM and glyoproteomics, we showed that a single integrin\u0026nbsp;\u003cstrong\u003ea\u003c/strong\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e attaches to ERAV at the 5-fold apices, straddling four of the five VP1 molecules assembled at the 5-fold. Strikingly, the structure of the virus-receptor complex revealed that major parts of the virus-receptor interface (\u003cstrong\u003eFig 2D, 4D,E\u003c/strong\u003e) are formed by two distinct N-glycans positioned on the integrin\u0026nbsp;a2 chain (N112) and\u0026nbsp;b1 chain (N269) with high-mannose and sialyl-\u003cstrong\u003ed\u003c/strong\u003eiantennary structures, respectively (\u003cstrong\u003eFig 2E,F\u003c/strong\u003e). Remarkably, the interactions with terminal mannose and sialic acid residues on these two N-glycans contribute more than half of the total interface surface area between ERAV and integrin\u0026nbsp;\u003cstrong\u003ea\u003c/strong\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e with the rest provided by protein-protein interactions with the integrin\u0026nbsp;⍺2\u0026nbsp;β-propeller.\u0026nbsp;Using isogenic\u0026nbsp;HEK293 cells that selectively display specific glycoconjugates or express individual 2-3/6 STs, and by\u0026nbsp;reconstituting integrin knockdown cells with\u0026nbsp;α2 N112A and\u0026nbsp;β1 N269A mutant integrins, we\u0026nbsp;demonstrated that both glycans contribute to receptor binding and that they\u0026nbsp;play a critical role in subsequent step(s) leading to cell entry and productive infection.\u003c/p\u003e\n\u003cp\u003eThe complex interaction of ERAV with integrin\u0026nbsp;\u003cstrong\u003ea\u003c/strong\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e is without precedence and points to the importance of studying microbial receptors in their full natural presentation on target cells. While sialic acid was previously found to be important for ERAV\u0026nbsp;entry\u003csup\u003e24–26\u003c/sup\u003e and the structural basis determined by crystallography\u003csup\u003e21\u003c/sup\u003e, our study clearly\u0026nbsp;demonstrates that sialic acid is only part of the ERAV receptor, which comprises further interactions with both another glycan and the\u0026nbsp;a2 protein surface. Direct binding studies with individual glycans or proteins using glycan and protein arrays are unlikely to uncover such complex interactions\u003csup\u003e52–54\u003c/sup\u003e, and only through genetic dissection in cell systems and follow-up structural studies, can the full nature be elucidated\u003csup\u003e55\u003c/sup\u003e. The protein specificity often observed in glycan interactions may reflect the presence of multiple glycans on a given protein that together constitute the functional epitope, a phenomenon referred to as “clustered saccharide patches”\u003csup\u003e56\u003c/sup\u003e. These have been proposed to be organized through specific spacing, arrangement, and interaction of multiple glycans on a protein or cell surface, creating unique, high-avidity binding sites for proteins, antibodies and pathogens. Examples of microbial proteins with selectivity for specific glycoproteins include the \u003cem\u003eP. falciparum\u003c/em\u003e protein EBA-175, which binds multiple sialic acids on the red cell glycoprotein Glycophorin A\u003csup\u003e57\u003c/sup\u003e, and the MARTX toxins produced by Gram-negative bacteria, which bind multiple biantennary N-glycans selectively on ICAM1\u003csup\u003e58\u003c/sup\u003e. However, structural insight into the organization of clustered saccharide patches has remained scarce. The first molecular structure of a higher-order glycan epitope was elucidated only recently, the mucin-binding X409 module of \u003cem\u003eVibrio cholerae\u003c/em\u003e biofilm matrix adhesion protein RbmC, which revealed recognition of monosaccharide moieties across four O-glycans and interactions with the backbone amino acids\u003csup\u003e59\u003c/sup\u003e. The ERAV-integrin complex reveals a distinctive mode of viral receptor engagement, integrating extensive protein-glycan interactions involving both sialylated and mannosylated glycans with direct protein-protein contacts. The use of two distinct glycans likely increases the specificity of the interaction, resulting in efficient and highly specific attachment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe involvement of a high-mannose glycan on the integrin α2 chain in the interaction of ERAV was surprising. Terminally located mannose residues of high-mannose N-glycans have been hardly, if at all, observed in virus-cell surface interactions. This may reflect the relatively low abundance of high-mannose N-glycans on the extracellular surface of mammalian cells compared with complex N-glycans. \u0026nbsp;Moreover, N-glycans that resist conversion into complex, sialylated antennary structures during ER–Golgi trafficking are typically buried within the folded protein, limiting their accessibility to α-mannosidases required for generating substrates for N-glycan branching\u003csup\u003e60,61\u003c/sup\u003e. Although not buried, the α2 high mannose sugar is located in a depression between the α and\u0026nbsp;b\u0026nbsp;chains and attachment of the sugar under tension prises open this interface a little, suggesting possible shielding of the sugar in the unbound closed form of the integrin.\u003c/p\u003e\n\u003cp\u003eAnother interesting feature is that ERAV binds at the β-propeller of the integrin\u0026nbsp;⍺2 chain rather than the\u0026nbsp;α-I domain that is involved in binding cellular ligands\u003csup\u003e62\u003c/sup\u003e. In the bent, closed form of the integrin, the\u0026nbsp;β-propeller points away from the membrane, well-positioned for viral attachment. Thus, by interacting with a non-ligand binding domain and with glycans, the virus bypasses the divalent cation dependency of binding.\u0026nbsp;Integrin\u0026nbsp;α2β1 also serves as a receptor for enteroviruses echovirus 1 (EV-1) and 8. These viruses also attach to the inactive closed conformation, but in this case via the ligand-binding\u0026nbsp;α-I domain\u003csup\u003e63\u003c/sup\u003e. The orientation and stoichiometry of integrin binding also vary markedly between ERAV and EV-1, the latter binding up to 60 integrins per particle compared to 12 for ERAV. The interaction of ERAV with the bent-closed, inactive conformation may reflect a preference for the specific positioning of glycans. Precedent for distinct N-glycan positioning in the bent-closed conformation of integrins was recently established for the α5β1 integrin, where the spatial arrangement of multiple N-glycans promoted oligomerisation of the glycan-binding protein galectin-3, thereby regulating integrin endocytosis and retrograde\u0026nbsp;trafficking\u003csup\u003e64\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLike ERAV, the closely related FMDV also uses an integrin as a receptor, but there are some notable differences in the mode of interaction.\u0026nbsp;\u003c/strong\u003eFMDV primarily binds integrin αvβ6 through an RGD motif on the extended disordered VP1 GH loop, resulting in a distribution of different binding poses\u003csup\u003e39\u003c/sup\u003e. In contrast to ERAV, there are 60 possible binding sites, the integrin is observed bound in the fully open conformation and the binding depends on cations, with the D of the RGD motif apparently coordinating the MIDAS Mg\u003csup\u003e2+\u003c/sup\u003e. In addition, an N-glycan of this integrin attaches to the virus, specifically at the region where upon cell culture adaptation a heparan sulfate binding site was formed\u003csup\u003e39\u003c/sup\u003e, although a functional role of this N-glycan for FMDV infection remains to be established. The VP1 GH loop is much shorter on ERAV, does not harbour an RGD and packs well-ordered against the virus surface (Fig. 4A). In contrast, the region around the 5-fold axes where ERAV attaches to integrin\u0026nbsp;\u003cstrong\u003ea\u003c/strong\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003cstrong\u003eb\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e is highly elaborated compared to FMDV (\u003cstrong\u003eFig. 4A\u003c/strong\u003e). Four loops (BC, HI, DE, FG) are found proximal to the 5-fold axis, and all are longer in ERAV. The most notable change is in the EF loop which is positioned at the end of the jelly roll distal from the 5-fold axis. In ERAV, it is greatly extended to include a\u0026nbsp;β-hairpin which folds back along the capsid surface towards the 5-fold axis creating a ‘blade’ against which the sialic acid nestles (\u003cstrong\u003eFig. 4F,G\u003c/strong\u003e). Thus, the surface architecture of each of these viruses is sculpted to allow very different modes of integrin recognition and glycans play a role in both interactions, although more dominantly in the case ERAV.