Enhanced molecular diagnosis of Onchocerca lupi using droplet digital PCR in clinically suspected companion animals

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background Onchocerca lupi , a zoonotic filarial nematode documented in southwestern North America and the Old World, is associated with ocular onchocerciosis in dogs and cats. Clinical signs range from ocular discharge and conjunctivitis to chronic nodular lesions involving the conjunctiva, sclera, and retrobulbar space. Many infections remain subclinical and undiagnosed. Current diagnostic approaches rely on microscopy and conventional PCR (cPCR) to confirm adult worms in nodules or microfilariae in skin snips. Real-time PCR (qPCR) has been applied primarily in large-scale epidemiological studies. However, amplification of O. lupi DNA may be inhibited, leading to false-negative results. Highly sensitive techniques such as droplet digital PCR (ddPCR) can enable the detection of parasite DNA in various biological samples through absolute quantification. The objectives of this study were to: I) validate a novel ddPCR assay that detects O. lupi , and II) assess the performance of the ddPCR assay compared to cPCR and qPCR in suspected clinical cases. Methods Following assay validation and optimization, 202 suspected clinical cases from 11 US states were assessed. Of these clinical cases, 97% (n = 196/202) were dogs, and 3% (n = 6/202) were cats. Samples included adult specimen O. lupi fragments (n = 34/202), subconjunctival nodule biopsies (n = 103/202), interscapular skin snips (n = 23/202), lower ear skin snips (n = 3/202), and formalin-fixed paraffin-embedded (FFPE) tissue samples (n = 39/202), all previously assessed using cPCR and qPCR. Statistical analysis was performed to assess agreement using Cohen’s kappa (κ), and Cochran’s Q test was used to compare the pattern of positive/negative results of the three diagnostic techniques. Results Overall, the ddPCR detected 71.3% (n = 144/202) of clinical cases as positive for O. lupi , including 71.9% of dog samples (n = 141/196), outperforming qPCR (64.8%; n = 127/196) and cPCR (54.1%; n = 106/196). Additionally, we confirmed O. lupi infection in 50% (n = 3/6) of the cat samples across all three diagnostic tests. Statistical analysis showed moderate agreement between cPCR + qPCR (κ = 0.74), fair agreement between cPCR + ddPCR (κ = 0.60), and almost perfect agreement between qPCR + ddPCR (κ = 0.81). This study represents the largest series of suspected O. lupi clinical cases in companion animals in the US to date, with positive detections reported in 10 of 11 sampled states, although travel history was not always available. Conclusion The validated, host-agnostic ddPCR assay demonstrated superior sensitivity across multiple sample types and provides a robust tool for clinical diagnosis and large-scale surveillance studies, supporting improved epidemiological understanding and One Health-based prevention strategies.
Full text 207,368 characters · extracted from preprint-html · click to expand
Enhanced molecular diagnosis of Onchocerca lupi using droplet digital PCR in clinically suspected companion animals | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Enhanced molecular diagnosis of Onchocerca lupi using droplet digital PCR in clinically suspected companion animals Maureen A. Kelly, Nancy Johnstone McLean, Stacy Peterson, Sylvia Ferguson, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9407830/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Background Onchocerca lupi , a zoonotic filarial nematode documented in southwestern North America and the Old World, is associated with ocular onchocerciosis in dogs and cats. Clinical signs range from ocular discharge and conjunctivitis to chronic nodular lesions involving the conjunctiva, sclera, and retrobulbar space. Many infections remain subclinical and undiagnosed. Current diagnostic approaches rely on microscopy and conventional PCR (cPCR) to confirm adult worms in nodules or microfilariae in skin snips. Real-time PCR (qPCR) has been applied primarily in large-scale epidemiological studies. However, amplification of O. lupi DNA may be inhibited, leading to false-negative results. Highly sensitive techniques such as droplet digital PCR (ddPCR) can enable the detection of parasite DNA in various biological samples through absolute quantification. The objectives of this study were to: I) validate a novel ddPCR assay that detects O. lupi , and II) assess the performance of the ddPCR assay compared to cPCR and qPCR in suspected clinical cases. Methods Following assay validation and optimization, 202 suspected clinical cases from 11 US states were assessed. Of these clinical cases, 97% (n = 196/202) were dogs, and 3% (n = 6/202) were cats. Samples included adult specimen O. lupi fragments (n = 34/202), subconjunctival nodule biopsies (n = 103/202), interscapular skin snips (n = 23/202), lower ear skin snips (n = 3/202), and formalin-fixed paraffin-embedded (FFPE) tissue samples (n = 39/202), all previously assessed using cPCR and qPCR. Statistical analysis was performed to assess agreement using Cohen’s kappa (κ), and Cochran’s Q test was used to compare the pattern of positive/negative results of the three diagnostic techniques. Results Overall, the ddPCR detected 71.3% (n = 144/202) of clinical cases as positive for O. lupi , including 71.9% of dog samples (n = 141/196), outperforming qPCR (64.8%; n = 127/196) and cPCR (54.1%; n = 106/196). Additionally, we confirmed O. lupi infection in 50% (n = 3/6) of the cat samples across all three diagnostic tests. Statistical analysis showed moderate agreement between cPCR + qPCR (κ = 0.74), fair agreement between cPCR + ddPCR (κ = 0.60), and almost perfect agreement between qPCR + ddPCR (κ = 0.81). This study represents the largest series of suspected O. lupi clinical cases in companion animals in the US to date, with positive detections reported in 10 of 11 sampled states, although travel history was not always available. Conclusion The validated, host-agnostic ddPCR assay demonstrated superior sensitivity across multiple sample types and provides a robust tool for clinical diagnosis and large-scale surveillance studies, supporting improved epidemiological understanding and One Health-based prevention strategies. Cutaneous filarial nematode companion animals droplet digital PCR molecular diagnostics ocular onchocercosis zoonotic onchocerciasis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Onchocerca lupi (Filarioidea, Onchocercidae) is an emerging zoonotic filarioid nematode that is the causative agent of ocular onchocerciosis in companion animals [ 1 – 3 ]. Originally described from a grey wolf, O. lupi has been documented in the Old World, specifically Africa, Asia, Europe, as well as North America [ 4 – 10 ]. Several knowledge gaps exist for this filarial nematode across biological factors, such as the pre-patent period and vectorial competence, as well as epidemiological factors, including baseline prevalence in endemic areas, particularly in the southwestern United States (US), and the establishment of local transmission in non-endemic areas due to the translocation of animals. Although several case series and epidemiological studies have documented the low prevalence of O. lupi in the US, further research is needed to understand this zoonotic filarial nematode better [ 11 – 16 ]. For this cutaneous dwelling filarial nematode, canids are considered the definitive hosts, with dogs ( Canis lupus familiaris ) the most frequently reported, followed by coyotes ( Canis latrans ), and wolves ( Canis lupus ) reported the least [ 11 – 13 , 16 – 26 ]. The most extensive case series in the US on canine O. lupi to date comprised 16 clinical cases and summarized diagnostics and treatment strategies [ 11 ]. In addition, a few epidemiological surveillance studies have been conducted in various southwestern US states, including New Mexico, Arizona, and Utah, to estimate baseline prevalence [ 14 – 16 ]. Feline infections are rare, with only four confirmed cases worldwide, including two in the US, one in Portugal, and one in Romania [ 20 , 27 , 28 ]. Zoonotic infections have also been documented, with nine human cases confirmed in the US to date, with the majority originating from southwestern states [ 29 – 36 ]. Until recently, the intermediate host of O. lupi was unknown [ 5 , 37 ]. Emerging molecular evidence indicates that both black flies ( Simulium tribulatum ) and biting midges (Ceratopogonidae sp.) may serve as competent intermediate hosts. Onchocerca lupi DNA has been detected in pools of black flies collected in southern California [ 38 ] and in the heads of biting midges from the Navajo Reservation in the southwestern US [ 15 ], supporting their potential role in parasite transmission. Clinically, ocular O. lupi infection in companion animals can present in one or both eyes, ranging from acute manifestations such as conjunctivitis and ocular discharge to chronic stages characterized by nodular development in various parts of the eye, with the potential for enucleation [ 11 ]. However, many cases go undiagnosed due to the subclinical nature of the infections or nonspecific clinical signs. Currently, no standardized or consistently effective treatment protocol for O. lupi has been established. Several case series indicate that a combination of surgical excision and drug therapy (i.e., ivermectin, doxycycline, prednisone) may be effective, as observed in other filarial nematode infections, such as Dirofilaria immitis [ 11 , 35 ]. The most widely used technique for diagnosing O. lupi infections involves a combination of morphological characterization of skin-dwelling microfilariae or adult specimens by microscopy and DNA detection by conventional PCR (cPCR). Skin snip samples are preferably collected from the nose, forehead, and interscapular region [ 11 – 13 , 16 , 17 , 20 , 22 – 24 , 39 , 40 ]. Diagnostic imaging, real-time PCR (qPCR), and indirect ELISA techniques have been recently developed and optimized to detect O. lupi in animals and humans [ 14 , 41 – 47 ]. However, these diagnostic techniques can be invasive, labor-intensive, and prone to PCR inhibition, resulting in false negatives. Droplet digital PCR (ddPCR) is an advanced molecular technique that enables absolute quantification of target DNA without the need for external standards [ 48 , 49 ]. In ddPCR, the reaction mixture containing the DNA sample, primers, probes, and other components is partitioned into thousands of nanoliter-sized droplets, each acting as an independent PCR reaction [ 48 , 49 ]. After amplification, each droplet is analyzed for the presence or absence of the target sequence using a fluorescent signal. By applying Poisson statistics, ddPCR calculates the absolute number of target molecules in the original sample without relying on standard curves [ 48 , 49 ]. The importance of ddPCR lies in its high sensitivity and accuracy, particularly for detecting low-abundance targets that may be missed by cPCR or qPCR. It is less affected by PCR inhibitors, making it ideal for challenging samples such as host tissues or formalin-fixed specimens [ 48 , 49 ]. Droplet digital PCR has been increasingly utilized in clinical diagnostics, epidemiological surveillance, and research for pathogen detection, mutation analysis, and monitoring treatment efficacy [ 48 , 49 ]. Therefore, our objective was to validate a ddPCR assay for detecting O. lupi across various sample types, including adult O. lupi fragments, subconjunctival nodule biopsies, skin snips, and formalin-fixed paraffin-embedded (FFPE) tissues of both dogs and cats. Then, the performance of this novel assay was compared to cPCR and qPCR to assess the prevalence in suspected clinical cases. Methods Suspected clinical cases Specimens from suspected clinical cases of O. lupi from both dogs (n = 196) and cats (n = 6) were submitted by veterinary ophthalmologists and pathologists from 11 states within the US, between 2018 and 2025, to the Texas A&M University Parasitology Diagnostic Lab (Fig. 1 ). All samples collected complied with the animal use protocol approved by Texas A&M University’s (TAMU) Institutional Animal Care and Use Committee (IACUC number: 2022 − 0261). Depending on the sample preservative (i.e., 70% ethanol vs. FFPE), different extraction methods were used. Detailed demographic data were collected for most cases; some information was missing for a proportion. Whenever possible and/or requested, these results were shared with the veterinarian responsible for the case. Sample preparation After collecting fresh tissue samples, veterinarians were advised to ship each sample in 70% ethanol for preservation. The samples included subconjunctival nodule biopsies, skin snips from the interscapular region, ear snips, and adult specimen fragments visible during collection. Following arrival, samples were transferred from a collection tube to a 1.5 mL microcentrifuge tube to evaporate ethanol using an Eppendorf Vacufuge (Eppendorf Vacufuge® Plus, Eppendorf, Germany), thereby reducing the likelihood of inhibition during genomic extraction. Before genomic extraction, all fresh tissue samples were enzymatically and mechanically disrupted by incubating in a thermomixer (Eppendorf, Germany) overnight at 56°C with a rotation rate of 350 RPM. All FFPE samples received contained at least 1–2 scrolls, each 20 µM thick. Upon arrival, the samples were placed in 1.5 mL microcentrifuge tubes. Genomic DNA was extracted following the protocol described above. When multiple FFPE scrolls from a single animal were received (6 scrolls total), the scrolls were individually processed, with two scrolls used per extraction. Once completed, a compiled sample containing 5 µL from each DNA extraction was used to screen for O. lupi. Genomic DNA was then extracted from all tissue samples using the DNeasy® Blood and Tissue Kit (Qiagen, Valencia, California, USA) according to the manufacturer's instructions. Genomic DNA from all FFPE samples was extracted using the QIAmp DNA FFPE Tissue Kit (QIAGEN, Valencia, CA, USA) according to the manufacturer's instructions. All genomic DNA was then kept frozen at -20°C until molecular testing. Molecular-based diagnostic assays Conventional PCR Conventional PCR was performed using pan-filarial primers targeting the mitochondrial cytochrome oxidase c subunit 1 ( cox1 ), yielding an amplicon of approximately 635 base pairs (bp), as previously described (14, 50) (Table 1 ). Briefly, all reactions were performed in a 25 µL reaction containing 8.75 µL molecular-grade water, 0.625 µL (10 µM) of each primer, 12.5 µL 2x GoTaq® Green Master Mix (Promega Corporation, Madison, WI, USA), and 2.5 µL DNA template. Cycling conditions consisted of 95°C for 2 minutes, followed by 40 cycles at 95°C for 45 seconds, 52°C for 45 seconds, and 72°C for 90 seconds, and a final extension step at 72°C for 5 minutes. All runs included DNA from a positive control and a no-template control. The positive control was DNA extracted from an adult female Setaria equina , and the no-template control consisted of nuclease-free water. Conventional PCR products were subjected to a 1% agarose gel stained with GelRed™ Nucleic Acid Gel Stain (GoldBio, St. Louis, MO, USA). The agarose gel was visualized under UV light to detect amplicons; if detected, the amplified DNA was purified using the Cycle Pure E. Z. N. A. kit (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer’s instructions. Following purification, samples were sent for Sanger sequencing (Eurofins, Louisville, KY, USA). Generated sequences were compared with genetic data available in GenBank using BLAST and aligned for phylogenetic analysis in Molecular Evolutionary Genetics Analysis (MEGA) X [ 51 ]. If sequencing was inconclusive, further analysis using an additional set of primers targeting a shorter cox1 fragment (115 bp) [ 38 ]. With the identical cPCR volume, reaction conditions, and purification protocol described above, the only alteration was to the annealing step at 50°C for 45 seconds for the shorter target region [ 38 ]. Table 1 Primers and probes designed for conventional PCR, real-time PCR, and droplet digital PCR for the detection of Onchocerca lupi DNA targeting the cytochrome c oxidase subunit ( cox1 ) gene region. Name Sequence (5’-3’) Reference Conventional PCR COIintForward GGAGGCGGTCCTGGTAGTAG [ 50 ] COIintReverse TGATTGGTGGTTTTGGTAA [ 50 ] ShortCOIF TCAAAATATGCGTTCTACTGCTGTG [ 38 ] ShortCOIR CAA AGACCCAGCTAA AACAGGAAC [ 38 ] Real-time PCR TaqMan® Probe FAM-CTTAGAGTAGAGGGTCAGCC-MGB-NFQ [ 14 ] O.l.Forward GGAGGCGGTCCTGGTAGTAG [ 14 ] O.l.Reverse GCAAACCCAAAACTATAGTATCC [ 14 ] Droplet Digital PCR Iowa Black Probe FAM-CTTAGAGTA /ZEN/ GAGGGTCAGCC-IABkFQ Current Study O.l.Forward GGAGGCGGTCCTGGTAGTAG Current Study O.l.Reverse GCAAACCCAAAACTATAGTATCC Current Study Probe-based qPCR All sample types were subjected to a recently optimized probe-based qPCR targeting a short region of cox1 , which amplified a 90 bp fragment of O. lupi [ 14 ] (Table 1 ). Briefly, all reactions consisted of 1.5 µL molecular-grade water, 0.5 µL (50 µM) each primer, 0.5 µL (20 µM) of probe, 10 µL 2x of TaqMan® Fast Advance Master Mix (Applied Biosystems, Waltham, MA, USA), 1 µL of VetMAX™ Xeno™ Internal Positive Control - VIC™ Assay (ThermoFisher Scientific Inc., Waltham, MA, USA), 1 µL of VetMAX™ Xeno™ Internal Positive Control (10 − 2.5 ) (ThermoFisher Scientific Inc., Waltham, MA, USA), and 5 µL of DNA template for a 20 µL reaction volume [ 14 ]. All qPCR assays were performed on a QuantStudio 3 real-time PCR system (Applied Biosystems, Waltham, MA, USA). Following the previously published protocol [ 14 ], all skin snips were diluted 1:10. In contrast, adult specimens visible during biopsies, subconjunctival nodule biopsies, ear snips, and FFPE samples were undiluted when tested [ 14 ]. Cycling conditions included an initial denaturation step at 95°C for 3 minutes to allow DNA separation, followed by 40 cycles of a two-step PCR at 95°C for 10 seconds and 64°C for 30 seconds. All runs included two positive controls and a non-template control. One positive control included extracted DNA from an adult O. lupi specimen, confirmed morphologically and molecularly. The second positive control consisted of the diluted DNA from VetMAX™ Xeno™ (10 − 2.5 ). For the no-template control, nuclease-free water was used. Results of qPCR were analyzed using Design & Analysis 2 software to determine the cycling threshold (CT) value of each sample (Applied Biosystems, Waltham, MA, USA) [ 14 ]. Droplet digital PCR Optimization of droplet digital PCR protocol The probe and primers used in this ddPCR were originally developed for a probe-based qPCR targeting mitochondrial cox1 to detect the single genetic lineage of O. lupi reported in the US [ 14 ]. In the present study, we adapted the original probe to an Iowa Black Probe® (Integrated DNA Technologies, Coralville, IA, USA) labeled with a FAM reporter dye (Table 1 ). First, we evaluated the optimal concentration for ddPCR using a ten-fold serial dilution series (10 − 1 to 10 − 5 ) with four sample types: i) an O. lupi adult fragment DNA, ii) a subconjunctival nodule biopsy, iii) a skin snip from the interscapular region, and iv) an FFPE of a subconjunctival nodule biopsy, all of which were positive in both cPCR and qPCR. To determine the optimal annealing temperature, we then performed a temperature gradient from 56.0°C to 66.0°C to assess droplet separation using three of the commonly received sample types: an adult O. lupi specimen and a subconjunctival nodule, both at a 10 − 1 dilution, and an undiluted FFPE of a subconjunctival biopsy. To evaluate the assay’s ability to detect low-copy number targets, a serial dilution was prepared