PIWIL1 is recruited to Centrosomes during Mitosis in Colorectal Cancer Cells and is linked to cell cycle progression

PIWIL1 is recruited to Centrosomes during Mitosis in Colorectal Cancer Cells and is linked to cell cycle progression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article PIWIL1 is recruited to Centrosomes during Mitosis in Colorectal Cancer Cells and is linked to cell cycle progression Maria Rosa Garcia-Silva, Sofía Montenegro, Sofía Dacosta, Juan Pablo Tosar, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4618560/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 13 Oct, 2024 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Background PIWI proteins, traditionally associated with germline development, have recently gained attention for their expression in various cancers, including colorectal cancer. However, the molecular mechanisms underlying their reactivation and impact on cancer initiation and progression remain elusive. Results Here, we found that PIWIL1 is expressed at relatively high levels in CRC-derived samples and cell lines, where it undergoes a dynamic re-localization to the centrosome during mitosis. Knockdown of PIWIL1 induces G2/M arrest associated to disruption of mitotic spindle and aberrant metaphase events, highlighting its role in cell cycle progression. We have also found that expression of PIWIL1 is lost during differentiation of Caco-2 cells into enterocytes and that PIWIL1 is expressed in cells at the base of intestinal crypts in normal human colon tissue, where intestinal stem cells are known to reside. Thus, it is possible that the presence of PIWIL1 in cancer cells reflects a physiological role of this protein in stem cell maintenance, what would argue in favor of the proposed stem cell origin of CRC. Supporting this view, dedifferentiation of human fibroblasts into induced pluripotent stem cells (iPSc) implies reactivation of PIWIL2 expression, another member of the PIWI protein family. Conclusions Overall, our findings suggest a role of PIWIL1 in mediating cell cycle dynamics, both in colorectal cancer cells and possibly also in intestinal stem cells. In a broader aspect, we provide support for an involvement of PIWI proteins in somatic stem cell maintenance, expanding non-gonadal functions for this protein family. PIWI Colorectal Cancer Cell cycle Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Colorectal cancer (CRC), one of the leading causes of cancer-related mortality worldwide, has been extensively studied for its intricate underlying molecular bases. Despite this, CRC remains a global health challenge, demanding deeper exploration of the particular molecular pathways driving its progression and the identification of novel therapeutic targets [ 1 ]. Among the myriad pathways implicated in cancer progression, the pathway mediated by PIWI (P-element-induced wimpy testis) proteins, traditionally associated with germline development and maintenance of genome stability, has emerged as a captivating focus of investigation due to its overexpression in various cancers, including CRC [ 2 ]. Notably, PIWIL1, a key component of piRNA-mediated gene expression regulation pathways, has gathered attention for its suspected role as an oncogene since 2002, when it was first reported to be overexpressed in seminoma (a testicular-derived tumor) [ 3 ]. Nowadays, overexpression of different PIWI proteins has been frequently observed in a variety of cancers, including gastric cancer, sarcoma, esophageal squamous cell carcinoma, endometrial cancer, colon cancer, cervical cancer, glioma, hepatocellular carcinoma, ovarian cancer, breast cancer, bladder cancer, and renal cell carcinoma [ 4 ]. Nevertheless, the mechanisms underlying PIWI protein overexpression and their impact on the initiation and progression of cancer remain elusive. Reports on the expression of piRNAs in either somatic or neoplastic cells are at times conflicting. In this respect, we have recently reported that a large fraction of the so-called somatic piRNAs, which have been described in nongonadal tissues, derive from non-coding RNAs and do not bear the specific molecular properties of canonical piRNAs [ 5 ], [ 6 ]. Additionally, experimental data obtained in CRC cells by two independent groups could not find evidence for the expression of canonical piRNAs linked to PIWIL1 [ 7 ], [ 8 ]. This suggests that PIWI proteins could act independently of piRNAs in these contexts. However, how piRNA-independent molecular mechanisms of PIWI proteins contribute to cancer initiation and progression is not clear yet. Henceforth, we aimed to shed light on the non-canonical functions of PIWIL1 re-activation in CRC cancer models. Our analysis first showed an overexpression of PIWIL1 in CRC patient´s samples from TGCA database. In addition, subcellular localization of PIWIL1 unveiled its remarkable re-localization during the cell cycle, from a nuclear scattered/dispersed granular distribution in interphase, to a microtubule-organizing center (MTOC)-like localization during mitosis in human cell lines derived from colorectal cancer (Caco-2). Building upon this observation, we delved into the functional consequences of PIWIL1's presence at the centrosome during mitosis. Our data clearly demonstrate that PIWIL1 silencing leads to a distinct cellular phenotype, characterized by cell cycle stalling at G2/M phase and the accumulation of aberrant metaphase events in Caco-2 cells. Remarkably, in normal colon-derived tissue samples, PIWIL1 is observed at the base of colon crypts, a known niche of intestinal stem cells. This is consistent with the PIWI pathway being relevant for the maintenance of stemness and self-renewal in somatic stem cells [ 9 ], [ 10 ], [ 11 ]. Also supporting a role in stemness maintenance, PIWIL1 expression seems to be downregulated during differentiation of Caco-2 cells to enterocytes. Albeit for a different PIWI protein (PIWIL2), we also observed dedifferentiation-induced expression in a model of induced pluripotent stem cell (iPS) generation, confirming our hypothesis that PIWI proteins are important for human stem cell maintenance. Mechanistically, our findings support an association between PIWIL1 and the mitotic spindle, as previously observed in germ cells [ 12 ], [ 13 ]. Taken together, our results highlight the relevance of PIWI proteins in the regulation of the cell cycle in undifferentiated cells, possibly explaining their unexpected but widely documented expression in cancer. Methods Bioinformatic Resources: Bioinformatic data mining was performed in CRC cohorts in TCGA, GTEX and TARGET in order to asses PIWIL1 gene expression. We used Xena’s Visual Spreadsheet and Chart View to construct Fig. 1 A and B to analyze PIWIL1 upregulation in connection with CRC [ 14 ]. Cell Culture and qRT-PCR. Caco-2 (HB-37) cells were purchased from the American Type Culture Collection (ATCC) and cultured in DMEM (Gibco) with 10% fetal bovine serum (Gibco) according to the supplier’s instructions. Caco-2 cells were synchronized with two pulses of 2mM of Thymidine (Sigma) for 16 hours. Total RNA was isolated using TRIzol reagent (Invitrogen). cDNA was obtained by MLV Reverse Transcriptase (Merck) using 1µg of Total RNA and an oligo (dT) 18 primer. The primer sequences for PIWIL1 RT–qPCR are: ATGGCGTACAGACACGAGGC (Forward) and AGTGACAGATTTGGCTCTCTG (reverse). Immunofluorescence and Confocal Microscopy Caco-2 cells (1x10 6 ) were plated onto microscope slides in a 24-well plate. After the desired time, cells were fixed using 4% paraformaldehyde for 15 min at RT and permeabilized with PBS-tween 0.2% for 3 minutes. Then, cells were incubated with blocking buffer (5% BSA in PBS) for 1 hour at 37°C. The cells were washed three times with PBS and incubated with primary antibody diluted in blocking buffer overnight in a humid chamber. Fluorophore-conjugated secondary antibodies were incubated, after 3 washes with PBS, on the slides 1 hour. DNA staining was performed with 300 µM DAPI (Sigma) for 5 minutes at room temperature in the dark. After washing with PBS, coverslips were mounted using Prolong Gold Antifade Reagent (Thermo Fisher Scientific). Cells were photographed with a Zeiss confocal microscope LSM 880 and analyzed using Fiji-ImageJ software. Rendering of images obtained by confocal Z Stacks was performed in AGAVE path-trace viewer (Allen Institut for Cell Science). Primary antibodies used in this study were: anti-PIWIL1 HPA018798 (Sigma-Prestige) and HPA018798 (Abcam). Anti β−tubulin sc-55529 (Santa Cruz tech). γ−Tubulin (SIGMA T6557). Centrin-2 (Merck, clone 20H5). PIWIL1 knock down assays and cell cycle flow cytometry. Caco-2 cells were transfected with siRNA (10nM) to PIWIL1 (Trifecta Kit; IDT), using Lipofectamine 3000 (Invitrogen) according to manufacturer’s instructions. The mRNA expression levels of PIWIL1 and Actin were examined by semiquantitative RT-PCR from total RNA using TriZol Reagent (Sigma) 72 h after siRNA transfection. Cell cycle progression of Caco-2 cells was measure 72 h after siRNA PIWIL1 vs irrelevant scrambled siRNA transfection by flow cytometry with Propidium Iodide (PI) Staining. Briefly, 1 million Caco-2 cells were fixed with cold 70% ethanol for 30 min, washed twice in PBS, and treated with Ribonuclease I (100µg/mL Sigma). After RNase treatment, cells were stained with 50µg/mL PI (Invitrogen), and analyzed using an AttuneTM NxT instrument and the FlowJo software. Approximately 10,000 cells per condition were selected after the gating strategy. The first gate was placed on FSC vs SSC. The second gate was placed on PE vs SSC-A and displayed as an histogram using PE intensity. Percentage of cells in each cell cycle phase was calculated using markers set within the analysis program. Wound Healing Assays. 1x10 4 Caco-2 and PIWIL1 knockdown Caco-2 cells were grown in 24-well plates. After the cells have become confluent we performed a cell-free gap in the monolayer by mechanical scratching (scratch wound) with a white sterile pipet tip. optical microscopy can be used to observe cells migrating into the wound area. Imaging Data was acquired every 24 hours using phase-contrast imaging of the wound area in the field-of-view using 10X objective lens. % of wound closure (Area) was measure by the wound healing tool by Volker Baecker for ImageJ. Colon-derived Tissue Arrays Immunohistochemistry. Colon carcinoma tissue array with matched adjacent normal colon tissue as control, including TNM, clinical stage and pathology grade, was acquired from Tissuearray.com (CO243b). Before immunohistochemistry, antigen retrieval was performed baking slides for at least 60 minutes at 60°C before de-paraffinization using xylene. De-paraffinized slides were treated as described for the immunofluorescence protocol. Caco-2 differentiation using Transwell Experiments. 