\u003c/p\u003e\n\u003cp\u003eThe data presented here argue against the idea that there is a clear distinction between attachment and uncoating receptors. Instead, they suggest that\u0026nbsp;picornaviruses may interact with multiple host cell membrane moieties, being proteins and/or glycans, with overlapping functions in primary cell attachment, induction of endocytosis and/or triggering of uncoating. Picornaviruses employ diverse mechanisms to enter host cells. Enteroviruses undergo a well-characterised cascade of conformational changes following receptor binding, ultimately leading to uncoating. For EV-D68, sialic acid facilitates this process by triggering the release of the pocket factor\u003csup\u003e9\u003c/sup\u003e. In contrast, minor group rhinoviruses and aphthoviruses do not require receptor-induced conformational changes for\u0026nbsp;infection\u003csup\u003e65\u003c/sup\u003e, instead they rely on\u0026nbsp;low pH and possibly other factors for entry\u003csup\u003e15,66,67\u003c/sup\u003e. In line with this, we observed no conformational changes in ERAV upon binding\u0026nbsp;integrin\u0026nbsp;⍺2β1. Our data show that, in addition to supporting ERAV binding, the sialylated and high-mannose integrin glycans play a critical role in subsequent steps leading to internalisation and cell entry. The mechanism by which they do so remains to be determined. N-linked glycosylation of integrins can affect their function by regulating conformational equilibria and interactions between domain interfaces\u003csup\u003e68\u003c/sup\u003e. Sialic acids can promote or inhibit integrin clustering, depending on the specific context and type of interaction\u003csup\u003e69,70\u003c/sup\u003e. Hence, it is conceivable that ERAV binding to sialylated and/or high-mannose glycans may promote receptor clustering on the cell surface, thereby stimulating endocytosis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn conclusion, our results reveal a previously unrecognised combination of protein-protein and protein-glycan interactions between a picornavirus and its receptor, supporting the concept that these viruses can engage multiple host cell surface moieties to promote attachment and trigger endocytosis, thereby establishing productive infection.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eCell culture and viruses. HEK293T (ATCC CRL-3216), HeLa-R19 (gift from G. Belov, University of Maryland and Virginia-Maryland Regional College of Veterinary Medicine), HeLa-Ohio (ECACC 84121901), equine lung fibroblasts (ELF cells, gift from M. Kikkert, Leiden University Medical Center, and Erwin van den Born, MSD Animal Health), HEK\u003csup\u003eΔSia\u003c/sup\u003e (with Siaα2-3Gal and Siaα2-6Gal knock-ins)\u003csup\u003e50\u003c/sup\u003e, HEK\u003csup\u003eN\u003c/sup\u003e (ΔB4GALT5/6 and C1GALT1; expresses only N-linked glycans)\u003csup\u003e50\u003c/sup\u003e, HEK\u003csup\u003eO\u003c/sup\u003e (ΔB4GALT5/6 and MGAT1; express only O-linked glycans)\u003csup\u003e50\u003c/sup\u003e, \u0026nbsp;HEK\u003csup\u003eGSL\u003c/sup\u003e (ΔC1GALT1 and MGAT1)\u003csup\u003e50\u003c/sup\u003e, and HEK\u003csup\u003eΔMGAT1\u0026nbsp;\u003c/sup\u003e(ΔMGAT1)\u003csup\u003e50\u003c/sup\u003e were cultured in\u0026nbsp;Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco) supplemented with 10% (vol/vol) fetal calf serum (FCS; Gibco). All cells were tested for mycoplasma contamination. CVB3 (Nancy) was obtained by transfecting in vitro-transcribed RNA derived from full-length infectious clone p53CB3/T7 as previously described\u003csup\u003e71\u003c/sup\u003e. ERAV (NM11/67) was obtained from David Rowlands and Toby Tuthill (University of Leeds, Leeds, United Kingdom).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGeneration of a genome-wide CRISPRi library in HEK293T cells. HEK293T cells transduced with a lentiviral dCas9-HA-BFP-KRAB-NLS expression vector (Addgene plasmid #102244) were single cell sorted to select for a 293T cell clone with efficient dCas9-BFP-knockdown capacity. To test knockdown capacity, clones were transduced with lentiviral vectors encoding gRNAs targeting the cell surface receptors \u003cem\u003eCD55\u003c/em\u003e or \u003cem\u003eCD59\u003c/em\u003e. After 1 week on puromycin (2 µg/ml) selection, \u003cem\u003eCD55\u003c/em\u003e, \u003cem\u003eCD59\u003c/em\u003e and GFP expression were quantified using the BD FACS Canto flow cytometer. A clone that showed the highest reduction in both marker genes was selected for the screens. The selected 293T clone was expanded and transduced with the human genome-wide CRISPRi v2 library\u003csup\u003e72\u003c/sup\u003e. This library contains approximately 100,000 gRNAs targeting around 20,000 genes. Sufficient cells were transduced and propagated to maintain at least 5 x 10\u003csup\u003e7\u003c/sup\u003e transduced (BFP+) cells, representing 500x coverage of the gRNA library. The transduction efficiency was around 20% to minimize the chance of multiple lentiviral integrations per cell. Two days after transduction, cells were cultured in the presence of puromycin for two days and one additional day without puromycin. 5 x 10\u003csup\u003e7\u003c/sup\u003e cells were seeded to a density of 2.5 x 10\u003csup\u003e5\u003c/sup\u003e cells/ml in T225 flasks and the next day infected with ERAV at MOI of 1. After 80 % of the monolayer showed cytopathic effect (usually around day 3 post infection), surviving cells were harvested and counted. In addition, an uninfected control population of cells was harvested at the same time. Cells were washed in PBS, and cell pellets were stored at -80°C until further processing. All screens were done in duplicate.\u003c/p\u003e\n\u003cp\u003ePurification of DNA and next-generation sequencing. DNA was isolated from collected cells using NucleoSpin Blood XL (Macherey Nagel) according to manufacturer’s recommendations. PCR was used to amplify gRNA cassettes with Illumina sequencing adapters and indexes as described by Luteijn \u003cem\u003eet al\u003c/em\u003e\u003cem\u003e\u003csup\u003e72\u003c/sup\u003e\u003c/em\u003e\u003cem\u003e.\u0026nbsp;\u003c/em\u003eGenomic DNA samples were digested with \u003cem\u003eSbfI\u003c/em\u003e-HF (NEB) to liberate a ~500-bp fragment containing the gRNA cassette. The gRNA cassette was isolated by gel using NucleoSpin Gel and PCR Clean-up kits (Macherey-Nagel), and the eluted DNA was used for PCR using indexing primers. Indexed samples were pooled and sequenced on an Illumina Nextseq 500 using a 1:1 mix of two custom sequencing primers. Sequencing was performed at the Utrecht Sequencing Facility using an Illumina NextSeq 500 to generate 50bp single end sequencing reads. After demultiplexing, samples were analyzed using the MaGeCK pipeline using non-targeting control gRNAs for normalisation. MaGeCK generated p-values and false-discovery rates for each gene and a robust rank aggregation algorithm to identify positively or negatively selected genes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGeneration of knockdown cell lines using CRISPR-dcas9. For screen validation, two of the most enriched gRNAs per gene targeting ITGA2 (gRNA#1: GGGAGGGTGCTTAACAGACA and gRNA#2: GGGTTTGCAGAGGTTTGCAG), ITGB1 (gRNA#1: GAGAGGCCCAGCGGGAGTCG and gRNA#2: GGCCGCGCCCGACACCCGGG ), and PA2G4 (gRNA#1: GCTAGAGTCTGGCGGCCGAG and gRNA#2: GCAGGTCCCAGGCGCGACAC) were cloned into the same expression plasmid used for the gRNA library (pCRISPRia-v2, Addgene plasmid no. 84832). The lentiviral gRNA plasmid co-expressed a puromycin resistance gene and blue fluorescence protein (BFP) via a T2A ribosomal skipping sequence controlled by the human EF1A promoter. The CRISPRi gRNAs introduced into this vector by Gibson assembly were expressed from a mouse U6 promoter. \u0026nbsp;Third-generation lentiviruses were produced in HEK-293T cells in 24-well format using standard lentivirus production protocols. 293T cells were thereafter transduced using spin infection at 800 × \u003cem\u003eg\u003c/em\u003e for 90m at 33°C in the presence of 8 μg/ml Polybrene. After 3 days, transduced cells were selected using puromycin (2 μg/ml). Knockdown was validated at mRNA level by qRT PCR and/or FACS staining.\u003c/p\u003e\n\u003cp\u003eITGA2 and ITGB1 plasmid construction and stable expression in 293T cells. For rescue and overexpression, ITGA2 or ITGB1 gBLOCK DNA fragments (IDT DNA) were cloned into a dual promoter lentiviral vector co-expressing the blasticidin resistance gene and the fluorescent gene mAmetrine\u003csup\u003e73\u003c/sup\u003e using NEBuilder HiFi plasmid assembly. ITGA2 and ITGB1 mutants were generated by PCR amplification with primers carrying the desired mutations, and the resulting fragments were assembled into the lentiviral vector backbone using the NEBuilder HiFi DNA Assembly Master Mix. Sequences were confirmed by Sanger sequencing (Macrogen). The constructs were used to generate third generation lentiviruses and introduced into 293T cells via lentiviral transduction protocols as described above (see Generation of knockdown cell lines using CRISPR-dcas9).