using synthetic DNA corresponding to the O. lupi cox1 gene region (molecular weight: 67,435.6 g/mol). The synthetic DNA had an initial concentration of 20 ng/µL (ThermoFisher Scientific Inc., Waltham, Massachusetts, USA). A working solution for the ddPCR with 1 x 10 7 copies/µL was prepared by diluting a 0.2 ng/µL stock with nuclease-free water. From this working solution, a tenfold serial dilution was performed to yield concentrations ranging from 10 6 to 10 0 copies/µL in the total reaction volume (20 µL). Given the high analytical sensitivity of ddPCR, we evaluated the potential cross-reactivity. All sample types assessed in this study, including adult specimen fragments, subconjunctival nodule biopsies, skin snips, ear snips, and FFPE tissues, were included in the analysis. Samples used to assess cross-reactivity were considered “negative control samples” and included an adult D. immitis specimen, tissue DNA from a purpose-bred laboratory beagle, and an FFPE tissue sample from a bat, all of which were O. lupi -negative. All reactions consisted of 5.5 µL molecular-grade water, 1.1 µL (9 µM) each primer, 1.1 µL (5 µM) of probe, 11 µL of ddPCR™ Supermix for Probes (no dUTP) (Bio-Rad Laboratories Inc., Hercules, CA, USA), and 2.2 µL of DNA template for a 22.2 µL reaction volume. Reactions were loaded into 96-well cartridges, and droplets were generated using the QX200™ AutoDG Droplet Generator (Bio-Rad Laboratories Inc., Hercules, CA, USA). PCR amplification was carried out on a C1000 Touch Thermal Cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA) using manufacturer recommended cycling conditions: an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of denaturation at 94°C for 30 seconds, and an annealing/extension step of 60°C for 1 min, with a final enzyme deactivation step at 98°C for 10 minutes. Nuclease-free water was used as a no-template control throughout all assays. Once amplified, samples were analyzed using the QX200 Droplet Reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA). All droplet fluorescence data were analyzed using QX Manager Software, 2.2 Standard Edition (Bio-Rad Laboratories Inc., Hercules, CA, USA). Testing clinical samples Using the newly optimized ddPCR assay targeting a 90 bp fragment of the cox1 gene of O. lupi (Table 1 ), all sample types were screened. All reactions consisted of the same reagents as described above. Both adult specimen fragments and subconjunctival nodules samples were diluted 10 − 1 for optimal droplet separation, whereas the remaining sample types were undiluted when tested. Positive controls included DNA of an adult O. lupi specimen, a subconjunctival biopsy, and an FFPE tissue sample, all confirmed morphologically and molecularly. Negative controls were those that tested during cross-reactivity (i.e., an adult specimen of D. immitis , tissue from a purpose-bred laboratory Beagle, and an FFPE tissue sample from a bat) that were confirmed O. lupi -negative. The no-template control was nuclease-free water. Statistical Analysis Statistical analyses were conducted using STATA®, version 19.5 BE-Basic Edition (College Station, TX, USA). All descriptive statistics and positivity reported across each diagnostic technique are summarized below. We performed Cohen’s Kappa (κ) to determine the level of agreement between each paired diagnostic test [ 52 – 54 ]. The level of agreement was categorized as follows: κ ≤ 0, no agreement; κ = 0.01–0.2, slight agreement; κ = 0.21–0.4, fair agreement; κ = 0.41–0.6, moderate agreement; κ = 0.61–0.8, substantial agreement; κ = 0.81-1.0, almost perfect [ 52 – 54 ]. We also applied the Cochran’s Q test to assess the binary results across all three diagnostic tests. A post hoc analysis using McNemar’s test was performed, with each diagnostic test paired, and controlled for multiple comparisons with the incorporation of the Bonferroni correction. A p -value of ≤ 0.05 was considered statistically significant unless adjusted [ 52 ]. Results ddPCR optimization and validation The adult fragment and the subconjunctival nodule biopsy showed sufficient rain (Fig. 2 ). Undiluted samples did not show two distinct clusters, indicating the DNA concentration used in the reaction was very high, whereas the 10x dilution showed two distinct clusters of positive and negative droplets (Fig. 2 A and 2 B). Therefore, a dilution factor of 10 − 1 was applied for all adult specimens and conjunctiva nodules samples. For the remaining sample types, including skin snips, ear snips, and FFPE samples, no dilution factor was required due to ideal droplet separation (Fig. 2 C and 2 D. The temperature gradient across all three sample types tested (i.e., a 10 − 1 dilution of an adult specimen, a 10 − 1 dilution of a subconjunctival nodule biopsy, and undiluted FFPE of a subconjunctival nodule biopsy) showed ideal droplet separation following the manufacturer's conditions (60°C); therefore, universal cycling conditions were implemented (Fig. 3 ). When assessing target DNA concentration using synthetic DNA, positive droplets were observed at all concentrations, with the lowest concentration (10 0 ) yielding a single positive droplet, indicating that the assay is capable of detecting extremely low copy numbers approaching the single-molecule level under universal cycling conditions (Fig. 4 ). Evaluation of cross-reactivity revealed that all O. lupi -negative samples produced exclusively negative droplets, confirming the assay’s analytical specificity (Fig. 5 ). Suspected clinical cases A total of 202 suspected clinical cases were screened, of which 97.0% (n = 196/202) originated from dogs and 3.0% (n = 6/202) from cats. Five different tissue types were evaluated, including subconjunctival nodule biopsies (n = 103/202), adult specimen fragments (n = 34/202), skin snips (n = 23/202), ear snips (n = 3/202), and FFPE tissue samples (n = 39/202) (Table 2 ). Diagnostic outcomes for each molecular assay are summarized in Table 3 . Overall, ddPCR showed the highest number of positive samples (71.3%, n = 144/202; 95% CI: 64.5—77.4), followed by qPCR (64.3%, n = 130/202; 95% CI: 57.3—70.9), with the fewest by cPCR and sequencing (54.0%, n = 109/202; 95% CI: 46.8—60.9) (Table 3 ). In the ddPCR, we confirmed 100% (n = 34) of adult specimen fragments and 58.2% (n = 60/103) of subconjunctival samples as positive at a 10 − 1 dilution factor (Table 3 ). Notably, ddPCR also identified seven additional positive skin snips (n = 13/23) that were not detected by either cPCR or qPCR. Using this optimized assay, we detected O. lupi in 94.9% (n = 37/39) of the FFPE samples (Table 3 ). Table 2 All tissue samples from suspected Onchocerca lupi clinical cases included in this study. Sample type No. (%) No. Dogs (%) No. Cats (%) Subconjunctival nodule biopsies 103 (63.1) 98 (95.1) 5 (4.9) Adult specimen fragments 34 (20.9) 33 (97.0) 1 (2.9) Skin snip 23 (14.1) 23 (100.0) - Ear snip 3 (1.8) 3 (100.0) - Formalin-fixed paraffin-embedded tissue 39 (19.3) 39 (100.0) - Total 202 196 6 Table 3 Summary of results obtained using conventional PCR, real-time PCR, and droplet digital PCR for the detection of Onchocerca lupi DNA. Diagnostic test(s) No. positive (%) 95% CI Conventional PCR (cPCR) 109 (54.0) 46.8—60.9 Subconjunctival nodule biopsies 53 (51.5) 41.4—61.4 Adult Specimen Fragments 32 (94.1) 80.3—99.2 Skin Snips 6 (26.1) 10.2—48.4 Ear Snip 0 - FFPE tissue 18 (46.2) 30.0—62.8 Real-time PCR (qPCR) 130 (64.3) 57.3—70.9 Subconjunctival nodule biopsies 54 (52.4) 42.3—62.3 Adult Specimen Fragments 33 (97.1) 84.6—99.9 Skin Snips 8 (34.8) 16.3—57.2 Ear Snip 0 - FFPE tissue 35 (89.8) 75.7—97.1 Droplet Digital PCR (ddPCR) 144 (71.3) 64.5—77.4 Subconjunctival nodule biopsies 60 (58.2) 48.1—67.8 Adult Specimen Fragments 34 (100.0) 89.7—1.00 Skin Snips 13 (56.5) 34.4—76.8 Ear Snip 0 - FFPE tissue 37 (94.9) 82.6—99.3 Total 202 (FFPE: formalin-fixed paraffin-embedded; CI: confidence interval) Using the probe-based qPCR, 64.3% (n = 130/202) were positive for O. lupi , of which an additional 21 positive samples for O. lupi were obtained when compared to cPCR, including one adult fragment, one subconjunctival biopsy, nineteen FFPE tissue samples, and two skin snips (Table 3 ). Conventional PCR confirmed 54.0% (n = 109/202), yielding 96 conclusive sequences with the pan-filarial cox1 primers [ 50 ] and 13 conclusive sequences via the shorter cox1 target [ 38 ] (Table 3 ). However, two of the sequences obtained and identified (from FFPE tissue samples) were previously published using both primer sets [ 23 , 24 ]. Therefore, a total of 107 sequences were obtained within this study. Using the pan-filarial primers, all 95 identical sequences obtained [ 50 ] were deposited in GenBank (Accession Number: PX857514-608) and were 100% identical to O. lupi sequences from the USA. The remaining 12 samples amplified identical sequences with the shorter cox1 target previously published [ 38 ], but were too short in bp to be submitted to GenBank. Therefore, we have included all 12 sequences in Supplementary Data, File 1. Additionally, we have listed all available information for each conclusive sequence submitted to GenBank (i.e., accession number, geographical location, and sample type) (Supplementary Data, Table S1 ) as well as those sequences via the short cox1 target [ 38 ] (i.e., geographical location, and sample type) (Supplementary Data, Table S2 ). We did not detect any O. lupi DNA within the three ear skin snips screened across all three diagnostic tests. Overall, 71.9% dogs (n = 141/196) and 50.0% cats (n = 3/6) were positive via this ddPCR assay (Table 4 ). Regarding confirmed canine O. lupi infections, these originated from the majority of states from which samples were submitted (n = 10/11), with the largest number of positive samples from New Mexico (70.3%; n = 97/138). This was also observed in cats from New Mexico with the most positive results (40.0%; n = 2/5). There were no positive dogs from Tennessee (n = 0/5). Table 4 Summary of all Onchocerca lupi positive clinical cases by sampling location. Collection States Total per state Positive via cPCR Positive via qPCR Positive via ddPCR No. Dogs Cats No. (%) Dogs (%) Cats (%) No. (%) Dogs (%) Cats (%) No. (%) Dogs (%) Cats (%) Arizona 10 10 - 5 (50.0) 5 (50.0) - 8 (80.0) 8 (80.0) - 9 (90.0) 9 (90.0) - California 10 10 - 5 (50.0) 5 (50.0) - 10 (100.0) 10 (100.0) - 10 (100.0) 10 (100.0) - Colorado 11 10 1 6 (54.5) 5 (50.0) 1 (100.0) 9 (81.8) 8 (80.0) 1 (100.0) 9 (81.8) 8 (80.0) 1 (100.0) Georgia* 1 1 - 1 (100.0) 1 (100.0) - 1 (100.0) 1 (100.0) - 1 (100.0) 1 (100.0) - Illinois* 1 1 - 1 (100.0) 1 (100.0) - 1 (100.0) 1 (100.0) - 1 (100.0) 1 (100.0) - New Mexico 143 138 5 85 (59.4) 83 (55.8) 2 (40.0) 87 (61.0) 85 (61.6) 2 (40.0) 99 (69.2) 97 (70.3) 2 (40.0) North Carolina* 5 5 - 1 (20.0) 1 (20.0) - 1 (20.0) 1 (20.0) - 1 (20.0) 1 (20.0) - Oklahoma* 2 2 - 0 - - 2 (100.0) 2 (100.0) - 2 (100.0) 2 (100.0) - Tennessee 5 5 - 0 0 - 0 0 - 0 0 - Texas 5 5 - 2 (40.0) 2 (40.0) - 3 (60.0) 3 (60.0) - 3 (60.0) 3 (60.0) - Utah 9 9 - 3 (33.3) 3 (33.3) - 8 (88.9) 8 (88.9) - 9 (100.0) 9 (100.0) - Total 202 196 6 109 (54.0) 106 (54.1) 3 (50.0) 130 (64.4) 127 (64.8) 3 (50.0) 144 (71.3) 141 (71.9) 3 (50.0) (*First confirmed case; cPCR: conventional PCR; qPCR: real-time PCR; ddPCR: droplet digital PCR) As shown in Table 5 , Cohen’s Kappa showed moderate agreement between cPCR + qPCR (κ = 0.74), with almost perfect agreement between qPCR + ddPCR (κ = 0.81), and fair agreement was found between cPCR + ddPCR (κ = 0.60). Cochran’s Q revealed a significant difference among the three diagnostic methods ( p < 0.001) (Table 6 ). In the post hoc analysis, differences remained significant across all three diagnostic tests after Bonferroni correction (Table 7 ). Table 5 The level of agreement found between each molecular diagnostic test used for the detection of Onchocerca lupi . Comparison of two tests (Test 1/Test 2) a b c d Cohen’s Kappa (κ) Agreement Interpretation cPCR/qPCR 107 2 23 70 0.7467 Moderate cPCR/ddPCR 107 2 37 56 0.6004 Fair qPCR/ddPCR 129 1 15 57 0.8195 Almost Perfect (cPCR: conventional PCR; qPCR: real-time PCR; ddPCR: droplet digital PCR) Table 6 Cochran’s Q test results for comparing three molecular diagnostic tests individually to detect Onchocerca lupi . Comparison of individual methods Q statistic df p -value cPCR 46.5500 2 < 0.001 qPCR ddPCR (Significant relationships ( p < 0.05) are denoted by bold font. df: degrees of freedom; cPCR: Conventional PCR; qPCR: probe-based real-time PCR; ddPCR: droplet digital PCR;) Table 7 Post-hoc analysis of the Cochran’s Q test for individual molecular tests using a McNemar test. Post hoc analysis p -value cPCR/qPCR < 0.001* cPCR/ddPCR < 0.001* qPCR/ddPCR < 0.001* (*Significant after Bonferroni correction (ɑ=0.0167); cPCR: Conventional PCR; qPCR: probe-based real-time PCR; ddPCR: droplet digital PCR;) Discussion In this study, we developed and optimized a highly sensitive and specific probe-based ddPCR assay capable of detecting O. lupi DNA at very low copy numbers. We also assessed the most extensive collection of suspected clinical cases of O. lupi in the US, comprising cases received from 11 states. Of these, four states (i.e., Georgia (n = 1/1), Illinois (n = 1/1), North Carolina (n = 1/5), Oklahoma (n = 2/2)) had their first confirmed O. lupi clinical case (Table 4 ). However, due to the absence of a complete history for these dogs, we cannot affirm whether these cases were autochthonous or travel-related. Among the various sample types received, we evaluated O. lupi infection across five tissue types: adult specimen fragments, subconjunctival nodule biopsies, skin snips, ear snips, and FFPE tissue. With the high sensitivity of ddPCR, we were able to detect DNA from an adult specimen stored in formalin for several years, which was negative in cPCR and qPCR. Among the collected samples, the majority were from dogs (n = 196). Among the cat samples, we received six suspected cases, of which 50% (n = 3/6) were confirmed positive for O. lupi by all three diagnostic techniques. Of the positive cat cases, one was an adult specimen fragment, and the other two were subconjunctival samples. Two of the three cat samples originated in New Mexico, and the third in Colorado. From the two previously reported cat cases in the US, the first originated in Utah, with a travel history from southern Nevada, and the second was permanently housed in a shelter in southern Utah [ 20 ]. The only large-scale epidemiological study performed was in Portugal, which sampled 155 stray cats via ear-snipping and identified a single cat infected with O. lupi [ 27 ]. The most recent case of O. lupi outside the US was in a client-owned cat from Romania with no travel history and free-range outdoor access [ 28 ]. Additionally, a recent epidemiological study is the only other study assessing O. lupi prevalence in cats in the US and reports an overall prevalence of 9.4% in cats and dogs. However, it is unclear what proportion of cats tested positive for O. lupi , separating species prevalence not the study's main objective [ 15 ]. Interestingly, all four reported cat cases worldwide, as well as the three identified in the present study, originated from regions where O. lupi has been documented in dogs, indicating that cats may play a secondary role for O. lupi in the epidemiology of this parasite compared to dogs [ 10 , 18 , 19 , 21 , 25 , 40 ]. These findings also suggest that cats may serve as reservoirs in endemic areas, thereby potentially contributing to vector transmission dynamics [ 15 , 38 ]. Given the limited information on the clinical and epidemiological aspects of O. lupi , further studies are needed to assess baseline prevalence at local-, national-, and global-scale. This newly developed ddPCR assay was adapted from a recently published probe-based qPCR assay in our lab, which was implemented in the largest epidemiological study of shelter dogs in an endemic urban area within the southwestern US [ 14 ]. Following optimization, the original qPCR showed no cross-reactivity with other filarial nematodes found in blood (i.e., Dirofilaria immitis, Acanthocheilonema reconditum ) and skin (i.e., Cercopithifilaria bainae ) [ 14 , 37 ], all of which are known to co-occur with O. lupi in the US. This result was consistent with the ddPCR assay, as we found no cross-reactivity among the three O. lupi -negative sample types, including one containing DNA of an adult D. immitis specimen. The high diagnostic sensitivity and specificity observed with ddPCR indicate a low likelihood of false positives, unlike with other molecular techniques, such as qPCR and cPCR [ 14 ]. Given the host-agnostic capability of this novel ddPCR, its high sensitivity and specificity, and the limited availability of diagnostic techniques, such as histopathology, imaging, and qPCR, it can also be easily implemented to confirm human cases [ 29 , 35 , 44 ]. In this opportunistic study, 10 of 11 sampled states had at least one confirmed O. lupi case via ddPCR (Table 4 ). Over half of the states from which samples were submitted are in the southwestern US (n = 6/11), where O. lupi is known to be endemic [ 11 – 15 ]. The remaining positive cases were from four states outside the southwestern US, where O. lupi endemicity had not previously been confirmed (Table 4 ) [ 22 , 33 , 55 ]. One major limitation of this study was that the sampled companion animals did not report a state of origin, state of adoption, or travel history (recent or former), which could not be provided for every suspected clinical case. Although veterinary ophthalmologists and pathologists submitted these samples, owners may not have shared this information at the time of sampling or, more likely, may not have known it. Additionally, some cases may have remained subclinical for many years and only showed clinical signs at the time of sampling, highlighting the importance of recording the origin of adoption in clinical assessments. Although it is not readily available due to a lack of records from adoption through a breeder or shelter, travel history must be recorded by attending veterinarians, as O. lupi continues to emerge and may be reported from areas of unknown endemic status [ 11 – 13 , 22 , 55 ]. For O. lupi , little is known about whether specific biological factors, such as age, sex, breed, and coat color, increase the risk of infection. A limitation of this study was that age was not available for all clinical cases. However, among those reported, the youngest age for an O. lupi- positive dog from a subconjunctival sample was 1 year and 7 months. In addition, a recent study from our lab found that two of eight shelter dogs positive for O. lupi were juveniles (≤ 1 year old) [ 14 ]. These findings suggest that the pre-patent period of O. lupi may be shorter than previously reported at 3–8 years in other clinical cases [ 3 , 9 , 38 ]. In another study, researchers assessed the relationship between coat color and black flies ( Simulium spp.) in dogs in New Mexico, finding that larger dogs with black coats had a higher risk of O. lupi infection than smaller dogs [ 16 ]. Biological factors such as age and coat color need to be assessed in controlled experimental infections, and future active surveillance studies of companion animals are critical for fully elucidating the biology and epidemiology of O. lupi across its geographic distribution. Although initially introduced in the 1990s, ddPCR remains relatively new in DNA-based techniques in infectious disease and parasitology diagnostics, especially in the veterinary field, where its capacity for absolute quantification represents a transformative advancement for accurate pathogen detection [ 48 , 49 , 55 , 57 ]. In veterinary parasitology, ddPCR has recently been implemented to assess signaling