1.0x10 5 Caco-2 cells were seeded on HTS-24 Transwell-Plates containing a 0.4 µm membrane (Costar; Corning Inc). Experiments were performed in triplicates. Plates were incubated at 37°C overnight and the medium of the upper chamber was replaced by new DMEM-PEST to remove non-adherent cells and reduce the risk of multilayer formation. The culture medium was refreshed every second day in both compartments for a total of 21 days. Polarized monolayer cells were checked by actin labelling and the formation of vertical filaments. Membrane filters were disassembled and proceed as detailed in the immunofluorescence protocol. Results PIWIL1 is Upregulated in primary tumor-derived samples from Colorectal Cancer Patients Compared to Healthy Individuals. Data mining was performed to determine the expression of the four PIWI proteins codified by the human genome, in samples-derived from patients with CRC. PIWIL1 , PIWIL2 , PIWIL3 and PIWIL4 RNA-seq data from colon primary tumor and normal cohorts-derived samples were analyzed using the UCSC Xena Browser (Goldman et al., 2020), integrating data from TCGA, TARGET and GTEX databases. RNA-seq data from 596 samples were ranked according to PIWI gene expression levels, revealing a positive correlation between PIWIL1 and tumor status (Fig. 1 A-C). PIWIL1 is localized in the nucleus in colon cancer cells. Cell lines derived from human colon carcinoma and the beningn colon epithelial cell line (CCDCoN) were assessed for PIWIL1 expression at transcript and protein level. All cell lines expressed variable levels of PIWIL1 transcripts, measured by RT-PCR, and protein levels assesed by immunoprecipitation followed by Western blot (Figs. 2 A and 2 B, respectively). Indirect immunofluorescence (IF) to determine PIWIL1 subcellular localization showed a predominant nuclear localization in Caco-2 (Fig. 2 C) and other CRC cell lines (Fig. 2 D), with the signal presenting a patterned distribution in the nucleoplasm and a remarkable association with the nuclear lamina during interphase. Drosphila Piwi shuttles to the nucleous thanks to a N-terminal nuclear localization signal (NLS) that is exposed upon piRNA binding [ 15 ]. Interestingly, we identified a predicted NLS in the exon 2 of PIWIL1 (aa 4 to 14), comprising a stretch of basic residues (arginine and alanine). To determine its functionality as a bona fide NLS in Caco-2 cells, we fused this sequence motif to mRuby2. Consistent with the observed predominantly nuclear expression of PIWIL1 in these cells (Fig. 2 C), NLS-tagged mRuby2 was mostly expressed in the nucleus (Fig. 2 E). PIWIL1 localizes to the centrosome in Caco-2 cells during mitosis. While PIWIL1 was mostly localized in the nucleoplasm or in the nuclear lamina in interphasic cells, we consistently observed its expression in the centrosome of mitotic cells (see, for example, Fig. 3 ). With the purpose of better elucidating the subcellular distribution of PIWIL1 during the cell cycle, we synchronized Caco-2 cells and confirmed PIWIL1 is dynamically redistributed during mitosis (Fig. 3 A). Confirming previous observations, synchronized Caco-2 cells co-stained for beta tubulin showed PIWIL1 relocalization to the MTOC during mitosis (Fig. 3 B). Co-localization assays of PIWIL1 and gamma tubulin, a known centrosomal marker, confirmed PIWIL1 as an integral component of the MTOC or the centrosome (Fig. 3 C). 3D Rendering of composite images are depicted in Fig. 3 D, where PIWIL1 and gamma tubulin appear to be arranged in a manner reminiscent of two interlocking rings, fitting together seamlessly. PIWIL1 silencing causes G2/M arrest and aberrant mitosis. To understand the functional implications of PIWIL1 localization to centrosomes in dividing CRC cells, we performed siRNA-mediated PIWIL1 knock down (KD). Levels of PIWIL1 protein and mRNA decreased by 70% as assessed by fluorescence microscopy and RT-qPCR, respectively (Fig. 4 A). Surprisingly, KD cells showed a significantly higher frequency of mitotic defects (vs control siRNA-transfected cells), comprising multiple centromeres, anormal mitotic spindles or misaligned metaphasic chromosomes (Fig. 4 B). This was followed by cell cycle arrest at G2/M, as measured by flow cytometry using propidium iodide DNA staining (Fig. 4 C). These cell division defects were consistent with KD cells having a lower proliferation rate and / or migratory capacity, as measured by wound healing assays (Fig. 4 D). In sum, despite Caco-2 cells are transformed and polyploid, they seem to rely on PIWIL1 to regulate mitotic fidelity, potentially avoiding mitotic catastrophe. PIWIL1 expression is restricted to stem cell niches in normal human colon tissue and is lost upon differentiation Next, we asked whether PIWIL1 expression in CRC patients and CRC cell lines is due to an aberrant expression of this otherwise germline-specific protein, or whether PIWIL1 is expressed in a subset of human colon cells under physiological conditions. Surprisingly, immunohistochemistry and immunofluorescence microscopy of normal human colon tissue showed PIWIL1 staining restricted to cells at the bottom of each intestinal crypt, where stem cells are known to be located [ 16 ] (Fig. 5 A). In contrast, colon cancer tissue showed pervasive PIWIL1 staining, with virtually all cells staining positive. However, unlike CRC cell lines, the signal was predominantly cytoplasmic in both healthy and cancer tissues. Intestinal crypts, which form the base of the villi, are the basic structural and functional units of intestinal epithelium. At the bottom of each crypt, a small number of about eight stem cells [ 16 ] are constantly dividing to give place to transit-amplifying progenitor cells. These progenitor cells divide as they migrate upwards and differentiate into two distinct lineages: enterocytes (absorptive cells) and secretory cells. Having observed that, in normal colon tissue, PIWIL1 expression is restricted to the stem cell population residing at the base of intestinal crypts, we asked whether PIWIL1 expression is downregulated during progenitor cell differentiation into enterocytes. To study this, we followed a well-stablished protocol [ 17 ] where Caco-2 cells are differentiated to enterocytes by means of a transwell assay. Surprisingly, unlike 2D cultures of undifferentiated cells (Fig. 2 ), we were not able to find PIWIL1 expression when Caco-2 cells were differentiated to enterocytes (Fig. 5 B). To validate the differentiation protocol, we analyzed the subcellular localization of centrin-2, a structural component of the centrosome, that migrates to the apical level of the cells upon differentiation (Fig. 5 B). Thus, loss of PIWIL1 during Caco-2 differentiation resembles the situation in normal colon epithelia, where only undifferentiated cells residing at the base of intestinal crypts express this protein to detectable levels. To study whether PIWI proteins are required for the maintenance of stemness and self-renewal in non-transformed cells, we analyzed RNA-seq data from GEO: GSE69626. In this study, human fibroblasts were de-differentiated into induced pluripotent stem cells (iPSCs) using six different reprogramming methods [ 18 ]. Surprisingly, while PIWIL1 was not involved in this process, PIWIL2 expression was induced in all reprogrammed cells (Fig. 5 C). Differentiated fibroblasts expressed FAP but lacked PIWIL2 and the stem cell marker NANOG. Conversely, de-differentiated cells expressed PIWIL2 and NANOG , while silencing FAP. Albeit involving a different PIWI protein to the one studied herein, results above strengthen the link between PIWI protein expression and stem cell biology. This agrees with PIWIL1 expression in stem cells from healthy colon tissue. In addition, these results potentially explain PIWIL1 overexpression in CRC based on the potential stem cell origin of colorectal cancer [ 19 ]. Discussion Several breakthroughs in the understanding of the PIWI pathway beyond its traditional involvement in transposon signaling in the gonads have been made in the past decade [ 20 ], [ 21 ], [ 22 ]. However, a complete understanding of extragonadal PIWI protein function, particularly in cancer, remains incompletely understood. In this regard, reactivation of PIWI expression has been attributed to aberrant DNA methylation, a hallmark of various types of tumors [ 23 ]. Aberrant expression of other genes from the PIWI pathway has been observed in several cancer cell lines, in the absence of a concomitant reactivation of piRNA biogenesis [ 7 ]. Our own data-mining analysis of 600 patients’ samples obtained from TGCA and GTEX showed pervasive PIWIL1 expression in CRC compared to normal colorectal tissue. Our results are therefore in good agreement with previous studies reporting aberrant PIWIL1 expression in CRC patients [ 24 ], [ 25 ], [ 26 ]. Interestingly, a piRNA-independent function for PIWIL1 in cancer cell proliferation has been previously reported in human pancreatic cancer cell lines, where it functions as an activator of the E3 ubiquitin ligase anaphase promoting complex/cyclosome [ 8 ]. In addition, PIWIL1 overexpression within an adenovirus vector promoted cell proliferation, associated with changes in global DNA methylation levels [ 27 ]. However, the molecular mechanisms linking PIWIL1 expression and sustained proliferation have not been thoroughly explored. In our study, we observed physical association between PIWIL1 and centrosomes during mitosis in Caco-2 cells and other CRC cell lines. PIWIL1 silencing in these cells induced cell cycle arrest, diminished cell proliferation, and provoked the accumulation of mitotic defects. These observations are in good agreement with earlier studies linking PIWIL1 with the anaphase-promoting complex, a key player in cell cycle control [ 8 ]. These findings suggest that cell cycle regulation mediated by PIWIL1 might be mediated through interactions with other proteins, regardless of piRNAs. Interestingly, during murine male meiosis, PIWIL1 is involved in the control of meiotic segregation and its deficiency causes chromosome misalignment and mis-segregation, leading to aneuploidy via its contact with transcribed centromeric regions [ 28 ]. Our findings of PIWIL1 recruitment to the centromere/MTOC during mitosis in CRC cells, and its importance for proper chromosome alignment during metaphase, support the idea that at least some of the gonadal functions of PIWIL1 are conserved in somatic tissues. These insights underscore the multifaceted role of PIWIL1 in cell cycle regulation and support previously recognized piRNA-independent functions during cell division. Our data also agrees with previous work conducted in gastric cancer cells. For instance, Liu et al . found that PIWIL1 downregulation effectively inhibited proliferation and induced G2/M phase cell cycle arrest [ 29 ]. Additionally, in breast cancer and sarcoma cell lines, PIWIL1 overexpression increases cyclin levels and regulates cyclin-dependent kinase inhibitors p21 and p27 [ 30 ], [ 31 ]. In glioblastoma, PIWIL1 knockdown induced significant changes in cell cycle-related genes, confirming the dysregulation of cyclin levels and the increase in cells arrested in G2/M [ 32 ]. The G2/M cell cycle transition slowdown observed as a result of reduced PIWIL1 expression in Caco-2 cells could have several functional implications. One hypothesis is that loss of PIWIL1 leads to a reduced proliferative capacity as a response to increased genomic instability and/or mitotic spindle disruption. Another hypothesis highlights the