Early synaptic changes and reduced brain connectivity in PD-like mice with depressive phenotype | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Early synaptic changes and reduced brain connectivity in PD-like mice with depressive phenotype Lluis Miquel-Rio, Judith Jericó-Escolar, Unai Sarriés-Serrano, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6179126/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 13 Aug, 2025 Read the published version in npj Parkinson's Disease → Version 1 posted 8 You are reading this latest preprint version Abstract Anxiety and depression are common in Parkinson's disease (PD), affecting quality of life. Aggregates of α-synuclein (α-Syn) are found in serotonergic (5-HT) raphe nuclei early in the disease, but their relationship to brain changes is unclear. We investigated synaptic plasticity, neuronal activity, and functional magnetic resonance imaging (fMRI)-based brain connectivity in a PD-like mouse model with depressive phenotype. AAV-induced human α-Syn accumulation in raphe 5-HT neurons causes progressive synaptic pathology in interconnected brain regions. This is marked by lower MAP-2, PSD95 and higher SV2A, VAMP2, which are key to synaptic structure and function, as confirmed in human brain tissue samples. Abnormalities in Egr-1-dependent neuronal activity and region-specific differences in resting-state functional brain activity were also detected eight weeks post-AAV infusion, before neurodegeneration. This provides evidence for synaptic and fMRI markers associated with α-Syn pathology in emotional brain circuits, and has translational importance for identifying PD patients at risk for depression. Biological sciences/Molecular biology Biological sciences/Neuroscience Biological sciences/Systems biology Health sciences/Diseases Health sciences/Neurology INTRODUCTION Parkinson’s disease (PD) is the most prevalent neurodegenerative motor disorder worldwide, with resting tremor, rigidity, bradykinesia and postural instability being the main symptoms of the disease 1 , 2 . However, growing evidence suggests that PD is a disorder with numerous non-motor symptoms that affect multiple, non-dopaminergic neuronal populations aside from the dopaminergic (DA) system 3 , 4 . Among mental health disorders, depression is one of the major non-motor symptoms of PD, with approximately 40–50% of patients with PD suffering from depressive disorder 5 – 7 . Although depression may be secondary to progressive and disabling motor symptoms, a significant number of PD patients present comorbid depression early in the prodromal phase, and many have somewhat more rapid disease progression 8 – 10 . This suggests that depression may influence primary motor impairments or signal more severe forms of PD. Therefore, it is not surprising that converging evidence suggests that a first occurrence of depression significantly increases the risk of developing PD later in life. Considerable efforts have been devoted to elucidate the neural basis of depression in PD (D-PD). Postmortem studies suggest that pathological processes may occur early in cortical and limbic regions linked to emotional control 11 – 13 , providing insight into the pathological mechanisms of depression in the pre-motor PD phase. Indeed, neurotransmitter imaging studies have shown abnormal serotonin (5-HT) innervation and neurotransmission in different brain regions including the dorsolateral prefrontal cortex (dlPFC), orbitofrontal cortex, anterior cingulate cortex (ACC), caudate nucleus (CAU), thalamus, and hippocampus (HPC) in D-PD patients 14 – 17 . However, other neuroimaging studies also suggest a loss of DA and noradrenaline fibers in the limbic regions in patients with D-PD 13 , 18 , 19 . Abnormal functional activity in the PFC, e.g. dlPFC and ACC, has been characterized as a critical feature in the pathophysiology of depressive disorders, as well as in the favorable outcomes of new antidepressant strategies 20 – 23 . Of note, the PFC is strongly innervated by raphe 5-HT neurons 24 , 25 and 5-HT dysfunction is linked to depressive disorder, also in PD 16 , 26 . Consistent with these data, several structural and functional neuroimaging studies have shown pronounced changes in the PFC networks in D-PD patients that differ from those of patients with PD alone 27 – 29 . Previous studies using 2-[ 18 F]-fluoro-2-deoxy-D-glucose and positron emission tomography (PET) showed hypo-metabolism in the orbitofrontal cortex and ACC 30 , 31 , suggesting that D-PD may be associated with orbital-inferior frontal lobe dysfunction. In addition, using magnetic resonance imaging (MRI), cortical thinning and white matter abnormalities have been reported in prefrontal, temporal and some limbic regions in patients with D-PD 32 – 34 . Reduced bilateral HPC and amygdala (Amg) volumes are other neuroanatomical correlates of depressive symptoms in PD 35 , 36 . More recently, it has been proposed that abnormal cortical-limbic circuit activity and connectivity, which suggest altered higher-order control of negative mood, is a possible neural mechanism of D-PD. Resting-state functional MRI (rs-fMRI) analysis showed reduced functional connectivity between the ACC and the right tempo-parietal junction, as well as between the posterior cingulate cortex and the insula, and between the superior parietal lobule and the PFC in patients with D-PD, distinguishing them from those PD patients without depression 28 , 37 – 39 . Other connectome studies have also reported a decrease in functional connectivity within the cortical-limbic networks, together with an increase in connectivity between limbic regions, e.g. increased functional connectivity between amygdala with the bilateral mediodorsal thalamus, in patients with D-PD 37 , 40 , 41 . These data suggest that the salient circuitry involved in emotion recognition, and negative emotions in particular, may be impaired in comorbid depressive symptoms in PD, and the underlying pathological mechanisms await further elucidation. The causes of PD are unclear, but the build-up of the α-synuclein protein (α-Syn) is a key part of the disease process 16 , 42 . α-Syn is expressed in all neuronal types, where it modulates axonal transport, vesicle dynamics and, ultimately synaptic plasticity 43 , 44 . Its overexpression in mouse raphe 5-HT neurons causes an increase in phosphorylation and aggregation of α-Syn protein, together with progressive accumulation of α-Syn in 5-HT-positive fibers in cortico-limbic regions, deficits in the brain-derived neurotrophic factor (BDNF) expression and reduced 5-HT neurotransmission, resulting in a depressive-like phenotype 45 . Of note, depression has been associated with elevated plasma α-Syn levels 46 , and we found higher levels of phospho-α-Syn in postmortem dlPFC and CAU samples from patients with depression, comparable to those of early-stage PD patients (Braak 2–3) 47 , which seems significant given the prevalence of depression in PD. Here, we combined rs-fMRI with synaptic and cellular activity mapping in the D-PD-like mouse model 45 to probe how α-Syn accumulation in the brain 5-HT system leads to synaptic and connectivity dysfunctions in brain areas controlling mood and emotional processes. We found altered synaptic marker density, increased cellular activity, and reduced rs-fMRI coupling of medial PFC (mPFC), caudate-putamen (CPu), and HPC with their cortico-subcortical targets dependent on changes in 5-HT neuroplasticity associated with α-Syn pathology. Changes in synaptic markers were confirmed in post-mortem samples from PD patients. These findings may be useful in facilitating a better understanding of the potential mechanism underlying depression in PD. RESULTS D-PD-like mouse model with h-α-Syn overexpression in raphe 5-HT neurons First, we confirmed that expression of the wild-type human α-Syn transgene (h-α-Syn) in 5-HT raphe neurons results in a progressive increase in h-α-Syn protein levels in the mouse 5-HT ascending system, as previously described 45 . Here we use a novel AAV2/5-CBh-WPRE3A vector encoding h-α-Syn (denoted AAV-α-Syn, provided by the MJJ Foundation) - previously we used AAV5-CBh-α-Syn 45 - infused into the mouse dorsal raphe nucleus (DR). To investigate the time-course of h-α-Syn expression, male and female mice were euthanized at 4- and 8-weeks post-injection. Increased h-α-Syn protein density levels were detected in the rostral-caudal axis of the DR (anteroposterior – AP coordinates from − 4.24 to -4.72 mm) of both males and females compared to the respective control group injected with the empty AAV2/5-CBh-WPRE3 vector containing non-coding (null) stuffer DNA (AAV-EV) (p < 0.0001) (Fig. 1 A, 1 B, Suppl 1A, 1B ). However, while the maximum increase in h-α-Syn density levels was found in male mice 8 weeks later (∼341% vs. ∼477% compared to control group at 4 and 8 weeks, respectively), no significant differences were found in female mice at 4 and 8 weeks post-AAV-α-Syn injection (∼295% and ∼286%, respectively) (Fig. 1 B, Suppl 1B) . Further histological analysis was performed to assess whether h-α-Syn protein co-localized with cells positive for the neuronal 5-HT-specific marker tryptophan hydroxylase (TPH). We found progressively significant increases in the number of TPH-positive cells co-localizing with h-α-Syn in the DR of male mice. At 8 weeks post-infusion 82.5 ± 1.3% of TPH-positive cells were positive for h-α-Syn immunoreactivity, compared to 66.4 ± 0.9% detected at 4 weeks post-infusion (p < 0.001) (Fig. 1 B ) . No significant differences were observed in female mice and we found a similar number of double positive cells for TPH and h-α-Syn in the DR (83.1 ± 1.9% and 84.2 ± 0.9% of double TPH/h-α-Syn-positive cells at 4 and 8 weeks, respectively) ( Suppl 1B). No loss of TPH-positive cells was observed in either sex, at least in this timeline. As we have found sex-related differences in raphe h-α-Syn accumulation and in behavioral profiles, e.g., stress-related behavior in males vs. anxiety-related behavior in females 48 , here we focused the next experiments on male mice. In the DR, the five major neuronal classes (in decreasing order of abundance) are 5-HT, DA, GABA, glutamate, and peptidergic neurons 49 . Therefore, we examined whether the two most important non-5-HT neuronal populations in the DR, DA and GABA neurons, are positive for h-α-Syn or its phosphorylated form at amino-acid serine-129 (p-α-Syn). We found that of the total number of p-α-Syn-positive cells in the DR, a small number were also positive for the GABA GAD67 marker (1.9 ± 0.2% and 3.7 ± 0.3% at 4 and 8 weeks, respectively) (Fig. 1 C, 1 D). In addition, we detected 62.4 ± 1.3% and 76.2 ± 0.9% of double-positive cells for the DA tyrosine hydroxylase (TH) neuron marker and h-α-Syn in more rostral DR regions (AP coordinates − 4.24 to -4.36 mm) at 4 and 8 weeks post-injection, respectively, with no change in the total number of TH-positive neurons compared to AAV-EV control group (Fig. 1 E, 1 F). Next, we analyzed the accumulation of h-α-Syn in efferent brain areas including the mPFC, cingulate cortex (Cg), CPu, and HPC of AAV-EV and AAV-α-Syn injected mice. As previously reported 45 , we confirmed an abundant and progressive presence of h-α-Syn-positive fibers in the different brain areas analyzed, reaching maximum levels 8 weeks later compared to 4 weeks (p < 0.05 − 0.001) (Fig. 1 G, 1 H). The h-α-Syn signal was exclusively axonal and no h-α-Syn cell bodies were detected, as previously 50 . In parallel, a significant loss of serotonin transporter-(SERT)-positive axons was observed in all brain areas examined 8 weeks later (p < 0.05 − 0.001; Suppl 2 ). In addition, we analyzed SERT/h-α-Syn-positive fiber density and found values (in descending order of density) of 39.2 ± 2.5%, 30.9 ± 2.7%, 20.1 ± 4.5%, and 15.8 ± 1.5% in CPu > Cg > mPFC > HPC at 8 weeks post-injection, indicating that h-α-Syn protein was transported anterogradely along 5-HT axons towards synaptic terminals. More interestingly, we also detected some TH-positive fibers co-localizing with h-α-Syn at 4 and 8 weeks post-injection. These were examined only in CPu and Cg of AAV-h-α-Syn-injected mice in DR compared to the control group ( Suppl 3A, 3B ). Analysis showed a progressive increase in the number of TH/h-α-Syn-positive fibers (CPu: 5.41 ± 0.9%, 10.5 ± 1.9%; Cg: 12.0 2.7%, 21.3 0.8 at 4 and 8 weeks later, respectively), although to a lesser extent compared to the density of SERT/h-α-Syn-positive fibers in the same brain areas. No significant difference in the TH-positive axon density was observed in the brain areas analysed ( Suppl 3C, 3D). Synaptic pathology in efferent brain regions in the D-PD-like mouse model In physiological conditions, α-Syn is abundant in the pre-synaptic compartment 51 . Neuropathological and experimental studies provided evidence that α-Syn aggregation might start at pre-synaptic terminals, inducing synaptic degeneration and subsequently neuronal loss 43 , 52 . Since an accumulation of the h-α-Syn protein was detected in efferent brain regions after infusion of AAV-h-α-Syn in DR, we mapped synaptic changes using different pre- and post-synaptic markers in interconnected brain areas. Immunoreactivity for synaptic vesicle glycoprotein 2A (SV2A), an integral glycoprotein found in the membranes of synaptic vesicles in all synaptic terminals and widely distributed throughout the brain, was increased by ∼87.8% in Cg (p < 0.0001) and by ∼82.6% in CPu (p < 0.0001) of AAV-h-α-Syn injected mice compared to control group at 8 weeks’ post-infusion. No changes were observed in other brain areas analyzed (Fig. 2 A, 2 B ) . In parallel, synaptophysin (SYP) density, another abundant synaptic vesicle membrane protein comprising ∼10% of the total synaptic protein 53 , was also increased in Cg (∼25%, p < 0.05) and CPu (∼40%, p < 0.01) of the same AAV-h-α-Syn injected mice compared to control group at 8 weeks post-infusion. Within the groups, a similar SYP density was detected in all other brain regions (Fig. 2 C, 2 D). We also examined the density of microtubule-associated protein 2 (MAP-2), a dendritically enriched protein that controls microtubule dynamics, cellular transport, and synaptic function 54 , 55 , in AAV-h-α-Syn injected mice compared to control group (Fig. 2 E, 2 F). MAP-2 density was significantly decreased in all brain areas assessed at 8 weeks (reduction of ∼72.3% in prelimbic cortex - PrL, ∼74% in infralimbic cortex - IL, ∼58% in Cg, ∼51% CPu, ∼40% in CA1, and ∼44% in CA2/3; p < 0.05 − 0.001). Taken together, the progressive axonal α-Syn accumulation is associated with an aberrant increase in the density of pre-synaptic markers and a decrease in MAP-2 immunoreactivity throughout the brain, especially after 8 weeks. We then performed immunoblot analysis on microdissected mouse mPFC, CPu, and HPC extracted 8 weeks after intra-DR injection of AAV-h-α-Syn or AAV-EV. Western-blot (WB) analysis confirmed a regional increase in the levels of the presynaptic markers SV2A (p < 0.01), SYP (p < 0.01), and VAMP2 (vesicle associated membrane protein 2, p < 0.05) in mPFC and marginal effects in CPu (SV2A, p = 0.060; SYP, p = 0.088; VAMP2, p < 0.05) compared to control group (Fig. 3 A-D). The changes in synaptic markers in the mPFC, but not in the CPu, were accompanied by a significant increase in the levels of the motor protein dynein (p < 0.01) (Fig. 3 E). There was also a significant reduction in the post-synaptic marker PSD95 (postsynaptic density protein 95) in the mPFC (p < 0.05) and CPu (p < 0.05) compared to controls (Fig. 3 F). No changes in these synaptic markers were found in the HPC from mice overexpressing h-α-Syn in DR. Synaptic pathology in cortical and subcortical brain areas in PD patients Previously, we showed that the accumulation of oligomeric α-Syn in the dlPFC of PD patients at different Braak stages (early B2-3 and late B5-6) correlates with an increase in PERK-eIF2α signaling, which is known