pathways, detect drug resistance, and improve current molecular diagnostics [ 58 – 62 ]. However, ddPCR has limitations in terms of cost and clinical diagnostic utility [ 48 , 49 , 56 ]. One major limitation of ddPCR is the higher cost of instruments and reagents, which makes its use more difficult, even in reference laboratories, as it is not widely available [ 48 , 49 , 56 ]. This is essential for identifying current or past infections to aid in treatment protocols, which is why incorporating a combination of classical parasitology using microscopy-based techniques and highly accurate molecular-based tools is essential for reliable diagnosis [ 11 , 14 , 22 , 23 ]. Conclusion This novel ddPCR assay demonstrated high sensitivity and specificity for detecting O. lupi across five sample types of suspected companion animal clinical cases, providing greater accuracy than cPCR and qPCR. This study also represents the most extensive series of confirmed clinical cases in the US, with 10 of 11 states sampled having at least one O. lupi positive case, and four states with the first confirmed clinical case. These results suggest that susceptible hosts face an increased risk of infection in both endemic and non-endemic areas. In clinical settings, this ddPCR assay can serve as a standard diagnostic test in reference laboratories to accurately evaluate suspected cases and can be used in large-scale surveillance studies to identify subclinical infections in various populations, such as shelter and stray dogs. Using molecular diagnostics, such as ddPCR, can elucidate the biology and epidemiology of this zoonotic filarial nematode and support control and prevention efforts. Declarations Acknowledgments We would like to acknowledge all those who assisted with this research, including those from the Texas A&M Parasitology Diagnostic Laboratory. We would also like to thank Dr. Erin Edwards (Texas Veterinary Medical Diagnostic Laboratory, College Station, TX), Kacie Martin (VCA Wyoming Animal Hospital, Albuquerque, NM), Leah Moody (University of Tennessee, Knoxville, TN), and Dan Ward (University of Tennessee, Knoxville, TN) for submitting clinical samples. Author’s contributions MAK: Technical writing – original draft, data curation, laboratory optimization and diagnostic work, methodology validation, formal analysis, statistical analysis. NJM: Data curation and technical writing—review and editing. SP: Data curation and technical writing—review and editing. SF: Data curation and technical writing—review and editing. TY: Data curation and technical writing—review and editing. BF: Data curation and technical writing—review and editing. JC: Data curation and technical writing—review and editing. Jordan West: Data curation and technical writing—review and editing. KB: Data curation and technical writing—review and editing. CS: Supervision, laboratory optimization, data curation, and technical writing—review and editing. HH: Supervision, laboratory optimization and diagnostics work, methodology validation, technical writing – review and editing. PW: Supervision, laboratory optimization and diagnostics work, methodology validation, technical writing – review and editing. GGV: Supervision, conceptualization, visualization, resources, funding, technical writing – review and editing. Funding This research was partially funded by the Thomas B. and Jeannette E. Laws McCabe Fund at the University of Pennsylvania. Data availability Data available upon request. Ethics approval and consent to participate Collection of samples followed the protocols approved by Texas A&M University’s Institutional Animal Care and Use Committee under protocol number 2022-0261. Consent for publication All authors consent to the publication of this manuscript. Competing interests The authors declare no competing interests. Author details 1 Department of Veterinary Pathobiology, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, 77843, USA 2 VCA Veterinary Care Animal Hospital and Referral Center, Albuquerque, New Mexico, 87111, USA 3 Thrive Pet Healthcare Specialists Albuquerque, New Mexico, 87109, US 4 Department of Pathology, College of Veterinary Medicine, Midwestern University, Glendale, Arizona, 85029, USA 5 ABQ Pet Care Hospital, Albuquerque, New Mexico, 87112, USA 6 College of Veterinary Medicine, University of Tennessee, Knoxville, Tennessee, 37996, USA 7 Brookstone Animal Hospital, Acworth, Georgia, 30101, USA 8 Animal Allergy & Dermatology of Colorado, Colorado Springs, Colorado, 80918, USA 9 Comparative Ocular Pathology Laboratory of Wisconsin, University of Wisconsin-Madison, Madison, Wisconsin, 53706, USA 10 Current affiliation: Department of Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, 66506, USA 11 Department of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, 19104, USA References Rodonaja T. A new species of nematode, Onchocerca lupi n. sp., from Canis lupus cubanensis . Soobshchenyia Akad Nauk Gruzinskoy SSR. 1967;45:715–719. Mutafchiev Y, Dantas-Torres F, Giannelli A, Abramo F, Papadopoulos E, Cardoso L, et al. Redescription of Onchocerca lupi (Spirurida: Onchocercidae) with histopathological observations. Parasit Vectors. 2013;6:309. doi: 10.1186/1756-3305-6-309 . Rojas A, Salant H, Yasur-Landau D, Tsarfati H, Baneth G. First report of Onchocerca lupi from Israel and confirmation of two genotypes circulating among canine, feline and human hosts. Parasitol. 2020;147(14):1723–1727. doi: 10.1017/S0031182020001560 . Otranto D, Dantas-Torres F, Gürlü VP, Sakru N, Yakar K, Bain O, et al. First Evidence of Human Zoonotic Infection by Onchocerca lupi (Spirurida, Onchocercidae). Am J Trop Med Hyg. 2011;84(1):55–58. doi: 10.4269/ajtmh.2011.10-0465 . Otranto D, Dantas-Torres F, Papadopoulos E, Petric D, Cupina AI, Bain O. Tracking the vector of Onchocerca lupi in a rural area of Greece. Emerg Infect Dis. 2012;18(7):1196–1200. doi: 10.3201/eid1807.AD1807 . Egyed Z, Sreter T, Szell Z, Beszteri B, Oravecz O, Marialigeti K, et al. Morphologic and genetic characterization of Onchocerca lupi infecting dogs. Vet Parasitol. 2001;102(4):309–319. doi: 10.1016/S0304-4017(01)00541-6 . Bergua A, Hohberger B, Held J, Muntau B, Tannich E, Tappe D. Human case of Onchocerca lupi infection, Germany, August 2014. Euro Surveill. 2015;20(16):21099. Miró G, Montoya A, Checa R, Gálvez R, Minguez JJ, Marino V, et al. First detection of Onchocerca lupi infection in dogs in southern Spain. Parasit Vectors. 2016;9:290. doi: 10.1186/s13071-016-1587-1 . Hodzić A, Hinney B, Konig S, Naucke TJ, Duscher G, Joachim A. A case of ocular infection with Onchocerca lupi in a dog from Germany. Transbound Emerg Dis. 2018;65(1):e214–e216. doi: 10.1111/tbed.12715 . Tudor P, Turcitu M, Mateescu C, Dantas-Torres F, Tudor N, Barbuceanu F, et al. Zoonotic ocular onchocercosis caused by Onchocerca lupi in dogs in Romania. Parasitol Res. 2016;115(2):859–862. doi: 10.1007/s00436-015-4816-1 . McLean NJ, Newkirk K, Adema CM. Canine ocular onchocerciasis: a retrospective review of the diagnosis, treatment, and outcome of 16 cases in New Mexico (2011–2015). Vet Ophthalmol. 2017;20(4):349–356. doi: 10.1111/vop.12433 . Otranto D, Giannelli A, Latrofa MS, Dantas-Torres F, Trumble NS, Chavkin M, et al. Canine infections with Onchocerca lupi nematodes, United States, 2011–2014. Emerg Infect Dis. 2015;21(5):868–871. doi: 10.3201/eid2105.141812 . Otranto D, Giannelli A, Trumble NS, Chavkin M, Kennard G, Latrofa MS, et al. Clinical case presentation and a review of the literature of canine onchocercosis by Onchocerca lupi in the United States. Parasit Vectors. 2015;8:89. doi: 10.1186/s13071-015-0699-3 . Kelly MA, Clarke E, Hakimi H, Budke CM, Verocai GG. Prevalence of Onchocerca lupi in shelter dogs from an endemic region of the Southwestern USA. Parasit Vectors. 2025;18(1):335. doi: 10.1186/s13071-025-06988-5 . Roe CC, Holiday O, Upshaw-Bia K, Benally G, Williamson CHD, Urbanz J, et al. Biting midges (Diptera: Ceratopogonidae) as putative vectors of zoonotic Onchocerca lupi (Nematoda: Onchocercidae) in northern Arizona and New Mexico, southwestern United States. Front Vet Sci. 2023;10:1167070. doi: 10.3389/fvets.2023.1167070 . Taylor ME, Auten CR, Foster T, Ebbs E, Hofkin BV. Canine ocular onchocerciasis in New Mexico: Risk factors for disease. Vet Ophthalmol. 2021;24(3):288–94. doi: 10.1111/vop.12889 . Roe CC, Yaglom H, Howard A, Urbanz J, Verocai GG, Andrews L, et al. Coyotes as Reservoirs for Onchocerca lupi , United States, 2015–2018. Emerg Infect Dis. 2020;26(12):2989–2993. doi: 10.3201/eid2612.190136 . Eberhard ML, Ortega Y, Dial S, Schiller CA, Sears AW, Greiner E. Ocular Onchocerca infections in two dogs in western United States. Vet Parasitol. 2000;90(4):333–338. doi: 10.1016/s0304-4017(00)00252-1 . Gardiner CH, Dick EJ, Jr., Meininger AC, Lozano-Alarcón F, Jackson P. Onchocerciasis in two dogs. J Am Vet Med Assoc. 1993;203(6):828–830. Labelle AL, Daniels JB, Dix M, Labelle P. Onchocerca lupi causing ocular disease in two cats. Vet Ophthalmol. 2011;14:105–110. doi: 10.1111/j.1463-5224.2011.00911.x . Orihel TC, Ash LR, Holshuh HJ, Santenelli S. Onchocerciasis in a California dog. Am J Trop Med Hyg. 1991;44(5):513–217. doi: 10.4269/ajtmh.1991.44.513 . Verocai GG, Conboy G, Lejeune M, Marron F, Hanna P, MacDonald E, et al. Onchocerca lupi nematodes in dogs exported from the United States into Canada. Emerg Infect Dis. 2016;22(8):1477–1479. doi: 10.3201/eid2208.151918 . Verocai GG, Sobotyk C, Lamison A, Borst MM, Edwards EE. Autochthonous, zoonotic Onchocerca lupi in a south Texas dog, United States. Parasit Vectors. 2021;14(1):203. doi: 10.1186/s13071-021-04707-4 . Wallitsch K, Jaffey JA, Ferguson S, Verocai GG, Sobotyk C, van Eerde E, et al. Extensive aberrant migration of Onchocerca lupi in a dog. Top Companion Anim Med. 2022;49:100666. doi: 10.1016/j.tcam.2022.100666 . Zarfoss MK, Dubielzig RR, Eberhard ML, Schmidt KS. Canine ocular onchocerciasis in the United States: two new cases and a review of the literature. Vet Ophthalmol. 2005;8(1):51–57. doi: 10.1111/j.1463-5224.2005.00348.x . Jones KEV, Terhaar HM, Jeffries C, Moore AR, Lappin MR, de Linde Henriksen M. What is your diagnosis? Impression smear of a conjunctival mass in a dog. Vet Clin Pathol. 2023;52(Suppl 2):103–106. doi: 10.1111/vcp.13105 . Maia C, Annoscia G, Latrofa MS, Pereira A, Giannelli A, Pedroso L, et al. Onchocerca lupi nematode in cat, Portugal. Emerg Infect Dis. 2015;2112:2252–2254. doi: 10.3201/eid2112.150061 . Tudor P, Ionascu I, Mateescu CI, Bezerra-Santos MA, Gurau MR, Mateescu RE, et al. Feline ocular onchocercosis by Onchocerca lupi : Phylogenetic insights and implication for veterinary health. Acta Trop. 2023;237:106723. doi: 10.1016/j.actatropica.2022.106723 . Kraai TL, Alarcon A, Lopez A, Verocai GG, McLean NJ, Qvarnstrom Y, et al. Recurrence or reinfection with Onchocerca lupi in a child in 2021 and 2024 in New Mexico amid rising canine infections. Am J Trop Med Hyg. 2025;113(4):844–847. doi: 10.4269/ajtmh.24-0795 . Eberhard ML, Ostovar GA, Chundu K, Hobohm D, Feiz-Erfan I, Mathison BA, et al. Case report: Zoonotic Onchocerca lupi infection in a 22-month-old child in Arizona: first report in the United States and a review of the literature. Am J Trop Med Hyg. 2013;88(3):601–605. doi: 10.4269/ajtmh.12-0733 . Cantey PT, Eberhard M, Weeks J, Swoboda S, Ostovar GA. Onchocerca lupi infection. J Neurosurg Pediatr. 2016;17(1):118–119. doi: 10.3171/2015.6.Peds15344 . Asghari A, Adhami G, Shariatzadeh SA, Kordi B, Anvari D, Shams M, et al. Confirmed cases of human Onchocerca lupi infection: a systematic review of an emerging threat. Parasitol Res. 2021;120(11):3633–644. doi: 10.1007/s00436-021-07309-2 . Biswas A, Yassin MH. An unexpected cause of eye irritation: A case of zoonotic ocular onchocerciasis. Case Rep Infect Dis. 2013;2013:1–3. doi: 10.1155/2013/504749 . Dudley RWR, Smith C, Dishop M, Mirsky D, Handler MH, Rao S. A cervical spine mass caused by Onchocerca lupi . Lancet. 2015;386(10001):1372. doi: 10.1016/S0140-6736(14)62255-8 . Cantey PT, Weeks J, Edwards M, Rao S, Ostovar GA, Dehority W, et al. The emergence of zoonotic Onchocerca lupi infection in the United States–A case-series. Clin Infect Dis. 2016;62(6):778–783. doi: 10.1093/cid/civ983 . Wu DB, Ko BD, Hernandez GL, Botros J, Spader H, Sapp S, et al. Neuroinvasive Onchocerca lupi infection in a ten-year-old Girl. Case Rep Infect Dis. 2022;2022:9773058. doi: 10.1155/2022/9773058 . Gruntmeir J, Kelly M, Ramos RAN, Verocai GG. Cutaneous filarioid nematodes of dogs in the United States: Are they emerging, neglected, or underdiagnosed parasites? Front Vet Sci. 2023;10. doi: 10.3389/fvets.2023.1128611 . Hassan HK, Bolcen S, Kubofcik J, Nutman TB, Eberhard ML, Middleton K, et al. Isolation of Onchocerca lupi in Dogs and black flies, California, USA. Emerg Infect Dis. 2015;21(5):789–796. doi: 10.3201/eid2105.142011 . Otranto D, Dantas-Torres F, Giannelli A, Abramo F, Cupina AI, Petric D, et al. Cutaneous distribution and circadian rhythm of Onchocerca lupi microfilariae in dogs. PLoS Negl Trop Dis. 2013;7(12). doi: 10.1371/journal.pntd.0002585 . Otranto D, Dantas-Torres F, Giannelli A, Latrofa MS, Papadopoulos E, Cardoso L, et al. Zoonotic Onchocerca lupi infection in dogs, Greece and Portugal, 2011–2012. Emerg Infect Dis. 2013;19(12):2000–2003. doi: 10.3201/eid1912.130264 . Franchini D, Giannelli A, Di Paola G, Cortes H, Cardoso L, Lia RP, et al. Image diagnosis of zoonotic onchocercosis by Onchocerca lupi . Vet Parasitol. 2014;203(1–2):91–95. doi: 10.1016/j.vetpar.2014.03.007 . Edelmann ML, Jager M, Espinheira F, Ledbetter EC. In vivo confocal microscopy for detection of subconjunctival Onchocerca lupi infection in a dog. Vet Ophthalmol. 2018;21(6):632–637. doi: 10.1111/vop.12547 . Latrofa MS, Annoscia G, Colella V, Cavalera MA, Maia C, Martin C, et al. A real-time PCR tool for the surveillance of zoonotic Onchocerca lupi in dogs, cats and potential vectors. PLoS Negl Trop Dis. 2018;12(4):e0006402. doi: 10.1371/journal.pntd.0006402 . de Almeida M, Nascimento FS, Mathison BA, Bishop H, Bradbury RS, Cama VA, et al. Duplex real-time PCR assay for clinical differentiation of Onchocerca lupi and Onchocerca volvulus . Am J Trop Med Hyg. 2020;103(4):1556–1562. doi: 10.4269/ajtmh.20-0113 . Laidoudi Y, Bedjaoui S, Medkour H, Latrofa MS, Mekroud A, Bitam I, et al. Molecular approach for the diagnosis of blood and skin canine filarioids. Microorganisms. 2020;8(11). doi: 10.3390/microorganisms8111671 . Roe CC, Urbanz J, Auten C, Verocai GG, Upshaw-Bia K, Holiday O, et al. LupiQuant: A real-time PCR-based assay for determining host-to-parasite DNA ratios of Onchocerca lupi and host Canis lupus from onchocercosis samples. PLoS One. 2022;17(11):e0276916. doi: 10.1371/journal.pone.0276916 . Latrofa MS, Louzada-Flores VN, Maia C, Kelly MA, Verocai GG, Cantacessi C, et al. Development of an indirect ELISA for the serodiagnosis of canine infection by Onchocerca lupi . Sci Rep. 2024;14(1). doi: 10.1038/s41598-024-53759-w . Baltrušis P, Höglund J. Digital PCR: modern solution to parasite diagnostics and population trait genetics. Parasit Vectors. 2023;16(1):143. doi: 10.1186/s13071-023-05756-7 . Li H, Bai R, Zhao Z, Tao L, Ma M, Ji Z, et al. Application of droplet digital PCR to detect the pathogens of infectious diseases. Biosci Rep. 2018;38(6). doi: 10.1042/bsr20181170 . Casiraghi M, Anderson TJC, Bandi C, Bazzocchi C, Genchi C. A phylogenetic analysis of filarial nematodes: comparison with the phylogeny of Wolbachia endosymbionts. Parasitol. 2001;122(1):93–103 doi: 10.1017/s0031182000007149 . Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol. 2018;356:1547–1549; doi: 10.1093/molbev/msy096 . Dohoo IR, Martin W, Stryhn H. Veterinary epidemiologic research. Second edition. edn. Charlotte, P.E.I.: VER, Inc.; 2009. McHugh ML. Interrater reliability: The kappa statistic. Biochem Med (Zagreb). 2012;22(3):276–282. doi: 10.11613/BM.2012.031 . Cohen J. A Coefficient of Agreement for Nominal Scales. Educational and Psychological Measurement. 1960;20(1):37–46. doi.10.1177/001316446002000104. McGarry JW, Carrozza R, Bradley C, Latrofa MS, Makepeace BL, Otranto D. Onchocerca lupi in imported dogs in the UK: implications for animal and public health. BMC Vet Res. 2022;18(1):66. doi: 10.1186/s12917-022-03169-9 . Pomari E, Piubelli C, Perandin F, Bisoffi Z. Digital PCR: a new technology for diagnosis of parasitic infections. Clin Microbiol Infect. 2019;25(12):1510–1516. doi: 10.1016/j.cmi.2019.06.009 . Tsokana CN, Symeonidou I, Sioutas G, Gelasakis AI, Papadopoulos E. Current applications of digital PCR in veterinary parasitology: An Overview. Parasitologia. 2023;3(3):269–283. doi: 10.3390/parasitologia3030028 . Shang Kuan T-C: Developmental regulation of Dirofilaria immitis microfilariae and evaluation of ecdysone signaling pathway transcript level using droplet digital polymerase chain reaction [master’s thesis]. Montreal (QC) C: McGill University; 2020. Kumar S, Lalicon IK, Prichard RK, Long T. Development and evaluation of quadruplex droplet-digital PCR assay for rapid detection of molecular markers associated with macrocyclic lactone resistance and susceptibility in Dirofilaria immitis . Int J Parasitol: Drugs Drug Resist. 2025:100625. doi: 10.1016/j.ijpddr.2025.100625 . Baltrušis P, Halvarsson P, Höglund J. Exploring benzimidazole resistance in Haemonchus contortus by next generation sequencing and droplet digital PCR. Int J Parasitol: Drugs Drug Resist. 2018;8(3):411–419. doi: 10.1016/j.ijpddr.2018.09.003 . Kao Y-F, Peake B, Madden R, Cowan SR, Scimeca RC, Thomas JE, et al. A probe-based droplet digital polymerase chain reaction assay for early detection of feline acute cytauxzoonosis. Vet Parasitol. 