role of PIWI proteins in cancer development and progression by promoting a stem cell-like status that sustains self-renewal and proliferation [ 23 ]. In the context of CRC, the origin of the malignancy is not well understood, but it is likely that the cells that give rise to the tumor are actually intestinal stem cells [ 19 ]. Sousa-Victor P. et al have identified PIWI as a critical regulator of somatic stem cell function in intestinal stem cells in flies, safeguarding maintenance of stemness [ 33 ]. In humans, others have observed a positive correlation between PIWI pathway genes and cancer stem cell markers in CRC [ 34 ]. PIWIL1 localization within colon stem cell niches in healthy intestinal tissue, and its overexpression in colon cancer cells, might reflect an evolutionary path leading from colon stem cells to colon cancer. In fact, the ability to in vitro differentiate Caco-2 cells into enterocytes could be considered evidence that these are non-terminally differentiated cells. Consistent with a role restricted to undifferentiated or stem cells, PIWIL1 was lost during Caco-2 differentiation to enterocytes. Taken together, these data suggest that the presence and activity of PIWIL1 at the base of intestinal crypts in normal colon tissue is being reflected in CRC-derived cells, either due to the stem cell origin of the CRC cell lines used herein, or due to functional convergence in the adoption of stem cell-like characteristics and undifferentiated states. The expression of PIWIL1 in colon tumor cells seems to be a necessary event for proper cell division. Its absence leads to aberrant mitosis and increases genomic instability, as demonstrated by previous studies and our own findings. Our study thus unveils an opportunity for targeting PIWIL1 as a novel CRC therapeutic strategy, potentially leading to mitotic catastrophe in these cells. In conclusion, PIWIL1 might be important for stem cell maintenance in the human intestine. For the same reason it might also be frequently expressed in CRC, where it seems to play a role in mitotic fidelity and/or cell cycle regulation. This protein seems to be silenced during differentiation, while its downregulation induces genomic instability in cancer cells. Therefore, we would like to make a case for exploring PIWIL1 as an attractive therapeutic target in the future. Conclusions Our study sheds light on the non-canonical functions of PIWI pathway in CRC cancer models, revealing its overexpression in patient samples and its dynamic relocalization during the cell cycle. We described PIWIL1's presence at the centrosome during mitosis, with its knockdown leading to G2/M arrest and aberrant mitotic events. Moreover, we observed PIWIL1 expression in the stem cell niche of normal colon tissue, suggesting a potential role in stem cell maintenance. Interestingly, PIWIL1 expression is lost during cell differentiation, indicating its association with undifferentiated states. Our findings underscore the possible complex role of PIWIL1 in CRC progression, highlighting its potential as a therapeutic target for future interventions aimed at inducing mitotic catastrophe in cancer cells and restoring normal stem cell dynamics in the intestine. Overall, our study provides valuable insights into the intricate molecular mechanisms underlying CRC pathogenesis and presents PIWI pathway as a promising avenue for further research and therapeutic development. Declarations Ethics approval and consent to participate Not applicable Consent for publication Authors give their consent for publication Availability of data and material All data supporting the findings of this study are available within the paper or under request to corresponding author: MRGS. Competing interests Authors declare Not competing interests Funding This work was supported by FOCEM (Fondo para la Convergencia Estructural del Mercosur) (COF 03/11), ANII (PEC_3_2019_1_158811) for the AttuneTM NxT equipment and to Comisión Sectorial de Investigación Científica (CSIC) Programa Grupos 2022 (Área salud). Authors' contributions. SM performed experiments related with Figure 2. SD contributed with initial cloning constructs for PIWIL1 tagging. JPT analyzed and interpreted data regarding iPSc de-differentiation assays and contributed in preparing, designing and writing the manuscript. AC was a major contributor in writing and designing the manuscript. MRGS designed, performed and analyzed the major results obtained in the manuscript and write the manuscript. All authors read and approved the final manuscript. Acknowledgements. Authors gratefully acknowledge the Advanced Bioimaging Unit and the Cell Biology Unit (Cytometry platform: MSc. Paula Céspedes) at Institut Pasteur of Montevideo for the support and assistance in the present work. References S. G. Patel, J. J. Karlitz, T. Yen, C. H. Lieu, y C. R. Boland, «The rising tide of early-onset colorectal cancer: a comprehensive review of epidemiology, clinical features, biology, risk factors, prevention, and early detection», Lancet Gastroenterol. Hepatol. , vol. 7, n. o 3, pp. 262-274, mar. 2022, doi: 10.1016/S2468-1253(21)00426-X. X. Wang, L.-T. Gou, y M.-F. Liu, «Noncanonical functions of PIWIL1/piRNAs in animal male germ cells and human diseases», Biol. Reprod. , vol. 107, n. o 1, pp. 101-108, jul. 2022, doi: 10.1093/biolre/ioac073. D. Qiao, A.-M. Zeeman, W. Deng, L. H. J. Looijenga, y H. Lin, «Molecular characterization of hiwi, a human member of the piwi gene family whose overexpression is correlated to seminomas», Oncogene , vol. 21, n. o 25, pp. 3988-3999, jun. 2002, doi: 10.1038/sj.onc.1205505. N. Chakravorty, «Non-coding RNAs: the silent regulators of health and diseases», Mol. Biol. Rep. , abr. 2022, doi: 10.1007/s11033-022-07464-4. J. P. Tosar, C. Rovira, y A. Cayota, «Non-coding RNA fragments account for the majority of annotated piRNAs expressed in somatic non-gonadal tissues», Commun. Biol. , vol. 1, n. o 1, p. 2, dic. 2018, doi: 10.1038/s42003-017-0001-7. J. P. Tosar, M. R. García-Silva, y A. Cayota, «Circulating SNORD57 rather than piR-54265 is a promising biomarker for colorectal cancer: common pitfalls in the study of somatic piRNAs in cancer», RNA , vol. 27, n. o 4, pp. 403-410, abr. 2021, doi: 10.1261/rna.078444.120. P. Genzor, S. C. Cordts, N. V. Bokil, y A. D. Haase, «Aberrant expression of select piRNA-pathway genes does not reactivate piRNA silencing in cancer cells», Proc. Natl. Acad. Sci. , vol. 116, n. o 23, pp. 11111-11112, jun. 2019, doi: 10.1073/pnas.1904498116. F. Li et al. , «piRNA-independent function of PIWIL1 as a co-activator for anaphase promoting complex/cyclosome to drive pancreatic cancer metastasis», Nat. Cell Biol. , vol. 22, n. o 4, pp. 425-438, abr. 2020, doi: 10.1038/s41556-020-0486-z. D. Palakodeti, M. Smielewska, Y.-C. Lu, G. W. Yeo, y B. R. Graveley, «The PIWI proteins SMEDWI-2 and SMEDWI-3 are required for stem cell function and piRNA expression in planarians», RNA , vol. 14, n. o 6, pp. 1174-1186, jun. 2008, doi: 10.1261/rna.1085008. C. E. Juliano et al. , «PIWI proteins and PIWI-interacting RNAs function in Hydra somatic stem cells», Proc. Natl. Acad. Sci. , vol. 111, n. o 1, pp. 337-342, ene. 2014, doi: 10.1073/pnas.1320965111. R. Galton, K. Fejes-Toth, y M. E. Bronner, «Co-option of the piRNA pathway to regulate neural crest specification», Sci. Adv. , vol. 8, n. o 32, p. eabn1441, ago. 2022, doi: 10.1126/sciadv.abn1441. A. J. Rodriguez et al. , «Seawi—a sea urchin piwi/argonaute family member is a component of MT-RNP complexes», RNA , vol. 11, n. o 5, pp. 646-656, may 2005, doi: 10.1261/rna.7198205. Z. G. Venkei et al. , «A kinesin Klp10A mediates cell cycle-dependent shuttling of Piwi between nucleus and nuage», PLOS Genet. , vol. 16, n. o 3, p. e1008648, mar. 2020, doi: 10.1371/journal.pgen.1008648. M. J. Goldman et al. , «Visualizing and interpreting cancer genomics data via the Xena platform», Nat. Biotechnol. , vol. 38, n. o 6, pp. 675-678, jun. 2020, doi: 10.1038/s41587-020-0546-8. R. Yashiro et al. , «Piwi Nuclear Localization and Its Regulatory Mechanism in Drosophila Ovarian Somatic Cells», Cell Rep. , vol. 23, n. o 12, pp. 3647-3657, jun. 2018, doi: 10.1016/j.celrep.2018.05.051. B. Tóth, S. Ben‐Moshe, A. Gavish, N. Barkai, y S. Itzkovitz, «Early commitment and robust differentiation in colonic crypts», Mol. Syst. Biol. , vol. 13, n. o 1, p. 902, ene. 2017, doi: 10.15252/msb.20167283. I. Hubatsch, E. G. E. Ragnarsson, y P. Artursson, «Determination of drug permeability and prediction of drug absorption in Caco-2 monolayers», Nat. Protoc. , vol. 2, n. o 9, pp. 2111-2119, sep. 2007, doi: 10.1038/nprot.2007.303. J. M. Churko et al. , «Transcriptomic and epigenomic differences in human induced pluripotent stem cells generated from six reprogramming methods», Nat. Biomed. Eng. , vol. 1, n. o 10, pp. 826-837, oct. 2017, doi: 10.1038/s41551-017-0141-6. D. J. Huels y O. J. Sansom, «Stem vs non-stem cell origin of colorectal cancer», Br. J. Cancer , vol. 113, n. o 1, pp. 1-5, jun. 2015, doi: 10.1038/bjc.2015.214. R. J. Ross, M. M. Weiner, y H. Lin, «PIWI proteins and PIWI-interacting RNAs in the soma», Nature , vol. 505, n. o 7483, pp. 353-359, ene. 2014, doi: 10.1038/nature12987. P. Dai et al. , «A Translation-Activating Function of MIWI/piRNA during Mouse Spermiogenesis», Cell , vol. 179, n. o 7, pp. 1566-1581.e16, dic. 2019, doi: 10.1016/j.cell.2019.11.022. A. Ramat et al. , «The PIWI protein Aubergine recruits eIF3 to activate translation in the germ plasm», Cell Res. , vol. 30, n. o 5, pp. 421-435, may 2020, doi: 10.1038/s41422-020-0294-9. M. Litwin, A. Szczepańska-Buda, A. Piotrowska, P. Dzięgiel, y W. Witkiewicz, «The meaning of PIWI proteins in cancer development», Oncol. Lett. , vol. 13, n. o 5, pp. 3354-3362, may 2017, doi: 10.3892/ol.2017.5932. C. Liu et al. , «Combined Phenotype of 4 Markers Improves Prognostic Value of Patients With Colon Cancer», Am. J. Med. Sci. , vol. 343, n. o 4, pp. 295-302, abr. 2012, doi: 10.1097/MAJ.0b013e31822cb4cd. R. Sun, C. Gao, D. Li, B. Li, y Y. Ding, «Expression Status of PIWIL1 as a Prognostic Marker of Colorectal Cancer», Dis. Markers , vol. 2017, pp. 1-7, 2017, doi: 10.1155/2017/1204937. R. Raeisossadati, M. R. Abbaszadegan, M. Moghbeli, A. Tavassoli, A. H. Kihara, y M. M. Forghanifard, «Aberrant expression of DPPA2 and HIWI genes in colorectal cancer and their impacts on poor prognosis», Tumor Biol. , vol. 35, n. o 6, pp. 5299-5305, jun. 2014, doi: 10.1007/s13277-014-1690-x. L. Yang et al. , «Hiwi Promotes the Proliferation of Colorectal Cancer Cells via Upregulating Global DNA Methylation», Dis. Markers , vol. 2015, pp. 1-10, 2015, doi: 10.1155/2015/383056. C. Hsieh, J. Xia, y H. Lin, «MIWI prevents aneuploidy during meiosis by cleaving excess satellite RNA», EMBO J. , vol. 39, n. o 16, p. e103614, ago. 2020, doi: 10.15252/embj.2019103614. X. Liu et al. , «Expression of hiwi gene in human gastric cancer was associated with proliferation of cancer cells», Int. J. Cancer , vol. 118, n. o 8, pp. 1922-1929, abr. 2006, doi: 10.1002/ijc.21575. S. Siddiqi, M. Terry, y I. Matushansky, «Hiwi Mediated Tumorigenesis Is Associated with DNA Hypermethylation», PLoS ONE , vol. 7, n. o 3, p. e33711, mar. 