\u003c/p\u003e\n\u003cp\u003eGeneration of HeLa integrin a2 knockout cell lines using CRISPR-Cas9. Two 20-nt guide RNA sequences targeting ITGA2 (gRNA: CTGGCTGAGAGCTGAAAATC) were selected from GeCKO (v.2) library b and cloned into library pSicoR-CRISPR-PuroR followed by transformation in competent DH5α \u003cem\u003eE.coli\u0026nbsp;\u003c/em\u003ecells. The plasmid DNA was extracted and sequenced to confirm the presence of the gRNA and thereafter transfected into HeLa-R19 cells. Subsequently, the cells were selected for 2 days using puromycin at 2 μg/ml. Thereafter, clonal cell lines were generated by limited dilution. Knockout was validated through FACS staining of the ITGA2 as well as sequencing. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eVirus growth curves.\u0026nbsp;HEK-293T cells were infected with ERAV at MOI of 10 for 1 h, washed twice with PBS, supplemented with medium, and then further incubated for 0, 24, 48 or 72 h after which the plates were subjected to 3 cycles of freezing and thawing. The samples were titrated on 293T cells to determine virus titers.\u003c/p\u003e\n\u003cp\u003eCrystal violet staining.\u0026nbsp;This assay was performed as described earlier with some modifications to the protocol\u003csup\u003e74\u003c/sup\u003e. Cells were seeded in 24-well plates a day before infections. The following day, the cells were infected and incubated at 37°C. At 48 hpi, the cells were washed with PBS and fixed with 4% PFA in PBS. The cells were stained with crystal violet (0.5% crystal violet, 20% methanol in H\u003csub\u003e2\u003c/sub\u003eO).\u003c/p\u003e\n\u003cp\u003eFACS staining.\u0026nbsp;Adherent cells were washed once with PBS and then detached using 0.5% trypsin. The cells were resuspended in complete DMEM media and transferred to V-shaped bottom 96-well plate. The plate was centrifuged at 14,000 rpm for 4 min and the supernatant discarded, followed by washing of the cells with PBS once and centrifuged at 1400 rpm for 4 min. The supernatant was discarded, and the cells resuspend cells in 150 μL PBA (PBS supplemented with 0.5% BSA and 0.02% NaAzide, cold). Cells were centrifuged for 4 min at 1200 rpm and the supernatant was discarded. Cells were then fixed in 4% PFA for 10 min at room temperature, centrifuged at 1200 rpm for 4 min and washed with PBS. Cells were blocked and permeabilized with 100 μL FACS buffer (PBS supplemented with 0.5% saponin and 2% FCS) for 10 min at RT. After incubation, the cells were stained with mouse anti-dsRNA (1:1000; English \u0026amp; Scientific Consulting) and integrin ⍺2Β1 mouse monoclonal antibody (1:500, VLA2 clone AA10, a kind gift from Jeffrey M. Bergelson, University of Pennsylvania), ITGA2 P1E6 (1: 500, cat. no. sc53502) antibodies followed by secondary donkey anti-mouse Alexa 647 (1:1000, cat. no. A31571) antibodies. The fluorescence intensity was quantified by CytoFLEX LX flow cytometer (Beckman Coulter) and the data analyzed by FlowJo v10 software (BD Biosciences). Samples were gated for live single cell populations and then gated for either dsRNA positive or integrin\u0026nbsp;⍺2Β1 positive cells.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAntibody blocking and pretreatment of ERAV with recombinant integrin ⍺2Β1.\u0026nbsp;For the receptor blocking experiments, cells were pretreated with integrin ⍺2Β1 antibody or IgG2 control antibody for 2 h at 37°C and then infected with ERAV at an MOI of 10. After virus adsorption for 1 h, the inoculum was removed and the cells washed three times with DMEM. The cells were supplemented with DMEM and further incubated for 16 h. The plates were frozen and thawed three times and titrated to determine virus titers. To study the effect of recombinant receptor on virus infection, ERAV was pretreated with recombinant integrin α2β1 (catalog no. 5698-A2, R\u0026amp;D Systems) for 1 h at 37°C and thereafter used to infect HeLa cells. After virus adsorption, the inoculum was removed and cells washed three times with PBS and supplemented with complete DMEM media. At 16 hpi, the cells were harvested for FACS staining. CVB3 was included in these experiments as a control.\u003c/p\u003e\n\u003cp\u003eVirus binding and internalisation assays.\u0026nbsp;Virus binding and internalisation assays were performed as previously described with modification\u003csup\u003e8,74,75\u003c/sup\u003e. HeLa-ITGA2-KO, 293T-ITGA2 KD, and Sia-KO cells were seeded in 24-well plates overnight. After preincubation on ice for 10 min plates were incubated with ERAV/CVB3 virus for 1h on ice and washed five times with ice-cold PBS. Cells were lysed in RA1 buffer and RNA was isolated using the NucleoSpin RNA kit protocol (catalog no. 740955.250; Macherey-Nagel). For the internalisation assays, after five cycles of washing, the cells were incubated in medium supplemented with 2% FCS for 1 h at 37 °C. The cells were washed five times in ice-cold PBS\u0026nbsp;and lysed in RA1 buffer for RNA extraction according to the manufacturers protocol. TaqMan reverse transcription kit (catalog no. N8080234; Applied Biosystems) was used to generate cDNA. Quantitative PCR was conducted using Roche Lightcycler 480 SYBR green I master mix kit (catalog no. 04 887 352 001; Roche), using the following primers: beta-actin: Fwd: CCTTCCTGGGCATGGAGTCCTG and Rev: GGAGCAATGATCTTGATCTTC and ERAV Fwd: CCAGGTAACCGGACAGCG; ERAV Rev: GGCAGCGCTACCACAGG, CVB3 Fwd: CGTGGGGCTACAATCAAGTT and CVB3 Rev: TAACAGGAGCTTTGGGCATC.\u003c/p\u003e\n\u003cp\u003eCell culture for large scale virus propagation.\u0026nbsp;Low passage (\u0026lt;5) HeLa Ohio cells were cultured in T175 flasks at 37°C with 5% CO₂ to 80–90% confluency. The cells were maintained in DMEM supplemented with 10% FCS, 1% glutamine (Gibco) and 1% penicillin-streptomycin (Gibco). Once confluent, cells were transferred to expanded roller bottles (Corning) and incubated at 37°C in DMEM, 10% FCS, 1% glutamine and 1% penicillin-streptomycin supplemented with HEPES (Gibco) until confluence (~72-96h). Roller bottles were washed three times with PBS (Gibco), infected with ERAV and grown in 250 mL DMEM, 5% glutamine, 1% penicillin-streptomycin and HEPES. Infected roller bottles were incubated at 37°C, and cells were monitored for detachment (~48h).\u003c/p\u003e\n\u003cp\u003eVirus purification.\u0026nbsp;Supernatants were collected from infected HeLa Ohio cells and 0.5% w/v Nonidet P-40 substitute (Thermo) was added as a detergent. The samples then underwent three freeze-thaw cycles to ensure complete viral release from cells and lysates were centrifuged at 4000 x g for 30 min to remove cellular debris. Supernatants were then precipitated overnight at 4°C with 8% w/v PEG8000 (Sigma), centrifuged at 4000 x g for 1 h, and the resulting pellets solubilized in 10 mL PBS. Solubilized samples were stored at 4°C overnight and then centrifuged at 32,000 x g on a 30% sucrose cushion for 4 h at 4°C, using an SW32 Ti rotor. Following centrifugation, the supernatant was carefully removed, and excess liquid aspirated from the pellets. The pellets were resuspended in 0.5 mL PBS and stored at 4°C overnight. Solubilised pellets were clarified by centrifugation at 4,000 x g for 30mm, layered onto a 15–45% sucrose gradient and centrifuged at 32,000 x g for 4 h at 4°C using an SW32 Ti rotor. Following centrifugation, 1 mL fractions were collected, and OD\u003csub\u003e260\u003c/sub\u003e and OD\u003csub\u003e280\u003c/sub\u003e measurements taken to determine fractions containing intact ERAV, which were pooled and pelleted at 32,000 x g for 4 h at 4°C before resuspending in 10µL of PBS supplemented with 2mM of EDTA or MgCl\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\n\u003cp\u003eVirus-integrin incubation for cryo-electron microscopy analysis.\u0026nbsp;50 µg of recombinant human integrin α2β1 (Bio-Techne cat. no. 5698-A2) in powder form was resuspended in concentrated ERAV (0.5 mg/mL) to yield a 300-fold molar excess of integrin to virus particles, to saturate potential binding sites. The ERAV-integrin complex was incubated at 4°C overnight.\u003c/p\u003e\n\u003cp\u003eCryo-electron microscopy and data collection.\u0026nbsp;Quantifoil R2/1 2nm carbon-coated 200 mesh grids were glow discharged on high for 45s using a High Power Expanded Plasma Cleaner (Harrick, PDC-002-CE). 3.5 µL of the prepared ERAV-integrin sample was pipetted onto the grids and blotted with blotting paper (Agar Scientific, AG47000-100) using the Vitrobot Mark IV System (ThermoFisher) (blot force +6, blot time 6s) maintained at 4˚C and 100% humidity. Grids were plunge-frozen into liquid ethane and stored in liquid nitrogen. Microscopy and data collection parameters are shown in Table 1.\u003c/p\u003e\n\u003cp\u003eData processing.