2021;292:109413. doi: 10.1016/j.vetpar.2021.109413 . Weerarathne P, Sanders TL, Kao YF, Cotey SR, Place JD, Fairbanks WS, et al. High prevalence of Cytauxzoon felis in bobcats ( Lynx rufus ) across Oklahoma and occurrence in West Texas, USA. J Wildl Dis. 2023;59(3):432–441. doi: 10.7589/jwd-d-22-00152 . Additional Declarations No competing interests reported. Supplementary Files OLddPCRSupplementaryTables41326.docx OLddPCRSupplementaryDataFile14726.txt Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 01 May, 2026 Reviewers agreed at journal 27 Apr, 2026 Reviewers agreed at journal 22 Apr, 2026 Reviewers invited by journal 18 Apr, 2026 Editor assigned by journal 17 Apr, 2026 Submission checks completed at journal 17 Apr, 2026 First submitted to journal 13 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9407830","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":629355736,"identity":"baa65889-cfde-4ad2-9286-d71ef4d828e4","order_by":0,"name":"Maureen A. Kelly","email":"","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":false,"prefix":"","firstName":"Maureen","middleName":"A.","lastName":"Kelly","suffix":""},{"id":629355737,"identity":"8a251d44-762e-4aee-8302-8c7592722d9f","order_by":1,"name":"Nancy Johnstone McLean","email":"","orcid":"","institution":"VCA Veterinary Care Animal Hospital and Referral Center","correspondingAuthor":false,"prefix":"","firstName":"Nancy","middleName":"Johnstone","lastName":"McLean","suffix":""},{"id":629355738,"identity":"18272575-ede1-4647-b393-f2935edd24ad","order_by":2,"name":"Stacy Peterson","email":"","orcid":"","institution":"Thrive Pet Healthcare Specialists","correspondingAuthor":false,"prefix":"","firstName":"Stacy","middleName":"","lastName":"Peterson","suffix":""},{"id":629355739,"identity":"25876a52-9b9f-4976-b9da-281f950a6705","order_by":3,"name":"Sylvia Ferguson","email":"","orcid":"","institution":"Midwestern University","correspondingAuthor":false,"prefix":"","firstName":"Sylvia","middleName":"","lastName":"Ferguson","suffix":""},{"id":629355740,"identity":"b557ad5b-ba4f-4f53-bdfb-b5e436a4828b","order_by":4,"name":"Tracy Young","email":"","orcid":"","institution":"ABQ Pet Care Hospital","correspondingAuthor":false,"prefix":"","firstName":"Tracy","middleName":"","lastName":"Young","suffix":""},{"id":629355741,"identity":"aed0c22d-efc2-4a9a-b7a0-74958660f3fe","order_by":5,"name":"Braidee Foote","email":"","orcid":"","institution":"University of Tennessee","correspondingAuthor":false,"prefix":"","firstName":"Braidee","middleName":"","lastName":"Foote","suffix":""},{"id":629355742,"identity":"5305b767-c2bf-4520-aae9-56c1d54cb14a","order_by":6,"name":"Jordan West","email":"","orcid":"","institution":"Brookstone Animal Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jordan","middleName":"","lastName":"West","suffix":""},{"id":629355743,"identity":"35674695-bdf1-477e-8f2d-60b9c2737fe1","order_by":7,"name":"Jackie Campbell","email":"","orcid":"","institution":"Animal Allergy \u0026 Dermatology of Colorado","correspondingAuthor":false,"prefix":"","firstName":"Jackie","middleName":"","lastName":"Campbell","suffix":""},{"id":629355744,"identity":"3377022e-e55e-4061-a0d6-e28049f2ad7a","order_by":8,"name":"Kelsey Brown","email":"","orcid":"","institution":"University of Wisconsin-Madison","correspondingAuthor":false,"prefix":"","firstName":"Kelsey","middleName":"","lastName":"Brown","suffix":""},{"id":629355745,"identity":"28e9b1fa-a2c3-4b4f-9986-d385e2b4dd13","order_by":9,"name":"Hassan Hakimi","email":"","orcid":"","institution":"Kansas State University","correspondingAuthor":false,"prefix":"","firstName":"Hassan","middleName":"","lastName":"Hakimi","suffix":""},{"id":629355746,"identity":"736155ca-1372-4488-b371-8e3dc3102688","order_by":10,"name":"Caroline Sobotyk","email":"","orcid":"","institution":"University of Pennsylvania","correspondingAuthor":false,"prefix":"","firstName":"Caroline","middleName":"","lastName":"Sobotyk","suffix":""},{"id":629355747,"identity":"7b8439b6-0056-4b09-a4ff-d459b7fcb68a","order_by":11,"name":"Pabasara Weerarathane","email":"","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":false,"prefix":"","firstName":"Pabasara","middleName":"","lastName":"Weerarathane","suffix":""},{"id":629355748,"identity":"4a6e325b-c70d-4935-8a20-f40a96d50167","order_by":12,"name":"Guilherme G. Verocai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYBADHn5kngRRWiQbQFQCCVoYDA4Qq0U+IvnYhw81djLGx8+YbmD8YRdtcID54G0ePFoMb6Qlz5xxLJnH7EyO2Q2GhOTcDQfYkq3xauk5Y8zM28DMY3aDLQ2ohRmohcdMGr+W85+BWup5jGeAtdQDtfB/w6tFnr2HGajlMI+BBPMxoJbDIFvY8GoxYG8zZpxx7DiPxJnkYzcS0o7nzjzMZmw5B58tzcyPGT7UVNvztx9su/HBpjq373jzwxtv8NlyAJmXACKY8SgH29JAQMEoGAWjYBSMAgYAzcpJWcloeIoAAAAASUVORK5CYII=","orcid":"","institution":"Texas A\u0026M University","correspondingAuthor":true,"prefix":"","firstName":"Guilherme","middleName":"G.","lastName":"Verocai","suffix":""}],"badges":[],"createdAt":"2026-04-13 19:23:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9407830/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9407830/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":107896111,"identity":"37033aa7-105a-43bd-ad28-15b38e713fe4","added_by":"auto","created_at":"2026-04-27 10:52:01","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5296065,"visible":true,"origin":"","legend":"\u003cp\u003eA map showing all 11 states sampled from, highlighting the endemic and non-endemic regions (A), with a summary of all suspected clinical cases per state (B).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-9407830/v1/4e6a5e37bb0ed44c7346acf1.png"},{"id":107896113,"identity":"156acb51-4979-481e-ac4d-f6c43cf6145b","added_by":"auto","created_at":"2026-04-27 10:52:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":10604675,"visible":true,"origin":"","legend":"\u003cp\u003eA visual representation of ddPCR droplets generated from a tenfold dilution (1 to 10\u003csup\u003e-5\u003c/sup\u003e) test using DNA of four different sample types: (A) an adult \u003cem\u003eOnchocerca lupi \u003c/em\u003especimen\u003cem\u003e, \u003c/em\u003e(B) a subconjunctival nodule biopsy, (C) a skin snip, and (D) a formalin-fixed paraffin-embedded subconjunctival tissue sample. The minimum threshold for positive droplets is indicated by the pink link, with positive droplets (blue) and negative droplets (grey).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-9407830/v1/b0dccf5fb394bd5a08e9d17c.png"},{"id":107896115,"identity":"b6b33be3-3c1b-4927-85c9-b5a223f0fe92","added_by":"auto","created_at":"2026-04-27 10:52:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1526976,"visible":true,"origin":"","legend":"\u003cp\u003eA visual representation of ddPCR droplets generated during temperature gradient (56.0°C to 66.0°C) for droplet separation testing using three different sample types: (A) an adult \u003cem\u003eOnchocerca lupi \u003c/em\u003especimen (10\u003csup\u003e-1\u003c/sup\u003e), (B) a subconjunctival nodule biopsy (10\u003csup\u003e-1\u003c/sup\u003e), and (C) a formalin-fixed paraffin-embedded subconjunctival tissue sample (10\u003csup\u003e0\u003c/sup\u003e).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-9407830/v1/a1270565e473eb2998e26f0a.png"},{"id":108006137,"identity":"73cd3fe9-a51d-4e7a-8fab-5acbd6bd4f2f","added_by":"auto","created_at":"2026-04-28 12:53:55","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":14366345,"visible":true,"origin":"","legend":"\u003cp\u003eA visual representation of ddPCR droplets generated to assess a single copy of the target DNA using synthetic DNA derived from an adult \u003cem\u003eOnchocerca lupi \u003c/em\u003especimen. The minimum threshold for positive droplets is indicated by the pink link, with positive droplets (blue) and negative droplets (grey) shown at a serial dilution (10\u003csup\u003e6\u003c/sup\u003e to 1).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-9407830/v1/6243ba776fa335371a98e25e.png"},{"id":107896116,"identity":"708fbd64-cd5f-4d4e-9295-89363f76bf76","added_by":"auto","created_at":"2026-04-27 10:52:02","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":10991871,"visible":true,"origin":"","legend":"\u003cp\u003eA visual representation of ddPCR droplets generated from using DNA from five suspected tissue samples, including (A)\u003cem\u003e \u003c/em\u003ean adult \u003cem\u003eOnchocerca lupi\u003c/em\u003e specimen, (B) a subconjunctival nodule biopsy, (C) a skin snip, (D) an ear snip, and (E) a formalin-fixed paraffin-embedded subconjunctival tissue sample. Negative controls included (F) an adult \u003cem\u003eDirofilaria immitis\u003c/em\u003e specimen, (G) a skin snip from a purpose-bred laboratory canine, and (H) a formalin-fixed paraffin-embedded tissue sample from a bat. The minimum threshold for positive droplets is indicated by the pink link, with positive droplets (blue) and negative droplets (grey) shown.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-9407830/v1/870fbcfdb7359280b470b3d7.png"},{"id":109205795,"identity":"963dace4-c063-485c-9c0c-9aafd4b5abe2","added_by":"auto","created_at":"2026-05-13 15:08:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":39615125,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9407830/v1/5813572e-1448-4da2-baaa-d780a6096877.pdf"},{"id":108006142,"identity":"22159ab5-99c2-4e27-9384-fb73a7fe6e08","added_by":"auto","created_at":"2026-04-28 12:53:59","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":26582,"visible":true,"origin":"","legend":"","description":"","filename":"OLddPCRSupplementaryTables41326.docx","url":"https://assets-eu.researchsquare.com/files/rs-9407830/v1/80a46c6d7e05cbaf0d3452ff.docx"},{"id":109203527,"identity":"97a1a8ae-ecf7-4808-887c-e0e3196813b7","added_by":"auto","created_at":"2026-05-13 14:38:10","extension":"txt","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1140,"visible":true,"origin":"","legend":"","description":"","filename":"OLddPCRSupplementaryDataFile14726.txt","url":"https://assets-eu.researchsquare.com/files/rs-9407830/v1/d89c58b0a2ff22ec2abe4cc6.txt"}],"financialInterests":"No competing interests reported.","formattedTitle":"Enhanced molecular diagnosis of Onchocerca lupi using droplet digital PCR in clinically suspected companion animals","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u003cem\u003eOnchocerca lupi\u003c/em\u003e (Filarioidea, Onchocercidae) is an emerging zoonotic filarioid nematode that is the causative agent of ocular onchocerciosis in companion animals [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Originally described from a grey wolf, \u003cem\u003eO. lupi\u003c/em\u003e has been documented in the Old World, specifically Africa, Asia, Europe, as well as North America [\u003cspan additionalcitationids=\"CR5 CR6 CR7 CR8 CR9\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Several knowledge gaps exist for this filarial nematode across biological factors, such as the pre-patent period and vectorial competence, as well as epidemiological factors, including baseline prevalence in endemic areas, particularly in the southwestern United States (US), and the establishment of local transmission in non-endemic areas due to the translocation of animals. Although several case series and epidemiological studies have documented the low prevalence of \u003cem\u003eO. lupi\u003c/em\u003e in the US, further research is needed to understand this zoonotic filarial nematode better [\u003cspan additionalcitationids=\"CR12 CR13 CR14 CR15\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFor this cutaneous dwelling filarial nematode, canids are considered the definitive hosts, with dogs (\u003cem\u003eCanis lupus familiaris\u003c/em\u003e) the most frequently reported, followed by coyotes (\u003cem\u003eCanis latrans\u003c/em\u003e), and wolves (\u003cem\u003eCanis lupus\u003c/em\u003e) reported the least [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan additionalcitationids=\"CR17 CR18 CR19 CR20 CR21 CR22 CR23 CR24 CR25\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The most extensive case series in the US on canine \u003cem\u003eO. lupi\u003c/em\u003e to date comprised 16 clinical cases and summarized diagnostics and treatment strategies [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In addition, a few epidemiological surveillance studies have been conducted in various southwestern US states, including New Mexico, Arizona, and Utah, to estimate baseline prevalence [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Feline infections are rare, with only four confirmed cases worldwide, including two in the US, one in Portugal, and one in Romania [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Zoonotic infections have also been documented, with nine human cases confirmed in the US to date, with the majority originating from southwestern states [\u003cspan additionalcitationids=\"CR30 CR31 CR32 CR33 CR34 CR35\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eUntil recently, the intermediate host of \u003cem\u003eO. lupi\u003c/em\u003e was unknown [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Emerging molecular evidence indicates that both black flies (\u003cem\u003eSimulium tribulatum\u003c/em\u003e) and biting midges (Ceratopogonidae sp.) may serve as competent intermediate hosts. \u003cem\u003eOnchocerca lupi\u003c/em\u003e DNA has been detected in pools of black flies collected in southern California [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] and in the heads of biting midges from the Navajo Reservation in the southwestern US [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], supporting their potential role in parasite transmission.\u003c/p\u003e \u003cp\u003eClinically, ocular \u003cem\u003eO. lupi\u003c/em\u003e infection in companion animals can present in one or both eyes, ranging from acute manifestations such as conjunctivitis and ocular discharge to chronic stages characterized by nodular development in various parts of the eye, with the potential for enucleation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, many cases go undiagnosed due to the subclinical nature of the infections or nonspecific clinical signs. Currently, no standardized or consistently effective treatment protocol for \u003cem\u003eO. lupi\u003c/em\u003e has been established. Several case series indicate that a combination of surgical excision and drug therapy (i.e., ivermectin, doxycycline, prednisone) may be effective, as observed in other filarial nematode infections, such as \u003cem\u003eDirofilaria immitis\u003c/em\u003e [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe most widely used technique for diagnosing \u003cem\u003eO. lupi\u003c/em\u003e infections involves a combination of morphological characterization of skin-dwelling microfilariae or adult specimens by microscopy and DNA detection by conventional PCR (cPCR). Skin snip samples are preferably collected from the nose, forehead, and interscapular region [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Diagnostic imaging, real-time PCR (qPCR), and indirect ELISA techniques have been recently developed and optimized to detect \u003cem\u003eO. lupi\u003c/em\u003e in animals and humans [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan additionalcitationids=\"CR42 CR43 CR44 CR45 CR46\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. However, these diagnostic techniques can be invasive, labor-intensive, and prone to PCR inhibition, resulting in false negatives. Droplet digital PCR (ddPCR) is an advanced molecular technique that enables absolute quantification of target DNA without the need for external standards [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. In ddPCR, the reaction mixture containing the DNA sample, primers, probes, and other components is partitioned into thousands of nanoliter-sized droplets, each acting as an independent PCR reaction [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. After amplification, each droplet is analyzed for the presence or absence of the target sequence using a fluorescent signal. By applying Poisson statistics, ddPCR calculates the absolute number of target molecules in the original sample without relying on standard curves [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. The importance of ddPCR lies in its high sensitivity and accuracy, particularly for detecting low-abundance targets that may be missed by cPCR or qPCR. It is less affected by PCR inhibitors, making it ideal for challenging samples such as host tissues or formalin-fixed specimens [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Droplet digital PCR has been increasingly utilized in clinical diagnostics, epidemiological surveillance, and research for pathogen detection, mutation analysis, and monitoring treatment efficacy [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Therefore, our objective was to validate a ddPCR assay for detecting \u003cem\u003eO. lupi\u003c/em\u003e across various sample types, including adult \u003cem\u003eO. lupi\u003c/em\u003e fragments, subconjunctival nodule biopsies, skin snips, and formalin-fixed paraffin-embedded (FFPE) tissues of both dogs and cats. Then, the performance of this novel assay was compared to cPCR and qPCR to assess the prevalence in suspected clinical cases.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSuspected clinical cases\u003c/h2\u003e \u003cp\u003eSpecimens from suspected clinical cases of \u003cem\u003eO. lupi\u003c/em\u003e from both dogs (n\u0026thinsp;=\u0026thinsp;196) and cats (n\u0026thinsp;=\u0026thinsp;6) were submitted by veterinary ophthalmologists and pathologists from 11 states within the US, between 2018 and 2025, to the Texas A\u0026amp;M University Parasitology Diagnostic Lab (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). All samples collected complied with the animal use protocol approved by Texas A\u0026amp;M University\u0026rsquo;s (TAMU) Institutional Animal Care and Use Committee (IACUC number: 2022\u0026thinsp;\u0026minus;\u0026thinsp;0261). Depending on the sample preservative (i.e., 70% ethanol vs. FFPE), different extraction methods were used. Detailed demographic data were collected for most cases; some information was missing for a proportion. Whenever possible and/or requested, these results were shared with the veterinarian responsible for the case.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSample preparation\u003c/h3\u003e\n\u003cp\u003eAfter collecting fresh tissue samples, veterinarians were advised to ship each sample in 70% ethanol for preservation. The samples included subconjunctival nodule biopsies, skin snips from the interscapular region, ear snips, and adult specimen fragments visible during collection. Following arrival, samples were transferred from a collection tube to a 1.5 mL microcentrifuge tube to evaporate ethanol using an Eppendorf Vacufuge (Eppendorf Vacufuge\u0026reg; Plus, Eppendorf, Germany), thereby reducing the likelihood of inhibition during genomic extraction. Before genomic extraction, all fresh tissue samples were enzymatically and mechanically disrupted by incubating in a thermomixer (Eppendorf, Germany) overnight at 56\u0026deg;C with a rotation rate of 350 RPM.\u003c/p\u003e \u003cp\u003eAll FFPE samples received contained at least 1\u0026ndash;2 scrolls, each 20 \u0026micro;M thick. Upon arrival, the samples were placed in 1.5 mL microcentrifuge tubes. Genomic DNA was extracted following the protocol described above. When multiple FFPE scrolls from a single animal were received (6 scrolls total), the scrolls were individually processed, with two scrolls used per extraction. Once completed, a compiled sample containing 5 \u0026micro;L from each DNA extraction was used to screen for \u003cem\u003eO. lupi.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eGenomic DNA was then extracted from all tissue samples using the DNeasy\u0026reg; Blood and Tissue Kit (Qiagen, Valencia, California, USA) according to the manufacturer's instructions. Genomic DNA from all FFPE samples was extracted using the QIAmp DNA FFPE Tissue Kit (QIAGEN, Valencia, CA, USA) according to the manufacturer's instructions. All genomic DNA was then kept frozen at -20\u0026deg;C until molecular testing.\u003c/p\u003e\n\u003ch3\u003eMolecular-based diagnostic assays\u003c/h3\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eConventional PCR\u003c/h2\u003e \u003cp\u003eConventional PCR was performed using pan-filarial primers targeting the mitochondrial cytochrome oxidase c subunit 1 (\u003cem\u003ecox1\u003c/em\u003e), yielding an amplicon of approximately 635 base pairs (bp), as previously described (14, 50) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Briefly, all reactions were performed in a 25 \u0026micro;L reaction containing 8.75 \u0026micro;L molecular-grade water, 0.625 \u0026micro;L (10 \u0026micro;M) of each primer, 12.5 \u0026micro;L 2x GoTaq\u0026reg; Green Master Mix (Promega Corporation, Madison, WI, USA), and 2.5 \u0026micro;L DNA template. Cycling conditions consisted of 95\u0026deg;C for 2 minutes, followed by 40 cycles at 95\u0026deg;C for 45 seconds, 52\u0026deg;C for 45 seconds, and 72\u0026deg;C for 90 seconds, and a final extension step at 72\u0026deg;C for 5 minutes. All runs included DNA from a positive control and a no-template control. The positive control was DNA extracted from an adult female \u003cem\u003eSetaria equina\u003c/em\u003e, and the no-template control consisted of nuclease-free water. Conventional PCR products were subjected to a 1% agarose gel stained with GelRed\u0026trade; Nucleic Acid Gel Stain (GoldBio, St. Louis, MO, USA). The agarose gel was visualized under UV light to detect amplicons; if detected, the amplified DNA was purified using the Cycle Pure E. Z. N. A. kit (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer\u0026rsquo;s instructions. Following purification, samples were sent for Sanger sequencing (Eurofins, Louisville, KY, USA). Generated sequences were compared with genetic data available in GenBank using BLAST and aligned for phylogenetic analysis in Molecular Evolutionary Genetics Analysis (MEGA) X [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. If sequencing was inconclusive, further analysis using an additional set of primers targeting a shorter \u003cem\u003ecox1\u003c/em\u003e fragment (115 bp) [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. With the identical cPCR volume, reaction conditions, and purification protocol described above, the only alteration was to the annealing step at 50\u0026deg;C for 45 seconds for the shorter target region [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers and probes designed for conventional PCR, real-time PCR, and droplet digital PCR for the detection of \u003cem\u003eOnchocerca lupi\u003c/em\u003e DNA targeting the cytochrome c oxidase subunit (\u003cem\u003ecox1\u003c/em\u003e) gene region.