2012, doi: 10.1371/journal.pone.0033711. J. Cao, G. Xu, J. Lan, Q. Huang, Z. Tang, y L. Tian, «High expression of piwi-like RNA-mediated gene silencing 1 is associated with poor prognosis via regulating transforming growth factor-β receptors and cyclin-dependent kinases in breast cancer», Mol. Med. Rep. , vol. 13, n. o 3, pp. 2829-2835, mar. 2016, doi: 10.3892/mmr.2016.4842. H. Huang et al. , «Piwil1 Regulates Glioma Stem Cell Maintenance and Glioblastoma Progression», Cell Rep. , vol. 34, n. o 1, p. 108522, ene. 2021, doi: 10.1016/j.celrep.2020.108522. P. Sousa-Victor et al. , «Piwi Is Required to Limit Exhaustion of Aging Somatic Stem Cells», Cell Rep. , vol. 20, n. o 11, pp. 2527-2537, sep. 2017, doi: 10.1016/j.celrep.2017.08.059. M. Litwin et al. , «Correlation of HIWI and HILI Expression with Cancer Stem Cell Markers in Colorectal Cancer», Anticancer Res. , vol. 35, n. o 6, pp. 3317-3324, jun. 2015. Additional Declarations No competing interests reported. Supplementary Files SupplFigure1Fullblots.pdf Cite Share Download PDF Status: Published Journal Publication published 13 Oct, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 02 Aug, 2024 Reviews received at journal 30 Jul, 2024 Reviews received at journal 12 Jul, 2024 Reviewers agreed at journal 07 Jul, 2024 Reviewers agreed at journal 03 Jul, 2024 Reviewers invited by journal 01 Jul, 2024 Editor assigned by journal 29 Jun, 2024 Editor invited by journal 25 Jun, 2024 Submission checks completed at journal 24 Jun, 2024 First submitted to journal 21 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4618560","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":326332789,"identity":"d0a06f02-a73e-4134-953a-ab85e6b0f14e","order_by":0,"name":"Maria Rosa Garcia-Silva","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYNACAwY5JF4CcVqMgSRjAwlaGBgSG4jWYt6/+NmHHwV26dvZjz9/8LHtHgM/e44BM28bbi0yN54Zz+wxSM7d2ZNj2DizrZhBsucNfi0SEgeMmRkMmHM3HMhhbOZtS2AwuEHAFgmJ45+BWurTDc4/f9j8F6jFnqAW/h6QLYcTDG4kGDYzgmyRIGgLTzFjj8Fxw50z3hjO7DmXwCNx5lnBwTnn8NlyfDPDjz/V8ub86Q8+/ChLkONvT9744E0Zbi0MEgkQ2gDK5wERBxjZ8GjhP4CqBQr+4NEyCkbBKBgFIw0AAFbXTn2i+9K4AAAAAElFTkSuQmCC","orcid":"","institution":"Institut Pasteur Montevideo","correspondingAuthor":true,"prefix":"","firstName":"Maria","middleName":"Rosa","lastName":"Garcia-Silva","suffix":""},{"id":326332790,"identity":"23be7a18-1d15-4339-a374-fc28066ba43f","order_by":1,"name":"Sofía Montenegro","email":"","orcid":"","institution":"Institut Pasteur Montevideo","correspondingAuthor":false,"prefix":"","firstName":"Sofía","middleName":"","lastName":"Montenegro","suffix":""},{"id":326332791,"identity":"412be0e3-6770-4c91-922b-0fdcf7b891e7","order_by":2,"name":"Sofía Dacosta","email":"","orcid":"","institution":"Institut Pasteur Montevideo","correspondingAuthor":false,"prefix":"","firstName":"Sofía","middleName":"","lastName":"Dacosta","suffix":""},{"id":326332792,"identity":"054cd442-e9b6-469d-8914-16445b43433f","order_by":3,"name":"Juan Pablo Tosar","email":"","orcid":"","institution":"Institut Pasteur Montevideo","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"Pablo","lastName":"Tosar","suffix":""},{"id":326332793,"identity":"d7717d60-a7ab-4644-8316-b03ef22a8b55","order_by":4,"name":"Alfonso Cayota","email":"","orcid":"","institution":"Institut Pasteur Montevideo","correspondingAuthor":false,"prefix":"","firstName":"Alfonso","middleName":"","lastName":"Cayota","suffix":""}],"badges":[],"createdAt":"2024-06-21 17:14:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4618560/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4618560/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-75098-6","type":"published","date":"2024-10-13T15:57:49+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60417466,"identity":"c8a61b06-9aca-4b46-8259-0ecab684d1d3","added_by":"auto","created_at":"2024-07-16 14:07:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":105475,"visible":true,"origin":"","legend":"\u003cp\u003ePIWIL1 is overexpressed in CRC tissue samples. A. Visual Spreadsheet obtained from https://ucscxena.github.io for PIWIL1-4, in normal colon tissue (GTEX) and TCGA (CRC samples). N = 650 samples. B. UCSC Xena Visual Spreadsheet for PIWIL1 mRNA in normal and primary tumor-derived samples. C. PIWIL1 levels in cancer tissue samples from TCGA and normal colon tissue from GTEx (p ≤ 0.0001).\u0026nbsp;\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4618560/v1/57259d15f040921f48ef1cca.png"},{"id":60418124,"identity":"b7209596-2006-41f2-b403-c61ba07ef447","added_by":"auto","created_at":"2024-07-16 14:15:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":372077,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePIWIL1 is expressed in several CRC cell lines and localizes in the nucleus. A. \u003c/strong\u003eRT-qPCR of full-length (2500bp; Genbank Gene ID:9271)\u003cem\u003ePIWIL1\u003c/em\u003e in different CRC cell lines and actin as loading control. \u003cstrong\u003eB.\u003c/strong\u003e Western blot of immunoprecipitated fractions enriched in PIWIL1 from different CRC cell lines. Positive control: testicular tissue. Black arrows: PIWIL1 (100 KDa). Gray arrows: IgG. \u003cstrong\u003eC.\u003c/strong\u003e PIWIL1 localization in interphasic Caco-2 cells, measured by indirect immunofluorescence (green). Blue: DAPI. Red: Beta tubulin. Last panel: orthogonal sectioning of a confocal z-stack image confirming intranuclear PIWIL1 expression. \u003cstrong\u003eD.\u003c/strong\u003eRepresentative images in different CRC-derived cell lines and normal colon-derived cell line (CCD841CoN). \u003cstrong\u003eE.\u003c/strong\u003eDiagram of the construction performed to test PIWIL1 predicted NLS (blue box) tagged to mRuby (top) and widefield microscopy showing nuclear expression of PIWIL1 NLS-tagged mRuby (red) in interphasic Caco-2 cells (bottom)\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4618560/v1/49bf9c996c1ebfdb0da5ac41.png"},{"id":60418125,"identity":"d0371ceb-cd82-43af-a34d-e01df8af3ba3","added_by":"auto","created_at":"2024-07-16 14:15:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1048000,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePIWIL1 is recruited to centrosomes in mitotic Caco-2 cells. A. \u003c/strong\u003ePIWIL1 localization in synchronous cultures of Caco-2 cells (green). Images representing different stages of mitosis are shown, based on DNA staining with DAPI (blue). \u003cstrong\u003eB\u003c/strong\u003e. Subcellular localization of PIWIL1 (green) and beta tubulin (red) in two representative images of Caco-2 cells in interphase or mitosis. Note the aberrant mitotic spindle that is characteristic of this cell line. \u003cstrong\u003eC.\u003c/strong\u003e Subcellular localization of PIWIL1 (green) and the centrosome marker gamma tubulin (red), in interphase and mitosis. Inset: magnified view of the centrosome. \u003cstrong\u003eD\u003c/strong\u003e. Rendering images (made in AGAVE) evidencing PIWIL1 recruitment to the MTOC (upper panel) and co-localization with centrosomes (bottom panel).\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4618560/v1/f7d1776c7f4153cda5c58ecd.png"},{"id":60417472,"identity":"1c21924b-5ade-4be8-80a9-5e3b46f0df2f","added_by":"auto","created_at":"2024-07-16 14:07:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":155031,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePIWIL1 silencing leads to aberrant mitosis and G2/M arrest. A. \u003c/strong\u003eRelative \u003cem\u003ePIWIL1\u003c/em\u003e mRNA levels (normalized to actin; left panel) and protein levels, quantified based on fluorescence intensity (right panel), in PIWIL1 KD cells vs cells transfected with a control siRNA. \u003cstrong\u003eB. \u003c/strong\u003eLeft panel: representative images of mitotic Caco-2 cells after PIWIL1 knock down. Tubulin (Red) and DAPI (Blue) are labeled to quantify mitotic abnormalities. Right Panel: Percentage of observed phenotypes. N= 100 cells in mitosis for each condition (PIWIL1 KD vs control siRNA). \u003cstrong\u003eC.\u003c/strong\u003e Cell cycle assays assessed by flow cytometry (PI staining to quantify DNA content). \u003cstrong\u003eD\u003c/strong\u003e. Wound-Healing assay comparing the capacity of PIWL1 KD Caco-2 cells vs control siRNA-transfected cells to close a scratch at t = 24 or t = 48 h. Representative images are shown in the right. N = 3 for each condition.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4618560/v1/e9144f45afab711d6bf24256.png"},{"id":60417469,"identity":"2b533c98-deb0-45c1-abf2-0712fac3116c","added_by":"auto","created_at":"2024-07-16 14:07:01","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":704215,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePIWIL1 expression anti-correlates with the differentiation status of colon epithelial cells. A. \u003c/strong\u003eUpper panel: Immunohistochemistry staining of PIWIL1 in tissue sections from normal colon tissue (left), peritumoral normal colon tissue (center) and colon adenocarcinoma (right). Low levels of Hematoxiline and Eosine were used to stain cells and nucleus.\u003cstrong\u003e \u003c/strong\u003eBottom panel: Immunofluorescence of PIWIL1 (green) in the stem cell-containing basal region of normal colon crypts (top) and colon adenocarcinoma-derived tissue (bottom). Composites images for PIWIL1 (green), DAPI (blue) and tubulin (red) are shown. White dashed lines demarcate the limits of the intestinal crypts. \u003cstrong\u003eB. \u003c/strong\u003eImmunofluorescence of PIWIL1 in Caco-2 cells submitted to differentiation in transwell assays. PIWIL1 is absent when we observed polarized, differentiated enterocytes, characterized by centrin-2 labelling of apical centrosomes. \u003cstrong\u003eC\u003c/strong\u003e. Analysis of RNA-seq data from GEO: GSE69626, showing \u003cem\u003ePIWIL2\u003c/em\u003e, \u003cem\u003eFAP\u003c/em\u003e and \u003cem\u003eNANOG\u003c/em\u003e mRNA abundance (expressed as Reads per Kilobase per Million mapped reads; RPKM) in differentiated human fibroblasts and induced pluripotent stem cells (iPSc) obtained from those fibroblasts using different methods.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4618560/v1/84bdae7f542ff477ff491fa9.png"},{"id":66597197,"identity":"2febc28a-687b-4b40-a186-08c22e26acc6","added_by":"auto","created_at":"2024-10-14 16:08:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3319365,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4618560/v1/8766d21d-03e2-4a32-9cb3-69457991be63.pdf"},{"id":60418126,"identity":"6486f681-9146-44e6-842e-8cb26800c2ab","added_by":"auto","created_at":"2024-07-16 14:15:01","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":131369,"visible":true,"origin":"","legend":"","description":"","filename":"SupplFigure1Fullblots.