\u0026nbsp;Pre-processing, including patch-based motion correction and CTF estimation, was performed using the streaming functionality implemented in the live mode of cryoSPARC (v4.6.2) using default parameters\u003csup\u003e76\u003c/sup\u003e. Particles were then identified using the cryoSPARC blob picker on a subset of micrographs (n=1,000) which were extracted, downsampled and subjected to a round of 2D classification to generate a template for template picking. False positives were filtered by re-running 2D classification, cleaned particle stacks were re-extracted, and particle poses refined using homogeneous refinement with I2 symmetry. For the ERAV-integrin + MgCl\u003csub\u003e2\u003c/sub\u003e and ERAV-only datasets, homogeneous refinement yielded maps with 2.64 Å and 2.81 Å resolution, which were used as references for motion correction. For the apo integrin in MgCl\u003csub\u003e2\u003c/sub\u003e, pre-processing and refinement steps were processed similar as the ERAV-integrin dataset. This initially yield an anisotropic map which was rebalanced using the Rebalance Orientations function implemented in cryoSPARC. This map was used as a template for Topaz training and picking particles in denoised micrographs. Particles were extracted from the raw micrographs and particle stacks were cleaned by 2D classification and then running three rounds of Ab initio reconstruction with two classes until a 3.7 Å map was achieved by non-uniform refinement which was used as a reference for motion correction to ultimately achieve a 3.6 Å map. Reference-based motion correction of the ERAV-integrin + EDTA set-up did not yield any improvement in the 2.13 Å resolution map from homogeneous refinement, therefore downstream steps for this dataset used the maps generated from the uncorrected data. The motion-corrected icosahedral maps for the two complexes were then 60-fold symmetry expanded, and 3D classified without alignments into 6 classes using a tight mask on the 5-fold axis of symmetry to allow classification into 5 classes of redundant 72° rotations of integrin ⍺2Β1 and 1 empty class. Difference maps between the sub-particles of the MgCl\u003csub\u003e2\u003c/sub\u003e and EDTA setups were performed using the default settings of the Python package, Electron Microscopy Data Analysis\u003csup\u003e77\u003c/sup\u003eby filtering the maps to 5 Å.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eModel building and figure preparation.\u0026nbsp;ERAV protomer models were initially built into the highest resolution map (the 2.03 Å resolution icosahedrally symmetric map of the MgCl\u003csub\u003e2\u003c/sub\u003e dataset) through iterative model building (starting from a previously published ERAV structure, PDB: 2WFF\u003csup\u003e41\u003c/sup\u003e), using Coot (v0.9.8.95)\u003csup\u003e78\u003c/sup\u003e and refinement using Phenix (v.1.21.2)\u003csup\u003e79\u003c/sup\u003e. The integrin α2β1model was initially generated using AlphaFold3\u003csup\u003e42\u003c/sup\u003e with the default settings. The predicted integrin\u0026nbsp;α2β1 model was initially rigid body fitted using Coot into the symmetry expanded cryo-EM map. Due to the variable quality of the integrin\u0026nbsp;α2β1 density we used a hybrid strategy of refinement using Phenix, splitting the AlphaFold3-predicted model into blocks of domains for which the density was of similar quality. Regions of the integrin ⍺2Β1 for which the density was of high quality (α2: 31-168, 372-652;\u0026nbsp;β1: 141-175, 180-378; high-mannose glycan; sialylated glycan) were subjected to full-atom refinement. Glycans were built by importing the monomers from the REFMAC (v.5) library\u003csup\u003e80\u003c/sup\u003e implemented on Coot. The monomers for the model were determined based on the results of the glycoproteomics data supported by the map density. \u0026nbsp;Regions with poorly defined density (α2: 169-371, 653-1182;\u0026nbsp;β1: 21-140, 176-179, 379-765) were refined as rigid domains. A final round of model building and refinement was performed using the well-ordered portion of the integrin with the modeled glycans along with the portion of the virus capsid that interacts with the integrin using full atom refinement to optimise small conformational adjustments of the virus in contact regions. For the apo-integrin, the model was built using the headpiece from the ERAV-bound integrin\u0026nbsp;α2β1 and rigid body-fitted into the density. Refinement statistics for the ERAV protomer, integrin\u0026nbsp;α2β1-ERAV complex, and apo-integrin are shown in Table S1. Final sharpened maps from cryoSPARC and refined models were imported to ChimeraX v.1.7.1 and used for generating the figures. We used OccuPy\u003csup\u003e44\u003c/sup\u003e to aid in the interpretation of the glycans. Analysis of contact surface area and interacting residues was performed using PISA\u003csup\u003e81\u003c/sup\u003e. The PDBePISA Search function was also used to look for similar binding interfaces across the PDB. Schematic representation of protein-ligand and protein-protein interactions were performed using LigPlot (v.2.2)\u003csup\u003e82\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eGlycoproteomic MS.\u0026nbsp;5 µg of recombinant human integrin (Bio-Techne cat. no. 5698-A2) was mixed with 40 volumes of SDC-buffer (0.1 M Tris-HCl pH 8, 40 mM TCEP, 100 mM CAA, 1% SDC, \u003cem\u003ev/v\u003c/em\u003e) for denaturation, reduction and alkylation. To cover the N-glycosylation sites of interest, the digestion of the protein was divided into two batches. The first using Glu-C (enzyme-to-protein ratio 1:25) at 37 °C for 3 h followed by trypsin (enzyme-to-protein ratio 1:50) at 37 °C overnight, and the second using chymotrypsin (enzyme to protein ratio 1:25) at 37 °C for 3 h. The samples were quenched with 0.5% TFA. Then, samples were loaded onto Oasis PRiME HLB (10 mg) 96-wells plates (Waters), washed with 0.1% TFA, and peptides were eluted using 60% ACN/0.1% TFA. The samples were analyzed using an Orbitrap Exploris Mass Spectrometers (Thermo Fisher Scientific) operated in the data-dependent mode (DDA) coupled to an Ultimate3000 liquid chromatography system (Thermo Fisher Scientific) and separated on a 50 cm reversed phase column packed in-house (Poroshell EC-C18, 2.7 μm, 50 cm × 75 μm; Agilent Technologies). The samples were eluted over a linear gradient of a dual-buffer setup with buffer A (0.1% FA) and buffer B (80% ACN, 0.1% FA). The gradient used for separation was equilibration at 9% solvent B from 0 to 1 m, 9% to 13% sol B from 1 to 2 m, 13% to 44% sol B from 2 to 102 m, 44% to 99% sol B from 102 to 105 m, with a flow rate of 300 nl/min. MS scans were recorded at a resolution of 60,000, with an automatic gain control (AGC) target of 400,000, 50 ms maximum injection time (IT) and a scan range of \u003cem\u003em/z\u003c/em\u003e 350–2,000. Data-dependent MS2 scans were recorded at a resolution of 30,000, AGC target of 50,000, 50 ms maximum IT and a scan range of \u003cem\u003em/z\u003c/em\u003e 120–4,000. Dynamic exclusion was set to 30 s. Higher-energy collisional dissociation (HCD) at a normalized collision energy of 29 were applied. Database searching was performed using Byos 5.8.24. Glycan database containing 279 entries. Cleavage specificity was set to fully tryptic with 2 missed cleavages and precursor and fragment tolerance were set to 10 and 20 ppm. Cysteine carbamidomethylation was set as a fixed modification. Methionine and tryptophan oxidation, and N-terminal cyclisation of glutamine and glutamic acid to pyroglutamic acid were all included as rare variable modifications, whereas \u003cem\u003eN\u003c/em\u003e-glycosylation was searched as a common variable modification. The results were manually checked and were used for quantification performed in Skyline 24.1.0.414. For quality control, the threshold for Idotp value was set to 0.85 and that of the mass error to 5 ppm. Peak areas for the same glycopeptides but different isotopic peaks, charge states, and modifications were summed.\u003c/p\u003e\n\u003cp\u003eStatistical analysis.\u0026nbsp;Data were analysed with GraphPad Prism 10 (GraphPad Software, LLC, San Diego, CA, USA) and expressed as mean ± SD. Two groups were compared by Student's \u003cem\u003et\u003c/em\u003e test (two-tailed). Multiple groups were compared by one-way ANOVA followed with the Tukey post hoc test. Data from different groups were compared by two-way ANOVA together with Tukey test. \u0026nbsp;\u003cem\u003eP\u0026nbsp;\u003c/em\u003evalue\u003cem\u003e\u0026nbsp;\u0026lt;\u003c/em\u003e 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability.\u0026nbsp;\u003c/strong\u003eThe atomic coordinates and cryo-EM density maps for the apo-integrin alpha 2 beta 1 and ERAV-integrin complex have been submitted to the Protein Data Bank with the accession numbers PDB: 28TP (EMD: 56814) and 28LV (EMD: 56603), respectively. All other relevant data are available from the authors upon request.