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003eConventional PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOIintForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGGCGGTCCTGGTAGTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOIintReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGATTGGTGGTTTTGGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eShortCOIF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCAAAATATGCGTTCTACTGCTGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eShortCOIR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAA AGACCCAGCTAA AACAGGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003eReal-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaqMan\u0026reg; Probe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFAM-CTTAGAGTAGAGGGTCAGCC-MGB-NFQ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eO.l.Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGGCGGTCCTGGTAGTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eO.l.Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAAACCCAAAACTATAGTATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003eDroplet Digital PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIowa Black Probe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFAM-CTTAGAGTA /ZEN/ GAGGGTCAGCC-IABkFQ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCurrent Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eO.l.Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGGCGGTCCTGGTAGTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCurrent Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eO.l.Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAAACCCAAAACTATAGTATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCurrent Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eProbe-based qPCR\u003c/h3\u003e\n\u003cp\u003eAll sample types were subjected to a recently optimized probe-based qPCR targeting a short region of \u003cem\u003ecox1\u003c/em\u003e, which amplified a 90 bp fragment of \u003cem\u003eO. lupi\u003c/em\u003e [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Briefly, all reactions consisted of 1.5 \u0026micro;L molecular-grade water, 0.5 \u0026micro;L (50 \u0026micro;M) each primer, 0.5 \u0026micro;L (20 \u0026micro;M) of probe, 10 \u0026micro;L 2x of TaqMan\u0026reg; Fast Advance Master Mix (Applied Biosystems, Waltham, MA, USA), 1 \u0026micro;L of VetMAX\u0026trade; Xeno\u0026trade; Internal Positive Control - VIC\u0026trade; Assay (ThermoFisher Scientific Inc., Waltham, MA, USA), 1 \u0026micro;L of VetMAX\u0026trade; Xeno\u0026trade; Internal Positive Control (10\u003csup\u003e\u0026minus;\u0026thinsp;2.5\u003c/sup\u003e) (ThermoFisher Scientific Inc., Waltham, MA, USA), and 5 \u0026micro;L of DNA template for a 20 \u0026micro;L reaction volume [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. All qPCR assays were performed on a QuantStudio 3 real-time PCR system (Applied Biosystems, Waltham, MA, USA). Following the previously published protocol [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], all skin snips were diluted 1:10. In contrast, adult specimens visible during biopsies, subconjunctival nodule biopsies, ear snips, and FFPE samples were undiluted when tested [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Cycling conditions included an initial denaturation step at 95\u0026deg;C for 3 minutes to allow DNA separation, followed by 40 cycles of a two-step PCR at 95\u0026deg;C for 10 seconds and 64\u0026deg;C for 30 seconds. All runs included two positive controls and a non-template control. One positive control included extracted DNA from an adult \u003cem\u003eO. lupi\u003c/em\u003e specimen, confirmed morphologically and molecularly. The second positive control consisted of the diluted DNA from VetMAX\u0026trade; Xeno\u0026trade; (10\u003csup\u003e\u0026minus;\u0026thinsp;2.5\u003c/sup\u003e). For the no-template control, nuclease-free water was used. Results of qPCR were analyzed using Design \u0026amp; Analysis 2 software to determine the cycling threshold (CT) value of each sample (Applied Biosystems, Waltham, MA, USA) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDroplet digital PCR\u003c/h2\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003eOptimization of droplet digital PCR protocol\u003c/h2\u003e \u003cp\u003eThe probe and primers used in this ddPCR were originally developed for a probe-based qPCR targeting mitochondrial \u003cem\u003ecox1\u003c/em\u003e to detect the single genetic lineage of \u003cem\u003eO. lupi\u003c/em\u003e reported in the US [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In the present study, we adapted the original probe to an Iowa Black Probe\u0026reg; (Integrated DNA Technologies, Coralville, IA, USA) labeled with a FAM reporter dye (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). First, we evaluated the optimal concentration for ddPCR using a ten-fold serial dilution series (10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e) with four sample types: i) an \u003cem\u003eO. lupi\u003c/em\u003e adult fragment DNA, ii) a subconjunctival nodule biopsy, iii) a skin snip from the interscapular region, and iv) an FFPE of a subconjunctival nodule biopsy, all of which were positive in both cPCR and qPCR.\u003c/p\u003e \u003cp\u003eTo determine the optimal annealing temperature, we then performed a temperature gradient from 56.0\u0026deg;C to 66.0\u0026deg;C to assess droplet separation using three of the commonly received sample types: an adult \u003cem\u003eO. lupi\u003c/em\u003e specimen and a subconjunctival nodule, both at a 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e dilution, and an undiluted FFPE of a subconjunctival biopsy. To evaluate the assay\u0026rsquo;s ability to detect low-copy number targets, a serial dilution was prepared using synthetic DNA corresponding to the \u003cem\u003eO. lupi cox1\u003c/em\u003e gene region (molecular weight: 67,435.6 g/mol). The synthetic DNA had an initial concentration of 20 ng/\u0026micro;L (ThermoFisher Scientific Inc., Waltham, Massachusetts, USA). A working solution for the ddPCR with 1 x 10\u003csup\u003e7\u003c/sup\u003e copies/\u0026micro;L was prepared by diluting a 0.2 ng/\u0026micro;L stock with nuclease-free water. From this working solution, a tenfold serial dilution was performed to yield concentrations ranging from 10\u003csup\u003e6\u003c/sup\u003e to 10\u003csup\u003e0\u003c/sup\u003e copies/\u0026micro;L in the total reaction volume (20 \u0026micro;L).\u003c/p\u003e \u003cp\u003eGiven the high analytical sensitivity of ddPCR, we evaluated the potential cross-reactivity. All sample types assessed in this study, including adult specimen fragments, subconjunctival nodule biopsies, skin snips, ear snips, and FFPE tissues, were included in the analysis. Samples used to assess cross-reactivity were considered \u0026ldquo;negative control samples\u0026rdquo; and included an adult \u003cem\u003eD. immitis\u003c/em\u003e specimen, tissue DNA from a purpose-bred laboratory beagle, and an FFPE tissue sample from a bat, all of which were \u003cem\u003eO. lupi\u003c/em\u003e-negative.\u003c/p\u003e \u003cp\u003eAll reactions consisted of 5.5 \u0026micro;L molecular-grade water, 1.1 \u0026micro;L (9 \u0026micro;M) each primer, 1.1 \u0026micro;L (5 \u0026micro;M) of probe, 11 \u0026micro;L of ddPCR\u0026trade; Supermix for Probes (no dUTP) (Bio-Rad Laboratories Inc., Hercules, CA, USA), and 2.2 \u0026micro;L of DNA template for a 22.2 \u0026micro;L reaction volume. Reactions were loaded into 96-well cartridges, and droplets were generated using the QX200\u0026trade; AutoDG Droplet Generator (Bio-Rad Laboratories Inc., Hercules, CA, USA). PCR amplification was carried out on a C1000 Touch Thermal Cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA) using manufacturer recommended cycling conditions: an initial denaturation step at 95\u0026deg;C for 10 minutes, followed by 40 cycles of denaturation at 94\u0026deg;C for 30 seconds, and an annealing/extension step of 60\u0026deg;C for 1 min, with a final enzyme deactivation step at 98\u0026deg;C for 10 minutes. Nuclease-free water was used as a no-template control throughout all assays. Once amplified, samples were analyzed using the QX200 Droplet Reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA). All droplet fluorescence data were analyzed using QX Manager Software, 2.2 Standard Edition (Bio-Rad Laboratories Inc., Hercules, CA, USA).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e\n\u003ch3\u003eTesting clinical samples\u003c/h3\u003e\n\u003cp\u003eUsing the newly optimized ddPCR assay targeting a 90 bp fragment of the \u003cem\u003ecox1\u003c/em\u003e gene of \u003cem\u003eO. lupi\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), all sample types were screened. All reactions consisted of the same reagents as described above. Both adult specimen fragments and subconjunctival nodules samples were diluted 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e for optimal droplet separation, whereas the remaining sample types were undiluted when tested. Positive controls included DNA of an adult \u003cem\u003eO. lupi\u003c/em\u003e specimen, a subconjunctival biopsy, and an FFPE tissue sample, all confirmed morphologically and molecularly. Negative controls were those that tested during cross-reactivity (i.e., an adult specimen of \u003cem\u003eD. immitis\u003c/em\u003e, tissue from a purpose-bred laboratory Beagle, and an FFPE tissue sample from a bat) that were confirmed \u003cem\u003eO. lupi\u003c/em\u003e-negative. The no-template control was nuclease-free water.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were conducted using STATA\u0026reg;, version 19.5 BE-Basic Edition (College Station, TX, USA). All descriptive statistics and positivity reported across each diagnostic technique are summarized below. We performed Cohen\u0026rsquo;s Kappa (κ) to determine the level of agreement between each paired diagnostic test [\u003cspan additionalcitationids=\"CR53\" citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. The level of agreement was categorized as follows: κ\u0026thinsp;\u0026le;\u0026thinsp;0, no agreement; κ\u0026thinsp;=\u0026thinsp;0.01\u0026ndash;0.2, slight agreement; κ\u0026thinsp;=\u0026thinsp;0.21\u0026ndash;0.4, fair agreement; κ\u0026thinsp;=\u0026thinsp;0.41\u0026ndash;0.6, moderate agreement; κ\u0026thinsp;=\u0026thinsp;0.61\u0026ndash;0.8, substantial agreement; κ\u0026thinsp;=\u0026thinsp;0.81-1.0, almost perfect [\u003cspan additionalcitationids=\"CR53\" citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. We also applied the Cochran\u0026rsquo;s Q test to assess the binary results across all three diagnostic tests. A post hoc analysis using McNemar\u0026rsquo;s test was performed, with each diagnostic test paired, and controlled for multiple comparisons with the incorporation of the Bonferroni correction. A \u003cem\u003ep\u003c/em\u003e-value of \u0026le;\u0026thinsp;0.05 was considered statistically significant unless adjusted [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eddPCR optimization and validation\u003c/h2\u003e \u003cp\u003eThe adult fragment and the subconjunctival nodule biopsy showed sufficient rain (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Undiluted samples did not show two distinct clusters, indicating the DNA concentration used in the reaction was very high, whereas the 10x dilution showed two distinct clusters of positive and negative droplets (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Therefore, a dilution factor of 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was applied for all adult specimens and conjunctiva nodules samples. For the remaining sample types, including skin snips, ear snips, and FFPE samples, no dilution factor was required due to ideal droplet separation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD. The temperature gradient across all three sample types tested (i.e., a 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e dilution of an adult specimen, a 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e dilution of a subconjunctival nodule biopsy, and undiluted FFPE of a subconjunctival nodule biopsy) showed ideal droplet separation following the manufacturer's conditions (60\u0026deg;C); therefore, universal cycling conditions were implemented (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). When assessing target DNA concentration using synthetic DNA, positive droplets were observed at all concentrations, with the lowest concentration (10\u003csup\u003e0\u003c/sup\u003e) yielding a single positive droplet, indicating that the assay is capable of detecting extremely low copy numbers approaching the single-molecule level under universal cycling conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Evaluation of cross-reactivity revealed that all \u003cem\u003eO. lupi\u003c/em\u003e-negative samples produced exclusively negative droplets, confirming the assay\u0026rsquo;s analytical specificity (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eSuspected clinical cases\u003c/h2\u003e \u003cp\u003eA total of 202 suspected clinical cases were screened, of which 97.0% (n\u0026thinsp;=\u0026thinsp;196/202) originated from dogs and 3.0% (n\u0026thinsp;=\u0026thinsp;6/202) from cats. Five different tissue types were evaluated, including subconjunctival nodule biopsies (n\u0026thinsp;=\u0026thinsp;103/202), adult specimen fragments (n\u0026thinsp;=\u0026thinsp;34/202), skin snips (n\u0026thinsp;=\u0026thinsp;23/202), ear snips (n\u0026thinsp;=\u0026thinsp;3/202), and FFPE tissue samples (n\u0026thinsp;=\u0026thinsp;39/202) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Diagnostic outcomes for each molecular assay are summarized in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Overall, ddPCR showed the highest number of positive samples (71.3%, n\u0026thinsp;=\u0026thinsp;144/202; 95% CI: 64.5\u0026mdash;77.4), followed by qPCR (64.3%, n\u0026thinsp;=\u0026thinsp;130/202; 95% CI: 57.3\u0026mdash;70.9), with the fewest by cPCR and sequencing (54.0%, n\u0026thinsp;=\u0026thinsp;109/202; 95% CI: 46.8\u0026mdash;60.9) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In the ddPCR, we confirmed 100% (n\u0026thinsp;=\u0026thinsp;34) of adult specimen fragments and 58.2% (n\u0026thinsp;=\u0026thinsp;60/103) of subconjunctival samples as positive at a 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e dilution factor (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Notably, ddPCR also identified seven additional positive skin snips (n\u0026thinsp;=\u0026thinsp;13/23) that were not detected by either cPCR or qPCR. Using this optimized assay, we detected \u003cem\u003eO. lupi\u003c/em\u003e in 94.9% (n\u0026thinsp;=\u0026thinsp;37/39) of the FFPE samples (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAll tissue samples from suspected \u003cem\u003eOnchocerca lupi\u003c/em\u003e clinical cases included in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSample type\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo. (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNo. Dogs (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNo. Cats (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSubconjunctival nodule biopsies\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e103 (63.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e98 (95.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5 (4.9)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAdult specimen fragments\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e34 (20.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e33 (97.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (2.9)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSkin snip\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e23 (14.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEar snip\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3 (1.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFormalin-fixed paraffin-embedded tissue\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e39 (19.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e39 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e202\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e196\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSummary of results obtained using conventional PCR, real-time PCR, and droplet digital PCR for the detection of \u003cem\u003eOnchocerca lupi\u003c/em\u003e DNA.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDiagnostic test(s)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo. positive (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e95% CI\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eConventional PCR (cPCR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e109 (54.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e46.8\u0026mdash;60.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSubconjunctival nodule biopsies\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e53 (51.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e41.4\u0026mdash;61.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAdult Specimen Fragments\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e32 (94.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e80.3\u0026mdash;99.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSkin Snips\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6 (26.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10.2\u0026mdash;48.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEar Snip\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFFPE tissue\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18 (46.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30.0\u0026mdash;62.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReal-time PCR (qPCR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e130 (64.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e57.3\u0026mdash;70.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSubconjunctival nodule biopsies\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e54 (52.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e42.3\u0026mdash;62.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAdult Specimen Fragments\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e33 (97.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e84.6\u0026mdash;99.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSkin Snips\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8 (34.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16.3\u0026mdash;57.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEar Snip\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFFPE tissue\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e35 (89.