to control the quality of synaptic proteins 47 . Here, we investigated whether the increased α-Syn levels in different brain areas is associated with regional changes in synaptic markers, as assessed in D-PD-like mice. First, we confirmed the regional presence of oligomeric α-Syn in the dlPFC, CAU, and HPC of PD patients at B2-3 and B5-6 by WB compared to controls (p < 0.05 − 0.001; Fig. 4 A, 4 B). We also detected a significant reduction in SERT levels in the dlPFC and CAU (marginal effects in HPC) examined in both B2-3 and B5-6 stages compared to control group (p < 0.05 − 0.001; Fig. 4 C, 4 D). In parallel, presynaptic SV2A and SYP protein levels were significantly increased in the dlPFC and CAU of PD patients at B2-3 compared to the control group (p < 0.05 − 0.01), but their density decreased in all brain areas examined at B5-6 compared to the control group (p < 0.05 − 0.01; Fig. 4 E- 4 G). For presynaptic VAMP2 protein, WB analysis showed higher levels in the dlPFC and CAU at the onset of the disease (B2-3) and decreased levels in CAU and HPC in the late stage (B5-6) compared to the respective control groups (p < 0.05 − 0.001; Fig. 4 E, 4 H). WB analysis of dynein showed marginal increases in motor protein levels in dlPFC (p = 0.055) and CAU (p = 0.064) at B2-3 and a slight reduction in HPC (p = 0.061) at B5-6 compared to controls (Fig. 4 E, 4 I). Furthermore, regionally increased α-Syn levels were associated with reduced PSD95 levels in dlPFC, CAU, and HPC of PD patients at B5-6 compared to the control subjects (p < 0.05–0.01; Fig. 4 E, 4 J). Taken together, we found changes in different pre- and post-synaptic markers in cortical and sub-cortical regions that depend on the duration of the disease, with increases in the initial pre-motor phases (B2-3) that progress to decreases in the later stages (B5-6) of the disease, perhaps correlating with cortical/subcortical synaptic loss. Mapping of Egr-1-dependent brain cell activity and functional connectivity in the D-PD-like mouse model We then investigated whether regional changes in synaptic plasticity translate into changes in Egr-1-dependent whole-brain cellular activity in the D-PD mouse model. We found that Egr-1 mRNA expression assessed by in situ hybridization was generally high in the PrL/IL cortices, Cg, CPu, hippocampal area (CA1 and CA2/3), and amygdala (Amg), while expression was lower in the hypothalamus (Hyp) and the DR in AAV-h-α-Syn mice compared to the control group (p < 0.05–0.0001; Fig. 5 A-C ) . Increases in Egr-1 mRNA expression in efferent cortical and subcortical areas occurred only 8 weeks later, parallel to the changes observed in the synaptic marker levels and the progressive increase in α-Syn-positive fibers. However, the level of Egr-1 mRNA expression was reduced in Hyp and DR 4 weeks later and remained so until the end of the experiment (p < 0.01 − 0.001; Fig. 5 C). Given the changed profile of cellular activity in the different brain regions examined, we then characterized brain connectivity in the D-PD-like mouse model at 8 weeks only. We investigated how the net activity of neural elements in a target region is influenced by the net activity of neural elements in a source region using resting-state fMRI (rs-fMRI). In a more specific manner, we evaluated the functional connectivity using seed-based analyses with three different regions considered as seed, namely mPFC, CPu, and HPC. In this way, we measured the correlation between the brain activity at any point in the brain and the activity in the regions of interest (seed), automatically identified based on a mouse brain atlas and the rest of the brain. To analyze phenotype differences, first we identified the points in the whole brain where connectivity with the seed region was significantly different between groups, and obtained a voxel-wise statistical map of the differences (Fig. 6 A-C, 7 A-C, 8 A-C). Since the points with significant differences are organized into clusters, we identified these clusters further to evaluate the average connectivity between them and the seed regions (Fig. 6 D, 7 D, 8 D).Voxel-wise statistics with FWE-correction and TFCE did not show differences in the connectivity of mPFC. However, when a p < 0.005 (without FWE-correction) was considered, four cluster of differences were detected. Compared to control group, the left mPFC of AAV-h-α-Syn mice showed reduced functional connectivity with the cluster 1 to 4 named as: PFC-1 (medial orbital cortex, PrL/IL, and accumbens nucleus; p < 0.0001), PFC-2 (substantia nigra reticulata, pontine reticular nucleus, and B9 5-HT cells; p < 0.0001), PFC-3 (HPC; p < 0.0001), and PFC-4 (DR and periaqueductal gray; p < 0.0001) (Fig. 6 A-D). Furthermore, we also evaluated functional connectivity through a seed-based analysis between the left CPu and the rest of the brain (Fig. 7 A-D). Compared to control group, the left CPu of AAV-h-α-Syn mice showed reduced functional connectivity with clusters CPu-1 to CPu-7 (corrected p-value < 0.05): CPu-1 (Prl/IL, CPu, somatosensory cortex, and globus palillus; p < 0.001), CPu-2 (motor cortex 1/2; p < 0.001), CPu-3 and CPu-6 (retrosplenial cortex; p < 0.0001 and p < 0.01, respectively), CPu-4 (CPu; p < 0.0001), CPu-5 (habenula, thalamus, hypothalamus, HPC, amygdala, substantia nigra reticulata, ventral tegmental area, visual cortex, DR, and periaqueductal gray; p < 0.0001), and CPu-7 (ectorhinal and perirhinal cortices; p < 0.0001). Finally, we also evaluated functional connectivity through a seed-based analysis between the left HPC and the rest of the brain (Fig. 8 A- 8 C). Compared to control group, the left HPC of AAV-h-α-Syn mice showed reduced functional connectivity with clusters HPC-1 to HPC-7 (corrected p-value < 0.05): HPC-1 (medial orbital cortex, and PrL/IL cortices; p < 0.0001), HPC-2 (CPu; p < 0.0001), HPC-3 (somatosensory cortex; p < 0.0001), and HPC-4 (thalamus and hypothalamus; p < 0.0001). Overall, our results highlight that cortico-limbic-raphe functional connectivity is greatly affected in D-PD-like mice. DISCUSSION Depression is one of the most common non-motor symptoms, is highly prevalent in PD patients, and one of the most important predictors of poor quality of life in people with PD. It often precedes motor symptoms, but is underdiagnosed and undertreated 56 , 57 . Indeed, the diagnosis of depression in PD is complex, especially when different clinical presentations of depression and PD overlap. In recent years, neuroimaging reports have suggested reduced connectivity between the cortico-limbic networks, perhaps as a result of altered higher-order cortical modulatory effects in emotion-related limbic areas (including the thalamus, ventral striatum, insula, Amg, and Cg), leading to mood dysregulation 33 , 37 , 58 , 59 . In support of this, multimodal neuroimaging studies combining structural and connectivity analysis have been able to identify neurophysiological subtypes of PD patients, distinguishing between those with the dominant severe depression subtype and those with the dominant severe movement subtype. The first group have an altered connectivity pattern, mainly composed in limbic regions 56 . An important biological basis for depression in PD is the result of the impairment of 5-HT innervation and neurotransmission in brain areas of the cortico-limbic system 6 , 14 , 15 , 17 , 60 . We have previously developed a mouse model with overexpression of h-α-Syn in DR 5-HT neurons that exhibits depressive-like behavior associated with reduced 5-HT neurotransmission in the mPFC and CPu 45 . Here, we extended these studies and showed that axonal h-α-Syn accumulation in male mice overexpressing the transgene in DR is coupled to a progressive loss of 5-HT SERT-positive fibers in cortical and subcortical areas and to a functional hypo-connectivity in cortico-limbic-raphe network, mainly at 8 weeks. Using seed-based analyses of rs-fMRI, we identified major clusters of connectivity changes between the mPFC-Accumbes nucleus, mPFC-DR, CPu-PrL/IL, CPu-thalamus + Amg, CPu-HPC, HPC-PrL/IL, HPC-CPu, and HPC-thalamus, networks which may be specifically involved in different aspects of emotion behavioral regulation, as reported in patients with D-PD. It is important to highlight the hypo-connectivity found between the mPFC-DR and CPu-DR using this mouse model of D-PD. Previous neuroimaging studies have reported a unique profile of reduced connectivity between the DR and the PFC + Cg that correlated with anxiety, drowsiness, and depression in PD 61 . Taken together, the data support the translational nature of this mouse model in advancing our understanding of the neurobiological substrates underlying depression in PD. However, it is important to note that some studies have found that certain non-motor symptoms such as fatigue, depression, anxiety and sleep problems occur more frequently in females; while other non-motor symptoms, such as drooling, diurnal somnolence, urinary and sexual dysfunction, and cognitive impairment are more prevalent in males 62 – 64 . Therefore, a key limitation of our study is that we only explored the effects of α-Syn accumulation in the 5-HT system using a male mouse model. Further studies that include females are essential to gain a comprehensive, relevant perspective. In parallel with the changes in the activity of the cortico-limbic-raphe network, we found an increase in Egr-1-dependent cellular activity in the cortico-limbic regions (PrL/IL, Cg, CPu, HPC, and Amg) in the D-PD mouse model at 8 weeks. Egr-1 (also called NGFI-A, Zif268, or Krox24) is a zinc finger transcription factor implicated in processes of synaptic plasticity and cell activation, and has been shown to have a crucial role in both neuronal death and inflammatory response 65 – 67 . In fact, elevated Egr-1 levels were detected in a PD mouse model of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) associated with an astrocyte activation and neuroinflammation 67 . Although we have not identified the Egr-1-dependent activated cell type in the whole brain, we have found increases in the neuroinflammatory markers TNFα, INFγ, and NFkB1 in the mPFC and CPu using this D-PD mouse model, suggesting a possible Egr1-dependent activation mechanism leading to astrogliosis and/or microgliosis (Miquel-Rio et al., personal communication). In addition, we also found reduced Egr-1 expression in the DR of D-PD mice locally injected with AAV-h-α-Syn. DR –one of the most extensively connected hubs in the mammalian brain– is the largest 5-HT nucleus, containing approximately one third of all 5-HT neurons in the brain 49 , although clusters of GABAergic, DAergic, and to a lesser extent, glutamatergic and peptidergic neurons have been identified in the DR 68 . In the present study, no changes in the number of TPH-positive or TH-positive cells were detected in the DR after h-α-Syn accumulation, but a reduced density of the SERT-positive fibers was shown in cortico-limbic regions, suggesting changes in the 5-HT system neuroplasticity. This could translate into a reduction in the specific activity of 5-HT cells, as observed with a reduction in Egr-1 mRNA expression in the DR. These results are further supported by our previous observations, confirming that overexpression of h-α-Syn in the mouse DR leads to decreased 5-HT neuron activity and 5-HT release in mPFC and CPu 45 . As mentioned above, recent PET neuroimaging studies have demonstrated specific 5-HT denervation in cortico-striatal-limbic areas in PD patients with prominent neuropsychiatric signs at disease onset 15 , 18 . Although some TH-positive fibers were also positive for h-α-Syn in projection brain areas (e.g., Cg and CPu) after AAV-h-α-Syn infusion in the DR, a large proportion of h-α-Syn-positive fibers colocalized with SERT-positive 5-HT fibers. More importantly, a reduction in SERT-positive fibers density, but not TH-positive fibers, was detected in the cortico-striatal limbic regions (CPu > Cg > mPFC > HPC) in D-PD mice compared to controls, as previously shown in animal models of h-α-Syn overexpression in non-DA neurons 69 , 70 . It is known that α-Syn is a protein that regulates the expression and cellular trafficking of monoamine transporters, e.g. SERT, DA transporter – DAT, and norepinephrine transporter - NET, towards the cell surface 16 . α-Syn-induced modulation of SERT trafficking is microtubule-dependent, as the microtubule destabilizing agent nocodazole disrupts the effects of α-Syn on SERT function and reverses the inhibition of uptake in co-transfected cells 71 . In addition, in vivo studies have shown that changes in the level of α-Syn expression in mouse 5-HT neurons directly produce opposite effects on the functional activity of SERT in efferent brain regions in response to the inhibitor citalopram 45 , 72 . Taken together, this may suggest that the progressive accumulation of h-α-Syn in 5-HT axons and terminals leads to impaired SERT function in serotonergic synapses, resulting in the loss of system integrity. Actually, synaptic dysfunction and altered axonal transport have been postulated to be some of the earliest pathological events in PD, in which α-Syn is considered a hub protein by interacting with many synaptic proteins (e.g. monoamine transporters), cytoskeletal components, chaperones, and several synaptic vesicles SV-associated proteins 52 , 73 , 74 . In physiological conditions, α-Syn is abundant in the pre-synaptic compartment 51 . Post-mortem and experimental studies provided evidence that α-Syn aggregation might start at pre-synaptic terminals, inducing synaptic degeneration and subsequently neuronal loss 52 , 73 . Unlike previous studies that showed a decrease in the density of pre-synaptic markers SV2A, SYP, and VAMP2 in aged PD mice (17–20 months) 75 – 78 , here we reported an accumulation of these same pre-synaptic proteins in parallel with higher h-α-Syn levels, mainly in the Cg and CPu in the D-PD mouse model. Indeed, we have previously shown that increased levels of SV2A protein co-localize with h-α-Syn in axonal swellings in mouse CPu and Cg 45 . In this regard, increases of the presynaptic SV2C protein -enriched in the basal ganglia and preferentially localized in DA neurons- were also reported in mice overexpressing mutant A53T α-Syn 79 , 80 . It is important to emphasize that we also observed increases in the levels of SV2A, SYP and VAMP2 proteins in the dlPFC and CAU of patients with PD in the early stages B2-3 of the disease, but these decreased in the later stages B5-6. Our data are consistent with recent studies showing reduced SYP and SV2A densities in cortical regions in B5-6 α-Syn stage compared to controls, associated with higher neurofilament light-chain (NfL) immunoreactivity and Lewy body density 74 , 81 . Although one of the main limitations of our study is the small number of post-mortem human tissue samples and the absence of an accurate diagnosis of depressive disorder in PD patients, the data support the idea that synaptic degeneration can occur together with axonal degeneration in the final stage of the disease. In the early B2-3 stages, when non-motor symptoms prevail, changes in the trafficking/refilling of synaptic vesicles mediated by α-Syn and/or in the structural organization of synapse may contribute to functional deficits in different brain networks, including those that regulate emotional processes. In fact, our data and others support these observations by showing reductions in the density of the 5-HT SERT marker that directly interacts with α-Syn in both stages B2-3 and B5-6 of PD 82 , 83 . In this study, we also found a significant increase in the levels of axonal transport motor protein dynein in the mPFC in the D-PD mouse model overexpressing h-α-Syn in DR. Dynein is a microtubule-based motor protein that mediates minus-end-directed vesicle transport through interaction with dynactin 55 , 84 . Previous studies have reported that mice and rats overexpressing A53T α-Syn have