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4618560/v1/c62bded4fb3e1c8c6863b01f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"PIWIL1 is recruited to Centrosomes during Mitosis in Colorectal Cancer Cells and is linked to cell cycle progression","fulltext":[{"header":"Background","content":"\u003cp\u003eColorectal cancer (CRC), one of the leading causes of cancer-related mortality worldwide, has been extensively studied for its intricate underlying molecular bases. Despite this, CRC remains a global health challenge, demanding deeper exploration of the particular molecular pathways driving its progression and the identification of novel therapeutic targets [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Among the myriad pathways implicated in cancer progression, the pathway mediated by PIWI (P-element-induced wimpy testis) proteins, traditionally associated with germline development and maintenance of genome stability, has emerged as a captivating focus of investigation due to its overexpression in various cancers, including CRC [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNotably, PIWIL1, a key component of piRNA-mediated gene expression regulation pathways, has gathered attention for its suspected role as an oncogene since 2002, when it was first reported to be overexpressed in seminoma (a testicular-derived tumor) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Nowadays, overexpression of different PIWI proteins has been frequently observed in a variety of cancers, including gastric cancer, sarcoma, esophageal squamous cell carcinoma, endometrial cancer, colon cancer, cervical cancer, glioma, hepatocellular carcinoma, ovarian cancer, breast cancer, bladder cancer, and renal cell carcinoma [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Nevertheless, the mechanisms underlying PIWI protein overexpression and their impact on the initiation and progression of cancer remain elusive.\u003c/p\u003e \u003cp\u003eReports on the expression of piRNAs in either somatic or neoplastic cells are at times conflicting. In this respect, we have recently reported that a large fraction of the so-called somatic piRNAs, which have been described in nongonadal tissues, derive from non-coding RNAs and do not bear the specific molecular properties of canonical piRNAs [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Additionally, experimental data obtained in CRC cells by two independent groups could not find evidence for the expression of canonical piRNAs linked to PIWIL1 [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. This suggests that PIWI proteins could act independently of piRNAs in these contexts. However, how piRNA-independent molecular mechanisms of PIWI proteins contribute to cancer initiation and progression is not clear yet.\u003c/p\u003e \u003cp\u003eHenceforth, we aimed to shed light on the non-canonical functions of PIWIL1 re-activation in CRC cancer models. Our analysis first showed an overexpression of \u003cem\u003ePIWIL1\u003c/em\u003e in CRC patient\u0026acute;s samples from TGCA database. In addition, subcellular localization of PIWIL1 unveiled its remarkable re-localization during the cell cycle, from a nuclear scattered/dispersed granular distribution in interphase, to a microtubule-organizing center (MTOC)-like localization during mitosis in human cell lines derived from colorectal cancer (Caco-2). Building upon this observation, we delved into the functional consequences of PIWIL1's presence at the centrosome during mitosis. Our data clearly demonstrate that PIWIL1 silencing leads to a distinct cellular phenotype, characterized by cell cycle stalling at G2/M phase and the accumulation of aberrant metaphase events in Caco-2 cells. Remarkably, in normal colon-derived tissue samples, PIWIL1 is observed at the base of colon crypts, a known niche of intestinal stem cells. This is consistent with the PIWI pathway being relevant for the maintenance of stemness and self-renewal in somatic stem cells [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Also supporting a role in stemness maintenance, PIWIL1 expression seems to be downregulated during differentiation of Caco-2 cells to enterocytes. Albeit for a different PIWI protein (PIWIL2), we also observed dedifferentiation-induced expression in a model of induced pluripotent stem cell (iPS) generation, confirming our hypothesis that PIWI proteins are important for human stem cell maintenance.\u003c/p\u003e \u003cp\u003eMechanistically, our findings support an association between PIWIL1 and the mitotic spindle, as previously observed in germ cells [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Taken together, our results highlight the relevance of PIWI proteins in the regulation of the cell cycle in undifferentiated cells, possibly explaining their unexpected but widely documented expression in cancer.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic Resources:\u003c/h2\u003e \u003cp\u003eBioinformatic data mining was performed in CRC cohorts in TCGA, GTEX and TARGET in order to asses PIWIL1 gene expression. We used Xena\u0026rsquo;s Visual Spreadsheet and Chart View to construct Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and B to analyze PIWIL1 upregulation in connection with CRC [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eCell Culture and qRT-PCR.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCaco-2 (HB-37) cells were purchased from the American Type Culture Collection (ATCC) and cultured in DMEM (Gibco) with 10% fetal bovine serum (Gibco) according to the supplier\u0026rsquo;s instructions. Caco-2 cells were synchronized with two pulses of 2mM of Thymidine (Sigma) for 16 hours.\u003c/p\u003e \u003cp\u003eTotal RNA was isolated using TRIzol reagent (Invitrogen). cDNA was obtained by MLV Reverse Transcriptase (Merck) using 1\u0026micro;g of Total RNA and an oligo (dT)\u003csub\u003e18\u003c/sub\u003e primer. The primer sequences for PIWIL1 RT\u0026ndash;qPCR are: ATGGCGTACAGACACGAGGC (Forward) and AGTGACAGATTTGGCTCTCTG (reverse).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence and Confocal Microscopy\u003c/h2\u003e \u003cp\u003eCaco-2 cells (1x10\u003csup\u003e6\u003c/sup\u003e) were plated onto microscope slides in a 24-well plate. After the desired time, cells were fixed using 4% paraformaldehyde for 15 min at RT and permeabilized with PBS-tween 0.2% for 3 minutes. Then, cells were incubated with blocking buffer (5% BSA in PBS) for 1 hour at 37\u0026deg;C. The cells were washed three times with PBS and incubated with primary antibody diluted in blocking buffer overnight in a humid chamber. Fluorophore-conjugated secondary antibodies were incubated, after 3 washes with PBS, on the slides 1 hour. DNA staining was performed with 300 \u0026micro;M DAPI (Sigma) for 5 minutes at room temperature in the dark. After washing with PBS, coverslips were mounted using Prolong Gold Antifade Reagent (Thermo Fisher Scientific). Cells were photographed with a Zeiss confocal microscope LSM 880 and analyzed using Fiji-ImageJ software. Rendering of images obtained by confocal Z Stacks was performed in AGAVE path-trace viewer (Allen Institut for Cell Science).\u003c/p\u003e \u003cp\u003ePrimary antibodies used in this study were: anti-PIWIL1 HPA018798 (Sigma-Prestige) and HPA018798 (Abcam). Anti β\u0026minus;tubulin sc-55529 (Santa Cruz tech). γ\u0026minus;Tubulin (SIGMA T6557). Centrin-2 (Merck, clone 20H5).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePIWIL1 knock down assays and cell cycle flow cytometry.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCaco-2 cells were transfected with siRNA (10nM) to PIWIL1 (Trifecta Kit; IDT), using Lipofectamine 3000 (Invitrogen) according to manufacturer\u0026rsquo;s instructions. The mRNA expression levels of PIWIL1 and Actin were examined by semiquantitative RT-PCR from total RNA using TriZol Reagent (Sigma) 72 h after siRNA transfection.\u003c/p\u003e \u003cp\u003eCell cycle progression of Caco-2 cells was measure 72 h after siRNA PIWIL1 \u003cem\u003evs\u003c/em\u003e irrelevant scrambled siRNA transfection by flow cytometry with Propidium Iodide (PI) Staining. Briefly, 1\u0026nbsp;million Caco-2 cells were fixed with cold 70% ethanol for 30 min, washed twice in PBS, and treated with Ribonuclease I (100\u0026micro;g/mL Sigma). After RNase treatment, cells were stained with 50\u0026micro;g/mL PI (Invitrogen), and analyzed using an AttuneTM NxT instrument and the FlowJo software. Approximately 10,000 cells per condition were selected after the gating strategy. The first gate was placed on FSC vs SSC. The second gate was placed on PE vs SSC-A and displayed as an histogram using PE intensity. Percentage of cells in each cell cycle phase was calculated using markers set within the analysis program.\u003c/p\u003e \u003cp\u003e \u003cb\u003eWound Healing Assays.\u003c/b\u003e \u003c/p\u003e \u003cp\u003e1x10\u003csup\u003e4\u003c/sup\u003e Caco-2 and PIWIL1 knockdown Caco-2 cells were grown in 24-well plates. After the cells have become confluent we performed a cell-free gap in the monolayer by mechanical scratching (scratch wound) with a white sterile pipet tip. optical microscopy can be used to observe cells migrating into the wound area. Imaging Data was acquired every 24 hours using phase-contrast imaging of the wound area in the field-of-view using 10X objective lens. % of wound closure (Area) was measure by the wound healing tool by Volker Baecker for ImageJ.\u003c/p\u003e \u003cp\u003e \u003cb\u003eColon-derived Tissue Arrays Immunohistochemistry.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eColon carcinoma tissue array with matched adjacent normal colon tissue as control, including TNM, clinical stage and pathology grade, was acquired from Tissuearray.com (CO243b). Before immunohistochemistry, antigen retrieval was performed baking slides for at least 60 minutes at 60\u0026deg;C before de-paraffinization using xylene. De-paraffinized slides were treated as described for the immunofluorescence protocol.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCaco-2 differentiation using Transwell Experiments.\u003c/b\u003e \u003c/p\u003e \u003cp\u003e1.0x10\u003csup\u003e5\u003c/sup\u003e Caco-2 cells were seeded on HTS-24 Transwell-Plates containing a 0.4 \u0026micro;m membrane (Costar; Corning Inc). Experiments were performed in triplicates. Plates were incubated at 37\u0026deg;C overnight and the medium of the upper chamber was replaced by new DMEM-PEST to remove non-adherent cells and reduce the risk of multilayer formation. The culture medium was refreshed every second day in both compartments for a total of 21 days. Polarized monolayer cells were checked by actin labelling and the formation of vertical filaments. Membrane filters were disassembled and proceed as detailed in the immunofluorescence protocol.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003ePIWIL1 is Upregulated in primary tumor-derived samples from Colorectal Cancer Patients Compared to Healthy Individuals.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eData mining was performed to determine the expression of the four PIWI proteins codified by the human genome, in samples-derived from patients with CRC. \u003cem\u003ePIWIL1\u003c/em\u003e, \u003cem\u003ePIWIL2\u003c/em\u003e, \u003cem\u003ePIWIL3\u003c/em\u003e and \u003cem\u003ePIWIL4\u003c/em\u003e RNA-seq data from colon primary tumor and normal cohorts-derived samples were analyzed using the UCSC Xena Browser (Goldman et al., 2020), integrating data from TCGA, TARGET and GTEX databases. RNA-seq data from 596 samples were ranked according to \u003cem\u003ePIWI\u003c/em\u003e gene expression levels, revealing a positive correlation between \u003cem\u003ePIWIL1\u003c/em\u003e and tumor status (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-C).