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e75.7\u0026mdash;97.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDroplet Digital PCR (ddPCR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e144 (71.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e64.5\u0026mdash;77.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSubconjunctival nodule biopsies\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60 (58.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48.1\u0026mdash;67.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAdult Specimen Fragments\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e34 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e89.7\u0026mdash;1.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSkin Snips\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13 (56.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34.4\u0026mdash;76.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEar Snip\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFFPE tissue\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e37 (94.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e82.6\u0026mdash;99.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e202\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e(FFPE: formalin-fixed paraffin-embedded; CI: confidence interval)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eUsing the probe-based qPCR, 64.3% (n\u0026thinsp;=\u0026thinsp;130/202) were positive for \u003cem\u003eO. lupi\u003c/em\u003e, of which an additional 21 positive samples for \u003cem\u003eO. lupi\u003c/em\u003e were obtained when compared to cPCR, including one adult fragment, one subconjunctival biopsy, nineteen FFPE tissue samples, and two skin snips (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Conventional PCR confirmed 54.0% (n\u0026thinsp;=\u0026thinsp;109/202), yielding 96 conclusive sequences with the pan-filarial \u003cem\u003ecox1\u003c/em\u003e primers [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] and 13 conclusive sequences via the shorter \u003cem\u003ecox1\u003c/em\u003e target [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). However, two of the sequences obtained and identified (from FFPE tissue samples) were previously published using both primer sets [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Therefore, a total of 107 sequences were obtained within this study. Using the pan-filarial primers, all 95 identical sequences obtained [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] were deposited in GenBank (Accession Number: PX857514-608) and were 100% identical to \u003cem\u003eO. lupi\u003c/em\u003e sequences from the USA. The remaining 12 samples amplified identical sequences with the shorter \u003cem\u003ecox1\u003c/em\u003e target previously published [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], but were too short in bp to be submitted to GenBank. Therefore, we have included all 12 sequences in Supplementary Data, File 1. Additionally, we have listed all available information for each conclusive sequence submitted to GenBank (i.e., accession number, geographical location, and sample type) (Supplementary Data, Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) as well as those sequences via the short \u003cem\u003ecox1\u003c/em\u003e target [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] (i.e., geographical location, and sample type) (Supplementary Data, Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). We did not detect any \u003cem\u003eO. lupi\u003c/em\u003e DNA within the three ear skin snips screened across all three diagnostic tests. Overall, 71.9% dogs (n\u0026thinsp;=\u0026thinsp;141/196) and 50.0% cats (n\u0026thinsp;=\u0026thinsp;3/6) were positive via this ddPCR assay (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Regarding confirmed canine \u003cem\u003eO. lupi\u003c/em\u003e infections, these originated from the majority of states from which samples were submitted (n\u0026thinsp;=\u0026thinsp;10/11), with the largest number of positive samples from New Mexico (70.3%; n\u0026thinsp;=\u0026thinsp;97/138). This was also observed in cats from New Mexico with the most positive results (40.0%; n\u0026thinsp;=\u0026thinsp;2/5). There were no positive dogs from Tennessee (n\u0026thinsp;=\u0026thinsp;0/5).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSummary of all \u003cem\u003eOnchocerca lupi\u003c/em\u003e positive clinical cases by sampling location.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"13\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCollection States\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eTotal per state\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e \u003cp\u003ePositive via cPCR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c10\" namest=\"c8\"\u003e \u003cp\u003ePositive via qPCR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c13\" namest=\"c11\"\u003e \u003cp\u003ePositive via ddPCR\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDogs\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCats\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNo. (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDogs (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCats\u003c/p\u003e \u003cp\u003e(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNo. (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eDogs (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eCats\u003c/p\u003e \u003cp\u003e(%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eNo. (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eDogs (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eCats\u003c/p\u003e \u003cp\u003e(%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eArizona\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5 (50.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5 (50.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e8 (80.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e8\u003c/p\u003e \u003cp\u003e(80.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e9 (90.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e9\u003c/p\u003e \u003cp\u003e(90.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCalifornia\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5 (50.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5 (50.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e10 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e10 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e10 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e10 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eColorado\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6 (54.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5\u003c/p\u003e \u003cp\u003e(50.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e9\u003c/p\u003e \u003cp\u003e(81.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e8\u003c/p\u003e \u003cp\u003e(80.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e9 (81.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e8\u003c/p\u003e \u003cp\u003e(80.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGeorgia*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIllinois*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e1 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNew Mexico\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e143\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e138\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e85 (59.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e83 (55.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2 (40.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e87 (61.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e85 (61.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2 (40.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e99 (69.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e97 (70.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e2 (40.0)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNorth Carolina*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (20.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1 (20.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1 (20.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1\u003c/p\u003e \u003cp\u003e(20.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1 (20.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e1 (20.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOklahoma*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e2 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e2 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTennessee\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTexas\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2 (40.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (40.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3 (60.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e3\u003c/p\u003e \u003cp\u003e(60.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e3 (60.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e3 (60.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUtah\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3 (33.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3 (33.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e8 (88.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e8\u003c/p\u003e \u003cp\u003e(88.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e9 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e9 (100.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e202\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e196\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e109\u003c/p\u003e \u003cp\u003e(54.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e106\u003c/p\u003e \u003cp\u003e(54.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3\u003c/p\u003e \u003cp\u003e(50.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e130\u003c/p\u003e \u003cp\u003e(64.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e127\u003c/p\u003e \u003cp\u003e(64.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e3\u003c/p\u003e \u003cp\u003e(50.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e144\u003c/p\u003e \u003cp\u003e(71.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e141\u003c/p\u003e \u003cp\u003e(71.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e3\u003c/p\u003e \u003cp\u003e(50.0)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"13\"\u003e(*First confirmed case; cPCR: conventional PCR; qPCR: real-time PCR; ddPCR: droplet digital PCR)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, Cohen\u0026rsquo;s Kappa showed moderate agreement between cPCR\u0026thinsp;+\u0026thinsp;qPCR (κ\u0026thinsp;=\u0026thinsp;0.74), with almost perfect agreement between qPCR\u0026thinsp;+\u0026thinsp;ddPCR (κ\u0026thinsp;=\u0026thinsp;0.81), and fair agreement was found between cPCR\u0026thinsp;+\u0026thinsp;ddPCR (κ\u0026thinsp;=\u0026thinsp;0.60). Cochran\u0026rsquo;s Q revealed a significant difference among the three diagnostic methods (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). In the post hoc analysis, differences remained significant across all three diagnostic tests after Bonferroni correction (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe level of agreement found between each molecular diagnostic test used for the detection of \u003cem\u003eOnchocerca lupi\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eComparison of two tests\u003c/p\u003e \u003cp\u003e(Test 1/Test 2)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ea\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eb\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ec\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ed\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCohen\u0026rsquo;s Kappa\u003c/p\u003e \u003cp\u003e(κ)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAgreement Interpretation\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecPCR/qPCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.7467\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eModerate\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecPCR/ddPCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.6004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFair\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eqPCR/ddPCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e129\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.8195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAlmost Perfect\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003e(cPCR: conventional PCR; qPCR: real-time PCR; ddPCR: droplet digital PCR)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCochran\u0026rsquo;s Q test results for comparing three molecular diagnostic tests individually to detect \u003cem\u003eOnchocerca lupi\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eComparison of individual methods\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eQ statistic\u003c/p\u003e \u003cp\u003edf\u003c/p\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecPCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e46.5500\u003c/p\u003e \u003cp\u003e2\u003c/p\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eqPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eddPCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003e(Significant relationships (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) are denoted by bold font. df: degrees of freedom; cPCR: Conventional PCR; qPCR: probe-based real-time PCR; ddPCR: droplet digital PCR;)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePost-hoc analysis of the Cochran\u0026rsquo;s Q test for individual molecular tests using a McNemar test.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePost hoc analysis\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ep\u003c/em\u003e-value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecPCR/qPCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001*\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecPCR/ddPCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001*\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eqPCR/ddPCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e\u0026lt;\u0026thinsp;0.001*\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003e(*Significant after Bonferroni correction (ɑ=0.0167); cPCR: Conventional PCR; qPCR: probe-based real-time PCR; ddPCR: droplet digital PCR;)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we developed and optimized a highly sensitive and specific probe-based ddPCR assay capable of detecting \u003cem\u003eO. lupi\u003c/em\u003e DNA at very low copy numbers. We also assessed the most extensive collection of suspected clinical cases of \u003cem\u003eO. lupi\u003c/em\u003e in the US, comprising cases received from 11 states. Of these, four states (i.e., Georgia (n\u0026thinsp;=\u0026thinsp;1/1), Illinois (n\u0026thinsp;=\u0026thinsp;1/1), North Carolina (n\u0026thinsp;=\u0026thinsp;1/5), Oklahoma (n\u0026thinsp;=\u0026thinsp;2/2)) had their first confirmed \u003cem\u003eO. lupi\u003c/em\u003e clinical case (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). However, due to the absence of a complete history for these dogs, we cannot affirm whether these cases were autochthonous or travel-related. Among the various sample types received, we evaluated \u003cem\u003eO. lupi\u003c/em\u003e infection across five tissue types: adult specimen fragments, subconjunctival nodule biopsies, skin snips, ear snips, and FFPE tissue. With the high sensitivity of ddPCR, we were able to detect DNA from an adult specimen stored in formalin for several years, which was negative in cPCR and qPCR.\u003c/p\u003e \u003cp\u003eAmong the collected samples, the majority were from dogs (n\u0026thinsp;=\u0026thinsp;196). Among the cat samples, we received six suspected cases, of which 50% (n\u0026thinsp;=\u0026thinsp;3/6) were confirmed positive for \u003cem\u003eO. lupi\u003c/em\u003e by all three diagnostic techniques. Of the positive cat cases, one was an adult specimen fragment, and the other two were subconjunctival samples. Two of the three cat samples originated in New Mexico, and the third in Colorado. From the two previously reported cat cases in the US, the first originated in Utah, with a travel history from southern Nevada, and the second was permanently housed in a shelter in southern Utah [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The only large-scale epidemiological study performed was in Portugal, which sampled 155 stray cats via ear-snipping and identified a single cat infected with \u003cem\u003eO. lupi\u003c/em\u003e [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The most recent case of \u003cem\u003eO. lupi\u003c/em\u003e outside the US was in a client-owned cat from Romania with no travel history and free-range outdoor access [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Additionally, a recent epidemiological study is the only other study assessing \u003cem\u003eO. lupi\u003c/em\u003e prevalence in cats in the US and reports an overall prevalence of 9.4% in cats and dogs. However, it is unclear what proportion of cats tested positive for \u003cem\u003eO. lupi\u003c/em\u003e, separating species prevalence not the study's main objective [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Interestingly, all four reported cat cases worldwide, as well as the three identified in the present study, originated from regions where \u003cem\u003eO. lupi\u003c/em\u003e has been documented in dogs, indicating that cats may play a secondary role for \u003cem\u003eO. lupi\u003c/em\u003e in the epidemiology of this parasite compared to dogs [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. These findings also suggest that cats may serve as reservoirs in endemic areas, thereby potentially contributing to vector transmission dynamics [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Given the limited information on the clinical and epidemiological aspects of \u003cem\u003eO. lupi\u003c/em\u003e, further studies are needed to assess baseline prevalence at local-, national-, and global-scale.