higher dynein levels compared to the control group, leading to an accumulation of pre-synaptic proteins and a disruption of axonal transport, which precedes axonal denervation 85 , 86 . We observed a similar pattern here, with a cortical loss of 5-HT fibers associated with increased levels of h-α-Syn and vesicular proteins. In addition, reductions in dynein levels were reported in substantia nigra and putamen at late PD stages 87 . Although we detected marginal effects in specific brain regions, these were increases in early stages B2-3 of PD (e.g., dlPFC and CAU), followed by decreases in stages B5-6 of PD (e.g., HPC), supporting that neurodegeneration in PD involves a breakdown of axonal transport. Remarkably, the changes in pre-synaptic plasticity that occurred in the D-PD mouse model led to changes at the post-synaptic level, with decreased MAP-2 (localized primarily in neuronal dendrites) and PSD95 levels in brain areas of the cortico-limbic network that could be linked to the detected functional hypo-connectivity. Like other authors, we also detected reduced levels of PSP95 in advanced stages of PD (Esteves and Cardoso, 2020; but not Fourie et al., 2014; Whitfield et al., 2014) In conclusion, we have shown here that overexpression of h-α-Syn in the 5-HT system leaves to a hypo-connectivity in the cortico-limbic-raphe network that closely resembles the functional changes described in patients with depression and PD. Elevated levels of h-α-Syn in 5-HT projection areas trigger an abnormal pattern of accumulation of synaptic vesicle-associated proteins and defects in dynein-driven transport that would lead to reduced 5-HT neurotransmission, alterations in postsynaptic plasticity in efferent brain areas and the development of a depressive phenotype. These findings may help to better understand the mechanisms underlying depression in PD. This D-PD mouse is a powerful translational model for studying new targets and potential antidepressant interventions in α-Syn-associated neurodegenerative disorders. METHODS Mice Male and female C57BL/6J mice (10 weeks; n = 114 for the whole study, Charles River, Lyon, France) were housed under controlled conditions (22 ± 1ºC; 12h light/dark cycle) with food and water available ad-libitum. Animal procedures were conducted in accordance with standard ethical guidelines (EU directive 2010/63 of 22 September 2010) and approved by the local ethical committee (University of Barcelona). Mouse model overexpressing h-α-Syn into serotonin (5-HT) neurons Recombinant adeno-associated viral vector serotype-2/5 (AAV2/5) with chicken-β-actin (CBh) promoter and a shortened WPRE3 that encodes the human wild-type α-synuclein (AAV-h-α-Syn) was used to overexpress the transgene in raphe 5-HT neurons of mice (dorsal raphe nucleus - DR), as previously reported 45 . The Michael J. Fox Foundation gently provided the AAV2/5 constructs produced and tittered by the UNC Vector Core. We examined any possible effect of the AAV2/5 vector itself capable of exerting toxicity on 5-HT neurons and causing behavioral alterations using an empty AAV2/5-CBh-WPRE3 vector containing non-coding (null) stuffer DNA (AAV-EV) as a control group. Isoflurane-anesthetized mice (doses: 4% induction, 2% maintenance) were randomly injected with 1 µl of AAV-h-α-Syn (concentration 0.5 x 10 13 gc/ml) or AAV-EV (concentration 0.5 x 10 13 gc/mL) into raphe nuclei (anterior-posterior AP: -4.5; medial-lateral ML: -1.0; dorsal-ventral DV: -3.2 in mm, relative to bregma with an angle 20º), using a microinjector (KDS-310-PLUS, World Precision Instruments, Sarasota, LF, USA) at 0.4 µl/min rate. The needle was kept in place for an additional 5 min before slowly being withdrawn. Mice were assessed at 4 and 8 weeks after AAV-h-α-Syn or AAV-EV infusion. Postmortem human brain samples Dorsolateral prefrontal cortex (dlPFC), caudate nucleus (CAU), and hippocampus (HPC) tissue samples from controls and PD patients were obtained from the Hospital Clinic-IDIBAPS biobank, in accordance with Spanish legislation and with the approval of the Ethics Committee of Spanish National Research Council (Project Ref. PID2019-105136RB‐I00). The post-mortem interval between death and the processing of the tissues ranged from 3 to 20 h, and the samples were stored at -80°C until they were tested. Pathological cases were categorized as stages 1–6 of LB disease pathology, according to Braak staining 12 , excluding tauopathies, vascular disease, and metabolic syndrome. No information (e.g. by formal testing) could be obtained on the neuropsychiatric status of the PD patients. Cases in the control group had not neurological, psychiatric, or metabolic disorders and no neuropathological abnormalities, except for sporadic Alzheimer’s disease. A total of 8 control and 16 cases with PD-related pathology were included in the present study. All PD cases were treated for motor symptoms. The duration of the disease was in the range of 8 to 18 years. The most common causes of death in people with PD were infections, neoplasia, and acute heart disease. See Table 1 for subject details. In situ hybridization (ISH) Mice were euthanized by cervical dislocation and brains were rapidly removed, frozen on dry ice and stored at -80ºC. Coronal tissue sections (14 µm-thick) containing medial prefrontal cortex (mPFC), cingulate cortex (Cg), caudate-putamen (CPu), hippocampus (HPC), amygdala (Amg), hypothalamus (Hyp), and dorsal raphe nucleus (DR) were obtained and processed, as described elsewhere 91 , 92 . An antisense oligo probe sequence (GCATCATCTCCTCCAGTTTGGGGTAGTTGTCCATGGTGGGTGAGT), complementary to bases Egr1 (NM_007913.5) was used (IBA Nucleic Acids Synthesis, Göttingen, Germany). Frozen tissue sections were fixed for 20 min at 4ºC in 4% paraformaldehyde in phosphate-buffered saline (1x PBS: 8 mM Na 2 HPO 4 , 1.4 mM KH 2 PO 4 , 136 mM NaCl, and 2.6 mM KCl), washed for 5 min in 3xPBS at room temperature, twice for 5 min each in 1x PBS, and incubated for 2 min at 21ºC in a solution of predigested pronase (Merck Millipore, Madrid, Spain) at a final concentration of 24 U/mL in 50 mM Tris-HCl, pH 7.5, and 5 mM EDTA. The enzymatic activity was stopped by immersion for 30 s in 2 mg/ml glycine in 1x PBS. Tissues were finally rinsed in 1xPBS and dehydrated through a graded series of ethanol. Oligonucleotide was individually labeled (2 pmol) at the 3'-end with [ 33 P]-dATP (> 2500 Ci/mmol; DuPont-NEN, Boston, MA, USA) using terminal deoxynucleotidyl-transferase (TdT, Calbiochem, La Jolla, CA, USA). For hybridization, the radioactively labelled probes were diluted in a solution containing 50% formamide, 4x standard saline citrate, 1x Denhardt’s solution, 10% dextran sulfate, 1% sarkosyl, 20 mM phosphate buffer, pH 7.0, 250 µg/ml yeast tRNA, and 500 µg/ml salmon sperm DNA. The final concentration of radioactive probes in the hybridization buffer was in the range (~ 1.5 nM). Tissue sections were covered with hybridization solution containing the labelled probes, overlaid with parafilm coverslips and incubated overnight at 42ºC in humid boxes. Sections were then washed 4 times (45 min each) in a buffer containing 0.6 M NaCl and 10 mM Tris-HCl (pH 7.5) at 60ºC. Hybridized sections were exposed to Biomax-MR film (Sigma-Aldrich) for 2–10 days at − 70°C with intensifying screens. For specificity control, adjacent sections were incubated with an excess (50x) of unlabeled probes. Films were analyzed and relative optical densities were evaluated in three adjacent sections by duplicate of each mouse, and averaged to obtain individual values using Image-J (v1.54c, NIH, Bethesda, MD, USA) software. Contrast and brightness of images were the only variables digitally adjusted. Immunofluorescence Mice were anaesthetized with pentobarbital and transcardially perfused with 4% PFA in sodium-phosphate buffer (pH 7.4). Brains were extracted, post-fixed 24 h at 4°C in the same solution, and placed in gradient sucrose solution 10–30% for 3 days at 4°C. After cryopreservation, serial 30 µm-thick sections were cut to obtain raphe nuclei, mPFC, Cg, CPu, and HPC. Immunofluorescence procedure was performed for h-α-Syn (anti-h-α-Synuclein clone Syn 211, 1:2000; ref.: AHB0261, Thermo Fisher Scientific, Waltham, MA, USA), mouse/human-α-Syn (anti-m/h-α-Syn, 1:500; ref.: ab212184, Abcam, Cambridge, UK) phospho-S129-α-Syn (anti-phospho-S129-α-Syn 1:2000; ref.: ab51253, Abcam, Cambridge, UK), tryptophan hydroxylase TPH (anti-TPH, 1:2500; ref.: AB1541, Sigma-Aldrich, Madrid, Spain), serotonin transporter SERT (anti-SERT, 1:2500; ref.: 24330, Immunostar, Hudson, WI, USA), glutamate decarboxylase GAD67 (anti-GAD67, 1:2500; ref.: MAB5406, Sigma-Aldrich, Madrid, Spain), tyrosine hydroxylase TH (anti-TH, 1:1250; ref.: ab112, Abcam, Cambridge, UK ) , MAP-2 (anti-MAP-2, 1:1000; ref.: ab32454, Abcam, Cambridge, UK ) , SV2A (anti-SV2A, 1:250; ref.: PA5-110451, Thermo Fisher Scientific, Waltham, MA, USA), and synaptophysin (anti-SYP, 1:1000; ref.: ab32127, Abcam, Cambridge, UK). Sections were washed in 1x PBS (pH 7.4) and 1x PBS/Triton 0.2%, and incubated in blocking solution (1x PBS/Triton containing 0.02% gelatin and the corresponding normal serum for the secondary antibody host) for 2 hours at room temperature. Primary antibody was incubated overnight at 4ºC, followed by incubation with the respective secondary antibodies for 2 hours at room temperature (Table 2 ). Finally, nuclei were stained with Hoestch dye (1:10.000; ref.: H3570, Life Technologies, Carlsbad, CA, USA) for 10 min and the sections were mounted in Entellan (Electron Microscopy Sciences, Hatfield, PA, USA). Confocal fluorescence microscopy The intracellular localization of h-α-Syn or p-α-Syn proteins in TPH + or GABA + cells in the DR, and the intracellular h-α-Syn distribution in 5-HT axons were examined by confocal microscopy using an inverted Nikon Eclipse Ti2-E microscope (Nikon Instruments, Tokyo, Japan) attached to the spinning disk unit Andor Dragonfly 200 (Oxford Instruments Company, Abindong, UK). For all experiments, a Plan Apochromatic 10-20x, numerical aperture (NA) 0.45 objective was used. A high-precision motorized stage was used to collect the large-scale 3D mosaics of each tissue section. Individual image tiles were 2048 × 2048 pixels with a z-section of 35 µm. For specific regions, we used an oil-immersion objective (Plan Apochromatic Lambda blue 40x, NA 1.4). Samples were excited with 405, 488, and 561 nm laser diodes, respectively. The beam was coupled into a multimode fiber going through the Andor Borealis unit reshaping the beam from a Gaussian profile to a homogenous flat top, and from there it was passed through the 40 µm pinhole disk. Tissue sections were imaged on a high resolution scientific complementary metal oxide semiconductor (sCMOS) camera (Zyla 4.2, 2.0 Andor, Oxford Instruments Company). Fusion software (Andor, Oxford Instruments Company) was used for acquisition and for image processing before analysis. Image stitching and deconvolution were performed using Fusion software (Andor, Oxford Instruments Company). Image analysis was performed with Image J/Fiji open source software (Wayne Rasband, NIH, Bethesda, MD, USA) using ImageJ Macro Language to develop custom Macros. Briefly, maximum projections of the channels of interest (red and green) were obtained for each section, and regions of interest (ROI) were delimited for each brain section to cover the maximum analyzable area. Quantification was performed using a group size ranging from four to ten animals and three coronal sections per animal. ROIs were systematically defined in all animals and brain regions. One ROI was analyzed per section in the DR, while two ROIs were analysed per section (bilaterally) in the brain projection areas. These sampling variables were kept constant for all animals in each experimental group. Various measurements were applied to the resulting images. For images co-labelling m/h-α-Syn/TPH or h-α-Syn/TH in the DR, the number of cells in the red channel was quantified after adjusting and homogenizing pixel values. Red-labeled cells were then examined for colocalization with the green channel upon merging and subsequently counted. Due to insufficient contrast with the background, GAD67 + cells could not be directly counted. Instead, for images co-labelling p-α-Syn/GAD67 in the DR, total p-α-Syn + cells were quantified, and then those colocalizing with GAD67 were identified. In projection brain areas (mPFC, Cg, CPu, HPC), images co-labelling h-α-Syn/SERT and h-α-Syn/TH were acquired, and the mean intensity values for the green and red channels were measured for each ROI. Similarly, images of the same projection areas labelling MAP2, SV2A, and SYP were analyzed, and mean intensity values for the red channel were also measured in the defined ROIs. Fiber colocalization of h-α-Syn with SERT and TH in projection areas was analyzed using the JACoP (Just Another Colocalization Plugin) plugin in ImageJ. First, images were standardized by adjusting their minimum and maximum pixel intensity values. Then, segmented images of the defined ROIs for the red and green channels were generated using consistent intensity thresholds across all images. Finally, the JACoP plugin was used to calculate Mander’s coefficient 1 (M1), which quantifies the proportion of the red channel overlapping with the green channel. Protein extraction and analysis by Western Blot (WB) The procedure for WB and all antibodies used were previously validated in mouse models overexpressing human α-Syn and in postmortem human brain samples 47 , 92 , 93 . Different brain areas from mice (mPFC, CPu, and HPC, 10 mg/each) and human (dlPFC, CPu, and HPC, 50 mg/each) were homogenized in RIPA lysis buffer (50 mM Tris, 150 mM NaCl, pH 8.0, 1% Triton X-100, 0.5% sodium deoxycholate, 5 mM EDTA, 0.1% SDS) with cOmplete™ protease and PhosSTOP™ phosphatase inhibitors (Roche; ref.: 05892970001, 4906845001, Basel, Sweden). Protein concentration was determined using the Pierce™ BCA Protein Assay Kit (ThermoFisher Scientific, Waltham, MA, USA). 