\u0026nbsp;\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are thankful to Jeffrey Bergelson for sharing VLA2 antibody used in this study, and Marjolein Kikkert and Erwin van den Born for providing ELF cells. The authors thank Sypke van Terwisga, Niels Beringen, and Stan Droogh for their help in performing FACS staining and general cell culture. C.O.O., R.D.L, M.Z. and F.J.M.v.K. were supported by funding from the EC (ERC Advanced Grant to F.J.M.v.K, virLUMINOus, Grant Nr. 101053576). G.K.Y.D. was supported by funding from the Biotechnology and Biological Sciences Research Council (UKRI-BBSRC) [grant number BB/T008784/1]. J.T.K. and T.J.T. were supported by the UKRI-MRC (MR/S023402/1) and UKRI-BBSRC (BBS/E/PI/230001C). The Pirbright Institute is supported by UKRI-BBSRC (BBS/E/PI/23NB0003). H.M.E.D. is supported by Wellcome (101122/Z/13/Z), D.I.S., E.E.F. and P.N.M.S. by the UKRI MRC (MR/N00065X/1).\u0026nbsp;C.P. is supported by a WHO/Bill and Melinda Gates Foundation award (R.G.IMCB.I8-TSA-083). D.I.S. is a Jenner Investigator. The Wellcome Centre for Human Genetics is supported by the Wellcome Trust (grant 090532/Z/09/Z). The computational aspects of this research were supported by the Wellcome Trust Core Award Grant Number 203141/Z/16/Z.\u0026nbsp;We acknowledge eBIC at Diamond Light Source for time on December 2024 under session no. BI34631-25.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors and affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThese authors contributed to the work equally: Collins Oduor Owino, Giann Kerwin Y. Dellosa and Rutger D. Luteijn.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCollins Oduor Owino\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e,\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cem\u003eRutger D. Luteijn, Marleen Zwaagstra, Jill E. Ver Eecke, Frank Buitenwerf, Wendy Meijer, Mengying Liu, Cornelis A.M. de Haan, Daniel L. Hurdiss, Erik de Vries, Frank J.M. van Kuppeveld\u003c/em\u003e\u003cstrong\u003e: Section of Virology, Division of Infectious Diseases and Immunology, Department of Biomolecular Health Sciences, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGiann Kerwin Y. Dellosa, Claudine Porta, Helen M.E. Duyvesteyn, Pranav N.M. Shah, Elizabeth E. Fry, David I. Stuart:\u0026nbsp;\u003c/em\u003eDivision of Structural Biology, Nuffield Department of Medicine, University of Oxford,\u0026nbsp;The Henry Welcome Building for Genomic Medicine, Oxford, UK\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGiann Kerwin Y. Dellosa, James T. Kelly, Tobias J. Tuthill:\u0026nbsp;\u003c/em\u003eThe Pirbright Institute, Ash Road, Woking, UK\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eXue Yu, Karli R. Reiding:\u0026nbsp;\u003c/em\u003eBiomolecular Mass Spectrometry and Proteomics, Bijvoet Center for Biomolecular Research and Utrecht Institute of Pharmaceutical Sciences, Utrecht University, Utrecht, The Netherlands\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eXue Yu:\u0026nbsp;\u003c/em\u003eNetherlands Proteomics Center, Utrecht, The Netherlands\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eYoshiki Narimatsu, Henrik Clausen:\u0026nbsp;\u003c/em\u003eCopenhagen Center for Glycomics, Department of Cellular and Molecular Medicine, Faculty of Health Sciences, University of Copenhagen, Blegdamsvej 3, Copenhagen, Denmark\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDavid I. Stuart:\u0026nbsp;\u003c/em\u003eThe CAMS Oxford Institute, The Henry Welcome Building for Genomic Medicine, Oxford, UK\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCOO, GKYD, RDL, DIS and FJMvK conceptualized the project; COO, RDL, ML, CAMdH, DLH, CP, HMEV, JTK, TJT, YN, HC, PNMS, EEF, KRR, EdV, DIS and FJMvK developed the methodology and provided reagents; COO, GKYD, RDL, MZ, XY, JEV, FB and WM performed the experiments; COO, GKYD, RDL, XY conducted data analysis; COO, GKYD and RDL wrote the original draft, which was reviewed and edited by all authors; RDL, JTK, TJT, EEF, PNMS, KRR, EdV, DIS and FJMvK supervised the work; FJMvK, TJT, EEF and DIS \u0026nbsp;acquired funding.\u003c/p\u003e\n\u003cp\u003eCorresponding author\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDavid I Stuart ([email protected]) and Frank JM van Kuppeveld ([email protected])\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLead contact:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eFrank JM van Kuppeveld ([email protected])\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eRen, J. \u003cem\u003eet al.\u003c/em\u003e Picornavirus uncoating intermediate captured in atomic detail. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, (2013).\u003c/li\u003e\n\u003cli\u003eButan, C., Filman, D. J. \u0026amp; Hogle, J. M. Cryo-electron microscopy reconstruction shows poliovirus 135S particles poised for membrane interaction and RNA release. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e88\u003c/strong\u003e, 1758\u0026ndash;1770 (2014).\u003c/li\u003e\n\u003cli\u003eStrauss, M. \u003cem\u003eet al.\u003c/em\u003e Nectin-like interactions between poliovirus and its receptor trigger conformational changes associated with cell entry. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e89\u003c/strong\u003e, 4143\u0026ndash;4157 (2015).\u003c/li\u003e\n\u003cli\u003ePanjwani, A. \u003cem\u003eet al.\u003c/em\u003e Capsid protein VP4 of human rhinovirus induces membrane permeability by the formation of a size-selective multimeric pore. \u003cem\u003ePLoS Pathog.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, (2014).\u003c/li\u003e\n\u003cli\u003eStrauss, M., Levy, H. C., Bostina, M., Filman, D. J. \u0026amp; Hogle, J. M. RNA transfer from poliovirus 135S particles across membranes is mediated by long umbilical connectors. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e87\u003c/strong\u003e, 3903\u0026ndash;3914 (2013).\u003c/li\u003e\n\u003cli\u003eBaggen, J., Thibaut, H. J., Strating, J. R. P. M. \u0026amp; Van Kuppeveld, F. J. M. The life cycle of non-polio enteroviruses and how to target it. \u003cem\u003eNat. Rev. Microbiol.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 368\u0026ndash;381 (2018).\u003c/li\u003e\n\u003cli\u003eRamos-Mart\u0026iacute;nez, I. E. \u003cem\u003eet al.\u003c/em\u003e Heparan Sulfate and Sialic Acid in Viral Attachment: Two Sides of the Same Coin? \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, (2022).\u003c/li\u003e\n\u003cli\u003eVaranese, L. \u003cem\u003eet al.\u003c/em\u003e MFSD6 is an entry receptor for enterovirus D68. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e641\u003c/strong\u003e, 1268\u0026ndash;1275 (2025).\u003c/li\u003e\n\u003cli\u003eLiu, Y. \u003cem\u003eet al.\u003c/em\u003e Sialic acid-dependent cell entry of human enterovirus D68. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 8865 (2015).\u003c/li\u003e\n\u003cli\u003eStasiak, K., Dunowska, M. \u0026amp; Rola, J. Prevalence and Sequence Analysis of Equine Rhinitis Viruses among Horses in Poland. \u003cem\u003eViruses\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, (2024).\u003c/li\u003e\n\u003cli\u003eDITCHFIELD, J. \u0026amp; MACPHERSON, L. W. Upper Respiratory Disease in Thoroughbred Horses: studies of its viral etiology in the Toronto area, 1960 to 1963. \u003cem\u003eCan. J. Comp. Med. Vet. Sci.\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 18 (1965).\u003c/li\u003e\n\u003cli\u003eHorsington, J., Lynch, S. E., Gilkerson, J. R., Studdert, M. J. \u0026amp; Hartley, C. A. Equine picornaviruses: Well known but poorly understood. \u003cem\u003eVet. Microbiol.\u003c/em\u003e \u003cstrong\u003e167\u003c/strong\u003e, 78\u0026ndash;85 (2013).\u003c/li\u003e\n\u003cli\u003eLi, F., Browning, G. F., Studdert, M. J. \u0026amp; Crabb, B. S. Equine rhinovirus 1 is more closely related to foot-and-mouth disease virus than to other picornaviruses. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e93\u003c/strong\u003e, 990\u0026ndash;995 (1996).\u003c/li\u003e\n\u003cli\u003eJackson, T. \u003cem\u003eet al.\u003c/em\u003e Integrin alphavbeta8 functions as a receptor for foot-and-mouth disease virus: role of the beta-chain cytodomain in integrin-mediated infection. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e78\u003c/strong\u003e, 4533\u0026ndash;4540 (2004).\u003c/li\u003e\n\u003cli\u003eBerryman, S., Clark, S., Monaghan, P. \u0026amp; Jackson, T. Early Events in Integrin \u0026alpha;v\u0026beta;6-Mediated Cell Entry of Foot-and-Mouth Disease Virus. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e79\u003c/strong\u003e, 8519\u0026ndash;8534 (2005).\u003c/li\u003e\n\u003cli\u003eJackson, T., Mould, A. P., Sheppard, D. \u0026amp; King, A. M. Q. Integrin \u0026alpha;v\u0026beta;1 Is a Receptor for Foot-and-Mouth Disease Virus. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e76\u003c/strong\u003e, 935 (2002).\u003c/li\u003e\n\u003cli\u003eJackson, T. \u003cem\u003eet al.\u003c/em\u003e Foot-and-mouth disease virus is a ligand for the high-affinity binding conformation of integrin \u0026alpha;5\u0026beta;1: Influence of the leucine residue within the RGDL motif on selectivity of integrin binding. \u003cem\u003eJournal of General Virology\u003c/em\u003e \u003cstrong\u003e81\u003c/strong\u003e, 1383\u0026ndash;1391 (2000).\u003c/li\u003e\n\u003cli\u003eNeff, S., Mason, P. W. \u0026amp; Baxt, B. High-Efficiency Utilization of the Bovine Integrin \u0026alpha;v\u0026beta;3 as a Receptor for Foot-and-Mouth Disease Virus Is Dependent on the Bovine \u0026beta;3 Subunit. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e, 7298 (2000).\u003c/li\u003e\n\u003cli\u003eBaxt, B. \u0026amp; Bachrach, H. L. Early interactions of foot-and-mouth disease virus with cultured cells. \u003cem\u003eVirology\u003c/em\u003e \u003cstrong\u003e104\u003c/strong\u003e, 42\u0026ndash;55 (1980).\u003c/li\u003e\n\u003cli\u003eBaranowski, E. \u003cem\u003eet al.\u003c/em\u003e Cell recognition by foot-and-mouth disease virus that lacks the RGD integrin-binding motif: flexibility in aphthovirus receptor usage. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e, 1641\u0026ndash;1647 (2000).\u003c/li\u003e\n\u003cli\u003eJackson, T. \u003cem\u003eet al.\u003c/em\u003e Efficient infection of cells in culture by type O foot-and-mouth disease virus requires binding to cell surface heparan sulfate. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e70\u003c/strong\u003e, 5282\u0026ndash;5287 (1996).\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez, M. A., Verdaguer, N., Mateu, M. G. \u0026amp; Domingo, E. Evolution subverting essentiality: Dispensability of the cell attachment Arg-Gly-Asp motif in multiply passaged foot-and-mouth disease virus. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e \u003cstrong\u003e94\u003c/strong\u003e, 6798\u0026ndash;6802 (1997).\u003c/li\u003e\n\u003cli\u003eBaranowski, E. \u003cem\u003eet al.\u003c/em\u003e Multiple virulence determinants of foot-and-mouth disease virus in cell culture. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e72\u003c/strong\u003e, 6362\u0026ndash;6372 (1998).\u003c/li\u003e\n\u003cli\u003eStevenson, R. A., Huang, J. A., Studdert, M. J. \u0026amp; Hartley, C. A. Sialic acid acts as a receptor for equine rhinitis A virus binding and infection. \u003cem\u003eJournal of General Virology\u003c/em\u003e \u003cstrong\u003e85\u003c/strong\u003e, 2535\u0026ndash;2543 (2004).\u003c/li\u003e\n\u003cli\u003eLonberg-Holm, K. \u0026amp; Philipson, L. Early interaction between animal viruses and cells. https://www.cabidigitallibrary.org/doi/full/10.5555/19762268769 (1974).\u003c/li\u003e\n\u003cli\u003eFry, E. E. \u003cem\u003eet al.\u003c/em\u003e Crystal structure of equine rhinitis A virus in complex with its sialic acid receptor. \u003cem\u003eJournal of General Virology\u003c/em\u003e \u003cstrong\u003e91\u003c/strong\u003e, 1971\u0026ndash;1977 (2010).\u003c/li\u003e\n\u003cli\u003eArnaout, M. A. The Integrin Receptors: From Discovery to Structure to Medicines. \u003cem\u003eImmunol. Rev.\u003c/em\u003e \u003cstrong\u003e329\u003c/strong\u003e, (2025).\u003c/li\u003e\n\u003cli\u003eArnaout, M. A., Mahalingam, B. \u0026amp; Xiong, J. P. Integrin structure, allostery, and bidirectional signaling. \u003cem\u003eAnnu. Rev. Cell Dev. Biol.\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 381\u0026ndash;410 (2005).\u003c/li\u003e\n\u003cli\u003eStricker, T. P. \u003cem\u003eet al.\u003c/em\u003e Structural analysis of the alpha(2) integrin I domain/procollagenase-1 (matrix metalloproteinase-1) interaction. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e276\u003c/strong\u003e, 29375\u0026ndash;29381 (2001).\u003c/li\u003e\n\u003cli\u003eJavid, H. \u003cem\u003eet al.\u003c/em\u003e RGD peptide in cancer targeting: Benefits, challenges, solutions, and possible integrin-RGD interactions. \u003cem\u003eCancer Med.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, (2024).\u003c/li\u003e\n\u003cli\u003eHughes, A. L. Evolution of the integrin alpha and beta protein families. \u003cem\u003eJ. Mol. Evol.\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 63\u0026ndash;72 (2001).\u003c/li\u003e\n\u003cli\u003eStaatz, W. D., Rajpara, S. M., Wayner, E. A., Carter, W. G. \u0026amp; Santoro, S. A. The membrane glycoprotein Ia-IIa (VLA-2) complex mediates the Mg++-dependent adhesion of platelets to collagen. \u003cem\u003eJ. Cell Biol.\u003c/em\u003e \u003cstrong\u003e108\u003c/strong\u003e, 1917\u0026ndash;1924 (1989).\u003c/li\u003e\n\u003cli\u003eZhang, K. \u0026amp; Chen, J. F. The regulation of integrin function by divalent cations. \u003cem\u003eCell Adh. Migr.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 20 (2012).\u003c/li\u003e\n\u003cli\u003eLee, J. O., Bankston, L. A. \u0026amp; Robert C Liddington, M. A. A. and. Two conformations of the integrin A-domain (I-domain): a pathway for activation? \u003cem\u003eStructure\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 1333\u0026ndash;1340 (1995).\u003c/li\u003e\n\u003cli\u003eTsukamoto, Y. \u0026amp; Okajima, T. O-GlcNAc glycans in the mammalian extracellular environment. \u003cem\u003eCarbohydr. Res.\u003c/em\u003e \u003cstrong\u003e549\u003c/strong\u003e, (2025).\u003c/li\u003e\n\u003cli\u003eKofsky, J. M., Babulic, J. L., Boddington, M. E., De Le\u0026oacute;n Gonz\u0026aacute;lez, F. V. \u0026amp; Capicciotti, C. J. Glycosyltransferases as versatile tools to study the biology of glycans. \u003cem\u003eGlycobiology\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 888\u0026ndash;910 (2023).\u003c/li\u003e\n\u003cli\u003eBellucci, M. A. \u003cem\u003eet al.\u003c/em\u003e ITAF45 is a pervasive trans-acting factor for picornavirus Type II IRES elements. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e122\u003c/strong\u003e, e2506281122 (2025).\u003c/li\u003e\n\u003cli\u003eBergelson, J. M., Shepley, M. P., Chan, B. M. C., Hemler, M. E. \u0026amp; Finberg, R. W. Identification of the Integrin VLA-2 as a Receptor for Echovirus 1. \u003cem\u003eScience (1979).\u003c/em\u003e \u003cstrong\u003e255\u003c/strong\u003e, 1718\u0026ndash;1720 (1992).\u003c/li\u003e\n\u003cli\u003eKotecha, A. \u003cem\u003eet al.\u003c/em\u003e Rules of engagement between \u0026alpha;v\u0026beta;6 integrin and foot-and-mouth disease virus. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, (2017).\u003c/li\u003e\n\u003cli\u003eZhang, P. \u003cem\u003eet al.\u003c/em\u003e Crystal structure of CD155 and electron microscopic studies of its complexes with polioviruses. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e105\u003c/strong\u003e, 18284\u0026ndash;18289 (2008).\u003c/li\u003e\n\u003cli\u003eTuthill, T. J. \u003cem\u003eet al.\u003c/em\u003e Equine Rhinitis A Virus and Its Low pH Empty Particle: Clues Towards an Aphthovirus Entry Mechanism? \u003cem\u003ePLoS Pathog.\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, e1000620 (2009).\u003c/li\u003e\n\u003cli\u003eJumper, J. \u003cem\u003eet al.\u003c/em\u003e Highly accurate protein structure prediction with AlphaFold. \u003cem\u003eNature 2021 596:7873\u003c/em\u003e \u003cstrong\u003e596\u003c/strong\u003e, 583\u0026ndash;589 (2021).\u003c/li\u003e\n\u003cli\u003eHollis, J. A., Chan, M. C., Malik, H. S. \u0026amp; Campbell, M. G. мolecular exaptation by the integrin \u0026alpha;I domain. \u003cem\u003eScience Advances \u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e, 9567 (2025).\u003c/li\u003e\n\u003cli\u003eForsberg, B. O., Shah, P. N. M. \u0026amp; Burt, A. A robust normalized local filter to estimate compositional heterogeneity directly from cryo-EM maps. \u003cem\u003eNature Communications 2023 14:1\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 1\u0026ndash;11 (2023).\u003c/li\u003e\n\u003cli\u003eKriegsh\u0026auml;user, G. \u003cem\u003eet al.\u003c/em\u003e Model of the equine rhinitis A virus capsid: identification of a major neutralizing immunogenic site. \u003cem\u003eJ. Gen. Virol.\u003c/em\u003e \u003cstrong\u003e84\u003c/strong\u003e, 2365\u0026ndash;2373 (2003).\u003c/li\u003e\n\u003cli\u003eWarner, S. \u003cem\u003eet al.\u003c/em\u003e Evidence that Equine Rhinitis A Virus VP1 Is a Target of Neutralizing Antibodies and Participates Directly in Receptor Binding. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e75\u003c/strong\u003e, 9274 (2001).\u003c/li\u003e\n\u003cli\u003eVarrasso, A. \u003cem\u003eet al.\u003c/em\u003e Sequence Conservation and Antigenic Variation of the Structural Proteins of Equine Rhinitis A Virus. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e75\u003c/strong\u003e, 10550 (2001).