\u003c/p\u003e \u003cp\u003eThis newly developed ddPCR assay was adapted from a recently published probe-based qPCR assay in our lab, which was implemented in the largest epidemiological study of shelter dogs in an endemic urban area within the southwestern US [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Following optimization, the original qPCR showed no cross-reactivity with other filarial nematodes found in blood (i.e., \u003cem\u003eDirofilaria immitis, Acanthocheilonema reconditum\u003c/em\u003e) and skin (i.e., \u003cem\u003eCercopithifilaria bainae\u003c/em\u003e) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], all of which are known to co-occur with \u003cem\u003eO. lupi\u003c/em\u003e in the US. This result was consistent with the ddPCR assay, as we found no cross-reactivity among the three \u003cem\u003eO. lupi\u003c/em\u003e-negative sample types, including one containing DNA of an adult \u003cem\u003eD. immitis\u003c/em\u003e specimen. The high diagnostic sensitivity and specificity observed with ddPCR indicate a low likelihood of false positives, unlike with other molecular techniques, such as qPCR and cPCR [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Given the host-agnostic capability of this novel ddPCR, its high sensitivity and specificity, and the limited availability of diagnostic techniques, such as histopathology, imaging, and qPCR, it can also be easily implemented to confirm human cases [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this opportunistic study, 10 of 11 sampled states had at least one confirmed \u003cem\u003eO. lupi\u003c/em\u003e case via ddPCR (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Over half of the states from which samples were submitted are in the southwestern US (n\u0026thinsp;=\u0026thinsp;6/11), where \u003cem\u003eO. lupi\u003c/em\u003e is known to be endemic [\u003cspan additionalcitationids=\"CR12 CR13 CR14\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The remaining positive cases were from four states outside the southwestern US, where \u003cem\u003eO. lupi\u003c/em\u003e endemicity had not previously been confirmed (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. One major limitation of this study was that the sampled companion animals did not report a state of origin, state of adoption, or travel history (recent or former), which could not be provided for every suspected clinical case. Although veterinary ophthalmologists and pathologists submitted these samples, owners may not have shared this information at the time of sampling or, more likely, may not have known it. Additionally, some cases may have remained subclinical for many years and only showed clinical signs at the time of sampling, highlighting the importance of recording the origin of adoption in clinical assessments. Although it is not readily available due to a lack of records from adoption through a breeder or shelter, travel history must be recorded by attending veterinarians, as \u003cem\u003eO. lupi\u003c/em\u003e continues to emerge and may be reported from areas of unknown endemic status [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFor \u003cem\u003eO. lupi\u003c/em\u003e, little is known about whether specific biological factors, such as age, sex, breed, and coat color, increase the risk of infection. A limitation of this study was that age was not available for all clinical cases. However, among those reported, the youngest age for an \u003cem\u003eO. lupi-\u003c/em\u003epositive dog from a subconjunctival sample was 1 year and 7 months. In addition, a recent study from our lab found that two of eight shelter dogs positive for \u003cem\u003eO. lupi\u003c/em\u003e were juveniles (\u0026le;\u0026thinsp;1 year old) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. These findings suggest that the pre-patent period of \u003cem\u003eO. lupi\u003c/em\u003e may be shorter than previously reported at 3\u0026ndash;8 years in other clinical cases [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. In another study, researchers assessed the relationship between coat color and black flies (\u003cem\u003eSimulium\u003c/em\u003e spp.) in dogs in New Mexico, finding that larger dogs with black coats had a higher risk of \u003cem\u003eO. lupi\u003c/em\u003e infection than smaller dogs [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Biological factors such as age and coat color need to be assessed in controlled experimental infections, and future active surveillance studies of companion animals are critical for fully elucidating the biology and epidemiology of \u003cem\u003eO. lupi\u003c/em\u003e across its geographic distribution.\u003c/p\u003e \u003cp\u003eAlthough initially introduced in the 1990s, ddPCR remains relatively new in DNA-based techniques in infectious disease and parasitology diagnostics, especially in the veterinary field, where its capacity for absolute quantification represents a transformative advancement for accurate pathogen detection [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. In veterinary parasitology, ddPCR has recently been implemented to assess signaling pathways, detect drug resistance, and improve current molecular diagnostics [\u003cspan additionalcitationids=\"CR59 CR60 CR61\" citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. However, ddPCR has limitations in terms of cost and clinical diagnostic utility [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. One major limitation of ddPCR is the higher cost of instruments and reagents, which makes its use more difficult, even in reference laboratories, as it is not widely available [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. This is essential for identifying current or past infections to aid in treatment protocols, which is why incorporating a combination of classical parasitology using microscopy-based techniques and highly accurate molecular-based tools is essential for reliable diagnosis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis novel ddPCR assay demonstrated high sensitivity and specificity for detecting \u003cem\u003eO. lupi\u003c/em\u003e across five sample types of suspected companion animal clinical cases, providing greater accuracy than cPCR and qPCR. This study also represents the most extensive series of confirmed clinical cases in the US, with 10 of 11 states sampled having at least one \u003cem\u003eO. lupi\u003c/em\u003e positive case, and four states with the first confirmed clinical case. These results suggest that susceptible hosts face an increased risk of infection in both endemic and non-endemic areas. In clinical settings, this ddPCR assay can serve as a standard diagnostic test in reference laboratories to accurately evaluate suspected cases and can be used in large-scale surveillance studies to identify subclinical infections in various populations, such as shelter and stray dogs. Using molecular diagnostics, such as ddPCR, can elucidate the biology and epidemiology of this zoonotic filarial nematode and support control and prevention efforts.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to acknowledge all\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ethose who assisted with this research, including those from the Texas A\u0026amp;M Parasitology Diagnostic Laboratory. We would also like to thank Dr. Erin Edwards (Texas Veterinary Medical Diagnostic Laboratory, College Station, TX), Kacie Martin (VCA Wyoming Animal Hospital, Albuquerque, NM), Leah Moody (University of Tennessee, Knoxville, TN), and Dan Ward (University of Tennessee, Knoxville, TN) for submitting clinical samples.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMAK:\u003c/strong\u003e Technical writing \u0026ndash; original draft, data curation, laboratory optimization and diagnostic work, methodology validation, formal analysis, statistical analysis. \u003cstrong\u003eNJM:\u0026nbsp;\u003c/strong\u003eData curation and technical writing\u0026mdash;review and editing. \u003cstrong\u003eSP:\u003c/strong\u003e Data curation and technical writing\u0026mdash;review and editing. \u003cstrong\u003eSF:\u003c/strong\u003e Data curation and technical writing\u0026mdash;review and editing. \u003cstrong\u003eTY:\u003c/strong\u003e Data curation and technical writing\u0026mdash;review and editing. \u003cstrong\u003eBF:\u003c/strong\u003e Data curation and technical writing\u0026mdash;review and editing. \u003cstrong\u003eJC:\u003c/strong\u003e Data curation and technical writing\u0026mdash;review and editing. \u003cstrong\u003eJordan West:\u0026nbsp;\u003c/strong\u003eData curation and technical writing\u0026mdash;review and editing. \u003cstrong\u003eKB:\u003c/strong\u003e Data curation and technical writing\u0026mdash;review and editing. \u003cstrong\u003eCS:\u0026nbsp;\u003c/strong\u003eSupervision,\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003elaboratory optimization, data curation, and technical writing\u0026mdash;review and editing. \u0026nbsp;\u003cstrong\u003eHH:\u0026nbsp;\u003c/strong\u003eSupervision,\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003elaboratory optimization and diagnostics work, methodology validation, technical writing \u0026ndash; review and editing.\u003cstrong\u003e\u0026nbsp;PW:\u0026nbsp;\u003c/strong\u003eSupervision, laboratory optimization and diagnostics work, methodology validation, technical writing \u0026ndash; review and editing.\u003cstrong\u003e\u0026nbsp;GGV:\u003c/strong\u003e Supervision, conceptualization, visualization, resources, funding, technical writing \u0026ndash; review and editing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThis research was partially funded by the Thomas B. and Jeannette E. Laws McCabe Fund at the University of Pennsylvania.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eData available upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCollection of samples followed the protocols approved by Texas A\u0026amp;M University\u0026rsquo;s Institutional Animal Care and Use Committee under protocol number 2022-0261.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors consent to the publication of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eDepartment of Veterinary Pathobiology, College of Veterinary Medicine and Biomedical\u003c/p\u003e\n\u003cp\u003eSciences, Texas A\u0026amp;M University, College Station, TX, 77843, USA\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003eVCA Veterinary Care Animal Hospital and Referral Center, Albuquerque, New Mexico, 87111, USA\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e3\u003c/sup\u003eThrive Pet Healthcare Specialists Albuquerque, New Mexico, 87109, US\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e4\u003c/sup\u003eDepartment of Pathology, College of Veterinary Medicine, Midwestern University, Glendale, Arizona, 85029, USA\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e5\u003c/sup\u003eABQ Pet Care Hospital, Albuquerque, New Mexico, 87112, USA\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e6\u003c/sup\u003eCollege of Veterinary Medicine, University of Tennessee, Knoxville, Tennessee, 37996, USA\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e7\u003c/sup\u003eBrookstone Animal Hospital, Acworth, Georgia, 30101, USA\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e8\u003c/sup\u003eAnimal Allergy \u0026amp; Dermatology of Colorado, Colorado Springs, Colorado, 80918, USA\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e9\u003c/sup\u003eComparative Ocular Pathology Laboratory of Wisconsin, University of Wisconsin-Madison, Madison, Wisconsin, 53706, USA\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e10\u003c/sup\u003eCurrent affiliation: Department of Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas, 66506, USA\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e11\u003c/sup\u003eDepartment of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, 19104, USA\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRodonaja T. A new species of nematode, \u003cem\u003eOnchocerca lupi\u003c/em\u003e n. sp., from \u003cem\u003eCanis lupus cubanensis\u003c/em\u003e. Soobshchenyia Akad Nauk Gruzinskoy SSR. 1967;45:715\u0026ndash;719.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMutafchiev Y, Dantas-Torres F, Giannelli A, Abramo F, Papadopoulos E, Cardoso L, et al. Redescription of \u003cem\u003eOnchocerca lupi\u003c/em\u003e (Spirurida: Onchocercidae) with histopathological observations. Parasit Vectors. 2013;6:309. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1756-3305-6-309\u003c/span\u003e\u003cspan address=\"10.1186/1756-3305-6-309\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRojas A, Salant H, Yasur-Landau D, Tsarfati H, Baneth G. First report of \u003cem\u003eOnchocerca lupi\u003c/em\u003e from Israel and confirmation of two genotypes circulating among canine, feline and human hosts. Parasitol. 2020;147(14):1723\u0026ndash;1727. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1017/S0031182020001560\u003c/span\u003e\u003cspan address=\"10.1017/S0031182020001560\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtranto D, Dantas-Torres F, G\u0026uuml;rl\u0026uuml; VP, Sakru N, Yakar K, Bain O, et al. First Evidence of Human Zoonotic Infection by \u003cem\u003eOnchocerca lupi\u003c/em\u003e (Spirurida, Onchocercidae). Am J Trop Med Hyg. 2011;84(1):55\u0026ndash;58. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4269/ajtmh.2011.10-0465\u003c/span\u003e\u003cspan address=\"10.4269/ajtmh.2011.10-0465\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtranto D, Dantas-Torres F, Papadopoulos E, Petric D, Cupina AI, Bain O. Tracking the vector of \u003cem\u003eOnchocerca lupi\u003c/em\u003e in a rural area of Greece. Emerg Infect Dis. 2012;18(7):1196\u0026ndash;1200. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3201/eid1807.AD1807\u003c/span\u003e\u003cspan address=\"10.3201/eid1807.AD1807\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEgyed Z, Sreter T, Szell Z, Beszteri B, Oravecz O, Marialigeti K, et al. Morphologic and genetic characterization of \u003cem\u003eOnchocerca lupi\u003c/em\u003e infecting dogs. Vet Parasitol. 2001;102(4):309\u0026ndash;319. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0304-4017(01)00541-6\u003c/span\u003e\u003cspan address=\"10.1016/S0304-4017(01)00541-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBergua A, Hohberger B, Held J, Muntau B, Tannich E, Tappe D. Human case of \u003cem\u003eOnchocerca lupi\u003c/em\u003e infection, Germany, August 2014. Euro Surveill. 2015;20(16):21099.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMir\u0026oacute; G, Montoya A, Checa R, G\u0026aacute;lvez R, Minguez JJ, Marino V, et al. First detection of \u003cem\u003eOnchocerca lupi\u003c/em\u003e infection in dogs in southern Spain. Parasit Vectors. 2016;9:290. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13071-016-1587-1\u003c/span\u003e\u003cspan address=\"10.1186/s13071-016-1587-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHodzić A, Hinney B, Konig S, Naucke TJ, Duscher G, Joachim A. A case of ocular infection with \u003cem\u003eOnchocerca lupi\u003c/em\u003e in a dog from Germany. Transbound Emerg Dis. 2018;65(1):e214\u0026ndash;e216. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/tbed.12715\u003c/span\u003e\u003cspan address=\"10.1111/tbed.12715\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTudor P, Turcitu M, Mateescu C, Dantas-Torres F, Tudor N, Barbuceanu F, et al. Zoonotic ocular onchocercosis caused by \u003cem\u003eOnchocerca lupi\u003c/em\u003e in dogs in Romania. Parasitol Res. 2016;115(2):859\u0026ndash;862. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00436-015-4816-1\u003c/span\u003e\u003cspan address=\"10.1007/s00436-015-4816-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcLean NJ, Newkirk K, Adema CM. Canine ocular onchocerciasis: a retrospective review of the diagnosis, treatment, and outcome of 16 cases in New Mexico (2011\u0026ndash;2015). Vet Ophthalmol. 2017;20(4):349\u0026ndash;356. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/vop.12433\u003c/span\u003e\u003cspan address=\"10.1111/vop.12433\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtranto D, Giannelli A, Latrofa MS, Dantas-Torres F, Trumble NS, Chavkin M, et al. Canine infections with \u003cem\u003eOnchocerca lupi\u003c/em\u003e nematodes, United States, 2011\u0026ndash;2014. Emerg Infect Dis. 2015;21(5):868\u0026ndash;871. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3201/eid2105.141812\u003c/span\u003e\u003cspan address=\"10.3201/eid2105.141812\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtranto D, Giannelli A, Trumble NS, Chavkin M, Kennard G, Latrofa MS, et al. Clinical case presentation and a review of the literature of canine onchocercosis by \u003cem\u003eOnchocerca lupi\u003c/em\u003e in the United States. Parasit Vectors. 2015;8:89. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13071-015-0699-3\u003c/span\u003e\u003cspan address=\"10.1186/s13071-015-0699-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKelly MA, Clarke E, Hakimi H, Budke CM, Verocai GG. Prevalence of \u003cem\u003eOnchocerca lupi\u003c/em\u003e in shelter dogs from an endemic region of the Southwestern USA. Parasit Vectors. 2025;18(1):335. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13071-025-06988-5\u003c/span\u003e\u003cspan address=\"10.1186/s13071-025-06988-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoe CC, Holiday O, Upshaw-Bia K, Benally G, Williamson CHD, Urbanz J, et al. Biting midges (Diptera: Ceratopogonidae) as putative vectors of zoonotic \u003cem\u003eOnchocerca lupi\u003c/em\u003e (Nematoda: Onchocercidae) in northern Arizona and New Mexico, southwestern United States. Front Vet Sci. 2023;10:1167070. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fvets.2023.1167070\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2023.1167070\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaylor ME, Auten CR, Foster T, Ebbs E, Hofkin BV. Canine ocular onchocerciasis in New Mexico: Risk factors for disease. Vet Ophthalmol. 2021;24(3):288\u0026ndash;94. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/vop.12889\u003c/span\u003e\u003cspan address=\"10.1111/vop.12889\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoe CC, Yaglom H, Howard A, Urbanz J, Verocai GG, Andrews L, et al. Coyotes as Reservoirs for \u003cem\u003eOnchocerca lupi\u003c/em\u003e, United States, 2015\u0026ndash;2018. Emerg Infect Dis. 2020;26(12):2989\u0026ndash;2993. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3201/eid2612.190136\u003c/span\u003e\u003cspan address=\"10.3201/eid2612.190136\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEberhard ML, Ortega Y, Dial S, Schiller CA, Sears AW, Greiner E. Ocular \u003cem\u003eOnchocerca\u003c/em\u003e infections in two dogs in western United States. Vet Parasitol. 2000;90(4):333\u0026ndash;338. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0304-4017(00)00252-1\u003c/span\u003e\u003cspan address=\"10.1016/s0304-4017(00)00252-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGardiner CH, Dick EJ, Jr., Meininger AC, Lozano-Alarc\u0026oacute;n F, Jackson P. Onchocerciasis in two dogs. J Am Vet Med Assoc. 1993;203(6):828\u0026ndash;830.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLabelle AL, Daniels JB, Dix M, Labelle P. \u003cem\u003eOnchocerca lupi\u003c/em\u003e causing ocular disease in two cats. Vet Ophthalmol. 2011;14:105\u0026ndash;110. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1463-5224.2011.00911.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1463-5224.2011.00911.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOrihel TC, Ash LR, Holshuh HJ, Santenelli S. Onchocerciasis in a California dog. Am J Trop Med Hyg. 1991;44(5):513\u0026ndash;217. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4269/ajtmh.1991.44.513\u003c/span\u003e\u003cspan address=\"10.4269/ajtmh.1991.44.513\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerocai GG, Conboy G, Lejeune M, Marron F, Hanna P, MacDonald E, et al. \u003cem\u003eOnchocerca lupi\u003c/em\u003e nematodes in dogs exported from the United States into Canada. Emerg Infect Dis. 2016;22(8):1477\u0026ndash;1479. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3201/eid2208.151918\u003c/span\u003e\u003cspan address=\"10.3201/eid2208.151918\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerocai GG, Sobotyk C, Lamison A, Borst MM, Edwards EE. Autochthonous, zoonotic \u003cem\u003eOnchocerca lupi\u003c/em\u003e in a south Texas dog, United States. Parasit Vectors. 2021;14(1):203. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13071-021-04707-4\u003c/span\u003e\u003cspan address=\"10.1186/s13071-021-04707-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWallitsch K, Jaffey JA, Ferguson S, Verocai GG, Sobotyk C, van Eerde E, et al. Extensive aberrant migration of \u003cem\u003eOnchocerca lupi\u003c/em\u003e in a dog. Top Companion Anim Med. 2022;49:100666. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tcam.2022.100666\u003c/span\u003e\u003cspan address=\"10.1016/j.tcam.2022.100666\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZarfoss MK, Dubielzig RR, Eberhard ML, Schmidt KS. Canine ocular onchocerciasis in the United States: two new cases and a review of the literature. Vet Ophthalmol. 