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePIWIL1 is localized in the nucleus in colon cancer cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCell lines derived from human colon carcinoma and the beningn colon epithelial cell line (CCDCoN) were assessed for PIWIL1 expression at transcript and protein level. All cell lines expressed variable levels of PIWIL1 transcripts, measured by RT-PCR, and protein levels assesed by immunoprecipitation followed by Western blot (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, respectively). Indirect immunofluorescence (IF) to determine PIWIL1 subcellular localization showed a predominant nuclear localization in Caco-2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) and other CRC cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), with the signal presenting a patterned distribution in the nucleoplasm and a remarkable association with the nuclear lamina during interphase.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eDrosphila\u003c/em\u003e Piwi shuttles to the nucleous thanks to a N-terminal nuclear localization signal (NLS) that is exposed upon piRNA binding [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Interestingly, we identified a predicted NLS in the exon 2 of PIWIL1 (aa 4 to 14), comprising a stretch of basic residues (arginine and alanine). To determine its functionality as a \u003cem\u003ebona fide\u003c/em\u003e NLS in Caco-2 cells, we fused this sequence motif to mRuby2. Consistent with the observed predominantly nuclear expression of PIWIL1 in these cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), NLS-tagged mRuby2 was mostly expressed in the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePIWIL1 localizes to the centrosome in Caco-2 cells during mitosis.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWhile PIWIL1 was mostly localized in the nucleoplasm or in the nuclear lamina in interphasic cells, we consistently observed its expression in the centrosome of mitotic cells (see, for example, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). With the purpose of better elucidating the subcellular distribution of PIWIL1 during the cell cycle, we synchronized Caco-2 cells and confirmed PIWIL1 is dynamically redistributed during mitosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Confirming previous observations, synchronized Caco-2 cells co-stained for beta tubulin showed PIWIL1 relocalization to the MTOC during mitosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCo-localization assays of PIWIL1 and gamma tubulin, a known centrosomal marker, confirmed PIWIL1 as an integral component of the MTOC or the centrosome (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). 3D Rendering of composite images are depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, where PIWIL1 and gamma tubulin appear to be arranged in a manner reminiscent of two interlocking rings, fitting together seamlessly.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePIWIL1 silencing causes G2/M arrest and aberrant mitosis.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo understand the functional implications of PIWIL1 localization to centrosomes in dividing CRC cells, we performed siRNA-mediated PIWIL1 knock down (KD). Levels of PIWIL1 protein and mRNA decreased by 70% as assessed by fluorescence microscopy and RT-qPCR, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Surprisingly, KD cells showed a significantly higher frequency of mitotic defects (vs control siRNA-transfected cells), comprising multiple centromeres, anormal mitotic spindles or misaligned metaphasic chromosomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). This was followed by cell cycle arrest at G2/M, as measured by flow cytometry using propidium iodide DNA staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). These cell division defects were consistent with KD cells having a lower proliferation rate and / or migratory capacity, as measured by wound healing assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). In sum, despite Caco-2 cells are transformed and polyploid, they seem to rely on PIWIL1 to regulate mitotic fidelity, potentially avoiding mitotic catastrophe.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePIWIL1 expression is restricted to stem cell niches in normal human colon tissue and is lost upon differentiation\u003c/b\u003e \u003c/p\u003e \u003cp\u003eNext, we asked whether PIWIL1 expression in CRC patients and CRC cell lines is due to an aberrant expression of this otherwise germline-specific protein, or whether PIWIL1 is expressed in a subset of human colon cells under physiological conditions. Surprisingly, immunohistochemistry and immunofluorescence microscopy of normal human colon tissue showed PIWIL1 staining restricted to cells at the bottom of each intestinal crypt, where stem cells are known to be located [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In contrast, colon cancer tissue showed pervasive PIWIL1 staining, with virtually all cells staining positive. However, unlike CRC cell lines, the signal was predominantly cytoplasmic in both healthy and cancer tissues.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIntestinal crypts, which form the base of the villi, are the basic structural and functional units of intestinal epithelium. At the bottom of each crypt, a small number of about eight stem cells [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] are constantly dividing to give place to transit-amplifying progenitor cells. These progenitor cells divide as they migrate upwards and differentiate into two distinct lineages: enterocytes (absorptive cells) and secretory cells.\u003c/p\u003e \u003cp\u003eHaving observed that, in normal colon tissue, PIWIL1 expression is restricted to the stem cell population residing at the base of intestinal crypts, we asked whether PIWIL1 expression is downregulated during progenitor cell differentiation into enterocytes. To study this, we followed a well-stablished protocol [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] where Caco-2 cells are differentiated to enterocytes by means of a transwell assay. Surprisingly, unlike 2D cultures of undifferentiated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), we were not able to find PIWIL1 expression when Caco-2 cells were differentiated to enterocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). To validate the differentiation protocol, we analyzed the subcellular localization of centrin-2, a structural component of the centrosome, that migrates to the apical level of the cells upon differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Thus, loss of PIWIL1 during Caco-2 differentiation resembles the situation in normal colon epithelia, where only undifferentiated cells residing at the base of intestinal crypts express this protein to detectable levels.\u003c/p\u003e \u003cp\u003eTo study whether PIWI proteins are required for the maintenance of stemness and self-renewal in non-transformed cells, we analyzed RNA-seq data from GEO: GSE69626. In this study, human fibroblasts were de-differentiated into induced pluripotent stem cells (iPSCs) using six different reprogramming methods [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Surprisingly, while \u003cem\u003ePIWIL1\u003c/em\u003e was not involved in this process, \u003cem\u003ePIWIL2\u003c/em\u003e expression was induced in all reprogrammed cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Differentiated fibroblasts expressed \u003cem\u003eFAP\u003c/em\u003e but lacked \u003cem\u003ePIWIL2\u003c/em\u003e and the stem cell marker \u003cem\u003eNANOG.\u003c/em\u003e Conversely, de-differentiated cells expressed \u003cem\u003ePIWIL2\u003c/em\u003e and \u003cem\u003eNANOG\u003c/em\u003e, while silencing FAP.\u003c/p\u003e \u003cp\u003eAlbeit involving a different PIWI protein to the one studied herein, results above strengthen the link between PIWI protein expression and stem cell biology. This agrees with PIWIL1 expression in stem cells from healthy colon tissue. In addition, these results potentially explain PIWIL1 overexpression in CRC based on the potential stem cell origin of colorectal cancer [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSeveral breakthroughs in the understanding of the PIWI pathway beyond its traditional involvement in transposon signaling in the gonads have been made in the past decade [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. However, a complete understanding of extragonadal PIWI protein function, particularly in cancer, remains incompletely understood. In this regard, reactivation of PIWI expression has been attributed to aberrant DNA methylation, a hallmark of various types of tumors [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Aberrant expression of other genes from the PIWI pathway has been observed in several cancer cell lines, in the absence of a concomitant reactivation of piRNA biogenesis [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur own data-mining analysis of 600 patients\u0026rsquo; samples obtained from TGCA and GTEX showed pervasive PIWIL1 expression in CRC compared to normal colorectal tissue. Our results are therefore in good agreement with previous studies reporting aberrant PIWIL1 expression in CRC patients [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Interestingly, a piRNA-independent function for PIWIL1 in cancer cell proliferation has been previously reported in human pancreatic cancer cell lines, where it functions as an activator of the E3 ubiquitin ligase anaphase promoting complex/cyclosome [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In addition, PIWIL1 overexpression within an adenovirus vector promoted cell proliferation, associated with changes in global DNA methylation levels [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, the molecular mechanisms linking PIWIL1 expression and sustained proliferation have not been thoroughly explored.\u003c/p\u003e \u003cp\u003eIn our study, we observed physical association between PIWIL1 and centrosomes during mitosis in Caco-2 cells and other CRC cell lines. PIWIL1 silencing in these cells induced cell cycle arrest, diminished cell proliferation, and provoked the accumulation of mitotic defects. These observations are in good agreement with earlier studies linking PIWIL1 with the anaphase-promoting complex, a key player in cell cycle control [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. These findings suggest that cell cycle regulation mediated by PIWIL1 might be mediated through interactions with other proteins, regardless of piRNAs. Interestingly, during murine male meiosis, PIWIL1 is involved in the control of meiotic segregation and its deficiency causes chromosome misalignment and mis-segregation, leading to aneuploidy via its contact with transcribed centromeric regions [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Our findings of PIWIL1 recruitment to the centromere/MTOC during mitosis in CRC cells, and its importance for proper chromosome alignment during metaphase, support the idea that at least some of the gonadal functions of PIWIL1 are conserved in somatic tissues. These insights underscore the multifaceted role of PIWIL1 in cell cycle regulation and support previously recognized piRNA-independent functions during cell division.