15 µg of protein lysates were separated by 4–15% SDS-PAGE (Bio-Rad, Hercules, CA, USA) and electrotransferred to a PVDF membrane (Bio-Rad). Protein blots were incubated with primary antibodies overnight at 4ºC. Anti-h/m-α-Syn (1:1000; ref.: ab212184, Abcam), anti-SYP (1:1000; ref.: ab32127, Abcam), anti-SV2A (1:1000; ref.: PA5-110451, Fisher Scientific), anti-VAMP2 (1:2000; ref.: ab3347, Abcam), anti-SERT (1:1000; ref.: ab102048, Abcam), anti-PDS95 (1:3000; ref.: ab2723, Abcam), and anti-dynein (1:2000; ref.: MAB1618, Millipore) were used (Table 2 ) . Protein expression levels were normalized by using the housekeeping β-actin (anti-β-actin-HRP. 1:50000; A3854, Merck). ImageLab software (Bio-Rad) was used for analysis. Magnetic resonance imaging (MRI) acquisition, processing and analysis Each mouse was scanned at 8 weeks after AAV2/5 vector (AAV-α-Syn or AAV-EV) infusion into DR (n = 8 mice/group). Experiments were conducted on a 7.0T BioSpec 70/30 horizontal animal scanner (Bruker BioSpin), equipped with an actively shielded gradient system (600 millitesla per metre) with a surface coil for the mouse brain as receiver coil. Animals were sedated (4% isoflurane in 30% oxygen and 70% nitrogen), placed in a supine position in a Plexiglas holder with a nose cone for administering anesthetic gases and fixed using tooth and ear bars. Eyes were protected from dryness with Siccafluid ophthalmologic fluid. Once placed in the holder with constant isoflurane (1.5%), a subcutaneous bolus of medetomidine (Domtor, Orion Pharma; 0.3 mg/kg body weight) was injected. For the next 15 min, the percentage of isoflurane was progressively decreased to 0.5%. Then, a continuous perfusion of 0.6 mg/kg body weight per hour of medetomidine was started and maintained until the end of the acquisition session. After completion of the imaging session, 1 µl/g of atipamezole (Antisedan, Orion Pharma) and saline were injected to reverse the sedative effect and compensate fluid loss. Localizer scans were used to ensure the accurate position of the head at the isocentre of the magnet. Anatomical T2 RARE images were acquired in coronal orientation with effective time of echo (TE) = 33 ms, time of repetition (TR) = 2.3 s, RARE factor = 8, voxel size = 0.08 × 0.08 mm 2 and slice thickness = 0.7 mm. Resting-state functional MRI (fMRI) was acquired with an EPI sequence with TR = 2 s, TE = 19.4, voxel size 0.21 × 0.21 mm 2 and slice thickness = 0.5 mm. In total, 420 volumes were acquired resulting in an acquisition time of 14 min. Seed-based analysis was performed as described previously 94 to evaluate functional connectivity of the CPu, HPC and mPFC with the rest of the brain. Preprocessing of the rs-fMRI data included: slice timing, spatial realignment using SPM8 for motion correction, elastic registration to the T2-weighted volume using ANTs for EPI distortion correction 95 , detrend, smoothing (FWHM = 0.6 mm), frequency filtering of time series between 0.01 and 0.1 Hz, and regression by motion parameters using NiTime ( http://nipy.org/nitime ). Brain parcellation was performed based on the MRI-based atlas of the mouse brain 96 . The atlas template was elastically registered to each subject T2-weighted volume using ANTs 95 and the estimated transformation was applied to the label map to obtain specific parcellation for each acquisition T2-weighted image, which was subsequently translated to the resting-state fMRI images. The left CPu, HPC or mPFC was selected as seed regions for seed-based analysis. Extracted average time series in the CPu, HPC or mPFC was correlated with the time series of all the voxels within the brain, resulting in a connectivity map for each seed, containing the value of the seed-to-voxel correlation. Voxel-wise statistics were computed in the seed-based connectivity maps using randomize algorithm from FSL 97 to identify areas where this connectivity was significantly different between groups. This statistical analysis enabled the evaluation of connectivity between the selected regions and the rest of the brain, and generated a map of the brain coordinates where significant differences were detected. Familywise error (FEW) correction and TFCE (Threshold-free cluster enhancement) were applied to deal with multiple comparisons. Significance was defined as p < 0.05. The clusters of voxels where significant differences were identified were used as a mask to quantify average connectivity value in that area that was subsequently compared between groups. Together with this, for exploratory purposes, an additional voxel-based statistical analysis was performed including only the TFCE correction and setting a significance threshold of p < 0.005. If no significant differences were identified using FWE-correction p < 0.05, results with uncorrected p < 0.005 will be reported. As statistically significant differences were detected in clusters, we extracted these and evaluated the average connectivity within them. We then compared this connectivity between clusters to complement the previous voxel-based analysis. Statistical analysis All values are mean ± standard error of the mean (SEM). Data from individual mouse was represented by single points when possible. The immunoreactivity value of the target proteins was corrected by the corresponding β-actin value and calculated as a percentage of a standard sample to control for inter-assay variability. The final estimate was the mean of the experimental replicates obtained in at least two different gels. Statistical comparisons were performed using GraphPad Prism 9.5.1 software. Outlier values were identified and excluded using the Grubbs’ test (i.e., Extreme Student zed Deviate – ESD method). Student's t test, one-way and two-way ANOVA analysis, followed by Bonferroni post hoc test were performed when appropriate, and indicated in results and figure legends. Non-parametric Kruskal-Wallis test followed by Dunnett’s multiple comparison test was used to analyze differences in means between control and different stages of PD. Differences were considered significant if p < 0.05. Summary of the statistical analysis is shown in Table 3. Other information The images of the full immunoblots are in Fig. Suppl 4 and Fig. Suppl 5. Abbreviations AcbC accumbens nucleus core B9 serotonin cells HPC hippocampus Hyp hypothamus MG medial geniculate nucleus OB olfactory bulb PAG periaqueductal gray Pn pontine nucleus SNr substantia nigra reticulata VDB nucleus of the vertical limb of the diagonal band Declarations ACKNOWLEDGEMENTS This work was supported by MCIU/AEI/FEDER, UE grant (PID2019-105136RB-100, PID2022-141700OB-I00, MCIN/AEI/10.13039/501100011033 to A.B.), and AGAUR 2021-SGR-01358, Catalan Government. CB/07/09/0034 Center for Networked Biomedical Research on Mental Health (CIBERSAM). We also thank the Spanish Stress Research Network, MCIN/AEI /10.13039/501100011033. U.S.S. is a recipient of a fellowship from the Non- Doctor Researcher Formation Pre-doctoral Program of Basque Government, Spain. U.A. is a recipient of a fellowship from the State Research Agency for the training of predoctoral research personnel (PREP2022-000676) associated to a generation of knowledge project (PID2022-141700OB-I00). The authors would like to thank the staff members of the Biobank of the Clinic Hospital Barcelona - IDIBAPS for their collaboration in the study. AUTHOR CONTRIBUTIONS Conceptualization and supervision of the research: A.B. Methodology: L.M.R. and U.S.S. performed stereotaxic surgeries in mice; L.M.R. processed human brain tissue samples; L.M.R., J.J.E, U.S.S., C.Y.C., U.A., and M.T.L. performed immunohistochemistry and WB experiments; V.P. performed in situ hybridization; C.C. provided advice on the acquisition and analysis of images on the Dragonfly confocal microscopy system; E.M.M. and X.L.G. conducted the rs-fMRI experiments, image acquisition, and data analysis. L.M.R. analyzed and supervised the data. Writing: A.B. with all nine authors’ inputs. Funding acquisition: A.B. All authors edited and approved the final version of the manuscript. COMPETING INTERESTS All authors declare no competing interest. ADDITIONAL INFORMATION Supplementary information DATA AVAILABILITY All relevant data that support the findings of this study are presented in the main text and supplementary information. Other source data are available from the corresponding author upon reasonable request. References Absalyamova, M. et al. Molecular basis of the development of Parkinson’s disease. Neuroscience 565, 292–300 (2024). Jankovic, J. Parkinson’s disease: clinical features and diagnosis. J. Neurol. Neurosurg. Psychiatry 79, 368–376 (2008). Poplawska-Domaszewicz, K., Qamar, M. A., Falup Pecurariu, C. & Chaudhuri, K. R. Recognition and characterising non-motor profile in early onset Parkinson’s disease (EOPD). Parkinsonism Relat. Disord. 129, 107123 (2024). Zis, P., Erro, R., Walton, C. C., Sauerbier, A. & Chaudhuri, K. R. The range and nature of non-motor symptoms in drug-naive Parkinson’s disease patients: a state-of-the-art systematic review. NPJ Park. Dis. 1, 15013 (2015). Fan, Y. et al. Serum neurotransmitter analysis of motor and non-motor symptoms in Parkinson’s patients. Front. Aging Neurosci. 16, 1423120 (2024). Hayley, S., Vahid-Ansari, F., Sun, H. & Albert, P. R. Mood disturbances in Parkinson’s disease: From prodromal origins to application of animal models. Neurobiol. Dis. 181, 106115 (2023). Stocchi, F. et al. Exploring depression in Parkinson’s disease: an Italian Delphi Consensus on phenomenology, diagnosis, and management. Neurol. Sci. Off. J. Ital. Neurol. Soc. Ital. Soc. Clin. Neurophysiol. 44, 3123–3131 (2023). Bareeqa, S. B. et al. Prodromal depression and subsequent risk of developing Parkinson’s disease: a systematic review with meta-analysis. Neurodegener. Dis. Manag. 12, 155–164 (2022). McDonald, W. M., Richard, I. H. & DeLong, M. R. Prevalence, etiology, and treatment of depression in Parkinson’s disease. Biol. Psychiatry 54, 363–375 (2003). Postuma, R. B. & Berg, D. Prodromal Parkinson’s Disease: The Decade Past, the Decade to Come. Mov. Disord. 34, 665–675 (2019). Borgonovo, J. et al. Changes in neural circuitry associated with depression at pre-clinical, pre-motor and early motor phases of Parkinson’s disease. Parkinsonism Relat. Disord. 35, 17–24 (2017). Braak, H. et al. Staging of brain pathology related to sporadic Parkinson’s disease. Neurobiol. Aging 24, 197–211 (2003). Jellinger, K. A. The pathobiological basis of depression in Parkinson disease: challenges and outlooks. J. Neural Transm. 129, 1397–1418 (2022). Ballanger, B. et al. Role of serotonergic 1A receptor dysfunction in depression associated with Parkinson’s disease. Mov. Disord. Off. J. Mov. Disord. Soc. 27, 84–89 (2012). Maillet, A. et al. The prominent role of serotonergic degeneration in apathy, anxiety and depression in de novo Parkinson’s disease. Brain J. Neurol. 139, 2486–2502 (2016). Miquel-Rio, L., Sarriés-Serrano, U., Pavia-Collado, R., Meana, J. J. & Bortolozzi, A. The Role of α-Synuclein in the Regulation of Serotonin System: Physiological and Pathological Features. Biomedicines 11, 541 (2023). Politis, M. et al. Depressive symptoms in PD correlate with higher 5-HTT binding in raphe and limbic structures. Neurology 75, 1920–1927 (2010). Maillet, A. et al. Serotonergic and Dopaminergic Lesions Underlying Parkinsonian Neuropsychiatric Signs. Mov. Disord. Off. J. Mov. Disord. Soc. 36, 2888–2900 (2021). Remy, P., Doder, M., Lees, A., Turjanski, N. & Brooks, D. Depression in Parkinson’s disease: loss of dopamine and noradrenaline innervation in the limbic system. Brain J. Neurol. 128, 1314–1322 (2005). Alexander, L., Wood, C. M. & Roberts, A. C. The ventromedial prefrontal cortex and emotion regulation: lost in translation? J. Physiol. 601, 37–50 (2023). Mayberg, H. S. Targeted electrode-based modulation of neural circuits for depression. J. Clin. Invest. 119, 717–725 (2009). Peng, W., Chen, Z., Yin, L., Jia, Z. & Gong, Q. Essential brain structural alterations in major depressive disorder: A voxel-wise meta-analysis on first episode, medication-naive patients. J. Affect. Disord. 199, 114–123 (2016). Wise, T. et al. Common and distinct patterns of grey-matter volume alteration in major depression and bipolar disorder: evidence from voxel-based meta-analysis. Mol. Psychiatry 22, 1455–1463 (2017). Amargós-Bosch, M. et al. Co-expression and In Vivo Interaction of Serotonin1A and Serotonin2A Receptors in Pyramidal Neurons of Prefrontal Cortex. Cereb. Cortex 14, 281–299 (2004). Santana, N., Bortolozzi, A., Serrats, J., Mengod, G. & Artigas, F. Expression of serotonin1A and serotonin2A receptors in pyramidal and GABAergic neurons of the rat prefrontal cortex. Cereb. Cortex N. Y. N 1991 14, 1100–1109 (2004). Sancho-Alonso, M. et al. New insights into the effects of serotonin on Parkinson’s disease and depression through its role in the gastrointestinal tract. Span. J. Psychiatry Ment. Health S2950-2853(24)00039–5 (2024) doi: 10.1016/j.sjpmh.2024.07.002 . de Schipper, L. J., van der Grond, J., Marinus, J., Henselmans, J. M. L. & van Hilten, J. J. Loss of integrity and atrophy in cingulate structural covariance networks in Parkinson’s disease. NeuroImage Clin. 15, 587–593 (2017). Lin, H. et al. Functional connectivity markers of depression in advanced Parkinson’s disease. NeuroImage Clin. 25, 102130 (2020). Vogt, B. A. Cingulate cortex in Parkinson’s disease. in Handbook of Clinical Neurology vol. 166 253–266 (Elsevier, 2019). Mayberg, H. S. et al. Selective hypometabolism in the inferior frontal lobe in depressed patients with Parkinson’s disease. Ann. Neurol. 28, 57–64 (1990). Ring, H. A. et al. Depression in Parkinson’s disease. A positron emission study. Br. J. Psychiatry J. Ment. Sci. 165, 333–339 (1994). Goto, M. et al. Depressive symptoms in Parkinson’s disease are related to decreased left hippocampal volume: correlation with the 15-item shortened version of the Geriatric Depression Scale. Acta Radiol. Stockh. Swed. 1987 59, 341–345 (2018). Huang, P. et al. Cortical abnormalities in Parkinson’s disease patients and relationship to depression: A surface-based morphometry study. Psychiatry Res. Neuroimaging 250, 24–28 (2016). Luo, C. et al. Cortical thinning in drug-naive Parkinson’s disease patients with depression. J. Neurol. 263, 2114–2119 (2016). Feldmann, A. et al. Morphometric changes of gray matter in Parkinson’s disease with depression: a voxel-based morphometry study. Mov. Disord. Off. J. Mov. Disord. Soc. 23, 42–46 (2008). van Mierlo, T. J., Chung, C., Foncke, E. M., Berendse, H. W. & van den Heuvel, O. A. Depressive symptoms in Parkinson’s disease are related to decreased hippocampus and amygdala volume. Mov. Disord. Off. J. Mov. Disord. Soc. 30, 245–252 (2015). Hu, X. et al. Abnormal functional connectivity of the amygdala is associated with depression in Parkinson’s disease. Mov. Disord. Off. J. Mov. Disord. Soc. 30, 238–244 (2015). Nakano, T. et al. Neural networks associated with quality of life in patients with Parkinson’s disease. Parkinsonism Relat. Disord. 89, 6–12 (2021). Qiu, Y.-H. et al. Alterations in intrinsic functional networks in Parkinson’s disease patients with depression: A resting-state functional magnetic resonance imaging study. CNS Neurosci. Ther. 27, 289–298 (2021). Lou, Y. et al. Altered brain network centrality in depressed Parkinson’s disease patients. Mov. Disord. Off. J. Mov. Disord. Soc. 30, 1777–1784 (2015). Sheng, K. et al. Altered spontaneous brain activity in patients with Parkinson’s disease accompanied by depressive symptoms, as revealed by regional homogeneity and functional connectivity in the prefrontal-limbic system. PloS One 9, e84705 (2014). Giguère, N., Burke Nanni, S. & Trudeau, L.-E. On Cell Loss and Selective Vulnerability of Neuronal Populations in Parkinson’s Disease. Front. Neurol. 9, (2018). Bellucci, A., Longhena, F. & Spillantini, M. G. The Role of Rab Proteins in Parkinson’s Disease Synaptopathy. Biomedicines 10, 1941 (2022). Volpicelli-Daley, L. A. Effects of α-synuclein on axonal transport. Neurobiol. Dis. 105, 321–327 (2017). Miquel-Rio, L. et al. Human α-synuclein overexpression in mouse serotonin neurons triggers a depressive-like phenotype. Rescue by oligonucleotide therapy. Transl. Psychiatry 12, 79 (2022). Ishiguro, M. et al. Increased Serum Levels of α-Synuclein in Patients With Major Depressive Disorder. Am. J. Geriatr. Psychiatry 27, 280–286 (2019). Sarriés-Serrano, U. et al. Impaired unfolded protein response, BDNF and synuclein markers in postmortem dorsolateral prefrontal cortex and caudate nucleus of patients with depression and Parkinson’s disease. Prog. Neuropsychopharmacol. Biol. Psychiatry 111299 (2025) doi: 10.1016/j.pnpbp.2025.111299 . Serrano, U. S., Miquel-Rio, L., Paz, V., Meana, J. J. & Bortolozzi, A. Sex-based modulation of endoplasmic reticulum stress and antidepressant response in a mouse model of α-synucleinopathy. Neurosci. Appl. 2, 101028 (2023). Huang, K. W. et al. Molecular and anatomical organization of the dorsal raphe nucleus. eLife 8, e46464 (2019). Alarcón-Arís, D. et al. Anti-α-synuclein ASO delivered to monoamine neurons prevents α-synuclein accumulation in a Parkinson’s disease-like mouse model and in monkeys. EBioMedicine 59, 102944 (2020). Burré, J. The Synaptic Function of α-Synuclein. J. Park. Dis. 5, 699–713 (2015). Longhena, F., Faustini, G., Spillantini, M. G. & Bellucci, A. Living in Promiscuity: The Multiple Partners of Alpha-Synuclein at the Synapse in Physiology and Pathology. Int. J. Mol. Sci. 20, 141 (2019). Gudi, V. et al. Synaptophysin Is a Reliable Marker for Axonal Damage. J. Neuropathol. Exp. Neurol. 76, 109–125 (2017). DeGiosio, R. A. et al. More than a marker: potential pathogenic functions of MAP2. Front. Mol. Neurosci. 15, 974890 (2022). Durairajan, S. S. K. et al. Unraveling the interplay of kinesin-1, tau, and microtubules in neurodegeneration associated with Alzheimer’s disease. Front. Cell. Neurosci. 