\u003c/li\u003e\n\u003cli\u003eHartley, C. A. \u003cem\u003eet al.\u003c/em\u003e Equine rhinitis A virus: structural proteins and immune response. \u003cem\u003eJ. Gen. Virol.\u003c/em\u003e \u003cstrong\u003e82\u003c/strong\u003e, 1725\u0026ndash;1728 (2001).\u003c/li\u003e\n\u003cli\u003eStevenson, R. A., Huang, J. A., Studdert, M. J. \u0026amp; Hartley, C. A. Identification of a neutralizing epitope in the betaE-betaF loop of VP1 of equine rhinitis A virus, defined by a neutralization-resistant variant. \u003cem\u003eJ. Gen. Virol.\u003c/em\u003e \u003cstrong\u003e85\u003c/strong\u003e, 2545\u0026ndash;2553 (2004).\u003c/li\u003e\n\u003cli\u003eNarimatsu, Y. \u003cem\u003eet al.\u003c/em\u003e An Atlas of Human Glycosylation Pathways Enables Display of the Human Glycome by Gene Engineered Cells. \u003cem\u003eMol. Cell\u003c/em\u003e \u003cstrong\u003e75\u003c/strong\u003e, 394-407.e5 (2019).\u003c/li\u003e\n\u003cli\u003eLiu, M. \u003cem\u003eet al.\u003c/em\u003e Cell-based sialoglycan arrays for directly comparing influenza A virus receptor requirements for binding and infection. \u003cem\u003eiScience\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 112549 (2025).\u003c/li\u003e\n\u003cli\u003eYu, X., Petritis, B., Duan, H., Xu, D. \u0026amp; LaBaer, J. Advances in cell-free protein array methods. \u003cem\u003eExpert Rev. Proteomics\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 1\u0026ndash;11 (2018).\u003c/li\u003e\n\u003cli\u003eHeimburg-Molinaro, J., Mehta, A. Y., Tilton, C. A. \u0026amp; Cummings, R. D. Insights Into Glycobiology and the Protein-Glycan Interactome Using Glycan Microarray Technologies. \u003cem\u003eMolecular and Cellular Proteomics\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, (2024).\u003c/li\u003e\n\u003cli\u003eRillahan, C. D. \u0026amp; Paulson, J. C. Glycan microarrays for decoding the glycome. \u003cem\u003eAnnu. Rev. Biochem.\u003c/em\u003e \u003cstrong\u003e80\u003c/strong\u003e, 797\u0026ndash;823 (2011).\u003c/li\u003e\n\u003cli\u003eNarimatsu, Y. \u003cem\u003eet al.\u003c/em\u003e Genetic glycoengineering in mammalian cells. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e296\u003c/strong\u003e, 100448 (2021).\u003c/li\u003e\n\u003cli\u003eCohen, M. \u0026amp; Varki, A. Modulation of glycan recognition by clustered saccharide patches. \u003cem\u003eInt. Rev. Cell Mol. Biol.\u003c/em\u003e \u003cstrong\u003e308\u003c/strong\u003e, 75\u0026ndash;125 (2014).\u003c/li\u003e\n\u003cli\u003eTolia, N. H., Enemark, E. J., Sim, B. K. L. \u0026amp; Joshua-Tor, L. Structural basis for the EBA-175 erythrocyte invasion pathway of the malaria parasite Plasmodium falciparum. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e122\u003c/strong\u003e, 183\u0026ndash;193 (2005).\u003c/li\u003e\n\u003cli\u003eChen, J. \u003cem\u003eet al.\u003c/em\u003e Vibrio MARTX toxin binding of biantennary N-glycans at host cell surfaces. \u003cem\u003eSci. Adv.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 63 (2025).\u003c/li\u003e\n\u003cli\u003eJaroentomeechai, T. \u003cem\u003eet al.\u003c/em\u003e Microbial binding module employs sophisticated clustered saccharide patches to selectively adhere to mucins. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, (2025).\u003c/li\u003e\n\u003cli\u003eMoremen, K. W., Tiemeyer, M. \u0026amp; Nairn, A. V. Vertebrate protein glycosylation: diversity, synthesis and function. \u003cem\u003eNat. Rev. Mol. Cell Biol.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 448\u0026ndash;462 (2012).\u003c/li\u003e\n\u003cli\u003eKornfeld, R. \u0026amp; Kornfeld, S. Assembly of asparagine-linked oligosaccharides. \u003cem\u003eAnnu. Rev. Biochem.\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e, 631\u0026ndash;664 (1985).\u003c/li\u003e\n\u003cli\u003eCormier, A. \u003cem\u003eet al.\u003c/em\u003e Cryo-EM structure of the \u0026alpha;v\u0026beta;8 integrin reveals a mechanism for stabilizing integrin extension. \u003cem\u003eNature Structural \u0026amp; Molecular Biology 2018 25:8\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 698\u0026ndash;704 (2018).\u003c/li\u003e\n\u003cli\u003eJokinen, J. \u003cem\u003eet al.\u003c/em\u003e Molecular mechanism of \u0026alpha;2\u0026beta;1 integrin interaction with human echovirus 1. \u003cem\u003eEMBO J.\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 196 (2009).\u003c/li\u003e\n\u003cli\u003eShafaq-Zadah, M. \u003cem\u003eet al.\u003c/em\u003e Spatial N-glycan rearrangement on \u0026alpha;5\u0026beta;1 integrin nucleates galectin-3 oligomers to determine endocytic fate. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, (2025).\u003c/li\u003e\n\u003cli\u003eBaxt, B., Virology, P. M.- \u0026amp; 1995, undefined. Foot-and-mouth disease virus undergoes restricted replication in macrophage cell cultures following Fc receptor-mediated adsorption. \u003cem\u003eElsevierB Baxt, PW MasonVirology, 1995\u0026bull;Elsevier\u003c/em\u003e https://www.sciencedirect.com/science/article/pii/S0042682285711105.\u003c/li\u003e\n\u003cli\u003eGroppelli, E., Tuthill, T. J. \u0026amp; Rowlands, D. J. Cell Entry of the Aphthovirus Equine Rhinitis A Virus Is Dependent on Endosome Acidification. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e84\u003c/strong\u003e, 6235 (2010).\u003c/li\u003e\n\u003cli\u003eO\u0026rsquo;Donnell, V., LaRocco, M., Duque, H. \u0026amp; Baxt, B. Analysis of Foot-and-Mouth Disease Virus Internalization Events in Cultured Cells. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e79\u003c/strong\u003e, 8506\u0026ndash;8518 (2005).\u003c/li\u003e\n\u003cli\u003eCai, X., Thinn, A. M. M., Wang, Z., Shan, H. \u0026amp; Zhu, J. The importance of N-glycosylation on \u0026beta;3 integrin ligand binding and conformational regulation. \u003cem\u003eScientific Reports 2017 7:1\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1\u0026ndash;14 (2017).\u003c/li\u003e\n\u003cli\u003eGu, J. \u0026amp; Taniguchi, N. Regulation of integrin functions by N-glycans. \u003cem\u003eGlycoconj. J.\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 9\u0026ndash;15 (2004).\u003c/li\u003e\n\u003cli\u003ePan, D. \u0026amp; Song, Y. Role of altered sialylation of the i-like domain of \u0026beta;1 integrin in the binding of fibronectin to \u0026beta;1 integrin: Thermodynamics and conformational analyses. \u003cem\u003eBiophys. J.\u003c/em\u003e \u003cstrong\u003e99\u003c/strong\u003e, 208\u0026ndash;217 (2010).\u003c/li\u003e\n\u003cli\u003eLanke, K. H. W. \u003cem\u003eet al.\u003c/em\u003e GBF1, a Guanine Nucleotide Exchange Factor for Arf, Is Crucial for Coxsackievirus B3 RNA Replication. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cstrong\u003e83\u003c/strong\u003e, 11940 (2009).\u003c/li\u003e\n\u003cli\u003eLuteijn, R. D. \u003cem\u003eet al.\u003c/em\u003e SLC19A1 transports immunoreactive cyclic dinucleotides. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e573\u003c/strong\u003e, 434 (2019).\u003c/li\u003e\n\u003cli\u003eVan De Weijer, M. L. \u003cem\u003eet al.\u003c/em\u003e A high-coverage shRNA screen identifies TMEM129 as an E3 ligase involved in ER-associated protein degradation. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 3832 (2014).\u003c/li\u003e\n\u003cli\u003eQiao, W. \u003cem\u003eet al.\u003c/em\u003e MYADM binds human parechovirus 1 and is essential for viral entry. \u003cem\u003eNature Communications 2024 15:1\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 1\u0026ndash;14 (2024).\u003c/li\u003e\n\u003cli\u003eMa, H. \u003cem\u003eet al.\u003c/em\u003e LDLRAD3 is a receptor for Venezuelan equine encephalitis virus. \u003cem\u003eNature 2020 588:7837\u003c/em\u003e \u003cstrong\u003e588\u003c/strong\u003e, 308\u0026ndash;314 (2020).\u003c/li\u003e\n\u003cli\u003ePunjani, A., Rubinstein, J. L., Fleet, D. J. \u0026amp; Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. \u003cem\u003eNature Methods 2017 14:3\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 290\u0026ndash;296 (2017).\u003c/li\u003e\n\u003cli\u003eWarshamanage, R., Yamashita, K. \u0026amp; Murshudov, G. N. EMDA: A Python package for Electron Microscopy Data Analysis. \u003cem\u003eJ. Struct. Biol.\u003c/em\u003e \u003cstrong\u003e214\u003c/strong\u003e, 107826 (2022).\u003c/li\u003e\n\u003cli\u003eEmsley, P., Lohkamp, B., Scott, W. G. \u0026amp; Cowtan, K. Features and development of Coot. \u003cem\u003eActa Crystallogr. D Biol. Crystallogr.\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, 486\u0026ndash;501 (2010).\u003c/li\u003e\n\u003cli\u003eLiebschner, D. \u003cem\u003eet al.\u003c/em\u003e Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. \u003cem\u003eActa Crystallogr. D Struct. Biol.\u003c/em\u003e \u003cstrong\u003e75\u003c/strong\u003e, 861\u0026ndash;877 (2019).\u003c/li\u003e\n\u003cli\u003eMurshudov, G. N., Vagin, A. A. \u0026amp; Dodson, E. J. Refinement of macromolecular structures by the maximum-likelihood method. \u003cem\u003eActa Crystallogr. D Biol. Crystallogr.