\u003c/p\u003e \u003cp\u003eOur data also agrees with previous work conducted in gastric cancer cells. For instance, Liu \u003cem\u003eet al\u003c/em\u003e. found that PIWIL1 downregulation effectively inhibited proliferation and induced G2/M phase cell cycle arrest [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Additionally, in breast cancer and sarcoma cell lines, PIWIL1 overexpression increases cyclin levels and regulates cyclin-dependent kinase inhibitors p21 and p27 [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In glioblastoma, PIWIL1 knockdown induced significant changes in cell cycle-related genes, confirming the dysregulation of cyclin levels and the increase in cells arrested in G2/M [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe G2/M cell cycle transition slowdown observed as a result of reduced PIWIL1 expression in Caco-2 cells could have several functional implications. One hypothesis is that loss of PIWIL1 leads to a reduced proliferative capacity as a response to increased genomic instability and/or mitotic spindle disruption.\u003c/p\u003e \u003cp\u003eAnother hypothesis highlights the role of PIWI proteins in cancer development and progression by promoting a stem cell-like status that sustains self-renewal and proliferation [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In the context of CRC, the origin of the malignancy is not well understood, but it is likely that the cells that give rise to the tumor are actually intestinal stem cells [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Sousa-Victor P. \u003cem\u003eet al\u003c/em\u003e have identified PIWI as a critical regulator of somatic stem cell function in intestinal stem cells in flies, safeguarding maintenance of stemness [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In humans, others have observed a positive correlation between PIWI pathway genes and cancer stem cell markers in CRC [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePIWIL1 localization within colon stem cell niches in healthy intestinal tissue, and its overexpression in colon cancer cells, might reflect an evolutionary path leading from colon stem cells to colon cancer. In fact, the ability to \u003cem\u003ein vitro\u003c/em\u003e differentiate Caco-2 cells into enterocytes could be considered evidence that these are non-terminally differentiated cells. Consistent with a role restricted to undifferentiated or stem cells, PIWIL1 was lost during Caco-2 differentiation to enterocytes. Taken together, these data suggest that the presence and activity of PIWIL1 at the base of intestinal crypts in normal colon tissue is being reflected in CRC-derived cells, either due to the stem cell origin of the CRC cell lines used herein, or due to functional convergence in the adoption of stem cell-like characteristics and undifferentiated states.\u003c/p\u003e \u003cp\u003eThe expression of PIWIL1 in colon tumor cells seems to be a necessary event for proper cell division. Its absence leads to aberrant mitosis and increases genomic instability, as demonstrated by previous studies and our own findings. Our study thus unveils an opportunity for targeting PIWIL1 as a novel CRC therapeutic strategy, potentially leading to mitotic catastrophe in these cells.\u003c/p\u003e \u003cp\u003eIn conclusion, PIWIL1 might be important for stem cell maintenance in the human intestine. For the same reason it might also be frequently expressed in CRC, where it seems to play a role in mitotic fidelity and/or cell cycle regulation. This protein seems to be silenced during differentiation, while its downregulation induces genomic instability in cancer cells. Therefore, we would like to make a case for exploring PIWIL1 as an attractive therapeutic target in the future.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOur study sheds light on the non-canonical functions of PIWI pathway in CRC cancer models, revealing its overexpression in patient samples and its dynamic relocalization during the cell cycle. We described PIWIL1\u0026apos;s presence at the centrosome during mitosis, with its knockdown leading to G2/M arrest and aberrant mitotic events. Moreover, we observed PIWIL1 expression in the stem cell niche of normal colon tissue, suggesting a potential role in stem cell maintenance. Interestingly, PIWIL1 expression is lost during cell differentiation, indicating its association with undifferentiated states. Our findings underscore the possible complex role of PIWIL1 in CRC progression, highlighting its potential as a therapeutic target for future interventions aimed at inducing mitotic catastrophe in cancer cells and restoring normal stem cell dynamics in the intestine. Overall, our study provides valuable insights into the intricate molecular mechanisms underlying CRC pathogenesis and presents PIWI pathway as a promising avenue for further research and therapeutic development.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors give their consent for publication\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data supporting the findings of this study are available within the paper or under request to corresponding author: MRGS.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors declare Not competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis work was supported by FOCEM (Fondo para la Convergencia Estructural del Mercosur) (COF 03/11), ANII (PEC_3_2019_1_158811) for the AttuneTM NxT equipment and to Comisi\u0026oacute;n Sectorial de Investigaci\u0026oacute;n Cient\u0026iacute;fica (CSIC) Programa Grupos 2022 (\u0026Aacute;rea salud).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eAuthors\u0026apos; contributions.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSM performed experiments related with Figure 2. SD contributed with initial cloning constructs for PIWIL1 tagging. JPT analyzed and interpreted data regarding iPSc de-differentiation assays and contributed in preparing, designing and writing the manuscript. AC was a major contributor in writing and designing the manuscript. MRGS designed, performed and analyzed the major results obtained in the manuscript and write the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAcknowledgements.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors gratefully acknowledge the Advanced Bioimaging Unit and the Cell Biology Unit (Cytometry platform: MSc. Paula C\u0026eacute;spedes) at Institut Pasteur of Montevideo for the support and assistance in the present work.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eS. G. Patel, J. J. Karlitz, T. Yen, C. H. Lieu, y C. R. Boland, \u0026laquo;The rising tide of early-onset colorectal cancer: a comprehensive review of epidemiology, clinical features, biology, risk factors, prevention, and early detection\u0026raquo;, \u003cem\u003eLancet Gastroenterol. Hepatol.\u003c/em\u003e, vol. 7, n.\u003csup\u003eo\u003c/sup\u003e 3, pp. 262-274, mar. 2022, doi: 10.1016/S2468-1253(21)00426-X.\u003c/li\u003e\n\u003cli\u003eX. Wang, L.-T. Gou, y M.-F. Liu, \u0026laquo;Noncanonical functions of PIWIL1/piRNAs in animal male germ cells and human diseases\u0026raquo;, \u003cem\u003eBiol. Reprod.\u003c/em\u003e, vol. 107, n.\u003csup\u003eo\u003c/sup\u003e 1, pp. 101-108, jul. 2022, doi: 10.1093/biolre/ioac073.\u003c/li\u003e\n\u003cli\u003eD. Qiao, A.-M. Zeeman, W. Deng, L. H. J. Looijenga, y H. Lin, \u0026laquo;Molecular characterization of hiwi, a human member of the piwi gene family whose overexpression is correlated to seminomas\u0026raquo;, \u003cem\u003eOncogene\u003c/em\u003e, vol. 21, n.\u003csup\u003eo\u003c/sup\u003e 25, pp. 3988-3999, jun. 2002, doi: 10.1038/sj.onc.1205505.\u003c/li\u003e\n\u003cli\u003eN. Chakravorty, \u0026laquo;Non-coding RNAs: the silent regulators of health and diseases\u0026raquo;, \u003cem\u003eMol. Biol. Rep.\u003c/em\u003e, abr. 2022, doi: 10.1007/s11033-022-07464-4.\u003c/li\u003e\n\u003cli\u003eJ. P. Tosar, C. Rovira, y A. Cayota, \u0026laquo;Non-coding RNA fragments account for the majority of annotated piRNAs expressed in somatic non-gonadal tissues\u0026raquo;, \u003cem\u003eCommun. Biol.\u003c/em\u003e, vol. 1, n.\u003csup\u003eo\u003c/sup\u003e 1, p. 2, dic. 2018, doi: 10.1038/s42003-017-0001-7.\u003c/li\u003e\n\u003cli\u003eJ. P. Tosar, M. R. Garc\u0026iacute;a-Silva, y A. Cayota, \u0026laquo;Circulating SNORD57 rather than piR-54265 is a promising biomarker for colorectal cancer: common pitfalls in the study of somatic piRNAs in cancer\u0026raquo;, \u003cem\u003eRNA\u003c/em\u003e, vol. 27, n.\u003csup\u003eo\u003c/sup\u003e 4, pp. 403-410, abr. 2021, doi: 10.1261/rna.078444.120.\u003c/li\u003e\n\u003cli\u003eP. Genzor, S. C. Cordts, N. V. Bokil, y A. D. Haase, \u0026laquo;Aberrant expression of select piRNA-pathway genes does not reactivate piRNA silencing in cancer cells\u0026raquo;, \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e, vol. 116, n.\u003csup\u003eo\u003c/sup\u003e 23, pp. 11111-11112, jun. 2019, doi: 10.1073/pnas.1904498116.\u003c/li\u003e\n\u003cli\u003eF. Li \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;piRNA-independent function of PIWIL1 as a co-activator for anaphase promoting complex/cyclosome to drive pancreatic cancer metastasis\u0026raquo;, \u003cem\u003eNat. Cell Biol.\u003c/em\u003e, vol. 22, n.\u003csup\u003eo\u003c/sup\u003e 4, pp. 425-438, abr. 2020, doi: 10.1038/s41556-020-0486-z.\u003c/li\u003e\n\u003cli\u003eD. Palakodeti, M. Smielewska, Y.-C. Lu, G. W. Yeo, y B. R. Graveley, \u0026laquo;The PIWI proteins SMEDWI-2 and SMEDWI-3 are required for stem cell function and piRNA expression in planarians\u0026raquo;, \u003cem\u003eRNA\u003c/em\u003e, vol. 14, n.\u003csup\u003eo\u003c/sup\u003e 6, pp. 1174-1186, jun. 2008, doi: 10.1261/rna.1085008.\u003c/li\u003e\n\u003cli\u003eC. E. Juliano \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;PIWI proteins and PIWI-interacting RNAs function in \u003cem\u003eHydra\u003c/em\u003e somatic stem cells\u0026raquo;, \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e, vol. 111, n.\u003csup\u003eo\u003c/sup\u003e 1, pp. 337-342, ene. 2014, doi: 10.1073/pnas.1320965111.\u003c/li\u003e\n\u003cli\u003eR. Galton, K. Fejes-Toth, y M. E. Bronner, \u0026laquo;Co-option of the piRNA pathway to regulate neural crest specification\u0026raquo;, \u003cem\u003eSci. Adv.\u003c/em\u003e, vol. 8, n.\u003csup\u003eo\u003c/sup\u003e 32, p. eabn1441, ago. 2022, doi: 10.1126/sciadv.abn1441.\u003c/li\u003e\n\u003cli\u003eA. J. Rodriguez \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;Seawi\u0026mdash;a sea urchin piwi/argonaute family member is a component of MT-RNP complexes\u0026raquo;, \u003cem\u003eRNA\u003c/em\u003e, vol. 11, n.\u003csup\u003eo\u003c/sup\u003e 5, pp. 646-656, may 2005, doi: 10.1261/rna.7198205.