18, (2024). Guo, T. et al. Clinically relevant connectivity features define three subtypes of Parkinson’s disease patients. Hum. Brain Mapp. 41, 4077–4092 (2020). Lin, H. et al. Functional connectivity markers of depression in advanced Parkinson’s disease. NeuroImage Clin. 25, 102130 (2020). Luo, C. et al. Resting-state fMRI study on drug-naive patients with Parkinson’s disease and with depression. J. Neurol. Neurosurg. Psychiatry 85, 675–683 (2014). Morgan, H. E., Ledbetter, C. R., Ferrier, C., Zweig, R. M. & Disbrow, E. A. Altered Cortico-Limbic Network Connectivity in Parkinsonian Depression: The Effect of Antidepressants. J. Park. Dis. 8, 429–440 (2018). Prange, S. et al. Limbic Serotonergic Plasticity Contributes to the Compensation of Apathy in Early Parkinson’s Disease. Mov. Disord. Off. J. Mov. Disord. Soc. 37, 1211–1221 (2022). Wang, J. et al. Common and unique dysconnectivity profiles of dorsal and median raphe in Parkinson’s disease. Hum. Brain Mapp. 44, 1070–1078 (2023). Hendriks, M., Vinke, R. S. & Georgiev, D. Gender discrepancies and differences in motor and non-motor symptoms, cognition, and psychological outcomes in the treatment of Parkinson’s disease with subthalamic deep brain stimulation. Front. Neurol. 14, 1257781 (2023). Martinez-Martin, P. et al. Gender-related differences in the burden of non-motor symptoms in Parkinson’s disease. J. Neurol. 259, 1639–1647 (2012). Cerri, S., Mus, L. & Blandini, F. Parkinson’s Disease in Women and Men: What’s the Difference? J. Park. Dis. 9, 501–515 (2019). Veyrac, A., Besnard, A., Caboche, J., Davis, S. & Laroche, S. The transcription factor Zif268/Egr1, brain plasticity, and memory. Prog. Mol. Biol. Transl. Sci. 122, 89–129 (2014). Xie, B. et al. Egr-1 transactivates Bim gene expression to promote neuronal apoptosis. J. Neurosci. Off. J. Soc. Neurosci. 31, 5032–5044 (2011). Yu, Q. et al. Early activation of Egr-1 promotes neuroinflammation and dopaminergic neurodegeneration in an experimental model of Parkinson’s disease. Exp. Neurol. 302, 145–154 (2018). Ren, J. et al. Single-cell transcriptomes and whole-brain projections of serotonin neurons in the mouse dorsal and median raphe nuclei. eLife 8, e49424 (2019). Kohl, Z. et al. Severely impaired hippocampal neurogenesis associates with an early serotonergic deficit in a BAC α-synuclein transgenic rat model of Parkinson’s disease. Neurobiol. Dis. 85, 206–217 (2016). Wan, O. W. et al. α-Synuclein induced toxicity in brain stem serotonin neurons mediated by an AAV vector driven by the tryptophan hydroxylase promoter. Sci. Rep. 6, 26285 (2016). Oaks, A. W. & Sidhu, A. Synuclein modulation of monoamine transporters. FEBS Lett. 585, 1001–1006 (2011). Alarcón-Arís, D. et al. Selective α-Synuclein Knockdown in Monoamine Neurons by Intranasal Oligonucleotide Delivery: Potential Therapy for Parkinson’s Disease. Mol. Ther. J. Am. Soc. Gene Ther. 26, 550–567 (2018). Bellucci, A. et al. Review: Parkinson’s disease: from synaptic loss to connectome dysfunction. Neuropathol. Appl. Neurobiol. 42, 77–94 (2016). Frigerio, I. et al. Regional differences in synaptic degeneration are linked to alpha-synuclein burden and axonal damage in Parkinson’s disease and dementia with Lewy bodies. Acta Neuropathol. Commun. 12, 4 (2024). Kim, K., Wi, S., Seo, J. H., Pyo, S. & Cho, S.-R. Reduced Interaction of Aggregated α-Synuclein and VAMP2 by Environmental Enrichment Alleviates Hyperactivity and Anxiety in a Model of Parkinson’s Disease. Genes 12, 392 (2021). Richter, F., Stanojlovic, M., Käufer, C., Gericke, B. & Feja, M. A Mouse Model to Test Novel Therapeutics for Parkinson’s Disease: an Update on the Thy1-aSyn (“line 61”) Mice. Neurotherapeutics 20, 97–116 (2023). Shin, M.-S., Jeong, H.-Y., An, D.-I., Lee, H.-Y. & Sung, Y.-H. Treadmill exercise facilitates synaptic plasticity on dopaminergic neurons and fibers in the mouse model with Parkinson’s disease. Neurosci. Lett. 621, 28–33 (2016). Xiong, M. et al. In vivo imaging of synaptic density with [11C]UCB-J PET in two mouse models of neurodegenerative disease. NeuroImage 239, 118302 (2021). Chang, C. H., Lim, K. L. & Foo, J. N. Synaptic Vesicle Glycoprotein 2C: a role in Parkinson’s disease. Front. Cell. Neurosci. 18, (2024). Dunn, A. R. et al. Synaptic vesicle glycoprotein 2C (SV2C) modulates dopamine release and is disrupted in Parkinson disease. Proc. Natl. Acad. Sci. U. S. A. 114, E2253–E2262 (2017). Frigerio, I. et al. Neurofilament light chain is increased in the parahippocampal cortex and associates with pathological hallmarks in Parkinson’s disease dementia. Transl. Neurodegener. 12, 3 (2023). Kish, S. J. et al. Preferential loss of serotonin markers in caudate versus putamen in Parkinson’s disease. Brain awm239 (2007) doi: 10.1093/brain/awm239 . Raisman, R., Cash, R. & Agid, Y. Parkinson’s disease: decreased density of 3H-imipramine and 3H-paroxetine binding sites in putamen. Neurology 36, 556–560 (1986). Waterman-Storer, C. M. et al. The interaction between cytoplasmic dynein and dynactin is required for fast axonal transport. Proc. Natl. Acad. Sci. U. S. A. 94, 12180–12185 (1997). Chung, C. Y., Koprich, J. B., Siddiqi, H. & Isacson, O. Dynamic Changes in Presynaptic and Axonal Transport Proteins Combined with Striatal Neuroinflammation Precede Dopaminergic Neuronal Loss in a Rat Model of AAV α-Synucleinopathy. J. Neurosci. 29, 3365–3373 (2009). Wang, Y. et al. The increase of α-synuclein and alterations of dynein in A53T transgenic and aging mouse. J. Clin. Neurosci. Off. J. Neurosurg. Soc. Australas. 96, 154–162 (2022). Chu, Y. et al. Alterations in axonal transport motor proteins in sporadic and experimental Parkinson’s disease. Brain 135, 2058–2073 (2012). Esteves, A. R. & Cardoso, S. M. Differential protein expression in diverse brain areas of Parkinson’s and Alzheimer’s disease patients. Sci. Rep. 10, 13149 (2020). Fourie, C. et al. Differential Changes in Postsynaptic Density Proteins in Postmortem Huntington’s Disease and Parkinson’s Disease Human Brains. J. Neurodegener. Dis. 2014, 938530 (2014). Whitfield, D. R. et al. Assessment of ZnT3 and PSD95 protein levels in Lewy body dementias and Alzheimer’s disease: association with cognitive impairment. Neurobiol. Aging 35, 2836–2844 (2014). Fullana, M. N. et al. Regionally selective knockdown of astroglial glutamate transporters in infralimbic cortex induces a depressive phenotype in mice. Glia 67, 1122–1137 (2019). Miquel-Rio, L. et al. ER-stress in mouse serotonin neurons triggers a depressive phenotype alleviated by ketamine targeting eIF2α signaling. iScience (2024). Alarcón-Arís, D. et al. Anti-α-synuclein ASO delivered to monoamine neurons prevents α-synuclein accumulation in a Parkinson’s disease-like mouse model and in monkeys. EBioMedicine 59, 102944 (2020). Fernandez-Garcia, C., Alonso-Frech, F., Monje, M. H. G. & Matias-Guiu, J. Role of deep brain stimulation therapy in the magnetic resonance-guided high-frequency focused ultrasound era: current situation and future prospects. Expert Rev. Neurother. 20, 7–21 (2020). Avants, B. et al. Multivariate analysis of structural and diffusion imaging in traumatic brain injury. Acad. Radiol. 15, 1360–1375 (2008). Ma, Y. et al. In Vivo 3D Digital Atlas Database of the Adult C57BL/6J Mouse Brain by Magnetic Resonance Microscopy. Front. Neuroanat. 2, 1 (2008). Winkler, A. M., Ridgway, G. R., Webster, M. A., Smith, S. M. & Nichols, T. E. Permutation inference for the general linear model. NeuroImage 92, 381–397 (2014). Tables Tables 1 to 3 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 13 Aug, 2025 Read the published version in npj Parkinson's Disease → Version 1 posted Editorial decision: Accepted 08 Jul, 2025 Reviews received at journal 07 Jul, 2025 Reviews received at journal 02 Jul, 2025 Reviewers agreed at journal 30 Jun, 2025 Reviewers agreed at journal 26 Jun, 2025 Reviewers invited by journal 26 Jun, 2025 Submission checks completed at journal 26 Jun, 2025 First submitted to journal 17 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6179126","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":476968575,"identity":"13f7c712-b396-4297-920c-337b1f473a12","order_by":0,"name":"Lluis Miquel-Rio","email":"","orcid":"","institution":"Spanish National Research Council (CSIC)","correspondingAuthor":false,"prefix":"","firstName":"Lluis","middleName":"","lastName":"Miquel-Rio","suffix":""},{"id":476968576,"identity":"b5885d2e-02b0-4234-a6e8-0fe7ac422423","order_by":1,"name":"Judith Jericó-Escolar","email":"","orcid":"","institution":"Spanish National Research Council (CSIC)","correspondingAuthor":false,"prefix":"","firstName":"Judith","middleName":"","lastName":"Jericó-Escolar","suffix":""},{"id":476968577,"identity":"4fb39f53-eb81-45b3-a978-4951092686f0","order_by":2,"name":"Unai Sarriés-Serrano","email":"","orcid":"","institution":"Spanish National Research Council (CSIC)","correspondingAuthor":false,"prefix":"","firstName":"Unai","middleName":"","lastName":"Sarriés-Serrano","suffix":""},{"id":476968578,"identity":"ab52e0ea-384c-473d-8d5a-d2c299f5cd16","order_by":3,"name":"Claudia Yanes-Castilla","email":"","orcid":"","institution":"Spanish National Research Council (CSIC)","correspondingAuthor":false,"prefix":"","firstName":"Claudia","middleName":"","lastName":"Yanes-Castilla","suffix":""},{"id":476968579,"identity":"410f966d-d56e-4a21-9fb4-e2d57a3a6f2c","order_by":4,"name":"María Torres-López","email":"","orcid":"","institution":"Hospital Universitario Virgen del Rocío, CSIC/Universidad de Sevilla","correspondingAuthor":false,"prefix":"","firstName":"María","middleName":"","lastName":"Torres-López","suffix":""},{"id":476968580,"identity":"5f9cd0f9-ccc3-41a5-a0ec-7f91c073fc38","order_by":5,"name":"Uxia Argibay","email":"","orcid":"","institution":"Spanish National Research Council (CSIC)","correspondingAuthor":false,"prefix":"","firstName":"Uxia","middleName":"","lastName":"Argibay","suffix":""},{"id":476968581,"identity":"00023453-74b0-4482-accf-43058a65852d","order_by":6,"name":"Verónica Paz","email":"","orcid":"","institution":"Spanish National Research Council (CSIC)","correspondingAuthor":false,"prefix":"","firstName":"Verónica","middleName":"","lastName":"Paz","suffix":""},{"id":476968582,"identity":"90fd7340-c6b0-4839-a7c0-a6aaae8423ff","order_by":7,"name":"Carme Casal","email":"","orcid":"","institution":"Spanish National Research Council (CSIC)","correspondingAuthor":false,"prefix":"","firstName":"Carme","middleName":"","lastName":"Casal","suffix":""},{"id":476968583,"identity":"c8924556-c3dc-433e-9afe-719a5c9642a2","order_by":8,"name":"Emma Muñoz-Moreno","email":"","orcid":"","institution":"Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS)","correspondingAuthor":false,"prefix":"","firstName":"Emma","middleName":"","lastName":"Muñoz-Moreno","suffix":""},{"id":476968584,"identity":"ea40e4ec-4e83-40ef-97c8-b5a94bea093c","order_by":9,"name":"Xavier López-Gil","email":"","orcid":"","institution":"Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS)","correspondingAuthor":false,"prefix":"","firstName":"Xavier","middleName":"","lastName":"López-Gil","suffix":""},{"id":476968586,"identity":"549baf84-2c86-4309-97eb-19ffd0cd8bb0","order_by":10,"name":"Analia Bortolozzi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABIElEQVRIie3QMUvDQBTA8RcOnsu1WS8UvK9wxbXgV7ng0KUUSxcHkZRCumidi1+ibh0vHNQl4JrB4UK/QECQDkU8Ei3CEenocH8IHAc/8t4B+Hz/s0BJAFkfjf3wbJboILEn0m6+CWkg0uwEAr8JMAmkJi2FT3OjzC2Mw95rZuTN3WU32s30ZAOcL4iB6uAQ9rYVSm5hGi2viJA5EuzFiV7l0F9rFMEqdX9TSEsQ4nVOkMUpxZp0UpCCUCAdd0JeDCslP4+EUYyyhvC5JQd3MFGMhIrTIxEMWdAQ0JYAOqRfjK5VvGTT6J5c2F2kQFrvwupdsgd3l/Ni+FzuPwbjkAalqeyL8cXL7n2yGXD+qEuzdwf7ebiWG9UGfD6fz/dnX7pQam+4GgPIAAAAAElFTkSuQmCC","orcid":"","institution":"Spanish National Research Council (CSIC)","correspondingAuthor":true,"prefix":"","firstName":"Analia","middleName":"","lastName":"Bortolozzi","suffix":""}],"badges":[],"createdAt":"2025-03-07 14:38:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6179126/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6179126/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41531-025-01073-1","type":"published","date":"2025-08-13T15:57:46+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":89310565,"identity":"17975b94-f8a7-4584-ad44-af621a724036","added_by":"auto","created_at":"2025-08-18 16:08:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":984213,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6179126/v1/83f2a42a-0c8b-42f3-8144-4c9860c5e58e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Early synaptic changes and reduced brain connectivity in PD-like mice with depressive phenotype","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eParkinson\u0026rsquo;s disease (PD) is the most prevalent neurodegenerative motor disorder worldwide, with resting tremor, rigidity, bradykinesia and postural instability being the main symptoms of the disease \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. However, growing evidence suggests that PD is a disorder with numerous non-motor symptoms that affect multiple, non-dopaminergic neuronal populations aside from the dopaminergic (DA) system \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Among mental health disorders, depression is one of the major non-motor symptoms of PD, with approximately 40\u0026ndash;50% of patients with PD suffering from depressive disorder \u003csup\u003e\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Although depression may be secondary to progressive and disabling motor symptoms, a significant number of PD patients present comorbid depression early in the prodromal phase, and many have somewhat more rapid disease progression \u003csup\u003e\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. This suggests that depression may influence primary motor impairments or signal more severe forms of PD. Therefore, it is not surprising that converging evidence suggests that a first occurrence of depression significantly increases the risk of developing PD later in life.