2005;8(1):51\u0026ndash;57. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1463-5224.2005.00348.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1463-5224.2005.00348.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJones KEV, Terhaar HM, Jeffries C, Moore AR, Lappin MR, de Linde Henriksen M. What is your diagnosis? Impression smear of a conjunctival mass in a dog. Vet Clin Pathol. 2023;52(Suppl 2):103\u0026ndash;106. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/vcp.13105\u003c/span\u003e\u003cspan address=\"10.1111/vcp.13105\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaia C, Annoscia G, Latrofa MS, Pereira A, Giannelli A, Pedroso L, et al. \u003cem\u003eOnchocerca lupi\u003c/em\u003e nematode in cat, Portugal. Emerg Infect Dis. 2015;2112:2252\u0026ndash;2254. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3201/eid2112.150061\u003c/span\u003e\u003cspan address=\"10.3201/eid2112.150061\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTudor P, Ionascu I, Mateescu CI, Bezerra-Santos MA, Gurau MR, Mateescu RE, et al. Feline ocular onchocercosis by \u003cem\u003eOnchocerca lupi\u003c/em\u003e: Phylogenetic insights and implication for veterinary health. Acta Trop. 2023;237:106723. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.actatropica.2022.106723\u003c/span\u003e\u003cspan address=\"10.1016/j.actatropica.2022.106723\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKraai TL, Alarcon A, Lopez A, Verocai GG, McLean NJ, Qvarnstrom Y, et al. Recurrence or reinfection with \u003cem\u003eOnchocerca lupi\u003c/em\u003e in a child in 2021 and 2024 in New Mexico amid rising canine infections. Am J Trop Med Hyg. 2025;113(4):844\u0026ndash;847. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4269/ajtmh.24-0795\u003c/span\u003e\u003cspan address=\"10.4269/ajtmh.24-0795\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEberhard ML, Ostovar GA, Chundu K, Hobohm D, Feiz-Erfan I, Mathison BA, et al. Case report: Zoonotic \u003cem\u003eOnchocerca lupi\u003c/em\u003e infection in a 22-month-old child in Arizona: first report in the United States and a review of the literature. Am J Trop Med Hyg. 2013;88(3):601\u0026ndash;605. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4269/ajtmh.12-0733\u003c/span\u003e\u003cspan address=\"10.4269/ajtmh.12-0733\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCantey PT, Eberhard M, Weeks J, Swoboda S, Ostovar GA. \u003cem\u003eOnchocerca lupi\u003c/em\u003e infection. J Neurosurg Pediatr. 2016;17(1):118\u0026ndash;119. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3171/2015.6.Peds15344\u003c/span\u003e\u003cspan address=\"10.3171/2015.6.Peds15344\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAsghari A, Adhami G, Shariatzadeh SA, Kordi B, Anvari D, Shams M, et al. Confirmed cases of human \u003cem\u003eOnchocerca lupi\u003c/em\u003e infection: a systematic review of an emerging threat. Parasitol Res. 2021;120(11):3633\u0026ndash;644. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00436-021-07309-2\u003c/span\u003e\u003cspan address=\"10.1007/s00436-021-07309-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiswas A, Yassin MH. An unexpected cause of eye irritation: A case of zoonotic ocular onchocerciasis. Case Rep Infect Dis. 2013;2013:1\u0026ndash;3. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2013/504749\u003c/span\u003e\u003cspan address=\"10.1155/2013/504749\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDudley RWR, Smith C, Dishop M, Mirsky D, Handler MH, Rao S. A cervical spine mass caused by \u003cem\u003eOnchocerca lupi\u003c/em\u003e. Lancet. 2015;386(10001):1372. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0140-6736(14)62255-8\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(14)62255-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCantey PT, Weeks J, Edwards M, Rao S, Ostovar GA, Dehority W, et al. The emergence of zoonotic \u003cem\u003eOnchocerca lupi\u003c/em\u003e infection in the United States\u0026ndash;A case-series. Clin Infect Dis. 2016;62(6):778\u0026ndash;783. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/cid/civ983\u003c/span\u003e\u003cspan address=\"10.1093/cid/civ983\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu DB, Ko BD, Hernandez GL, Botros J, Spader H, Sapp S, et al. Neuroinvasive \u003cem\u003eOnchocerca lupi\u003c/em\u003e infection in a ten-year-old Girl. Case Rep Infect Dis. 2022;2022:9773058. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2022/9773058\u003c/span\u003e\u003cspan address=\"10.1155/2022/9773058\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGruntmeir J, Kelly M, Ramos RAN, Verocai GG. Cutaneous filarioid nematodes of dogs in the United States: Are they emerging, neglected, or underdiagnosed parasites? Front Vet Sci. 2023;10. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fvets.2023.1128611\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2023.1128611\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHassan HK, Bolcen S, Kubofcik J, Nutman TB, Eberhard ML, Middleton K, et al. Isolation of \u003cem\u003eOnchocerca lupi\u003c/em\u003e in Dogs and black flies, California, USA. Emerg Infect Dis. 2015;21(5):789\u0026ndash;796. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3201/eid2105.142011\u003c/span\u003e\u003cspan address=\"10.3201/eid2105.142011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtranto D, Dantas-Torres F, Giannelli A, Abramo F, Cupina AI, Petric D, et al. Cutaneous distribution and circadian rhythm of \u003cem\u003eOnchocerca lupi\u003c/em\u003e microfilariae in dogs. PLoS Negl Trop Dis. 2013;7(12). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pntd.0002585\u003c/span\u003e\u003cspan address=\"10.1371/journal.pntd.0002585\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtranto D, Dantas-Torres F, Giannelli A, Latrofa MS, Papadopoulos E, Cardoso L, et al. Zoonotic \u003cem\u003eOnchocerca lupi\u003c/em\u003e infection in dogs, Greece and Portugal, 2011\u0026ndash;2012. Emerg Infect Dis. 2013;19(12):2000\u0026ndash;2003. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3201/eid1912.130264\u003c/span\u003e\u003cspan address=\"10.3201/eid1912.130264\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFranchini D, Giannelli A, Di Paola G, Cortes H, Cardoso L, Lia RP, et al. Image diagnosis of zoonotic onchocercosis by \u003cem\u003eOnchocerca lupi\u003c/em\u003e. Vet Parasitol. 2014;203(1\u0026ndash;2):91\u0026ndash;95. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.vetpar.2014.03.007\u003c/span\u003e\u003cspan address=\"10.1016/j.vetpar.2014.03.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdelmann ML, Jager M, Espinheira F, Ledbetter EC. In vivo confocal microscopy for detection of subconjunctival \u003cem\u003eOnchocerca lupi\u003c/em\u003e infection in a dog. Vet Ophthalmol. 2018;21(6):632\u0026ndash;637. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/vop.12547\u003c/span\u003e\u003cspan address=\"10.1111/vop.12547\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLatrofa MS, Annoscia G, Colella V, Cavalera MA, Maia C, Martin C, et al. A real-time PCR tool for the surveillance of zoonotic \u003cem\u003eOnchocerca lupi\u003c/em\u003e in dogs, cats and potential vectors. PLoS Negl Trop Dis. 2018;12(4):e0006402. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pntd.0006402\u003c/span\u003e\u003cspan address=\"10.1371/journal.pntd.0006402\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Almeida M, Nascimento FS, Mathison BA, Bishop H, Bradbury RS, Cama VA, et al. Duplex real-time PCR assay for clinical differentiation of \u003cem\u003eOnchocerca lupi\u003c/em\u003e and \u003cem\u003eOnchocerca volvulus\u003c/em\u003e. Am J Trop Med Hyg. 2020;103(4):1556\u0026ndash;1562. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4269/ajtmh.20-0113\u003c/span\u003e\u003cspan address=\"10.4269/ajtmh.20-0113\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaidoudi Y, Bedjaoui S, Medkour H, Latrofa MS, Mekroud A, Bitam I, et al. Molecular approach for the diagnosis of blood and skin canine filarioids. Microorganisms. 2020;8(11). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/microorganisms8111671\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms8111671\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoe CC, Urbanz J, Auten C, Verocai GG, Upshaw-Bia K, Holiday O, et al. LupiQuant: A real-time PCR-based assay for determining host-to-parasite DNA ratios of \u003cem\u003eOnchocerca lupi\u003c/em\u003e and host \u003cem\u003eCanis lupus\u003c/em\u003e from onchocercosis samples. PLoS One. 2022;17(11):e0276916. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0276916\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0276916\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLatrofa MS, Louzada-Flores VN, Maia C, Kelly MA, Verocai GG, Cantacessi C, et al. Development of an indirect ELISA for the serodiagnosis of canine infection by \u003cem\u003eOnchocerca lupi\u003c/em\u003e. Sci Rep. 2024;14(1). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-024-53759-w\u003c/span\u003e\u003cspan address=\"10.1038/s41598-024-53759-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaltrušis P, H\u0026ouml;glund J. Digital PCR: modern solution to parasite diagnostics and population trait genetics. Parasit Vectors. 2023;16(1):143. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13071-023-05756-7\u003c/span\u003e\u003cspan address=\"10.1186/s13071-023-05756-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi H, Bai R, Zhao Z, Tao L, Ma M, Ji Z, et al. Application of droplet digital PCR to detect the pathogens of infectious diseases. Biosci Rep. 2018;38(6). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1042/bsr20181170\u003c/span\u003e\u003cspan address=\"10.1042/bsr20181170\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasiraghi M, Anderson TJC, Bandi C, Bazzocchi C, Genchi C. A phylogenetic analysis of filarial nematodes: comparison with the phylogeny of \u003cem\u003eWolbachia\u003c/em\u003e endosymbionts. Parasitol. 2001;122(1):93\u0026ndash;103 doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1017/s0031182000007149\u003c/span\u003e\u003cspan address=\"10.1017/s0031182000007149\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol. 2018;356:1547\u0026ndash;1549; doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/molbev/msy096\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msy096\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDohoo IR, Martin W, Stryhn H. Veterinary epidemiologic research. Second edition. edn. Charlotte, P.E.I.: VER, Inc.; 2009.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcHugh ML. Interrater reliability: The kappa statistic. Biochem Med (Zagreb). 2012;22(3):276\u0026ndash;282. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.11613/BM.2012.031\u003c/span\u003e\u003cspan address=\"10.11613/BM.2012.031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCohen J. A Coefficient of Agreement for Nominal Scales. Educational and Psychological Measurement. 1960;20(1):37\u0026ndash;46. doi.10.1177/001316446002000104.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcGarry JW, Carrozza R, Bradley C, Latrofa MS, Makepeace BL, Otranto D. \u003cem\u003eOnchocerca lupi\u003c/em\u003e in imported dogs in the UK: implications for animal and public health. BMC Vet Res. 2022;18(1):66. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12917-022-03169-9\u003c/span\u003e\u003cspan address=\"10.1186/s12917-022-03169-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePomari E, Piubelli C, Perandin F, Bisoffi Z. Digital PCR: a new technology for diagnosis of parasitic infections. Clin Microbiol Infect. 2019;25(12):1510\u0026ndash;1516. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cmi.2019.06.009\u003c/span\u003e\u003cspan address=\"10.1016/j.cmi.2019.06.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsokana CN, Symeonidou I, Sioutas G, Gelasakis AI, Papadopoulos E. Current applications of digital PCR in veterinary parasitology: An Overview. Parasitologia. 2023;3(3):269\u0026ndash;283. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/parasitologia3030028\u003c/span\u003e\u003cspan address=\"10.3390/parasitologia3030028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShang Kuan T-C: Developmental regulation of \u003cem\u003eDirofilaria immitis\u003c/em\u003e microfilariae and evaluation of ecdysone signaling pathway transcript level using droplet digital polymerase chain reaction [master\u0026rsquo;s thesis]. Montreal (QC) C: McGill University; 2020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Lalicon IK, Prichard RK, Long T. Development and evaluation of quadruplex droplet-digital PCR assay for rapid detection of molecular markers associated with macrocyclic lactone resistance and susceptibility in \u003cem\u003eDirofilaria immitis\u003c/em\u003e. Int J Parasitol: Drugs Drug Resist. 2025:100625. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ijpddr.2025.100625\u003c/span\u003e\u003cspan address=\"10.1016/j.ijpddr.2025.100625\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaltrušis P, Halvarsson P, H\u0026ouml;glund J. Exploring benzimidazole resistance in \u003cem\u003eHaemonchus contortus\u003c/em\u003e by next generation sequencing and droplet digital PCR. Int J Parasitol: Drugs Drug Resist. 2018;8(3):411\u0026ndash;419. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ijpddr.2018.09.003\u003c/span\u003e\u003cspan address=\"10.1016/j.ijpddr.2018.09.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKao Y-F, Peake B, Madden R, Cowan SR, Scimeca RC, Thomas JE, et al. A probe-based droplet digital polymerase chain reaction assay for early detection of feline acute cytauxzoonosis. Vet Parasitol. 2021;292:109413. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.vetpar.2021.109413\u003c/span\u003e\u003cspan address=\"10.1016/j.vetpar.2021.109413\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeerarathne P, Sanders TL, Kao YF, Cotey SR, Place JD, Fairbanks WS, et al. High prevalence of \u003cem\u003eCytauxzoon felis\u003c/em\u003e in bobcats (\u003cem\u003eLynx rufus\u003c/em\u003e) across Oklahoma and occurrence in West Texas, USA. J Wildl Dis. 2023;59(3):432\u0026ndash;441. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7589/jwd-d-22-00152\u003c/span\u003e\u003cspan address=\"10.7589/jwd-d-22-00152\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Cutaneous filarial nematode, companion animals, droplet digital PCR, molecular diagnostics, ocular onchocercosis, zoonotic onchocerciasis","lastPublishedDoi":"10.21203/rs.3.rs-9407830/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9407830/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003e \u003cem\u003eOnchocerca lupi\u003c/em\u003e, a zoonotic filarial nematode documented in southwestern North America and the Old World, is associated with ocular onchocerciosis in dogs and cats. Clinical signs range from ocular discharge and conjunctivitis to chronic nodular lesions involving the conjunctiva, sclera, and retrobulbar space. Many infections remain subclinical and undiagnosed. Current diagnostic approaches rely on microscopy and conventional PCR (cPCR) to confirm adult worms in nodules or microfilariae in skin snips. Real-time PCR (qPCR) has been applied primarily in large-scale epidemiological studies. However, amplification of \u003cem\u003eO. lupi\u003c/em\u003e DNA may be inhibited, leading to false-negative results. Highly sensitive techniques such as droplet digital PCR (ddPCR) can enable the detection of parasite DNA in various biological samples through absolute quantification. The objectives of this study were to: I) validate a novel ddPCR assay that detects \u003cem\u003eO. lupi\u003c/em\u003e, and II) assess the performance of the ddPCR assay compared to cPCR and qPCR in suspected clinical cases.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eFollowing assay validation and optimization, 202 suspected clinical cases from 11 US states were assessed. Of these clinical cases, 97% (n\u0026thinsp;=\u0026thinsp;196/202) were dogs, and 3% (n\u0026thinsp;=\u0026thinsp;6/202) were cats. Samples included adult specimen \u003cem\u003eO. lupi\u003c/em\u003e fragments (n\u0026thinsp;=\u0026thinsp;34/202), subconjunctival nodule biopsies (n\u0026thinsp;=\u0026thinsp;103/202), interscapular skin snips (n\u0026thinsp;=\u0026thinsp;23/202), lower ear skin snips (n\u0026thinsp;=\u0026thinsp;3/202), and formalin-fixed paraffin-embedded (FFPE) tissue samples (n\u0026thinsp;=\u0026thinsp;39/202), all previously assessed using cPCR and qPCR. Statistical analysis was performed to assess agreement using Cohen\u0026rsquo;s kappa (κ), and Cochran\u0026rsquo;s Q test was used to compare the pattern of positive/negative results of the three diagnostic techniques.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eOverall, the ddPCR detected 71.3% (n\u0026thinsp;=\u0026thinsp;144/202) of clinical cases as positive for \u003cem\u003eO. lupi\u003c/em\u003e, including 71.9% of dog samples (n\u0026thinsp;=\u0026thinsp;141/196), outperforming qPCR (64.8%; n\u0026thinsp;=\u0026thinsp;127/196) and cPCR (54.1%; n\u0026thinsp;=\u0026thinsp;106/196). Additionally, we confirmed \u003cem\u003eO. lupi\u003c/em\u003e infection in 50% (n\u0026thinsp;=\u0026thinsp;3/6) of the cat samples across all three diagnostic tests. Statistical analysis showed moderate agreement between cPCR\u0026thinsp;+\u0026thinsp;qPCR (κ\u0026thinsp;=\u0026thinsp;0.74), fair agreement between cPCR\u0026thinsp;+\u0026thinsp;ddPCR (κ\u0026thinsp;=\u0026thinsp;0.60), and almost perfect agreement between qPCR\u0026thinsp;+\u0026thinsp;ddPCR (κ\u0026thinsp;=\u0026thinsp;0.81). This study represents the largest series of suspected \u003cem\u003eO. lupi\u003c/em\u003e clinical cases in companion animals in the US to date, with positive detections reported in 10 of 11 sampled states, although travel history was not always available.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe validated, host-agnostic ddPCR assay demonstrated superior sensitivity across multiple sample types and provides a robust tool for clinical diagnosis and large-scale surveillance studies, supporting improved epidemiological understanding and One Health-based prevention strategies.\u003c/p\u003e","manuscriptTitle":"Enhanced molecular diagnosis of Onchocerca lupi using droplet digital PCR in clinically suspected companion animals","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-27 10:51:56","doi":"10.21203/rs.3.rs-9407830/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-05-01T13:21:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"174521218877554765653000543228239365226","date":"2026-04-27T07:43:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"270500917775523485690080934123845024639","date":"2026-04-22T14:30:32+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-18T13:56:13+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-17T13:56:50+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-17T12:47:53+00:00","index":"","fulltext":""},{"type":"submitted","content":"Parasites \u0026 Vectors","date":"2026-04-13T19:15:14+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f45ddaeb-7f21-4544-9ec3-6b81df7ecd61","owner":[],"postedDate":"April 27th, 2026","published":true,"recentEditorialEvents":[{"type":"editorInvitedReview","content":"","date":"2026-05-01T13:21:50+00:00","index":20,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-04-27T10:51:56+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-27 10:51:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9407830","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9407830","identity":"rs-9407830","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00