\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 240\u0026ndash;255 (1997).\u003c/li\u003e\n\u003cli\u003eKrissinel, E. \u0026amp; Henrick, K. Inference of macromolecular assemblies from crystalline state. \u003cem\u003eJ. Mol. Biol.\u003c/em\u003e \u003cstrong\u003e372\u003c/strong\u003e, 774\u0026ndash;797 (2007).\u003c/li\u003e\n\u003cli\u003eWallace, A. C., Laskowski, R. A. \u0026amp; Thornton, J. M. LIGPLOT: a program to generate schematic diagrams of protein-ligand interactions. \u003cem\u003eProtein Eng.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 127\u0026ndash;134 (1995).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cp\u003e\u003cstrong\u003eTable 1. Cryo-EM data collection parameters\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"633\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eERAV only\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eERAV-Integrin\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp; + 2mM MgCl\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eERAV-integrin\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp; + 2mM EDTA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eApo integrin + 2mM MgCl\u003csub\u003e2\u003c/sub\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMicroscope\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003eTitan\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; Krios G3i\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003eTitan\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; Krios G2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eTitan\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; Krios G3i\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003eTitan\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; Krios G2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDetector\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003eFalcon 4i\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; SelectrisX (ThermoFisher)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003eBioQuantum K3\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e(Ametek-Gatan)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003eFalcon 4i\u003c/p\u003e\n \u003cp\u003e\u0026nbsp; SelectrisX (ThermoFisher)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003eBioQuantum K3\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e(Ametek-Gatan)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNominal Magnification\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003e165,000x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003e105,000x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003e165,000x\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e105,000x\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eVoltage (kV)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003e300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003e300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003e300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e300\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMovies collected (#)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003e1,000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003e14,405\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003e16,799\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e7,172\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal \u0026nbsp;dose\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(e\u003csup\u003e-\u003c/sup\u003e/\u0026Aring;\u003csup\u003e2\u003c/sup\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003e50.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003e50.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eExposure \u0026nbsp;time (s)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003e3.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003e2.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003e3.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e2.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDose rate\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(e\u003csup\u003e-\u003c/sup\u003e/pix/s)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003e8.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003e9.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003e8.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e9.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDefocus \u0026nbsp;range (\u0026micro;m)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003e-3.0 to \u0026nbsp;-1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003e-2.4 to \u0026nbsp;-0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003e-3.0 to \u0026nbsp;-1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e-3.0 to -1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePixel \u0026nbsp;size (\u0026Aring;/pix)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003e0.7303\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 138px;\"\u003e\n \u003cp\u003e0.8250\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 139px;\"\u003e\n \u003cp\u003e0.7303\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e0.8290\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSymmetry\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003eI2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003eI2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003eC1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp\u003eI2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003eC1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003eC1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eInitial \u0026nbsp;particle count (#)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003e4,926\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e32,851\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003e1,509,989\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp\u003e22,091\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003e243,410\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e108,236\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 106px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFinal \u0026nbsp;particle count (#)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 131px;\"\u003e\n \u003cp\u003e2,108\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e25,170\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 64px;\"\u003e\n \u003cp\u003e266,365\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp\u003e22,091\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 71px;\"\u003e\n \u003cp\u003e42,755\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 118px;\"\u003e\n \u003cp\u003e55,595\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-9053284/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9053284/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Equine rhinitis A virus (ERAV), a picornavirus closely related to foot-and-mouth disease virus, causes respiratory infections in horses. We performed a HEK293T CRISPRi screen and identified integrin ⍺2β1 as a protein receptor for ERAV. Using knock-out cells and by pretreating cells with an antibody or soluble receptor, we confirmed the importance of this integrin for infection of multiple cell types, including equine fibroblasts. Cryo-EM and glycoproteomics analyses revealed that ERAV binds integrin ⍺2β1 in its closed conformation by attaching to the β-propeller of the ⍺2 chain, independent of divalent cations, as well as to a high-mannose glycan on ⍺2 N112 and a sialylated glycan on β1 N269. Using glycan knockout and knock-in cells and by reconstituting integrin ⍺2β1-depleted cells with mutant receptors, we demonstrated the importance of these glycans for virus entry. Our results identify a hitherto unseen combination of protein and glycan interactions between a virus and its receptor.","manuscriptTitle":"Identification and structural characterisation of a picornavirus integrin receptor with an essential role of two distinct glycans for virus infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-17 14:07:13","doi":"10.21203/rs.3.rs-9053284/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"9838444b-b06a-4b32-9a2b-99c3f28de271","owner":[],"postedDate":"March 17th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":64391964,"name":"Biological sciences/Microbiology/Virology/Virus\u0026#x2013;host interactions"},{"id":64391965,"name":"Biological sciences/Microbiology/Virology/Virus structures"}],"tags":[],"updatedAt":"2026-03-17T14:07:13+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-17 14:07:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9053284","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9053284","identity":"rs-9053284","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}