\u003c/p\u003e \u003cp\u003eConsiderable efforts have been devoted to elucidate the neural basis of depression in PD (D-PD). Postmortem studies suggest that pathological processes may occur early in cortical and limbic regions linked to emotional control \u003csup\u003e\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, providing insight into the pathological mechanisms of depression in the pre-motor PD phase. Indeed, neurotransmitter imaging studies have shown abnormal serotonin (5-HT) innervation and neurotransmission in different brain regions including the dorsolateral prefrontal cortex (dlPFC), orbitofrontal cortex, anterior cingulate cortex (ACC), caudate nucleus (CAU), thalamus, and hippocampus (HPC) in D-PD patients \u003csup\u003e\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. However, other neuroimaging studies also suggest a loss of DA and noradrenaline fibers in the limbic regions in patients with D-PD \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Abnormal functional activity in the PFC, e.g. dlPFC and ACC, has been characterized as a critical feature in the pathophysiology of depressive disorders, as well as in the favorable outcomes of new antidepressant strategies \u003csup\u003e\u003cspan additionalcitationids=\"CR21 CR22\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Of note, the PFC is strongly innervated by raphe 5-HT neurons \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e and 5-HT dysfunction is linked to depressive disorder, also in PD \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Consistent with these data, several structural and functional neuroimaging studies have shown pronounced changes in the PFC networks in D-PD patients that differ from those of patients with PD alone \u003csup\u003e\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Previous studies using 2-[\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003eF]-fluoro-2-deoxy-D-glucose and positron emission tomography (PET) showed hypo-metabolism in the orbitofrontal cortex and ACC \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e, suggesting that D-PD may be associated with orbital-inferior frontal lobe dysfunction. In addition, using magnetic resonance imaging (MRI), cortical thinning and white matter abnormalities have been reported in prefrontal, temporal and some limbic regions in patients with D-PD \u003csup\u003e\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Reduced bilateral HPC and amygdala (Amg) volumes are other neuroanatomical correlates of depressive symptoms in PD \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMore recently, it has been proposed that abnormal cortical-limbic circuit activity and connectivity, which suggest altered higher-order control of negative mood, is a possible neural mechanism of D-PD. Resting-state functional MRI (rs-fMRI) analysis showed reduced functional connectivity between the ACC and the right tempo-parietal junction, as well as between the posterior cingulate cortex and the insula, and between the superior parietal lobule and the PFC in patients with D-PD, distinguishing them from those PD patients without depression \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Other connectome studies have also reported a decrease in functional connectivity within the cortical-limbic networks, together with an increase in connectivity between limbic regions, e.g. increased functional connectivity between amygdala with the bilateral mediodorsal thalamus, in patients with D-PD \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. These data suggest that the salient circuitry involved in emotion recognition, and negative emotions in particular, may be impaired in comorbid depressive symptoms in PD, and the underlying pathological mechanisms await further elucidation.\u003c/p\u003e \u003cp\u003eThe causes of PD are unclear, but the build-up of the α-synuclein protein (α-Syn) is a key part of the disease process \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. α-Syn is expressed in all neuronal types, where it modulates axonal transport, vesicle dynamics and, ultimately synaptic plasticity \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e,\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Its overexpression in mouse raphe 5-HT neurons causes an increase in phosphorylation and aggregation of α-Syn protein, together with progressive accumulation of α-Syn in 5-HT-positive fibers in cortico-limbic regions, deficits in the brain-derived neurotrophic factor (BDNF) expression and reduced 5-HT neurotransmission, resulting in a depressive-like phenotype \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Of note, depression has been associated with elevated plasma α-Syn levels \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e, and we found higher levels of phospho-α-Syn in postmortem dlPFC and CAU samples from patients with depression, comparable to those of early-stage PD patients (Braak 2\u0026ndash;3) \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e, which seems significant given the prevalence of depression in PD. Here, we combined rs-fMRI with synaptic and cellular activity mapping in the D-PD-like mouse model \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e to probe how α-Syn accumulation in the brain 5-HT system leads to synaptic and connectivity dysfunctions in brain areas controlling mood and emotional processes. We found altered synaptic marker density, increased cellular activity, and reduced rs-fMRI coupling of medial PFC (mPFC), caudate-putamen (CPu), and HPC with their cortico-subcortical targets dependent on changes in 5-HT neuroplasticity associated with α-Syn pathology. Changes in synaptic markers were confirmed in post-mortem samples from PD patients. These findings may be useful in facilitating a better understanding of the potential mechanism underlying depression in PD.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eD-PD-like mouse model with h-α-Syn overexpression in raphe 5-HT neurons\u003c/h2\u003e \u003cp\u003eFirst, we confirmed that expression of the wild-type human α-Syn transgene (h-α-Syn) in 5-HT raphe neurons results in a progressive increase in h-α-Syn protein levels in the mouse 5-HT ascending system, as previously described \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Here we use a novel AAV2/5-CBh-WPRE3A vector encoding h-α-Syn (denoted AAV-α-Syn, provided by the MJJ Foundation) - previously we used AAV5-CBh-α-Syn \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e - infused into the mouse dorsal raphe nucleus (DR). To investigate the time-course of h-α-Syn expression, male and female mice were euthanized at 4- and 8-weeks post-injection. Increased h-α-Syn protein density levels were detected in the rostral-caudal axis of the DR (anteroposterior \u0026ndash; AP coordinates from \u0026minus;\u0026thinsp;4.24 to -4.72 mm) of both males and females compared to the respective control group injected with the empty AAV2/5-CBh-WPRE3 vector containing non-coding (null) stuffer DNA (AAV-EV) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, \u003cb\u003eSuppl 1A, 1B\u003c/b\u003e). However, while the maximum increase in h-α-Syn density levels was found in male mice 8 weeks later (\u0026sim;341% vs. \u0026sim;477% compared to control group at 4 and 8 weeks, respectively), no significant differences were found in female mice at 4 and 8 weeks post-AAV-α-Syn injection (\u0026sim;295% and \u0026sim;286%, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, \u003cb\u003eSuppl 1B)\u003c/b\u003e. Further histological analysis was performed to assess whether h-α-Syn protein co-localized with cells positive for the neuronal 5-HT-specific marker tryptophan hydroxylase (TPH). We found progressively significant increases in the number of TPH-positive cells co-localizing with h-α-Syn in the DR of male mice. At 8 weeks post-infusion 82.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3% of TPH-positive cells were positive for h-α-Syn immunoreactivity, compared to 66.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9% detected at 4 weeks post-infusion (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. No significant differences were observed in female mice and we found a similar number of double positive cells for TPH and h-α-Syn in the DR (83.1\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9% and 84.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9% of double TPH/h-α-Syn-positive cells at 4 and 8 weeks, respectively) (\u003cb\u003eSuppl 1B).\u003c/b\u003e No loss of TPH-positive cells was observed in either sex, at least in this timeline. As we have found sex-related differences in raphe h-α-Syn accumulation and in behavioral profiles, e.g., stress-related behavior in males vs. anxiety-related behavior in females \u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e, here we focused the next experiments on male mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn the DR, the five major neuronal classes (in decreasing order of abundance) are 5-HT, DA, GABA, glutamate, and peptidergic neurons \u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Therefore, we examined whether the two most important non-5-HT neuronal populations in the DR, DA and GABA neurons, are positive for h-α-Syn or its phosphorylated form at amino-acid serine-129 (p-α-Syn). We found that of the total number of p-α-Syn-positive cells in the DR, a small number were also positive for the GABA GAD67 marker (1.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2% and 3.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3% at 4 and 8 weeks, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). In addition, we detected 62.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3% and 76.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9% of double-positive cells for the DA tyrosine hydroxylase (TH) neuron marker and h-α-Syn in more rostral DR regions (AP coordinates \u0026minus;\u0026thinsp;4.24 to -4.36 mm) at 4 and 8 weeks post-injection, respectively, with no change in the total number of TH-positive neurons compared to AAV-EV control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003eNext, we analyzed the accumulation of h-α-Syn in efferent brain areas including the mPFC, cingulate cortex (Cg), CPu, and HPC of AAV-EV and AAV-α-Syn injected mice. As previously reported \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e, we confirmed an abundant and progressive presence of h-α-Syn-positive fibers in the different brain areas analyzed, reaching maximum levels 8 weeks later compared to 4 weeks (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u0026thinsp;\u0026minus;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH). The h-α-Syn signal was exclusively axonal and no h-α-Syn cell bodies were detected, as previously \u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. In parallel, a significant loss of serotonin transporter-(SERT)-positive axons was observed in all brain areas examined 8 weeks later (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u0026thinsp;\u0026minus;\u0026thinsp;0.001; \u003cb\u003eSuppl 2\u003c/b\u003e). In addition, we analyzed SERT/h-α-Syn-positive fiber density and found values (in descending order of density) of 39.2\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5%, 30.9\u0026thinsp;\u0026plusmn;\u0026thinsp;2.7%, 20.1\u0026thinsp;\u0026plusmn;\u0026thinsp;4.5%, and 15.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5% in CPu\u0026thinsp;\u0026gt;\u0026thinsp;Cg\u0026thinsp;\u0026gt;\u0026thinsp;mPFC\u0026thinsp;\u0026gt;\u0026thinsp;HPC at 8 weeks post-injection, indicating that h-α-Syn protein was transported anterogradely along 5-HT axons towards synaptic terminals. More interestingly, we also detected some TH-positive fibers co-localizing with h-α-Syn at 4 and 8 weeks post-injection. These were examined only in CPu and Cg of AAV-h-α-Syn-injected mice in DR compared to the control group (\u003cb\u003eSuppl 3A, 3B\u003c/b\u003e). Analysis showed a progressive increase in the number of TH/h-α-Syn-positive fibers (CPu: 5.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9%, 10.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9%; Cg: 12.0 2.7%, 21.3 0.8 at 4 and 8 weeks later, respectively), although to a lesser extent compared to the density of SERT/h-α-Syn-positive fibers in the same brain areas. No significant difference in the TH-positive axon density was observed in the brain areas analysed (\u003cb\u003eSuppl 3C, 3D).\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSynaptic pathology in efferent brain regions in the D-PD-like mouse model\u003c/h3\u003e\n\u003cp\u003eIn physiological conditions, α-Syn is abundant in the pre-synaptic compartment \u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. Neuropathological and experimental studies provided evidence that α-Syn aggregation might start at pre-synaptic terminals, inducing synaptic degeneration and subsequently neuronal loss \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e,\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. Since an accumulation of the h-α-Syn protein was detected in efferent brain regions after infusion of AAV-h-α-Syn in DR, we mapped synaptic changes using different pre- and post-synaptic markers in interconnected brain areas. Immunoreactivity for synaptic vesicle glycoprotein 2A (SV2A), an integral glycoprotein found in the membranes of synaptic vesicles in all synaptic terminals and widely distributed throughout the brain, was increased by \u0026sim;87.8% in Cg (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and by \u0026sim;82.6% in CPu (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) of AAV-h-α-Syn injected mice compared to control group at 8 weeks\u0026rsquo; post-infusion. No changes were observed in other brain areas analyzed (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. In parallel, synaptophysin (SYP) density, another abundant synaptic vesicle membrane protein comprising \u0026sim;10% of the total synaptic protein \u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e, was also increased in Cg (\u0026sim;25%, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and CPu (\u0026sim;40%, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) of the same AAV-h-α-Syn injected mice compared to control group at 8 weeks post-infusion. Within the groups, a similar SYP density was detected in all other brain regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe also examined the density of microtubule-associated protein 2 (MAP-2), a dendritically enriched protein that controls microtubule dynamics, cellular transport, and synaptic function \u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e,\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e, in AAV-h-α-Syn injected mice compared to control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). MAP-2 density was significantly decreased in all brain areas assessed at 8 weeks (reduction of \u0026sim;72.3% in prelimbic cortex - PrL, \u0026sim;74% in infralimbic cortex - IL, \u0026sim;58% in Cg, \u0026sim;51% CPu, \u0026sim;40% in CA1, and \u0026sim;44% in CA2/3; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u0026thinsp;\u0026minus;\u0026thinsp;0.001). Taken together, the progressive axonal α-Syn accumulation is associated with an aberrant increase in the density of pre-synaptic markers and a decrease in MAP-2 immunoreactivity throughout the brain, especially after 8 weeks.\u003c/p\u003e \u003cp\u003eWe then performed immunoblot analysis on microdissected mouse mPFC, CPu, and HPC extracted 8 weeks after intra-DR injection of AAV-h-α-Syn or AAV-EV. Western-blot (WB) analysis confirmed a regional increase in the levels of the presynaptic markers SV2A (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01), SYP (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and VAMP2 (vesicle associated membrane protein 2, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in mPFC and marginal effects in CPu (SV2A, p\u0026thinsp;=\u0026thinsp;0.060; SYP, p\u0026thinsp;=\u0026thinsp;0.088; VAMP2, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared to control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-D). The changes in synaptic markers in the mPFC, but not in the CPu, were accompanied by a significant increase in the levels of the motor protein dynein (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). There was also a significant reduction in the post-synaptic marker PSD95 (postsynaptic density protein 95) in the mPFC (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and CPu (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). No changes in these synaptic markers were found in the HPC from mice overexpressing h-α-Syn in DR.