\u003c/li\u003e\n\u003cli\u003eZ. G. Venkei \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;A kinesin Klp10A mediates cell cycle-dependent shuttling of Piwi between nucleus and nuage\u0026raquo;, \u003cem\u003ePLOS Genet.\u003c/em\u003e, vol. 16, n.\u003csup\u003eo\u003c/sup\u003e 3, p. e1008648, mar. 2020, doi: 10.1371/journal.pgen.1008648.\u003c/li\u003e\n\u003cli\u003eM. J. Goldman \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;Visualizing and interpreting cancer genomics data via the Xena platform\u0026raquo;, \u003cem\u003eNat. Biotechnol.\u003c/em\u003e, vol. 38, n.\u003csup\u003eo\u003c/sup\u003e 6, pp. 675-678, jun. 2020, doi: 10.1038/s41587-020-0546-8.\u003c/li\u003e\n\u003cli\u003eR. Yashiro \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;Piwi Nuclear Localization and Its Regulatory Mechanism in Drosophila Ovarian Somatic Cells\u0026raquo;, \u003cem\u003eCell Rep.\u003c/em\u003e, vol. 23, n.\u003csup\u003eo\u003c/sup\u003e 12, pp. 3647-3657, jun. 2018, doi: 10.1016/j.celrep.2018.05.051.\u003c/li\u003e\n\u003cli\u003eB. T\u0026oacute;th, S. Ben‐Moshe, A. Gavish, N. Barkai, y S. Itzkovitz, \u0026laquo;Early commitment and robust differentiation in colonic crypts\u0026raquo;, \u003cem\u003eMol. Syst. Biol.\u003c/em\u003e, vol. 13, n.\u003csup\u003eo\u003c/sup\u003e 1, p. 902, ene. 2017, doi: 10.15252/msb.20167283.\u003c/li\u003e\n\u003cli\u003eI. Hubatsch, E. G. E. Ragnarsson, y P. Artursson, \u0026laquo;Determination of drug permeability and prediction of drug absorption in Caco-2 monolayers\u0026raquo;, \u003cem\u003eNat. Protoc.\u003c/em\u003e, vol. 2, n.\u003csup\u003eo\u003c/sup\u003e 9, pp. 2111-2119, sep. 2007, doi: 10.1038/nprot.2007.303.\u003c/li\u003e\n\u003cli\u003eJ. M. Churko \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;Transcriptomic and epigenomic differences in human induced pluripotent stem cells generated from six reprogramming methods\u0026raquo;, \u003cem\u003eNat. Biomed. Eng.\u003c/em\u003e, vol. 1, n.\u003csup\u003eo\u003c/sup\u003e 10, pp. 826-837, oct. 2017, doi: 10.1038/s41551-017-0141-6.\u003c/li\u003e\n\u003cli\u003eD. J. Huels y O. J. Sansom, \u0026laquo;Stem vs non-stem cell origin of colorectal cancer\u0026raquo;, \u003cem\u003eBr. J. Cancer\u003c/em\u003e, vol. 113, n.\u003csup\u003eo\u003c/sup\u003e 1, pp. 1-5, jun. 2015, doi: 10.1038/bjc.2015.214.\u003c/li\u003e\n\u003cli\u003eR. J. Ross, M. M. Weiner, y H. Lin, \u0026laquo;PIWI proteins and PIWI-interacting RNAs in the soma\u0026raquo;, \u003cem\u003eNature\u003c/em\u003e, vol. 505, n.\u003csup\u003eo\u003c/sup\u003e 7483, pp. 353-359, ene. 2014, doi: 10.1038/nature12987.\u003c/li\u003e\n\u003cli\u003eP. Dai \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;A Translation-Activating Function of MIWI/piRNA during Mouse Spermiogenesis\u0026raquo;, \u003cem\u003eCell\u003c/em\u003e, vol. 179, n.\u003csup\u003eo\u003c/sup\u003e 7, pp. 1566-1581.e16, dic. 2019, doi: 10.1016/j.cell.2019.11.022.\u003c/li\u003e\n\u003cli\u003eA. Ramat \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;The PIWI protein Aubergine recruits eIF3 to activate translation in the germ plasm\u0026raquo;, \u003cem\u003eCell Res.\u003c/em\u003e, vol. 30, n.\u003csup\u003eo\u003c/sup\u003e 5, pp. 421-435, may 2020, doi: 10.1038/s41422-020-0294-9.\u003c/li\u003e\n\u003cli\u003eM. Litwin, A. Szczepańska-Buda, A. Piotrowska, P. Dzięgiel, y W. Witkiewicz, \u0026laquo;The meaning of PIWI proteins in cancer development\u0026raquo;, \u003cem\u003eOncol. Lett.\u003c/em\u003e, vol. 13, n.\u003csup\u003eo\u003c/sup\u003e 5, pp. 3354-3362, may 2017, doi: 10.3892/ol.2017.5932.\u003c/li\u003e\n\u003cli\u003eC. Liu \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;Combined Phenotype of 4 Markers Improves Prognostic Value of Patients With Colon Cancer\u0026raquo;, \u003cem\u003eAm. J. Med. Sci.\u003c/em\u003e, vol. 343, n.\u003csup\u003eo\u003c/sup\u003e 4, pp. 295-302, abr. 2012, doi: 10.1097/MAJ.0b013e31822cb4cd.\u003c/li\u003e\n\u003cli\u003eR. Sun, C. Gao, D. Li, B. Li, y Y. Ding, \u0026laquo;Expression Status of PIWIL1 as a Prognostic Marker of Colorectal Cancer\u0026raquo;, \u003cem\u003eDis. Markers\u003c/em\u003e, vol. 2017, pp. 1-7, 2017, doi: 10.1155/2017/1204937.\u003c/li\u003e\n\u003cli\u003eR. Raeisossadati, M. R. Abbaszadegan, M. Moghbeli, A. Tavassoli, A. H. Kihara, y M. M. Forghanifard, \u0026laquo;Aberrant expression of DPPA2 and HIWI genes in colorectal cancer and their impacts on poor prognosis\u0026raquo;, \u003cem\u003eTumor Biol.\u003c/em\u003e, vol. 35, n.\u003csup\u003eo\u003c/sup\u003e 6, pp. 5299-5305, jun. 2014, doi: 10.1007/s13277-014-1690-x.\u003c/li\u003e\n\u003cli\u003eL. Yang \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;Hiwi Promotes the Proliferation of Colorectal Cancer Cells via Upregulating Global DNA Methylation\u0026raquo;, \u003cem\u003eDis. Markers\u003c/em\u003e, vol. 2015, pp. 1-10, 2015, doi: 10.1155/2015/383056.\u003c/li\u003e\n\u003cli\u003eC. Hsieh, J. Xia, y H. Lin, \u0026laquo;MIWI prevents aneuploidy during meiosis by cleaving excess satellite RNA\u0026raquo;, \u003cem\u003eEMBO J.\u003c/em\u003e, vol. 39, n.\u003csup\u003eo\u003c/sup\u003e 16, p. e103614, ago. 2020, doi: 10.15252/embj.2019103614.\u003c/li\u003e\n\u003cli\u003eX. Liu \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;Expression of \u003cem\u003ehiwi\u003c/em\u003e gene in human gastric cancer was associated with proliferation of cancer cells\u0026raquo;, \u003cem\u003eInt. J. Cancer\u003c/em\u003e, vol. 118, n.\u003csup\u003eo\u003c/sup\u003e 8, pp. 1922-1929, abr. 2006, doi: 10.1002/ijc.21575.\u003c/li\u003e\n\u003cli\u003eS. Siddiqi, M. Terry, y I. Matushansky, \u0026laquo;Hiwi Mediated Tumorigenesis Is Associated with DNA Hypermethylation\u0026raquo;, \u003cem\u003ePLoS ONE\u003c/em\u003e, vol. 7, n.\u003csup\u003eo\u003c/sup\u003e 3, p. e33711, mar. 2012, doi: 10.1371/journal.pone.0033711.\u003c/li\u003e\n\u003cli\u003eJ. Cao, G. Xu, J. Lan, Q. Huang, Z. Tang, y L. Tian, \u0026laquo;High expression of piwi-like RNA-mediated gene silencing 1 is associated with poor prognosis via regulating transforming growth factor-\u0026beta; receptors and cyclin-dependent kinases in breast cancer\u0026raquo;, \u003cem\u003eMol. Med. Rep.\u003c/em\u003e, vol. 13, n.\u003csup\u003eo\u003c/sup\u003e 3, pp. 2829-2835, mar. 2016, doi: 10.3892/mmr.2016.4842.\u003c/li\u003e\n\u003cli\u003eH. Huang \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;Piwil1 Regulates Glioma Stem Cell Maintenance and Glioblastoma Progression\u0026raquo;, \u003cem\u003eCell Rep.\u003c/em\u003e, vol. 34, n.\u003csup\u003eo\u003c/sup\u003e 1, p. 108522, ene. 2021, doi: 10.1016/j.celrep.2020.108522.\u003c/li\u003e\n\u003cli\u003eP. Sousa-Victor \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;Piwi Is Required to Limit Exhaustion of Aging Somatic Stem Cells\u0026raquo;, \u003cem\u003eCell Rep.\u003c/em\u003e, vol. 20, n.\u003csup\u003eo\u003c/sup\u003e 11, pp. 2527-2537, sep. 2017, doi: 10.1016/j.celrep.2017.08.059.\u003c/li\u003e\n\u003cli\u003eM. Litwin \u003cem\u003eet al.\u003c/em\u003e, \u0026laquo;Correlation of HIWI and HILI Expression with Cancer Stem Cell Markers in Colorectal Cancer\u0026raquo;, \u003cem\u003eAnticancer Res.\u003c/em\u003e, vol. 35, n.\u003csup\u003eo\u003c/sup\u003e 6, pp. 3317-3324, jun. 2015.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"PIWI, Colorectal Cancer, Cell cycle","lastPublishedDoi":"10.21203/rs.3.rs-4618560/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4618560/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003eBackground\u003c/b\u003e\u003c/p\u003e \u003cp\u003ePIWI proteins, traditionally associated with germline development, have recently gained attention for their expression in various cancers, including colorectal cancer. However, the molecular mechanisms underlying their reactivation and impact on cancer initiation and progression remain elusive.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eHere, we found that PIWIL1 is expressed at relatively high levels in CRC-derived samples and cell lines, where it undergoes a dynamic re-localization to the centrosome during mitosis. Knockdown of PIWIL1 induces G2/M arrest associated to disruption of mitotic spindle and aberrant metaphase events, highlighting its role in cell cycle progression. We have also found that expression of PIWIL1 is lost during differentiation of Caco-2 cells into enterocytes and that PIWIL1 is expressed in cells at the base of intestinal crypts in normal human colon tissue, where intestinal stem cells are known to reside. Thus, it is possible that the presence of PIWIL1 in cancer cells reflects a physiological role of this protein in stem cell maintenance, what would argue in favor of the proposed stem cell origin of CRC. Supporting this view, dedifferentiation of human fibroblasts into induced pluripotent stem cells (iPSc) implies reactivation of PIWIL2 expression, another member of the PIWI protein family.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusions\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOverall, our findings suggest a role of PIWIL1 in mediating cell cycle dynamics, both in colorectal cancer cells and possibly also in intestinal stem cells. In a broader aspect, we provide support for an involvement of PIWI proteins in somatic stem cell maintenance, expanding non-gonadal functions for this protein family.\u003c/p\u003e","manuscriptTitle":"PIWIL1 is recruited to Centrosomes during Mitosis in Colorectal Cancer Cells and is linked to cell cycle progression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-16 14:06:56","doi":"10.21203/rs.3.rs-4618560/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-02T06:04:12+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-31T01:28:59+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-12T21:50:23+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"128955190136855891570584064057904206134","date":"2024-07-07T20:38:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"247805785289600849956955329599903256651","date":"2024-07-03T18:02:21+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-01T09:39:09+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-29T13:03:45+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-06-25T15:04:26+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-24T12:15:53+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-06-21T16:42:09+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1d471d7b-346b-433b-98d0-e5056eebc8db","owner":[],"postedDate":"July 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-10-14T16:02:26+00:00","versionOfRecord":{"articleIdentity":"rs-4618560","link":"https://doi.org/10.1038/s41598-024-75098-6","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-10-13 15:57:49","publishedOnDateReadable":"October 13th, 2024"},"versionCreatedAt":"2024-07-16 14:06:56","video":"","vorDoi":"10.1038/s41598-024-75098-6","vorDoiUrl":"https://doi.org/10.1038/s41598-024-75098-6","workflowStages":[]},"version":"v1","identity":"rs-4618560","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4618560","identity":"rs-4618560","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}