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eSynaptic pathology in cortical and subcortical brain areas in PD patients\u003c/h3\u003e\n\u003cp\u003ePreviously, we showed that the accumulation of oligomeric α-Syn in the dlPFC of PD patients at different Braak stages (early B2-3 and late B5-6) correlates with an increase in PERK-eIF2α signaling, which is known to control the quality of synaptic proteins \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. Here, we investigated whether the increased α-Syn levels in different brain areas is associated with regional changes in synaptic markers, as assessed in D-PD-like mice. First, we confirmed the regional presence of oligomeric α-Syn in the dlPFC, CAU, and HPC of PD patients at B2-3 and B5-6 by WB compared to controls (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u0026thinsp;\u0026minus;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). We also detected a significant reduction in SERT levels in the dlPFC and CAU (marginal effects in HPC) examined in both B2-3 and B5-6 stages compared to control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u0026thinsp;\u0026minus;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). In parallel, presynaptic SV2A and SYP protein levels were significantly increased in the dlPFC and CAU of PD patients at B2-3 compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u0026thinsp;\u0026minus;\u0026thinsp;0.01), but their density decreased in all brain areas examined at B5-6 compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u0026thinsp;\u0026minus;\u0026thinsp;0.01; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE- \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). For presynaptic VAMP2 protein, WB analysis showed higher levels in the dlPFC and CAU at the onset of the disease (B2-3) and decreased levels in CAU and HPC in the late stage (B5-6) compared to the respective control groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u0026thinsp;\u0026minus;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). WB analysis of dynein showed marginal increases in motor protein levels in dlPFC (p\u0026thinsp;=\u0026thinsp;0.055) and CAU (p\u0026thinsp;=\u0026thinsp;0.064) at B2-3 and a slight reduction in HPC (p\u0026thinsp;=\u0026thinsp;0.061) at B5-6 compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI). Furthermore, regionally increased α-Syn levels were associated with reduced PSD95 levels in dlPFC, CAU, and HPC of PD patients at B5-6 compared to the control subjects (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u0026ndash;0.01; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ). Taken together, we found changes in different pre- and post-synaptic markers in cortical and sub-cortical regions that depend on the duration of the disease, with increases in the initial pre-motor phases (B2-3) that progress to decreases in the later stages (B5-6) of the disease, perhaps correlating with cortical/subcortical synaptic loss.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eMapping of Egr-1-dependent brain cell activity and functional connectivity in the D-PD-like mouse model\u003c/h3\u003e\n\u003cp\u003eWe then investigated whether regional changes in synaptic plasticity translate into changes in Egr-1-dependent whole-brain cellular activity in the D-PD mouse model. We found that Egr-1 mRNA expression assessed by \u003cem\u003ein situ\u003c/em\u003e hybridization was generally high in the PrL/IL cortices, Cg, CPu, hippocampal area (CA1 and CA2/3), and amygdala (Amg), while expression was lower in the hypothalamus (Hyp) and the DR in AAV-h-α-Syn mice compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05\u0026ndash;0.0001; Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-C\u003cb\u003e)\u003c/b\u003e. Increases in Egr-1 mRNA expression in efferent cortical and subcortical areas occurred only 8 weeks later, parallel to the changes observed in the synaptic marker levels and the progressive increase in α-Syn-positive fibers. However, the level of Egr-1 mRNA expression was reduced in Hyp and DR 4 weeks later and remained so until the end of the experiment (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u0026thinsp;\u0026minus;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGiven the changed profile of cellular activity in the different brain regions examined, we then characterized brain connectivity in the D-PD-like mouse model at 8 weeks only. We investigated how the net activity of neural elements in a target region is influenced by the net activity of neural elements in a source region using resting-state fMRI (rs-fMRI). In a more specific manner, we evaluated the functional connectivity using seed-based analyses with three different regions considered as seed, namely mPFC, CPu, and HPC. In this way, we measured the correlation between the brain activity at any point in the brain and the activity in the regions of interest (seed), automatically identified based on a mouse brain atlas and the rest of the brain. To analyze phenotype differences, first we identified the points in the whole brain where connectivity with the seed region was significantly different between groups, and obtained a voxel-wise statistical map of the differences (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-C, \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-C, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA-C). Since the points with significant differences are organized into clusters, we identified these clusters further to evaluate the average connectivity between them and the seed regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD).Voxel-wise statistics with FWE-correction and TFCE did not show differences in the connectivity of mPFC. However, when a p\u0026thinsp;\u0026lt;\u0026thinsp;0.005 (without FWE-correction) was considered, four cluster of differences were detected.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCompared to control group, the left mPFC of AAV-h-α-Syn mice showed reduced functional connectivity with the cluster 1 to 4 named as: PFC-1 (medial orbital cortex, PrL/IL, and accumbens nucleus; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), PFC-2 (substantia nigra reticulata, pontine reticular nucleus, and B9 5-HT cells; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), PFC-3 (HPC; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and PFC-4 (DR and periaqueductal gray; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-D).\u003c/p\u003e \u003cp\u003eFurthermore, we also evaluated functional connectivity through a seed-based analysis between the left CPu and the rest of the brain (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-D). Compared to control group, the left CPu of AAV-h-α-Syn mice showed reduced functional connectivity with clusters CPu-1 to CPu-7 (corrected p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05): CPu-1 (Prl/IL, CPu, somatosensory cortex, and globus palillus; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), CPu-2 (motor cortex 1/2; p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), CPu-3 and CPu-6 (retrosplenial cortex; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 and p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, respectively), CPu-4 (CPu; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), CPu-5 (habenula, thalamus, hypothalamus, HPC, amygdala, substantia nigra reticulata, ventral tegmental area, visual cortex, DR, and periaqueductal gray; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and CPu-7 (ectorhinal and perirhinal cortices; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001).\u003c/p\u003e \u003cp\u003eFinally, we also evaluated functional connectivity through a seed-based analysis between the left HPC and the rest of the brain (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA-\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). Compared to control group, the left HPC of AAV-h-α-Syn mice showed reduced functional connectivity with clusters HPC-1 to HPC-7 (corrected p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05): HPC-1 (medial orbital cortex, and PrL/IL cortices; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), HPC-2 (CPu; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), HPC-3 (somatosensory cortex; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and HPC-4 (thalamus and hypothalamus; p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Overall, our results highlight that cortico-limbic-raphe functional connectivity is greatly affected in D-PD-like mice.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eDepression is one of the most common non-motor symptoms, is highly prevalent in PD patients, and one of the most important predictors of poor quality of life in people with PD. It often precedes motor symptoms, but is underdiagnosed and undertreated \u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e,\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. Indeed, the diagnosis of depression in PD is complex, especially when different clinical presentations of depression and PD overlap. In recent years, neuroimaging reports have suggested reduced connectivity between the cortico-limbic networks, perhaps as a result of altered higher-order cortical modulatory effects in emotion-related limbic areas (including the thalamus, ventral striatum, insula, Amg, and Cg), leading to mood dysregulation \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e,\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e. In support of this, multimodal neuroimaging studies combining structural and connectivity analysis have been able to identify neurophysiological subtypes of PD patients, distinguishing between those with the dominant severe depression subtype and those with the dominant severe movement subtype. The first group have an altered connectivity pattern, mainly composed in limbic regions \u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. An important biological basis for depression in PD is the result of the impairment of 5-HT innervation and neurotransmission in brain areas of the cortico-limbic system \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e. We have previously developed a mouse model with overexpression of h-α-Syn in DR 5-HT neurons that exhibits depressive-like behavior associated with reduced 5-HT neurotransmission in the mPFC and CPu \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Here, we extended these studies and showed that axonal h-α-Syn accumulation in male mice overexpressing the transgene in DR is coupled to a progressive loss of 5-HT SERT-positive fibers in cortical and subcortical areas and to a functional hypo-connectivity in cortico-limbic-raphe network, mainly at 8 weeks. Using seed-based analyses of rs-fMRI, we identified major clusters of connectivity changes between the mPFC-Accumbes nucleus, mPFC-DR, CPu-PrL/IL, CPu-thalamus\u0026thinsp;+\u0026thinsp;Amg, CPu-HPC, HPC-PrL/IL, HPC-CPu, and HPC-thalamus, networks which may be specifically involved in different aspects of emotion behavioral regulation, as reported in patients with D-PD. It is important to highlight the hypo-connectivity found between the mPFC-DR and CPu-DR using this mouse model of D-PD. Previous neuroimaging studies have reported a unique profile of reduced connectivity between the DR and the PFC\u0026thinsp;+\u0026thinsp;Cg that correlated with anxiety, drowsiness, and depression in PD \u003csup\u003e\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e. Taken together, the data support the translational nature of this mouse model in advancing our understanding of the neurobiological substrates underlying depression in PD. However, it is important to note that some studies have found that certain non-motor symptoms such as fatigue, depression, anxiety and sleep problems occur more frequently in females; while other non-motor symptoms, such as drooling, diurnal somnolence, urinary and sexual dysfunction, and cognitive impairment are more prevalent in males \u003csup\u003e\u003cspan additionalcitationids=\"CR63\" citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u003c/sup\u003e. Therefore, a key limitation of our study is that we only explored the effects of α-Syn accumulation in the 5-HT system using a male mouse model. Further studies that include females are essential to gain a comprehensive, relevant perspective.\u003c/p\u003e \u003cp\u003eIn parallel with the changes in the activity of the cortico-limbic-raphe network, we found an increase in Egr-1-dependent cellular activity in the cortico-limbic regions (PrL/IL, Cg, CPu, HPC, and Amg) in the D-PD mouse model at 8 weeks. Egr-1 (also called NGFI-A, Zif268, or Krox24) is a zinc finger transcription factor implicated in processes of synaptic plasticity and cell activation, and has been shown to have a crucial role in both neuronal death and inflammatory response \u003csup\u003e\u003cspan additionalcitationids=\"CR66\" citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u003c/sup\u003e. In fact, elevated Egr-1 levels were detected in a PD mouse model of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) associated with an astrocyte activation and neuroinflammation \u003csup\u003e\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u003c/sup\u003e. Although we have not identified the Egr-1-dependent activated cell type in the whole brain, we have found increases in the neuroinflammatory markers TNFα, INFγ, and NFkB1 in the mPFC and CPu using this D-PD mouse model, suggesting a possible Egr1-dependent activation mechanism leading to astrogliosis and/or microgliosis (Miquel-Rio et al., personal communication). In addition, we also found reduced Egr-1 expression in the DR of D-PD mice locally injected with AAV-h-α-Syn. DR \u0026ndash;one of the most extensively connected hubs in the mammalian brain\u0026ndash; is the largest 5-HT nucleus, containing approximately one third of all 5-HT neurons in the brain \u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e, although clusters of GABAergic, DAergic, and to a lesser extent, glutamatergic and peptidergic neurons have been identified in the DR \u003csup\u003e\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e\u003c/sup\u003e. In the present study, no changes in the number of TPH-positive or TH-positive cells were detected in the DR after h-α-Syn accumulation, but a reduced density of the SERT-positive fibers was shown in cortico-limbic regions, suggesting changes in the 5-HT system neuroplasticity. This could translate into a reduction in the specific activity of 5-HT cells, as observed with a reduction in Egr-1 mRNA expression in the DR. These results are further supported by our previous observations, confirming that overexpression of h-α-Syn in the mouse DR leads to decreased 5-HT neuron activity and 5-HT release in mPFC and CPu \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAs mentioned above, recent PET neuroimaging studies have demonstrated specific 5-HT denervation in cortico-striatal-limbic areas in PD patients with prominent neuropsychiatric signs at disease onset \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Although some TH-positive fibers were also positive for h-α-Syn in projection brain areas (e.g., Cg and CPu) after AAV-h-α-Syn infusion in the DR, a large proportion of h-α-Syn-positive fibers colocalized with SERT-positive 5-HT fibers. More importantly, a reduction in SERT-positive fibers density, but not TH-positive fibers, was detected in the cortico-striatal limbic regions (CPu\u0026thinsp;\u0026gt;\u0026thinsp;Cg\u0026thinsp;\u0026gt;\u0026thinsp;mPFC\u0026thinsp;\u0026gt;\u0026thinsp;HPC) in D-PD mice compared to controls, as previously shown in animal models of h-α-Syn overexpression in non-DA neurons \u003csup\u003e\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e,\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e\u003c/sup\u003e. It is known that α-Syn is a protein that regulates the expression and cellular trafficking of monoamine transporters, e.g. SERT, DA transporter \u0026ndash; DAT, and norepinephrine transporter - NET, towards the cell surface \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. α-Syn-induced modulation of SERT trafficking is microtubule-dependent, as the microtubule destabilizing agent nocodazole disrupts the effects of α-Syn on SERT function and reverses the inhibition of uptake in co-transfected cells \u003csup\u003e\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e\u003c/sup\u003e. In addition, \u003cem\u003ein vivo\u003c/em\u003e studies have shown that changes in the level of α-Syn expression in mouse 5-HT neurons directly produce opposite effects on the functional activity of SERT in efferent brain regions in response to the inhibitor citalopram \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e,\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e\u003c/sup\u003e. Taken together, this may suggest that the progressive accumulation of h-α-Syn in 5-HT axons and terminals leads to impaired SERT function in serotonergic synapses, resulting in the loss of system integrity.\u003c/p\u003e \u003cp\u003eActually, synaptic dysfunction and altered axonal transport have been postulated to be some of the earliest pathological events in PD, in which α-Syn is considered a hub protein by interacting with many synaptic proteins (e.g. monoamine transporters), cytoskeletal components, chaperones, and several synaptic vesicles SV-associated proteins \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e,\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e,\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e\u003c/sup\u003e. In physiological conditions, α-Syn is abundant in the pre-synaptic compartment \u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. Post-mortem and experimental studies provided evidence that α-Syn aggregation might start at pre-synaptic terminals, inducing synaptic degeneration and subsequently neuronal loss \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e,\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e\u003c/sup\u003e. Unlike previous studies that showed a decrease in the density of pre-synaptic markers SV2A, SYP, and VAMP2 in aged PD mice (17\u0026ndash;20 months) \u003csup\u003e\u003cspan additionalcitationids=\"CR76 CR77\" citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e\u003c/sup\u003e, here we reported an accumulation of these same pre-synaptic proteins in parallel with higher h-α-Syn levels, mainly in the Cg and CPu in the D-PD mouse model. Indeed, we have previously shown that increased levels of SV2A protein co-localize with h-α-Syn in axonal swellings in mouse CPu and Cg \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. In this regard, increases of the presynaptic SV2C protein -enriched in the basal ganglia and preferentially localized in DA neurons- were also reported in mice overexpressing mutant A53T α-Syn \u003csup\u003e\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e,\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e\u003c/sup\u003e. It is important to emphasize that we also observed increases in the levels of SV2A, SYP and VAMP2 proteins in the dlPFC and CAU of patients with PD in the early stages B2-3 of the disease, but these decreased in the later stages B5-6. Our data are consistent with recent studies showing reduced SYP and SV2A densities in cortical regions in B5-6 α-Syn stage compared to controls, associated with higher neurofilament light-chain (NfL) immunoreactivity and Lewy body density \u003csup\u003e\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e,\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e\u003c/sup\u003e. Although one of the main limitations of our study is the small number of post-mortem human tissue samples and the absence of an accurate diagnosis of depressive disorder in PD patients, the data support the idea that synaptic degeneration can occur together with axonal degeneration in the final stage of the disease. In the early B2-3 stages, when non-motor symptoms prevail, changes in the trafficking/refilling of synaptic vesicles mediated by α-Syn and/or in the structural organization of synapse may contribute to functional deficits in different brain networks, including those that regulate emotional processes. In fact, our data and others support these observations by showing reductions in the density of the 5-HT SERT marker that directly interacts with α-Syn in both stages B2-3 and B5-6 of PD \u003csup\u003e\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e,\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn this study, we also found a significant increase in the levels of axonal transport motor protein dynein in the mPFC in the D-PD mouse model overexpressing h-α-Syn in DR. Dynein is a microtubule-based motor protein that mediates minus-end-directed vesicle transport through interaction with dynactin \u003csup\u003e\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e,\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e\u003c/sup\u003e. Previous studies have reported that mice and rats overexpressing A53T α-Syn have higher dynein levels compared to the control group, leading to an accumulation of pre-synaptic proteins and a disruption of axonal transport, which precedes axonal denervation \u003csup\u003e\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e,\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e\u003c/sup\u003e. We observed a similar pattern here, with a cortical loss of 5-HT fibers associated with increased levels of h-α-Syn and vesicular proteins. In addition, reductions in dynein levels were reported in substantia nigra and putamen at late PD stages \u003csup\u003e\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e\u003c/sup\u003e. Although we detected marginal effects in specific brain regions, these were increases in early stages B2-3 of PD (e.g., dlPFC and CAU), followed by decreases in stages B5-6 of PD (e.g., HPC), supporting that neurodegeneration in PD involves a breakdown of axonal transport. Remarkably, the changes in pre-synaptic plasticity that occurred in the D-PD mouse model led to changes at the post-synaptic level, with decreased MAP-2 (localized primarily in neuronal dendrites) and PSD95 levels in brain areas of the cortico-limbic network that could be linked to the detected functional hypo-connectivity. Like other authors, we also detected reduced levels of PSP95 in advanced stages of PD (Esteves and Cardoso, 2020; but not Fourie et al., 2014; Whitfield et al., 2014)\u003c/p\u003e \u003cp\u003eIn conclusion, we have shown here that overexpression of h-α-Syn in the 5-HT system leaves to a hypo-connectivity in the cortico-limbic-raphe network that closely resembles the functional changes described in patients with depression and PD. Elevated levels of h-α-Syn in 5-HT projection areas trigger an abnormal pattern of accumulation of synaptic vesicle-associated proteins and defects in dynein-driven transport that would lead to reduced 5-HT neurotransmission, alterations in postsynaptic plasticity in efferent brain areas and the development of a depressive phenotype. These findings may help to better understand the mechanisms underlying depression in PD. This D-PD mouse is a powerful translational model for studying new targets and potential antidepressant interventions in α-Syn-associated neurodegenerative disorders.\u003c/p\u003e"},{"header":"METHODS","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e\n \u003ch2\u003eMice\u003c/h2\u003e\n \u003cp\u003eMale and female C57BL/6J mice (10 weeks; n\u0026thinsp;=\u0026thinsp;114 for the whole study, Charles River, Lyon, France) were housed under controlled conditions (22\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026ordm;C; 12h light/dark cycle) with food and water available ad-libitum. Animal procedures were conducted in accordance with standard ethical guidelines (EU directive 2010/63 of 22 September 2010) and approved by the local ethical committee (University of Barcelona).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003ch3\u003eMouse model overexpressing h-\u0026alpha;-Syn into serotonin (5-HT) neurons\u003c/h3\u003e\n\u003cp\u003eRecombinant adeno-associated viral vector serotype-2/5 (AAV2/5) with chicken-\u0026beta;-actin (CBh) promoter and a shortened WPRE3 that encodes the human wild-type \u0026alpha;-synuclein (AAV-h-\u0026alpha;-Syn) was used to overexpress the transgene in raphe 5-HT neurons of mice (dorsal raphe nucleus - DR), as previously reported \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. The Michael J. Fox Foundation gently provided the AAV2/5 constructs produced and tittered by the UNC Vector Core. We examined any possible effect of the AAV2/5 vector itself capable of exerting toxicity on 5-HT neurons and causing behavioral alterations using an empty AAV2/5-CBh-WPRE3 vector containing non-coding (null) stuffer DNA (AAV-EV) as a control group. Isoflurane-anesthetized mice (doses: 4% induction, 2% maintenance) were randomly injected with 1 \u0026micro;l of AAV-h-\u0026alpha;-Syn (concentration 0.5 x 10\u003csup\u003e13\u003c/sup\u003e gc/ml) or AAV-EV (concentration 0.5 x 10\u003csup\u003e13\u003c/sup\u003e gc/mL) into raphe nuclei (anterior-posterior AP: -4.5; medial-lateral ML: -1.0; dorsal-ventral DV: -3.2 in mm, relative to bregma with an angle 20\u0026ordm;), using a microinjector (KDS-310-PLUS, World Precision Instruments, Sarasota, LF, USA) at 0.4 \u0026micro;l/min rate. The needle was kept in place for an additional 5 min before slowly being withdrawn. Mice were assessed at 4 and 8 weeks after AAV-h-\u0026alpha;-Syn or AAV-EV infusion.\u003c/p\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003ePostmortem human brain samples\u003c/h2\u003e\n \u003cp\u003eDorsolateral prefrontal cortex (dlPFC), caudate nucleus (CAU), and hippocampus (HPC) tissue samples from controls and PD patients were obtained from the Hospital Clinic-IDIBAPS biobank, in accordance with Spanish legislation and with the approval of the Ethics Committee of Spanish National Research Council (Project Ref. PID2019-105136RB‐I00). The post-mortem interval between death and the processing of the tissues ranged from 3 to 20 h, and the samples were stored at -80\u0026deg;C until they were tested. Pathological cases were categorized as stages 1\u0026ndash;6 of LB disease pathology, according to Braak staining \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e, excluding tauopathies, vascular disease, and metabolic syndrome. No information (e.g. by formal testing) could be obtained on the neuropsychiatric status of the PD patients. Cases in the control group had not neurological, psychiatric, or metabolic disorders and no neuropathological abnormalities, except for sporadic Alzheimer\u0026rsquo;s disease. A total of 8 control and 16 cases with PD-related pathology were included in the present study. All PD cases were treated for motor symptoms. The duration of the disease was in the range of 8 to 18 years. The most common causes of death in people with PD were infections, neoplasia, and acute heart disease. See Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e for subject details.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eIn situ\u003c/strong\u003e \u003cstrong\u003ehybridization (ISH)\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eMice were euthanized by cervical dislocation and brains were rapidly removed, frozen on dry ice and stored at -80\u0026ordm;C. Coronal tissue sections (14 \u0026micro;m-thick) containing medial prefrontal cortex (mPFC), cingulate cortex (Cg), caudate-putamen (CPu), hippocampus (HPC), amygdala (Amg), hypothalamus (Hyp), and dorsal raphe nucleus (DR) were obtained and processed, as described elsewhere \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e91\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e92\u003c/span\u003e\u003c/sup\u003e. An antisense oligo probe sequence (GCATCATCTCCTCCAGTTTGGGGTAGTTGTCCATGGTGGGTGAGT), complementary to bases Egr1 (NM_007913.5) was used (IBA Nucleic Acids Synthesis, G\u0026ouml;ttingen, Germany). Frozen tissue sections were fixed for 20 min at 4\u0026ordm;C in 4% paraformaldehyde in phosphate-buffered saline (1x PBS: 8 mM Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e, 1.4 mM KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 136 mM NaCl, and 2.6 mM KCl), washed for 5 min in 3xPBS at room temperature, twice for 5 min each in 1x PBS, and incubated for 2 min at 21\u0026ordm;C in a solution of predigested pronase (Merck Millipore, Madrid, Spain) at a final concentration of 24 U/mL in 50 mM Tris-HCl, pH 7.5, and 5 mM EDTA. The enzymatic activity was stopped by immersion for 30 s in 2 mg/ml glycine in 1x PBS. Tissues were finally rinsed in 1xPBS and dehydrated through a graded series of ethanol.\u003c/p\u003e\n \u003cp\u003eOligonucleotide was individually labeled (2 pmol) at the 3\u0026apos;-end with [\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003eP]-dATP (\u0026gt;\u0026thinsp;2500 Ci/mmol; DuPont-NEN, Boston, MA, USA) using terminal deoxynucleotidyl-transferase (TdT, Calbiochem, La Jolla, CA, USA). For hybridization, the radioactively labelled probes were diluted in a solution containing 50% formamide, 4x standard saline citrate, 1x Denhardt\u0026rsquo;s solution, 10% dextran sulfate, 1% sarkosyl, 20 mM phosphate buffer, pH 7.0, 250 \u0026micro;g/ml yeast tRNA, and 500 \u0026micro;g/ml salmon sperm DNA. The final concentration of radioactive probes in the hybridization buffer was in the range (~\u0026thinsp;1.5 nM). Tissue sections were covered with hybridization solution containing the labelled probes, overlaid with parafilm coverslips and incubated overnight at 42\u0026ordm;C in humid boxes. Sections were then washed 4 times (45 min each) in a buffer containing 0.6 M NaCl and 10 mM Tris-HCl (pH 7.5) at 60\u0026ordm;C. Hybridized sections were exposed to Biomax-MR film (Sigma-Aldrich) for 2\u0026ndash;10 days at \u0026minus;\u0026thinsp;70\u0026deg;C with intensifying screens. For specificity control, adjacent sections were incubated with an excess (50x) of unlabeled probes. Films were analyzed and relative optical densities were evaluated in three adjacent sections by duplicate of each mouse, and averaged to obtain individual values using Image-J (v1.54c, NIH, Bethesda, MD, USA) software. Contrast and brightness of images were the only variables digitally adjusted.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eImmunofluorescence\u003c/h2\u003e\n \u003cp\u003eMice were anaesthetized with pentobarbital and transcardially perfused with 4% PFA in sodium-phosphate buffer (pH 7.4). Brains were extracted, post-fixed 24 h at 4\u0026deg;C in the same solution, and placed in gradient sucrose solution 10\u0026ndash;30% for 3 days at 4\u0026deg;C. After cryopreservation, serial 30 \u0026micro;m-thick sections were cut to obtain raphe nuclei, mPFC, Cg, CPu, and HPC. Immunofluorescence procedure was performed for h-\u0026alpha;-Syn (anti-h-\u0026alpha;-Synuclein clone Syn 211, 1:2000; ref.: AHB0261, Thermo Fisher Scientific, Waltham, MA, USA), mouse/human-\u0026alpha;-Syn (anti-m/h-\u0026alpha;-Syn, 1:500; ref.: ab212184, Abcam, Cambridge, UK) phospho-S129-\u0026alpha;-Syn (anti-phospho-S129-\u0026alpha;-Syn 1:2000; ref.: ab51253, Abcam, Cambridge, UK), tryptophan hydroxylase TPH (anti-TPH, 1:2500; ref.: AB1541, Sigma-Aldrich, Madrid, Spain), serotonin transporter SERT (anti-SERT, 1:2500; ref.: 24330, Immunostar, Hudson, WI, USA), glutamate decarboxylase GAD67 (anti-GAD67, 1:2500; ref.: MAB5406, Sigma-Aldrich, Madrid, Spain), tyrosine hydroxylase TH (anti-TH, 1:1250; ref.: ab112, Abcam, Cambridge, UK\u003cstrong\u003e)\u003c/strong\u003e, MAP-2 (anti-MAP-2, 1:1000; ref.: ab32454, Abcam, Cambridge, UK\u003cstrong\u003e)\u003c/strong\u003e, SV2A (anti-SV2A, 1:250; ref.: PA5-110451, Thermo Fisher Scientific, Waltham, MA, USA), and synaptophysin (anti-SYP, 1:1000; ref.: ab32127, Abcam, Cambridge, UK). Sections were washed in 1x PBS (pH 7.4) and 1x PBS/Triton 0.2%, and incubated in blocking solution (1x PBS/Triton containing 0.02% gelatin and the corresponding normal serum for the secondary antibody host) for 2 hours at room temperature. Primary antibody was incubated overnight at 4\u0026ordm;C, followed by incubation with the respective secondary antibodies for 2 hours at room temperature (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Finally, nuclei were stained with Hoestch dye (1:10.000; ref.: H3570, Life Technologies, Carlsbad, CA, USA) for 10 min and the sections were mounted in Entellan (Electron Microscopy Sciences, Hatfield, PA, USA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eConfocal fluorescence microscopy\u003c/h2\u003e\n \u003cp\u003eThe intracellular localization of h-\u0026alpha;-Syn or p-\u0026alpha;-Syn proteins in TPH\u003csup\u003e+\u003c/sup\u003e or GABA\u003csup\u003e+\u003c/sup\u003e cells in the DR, and the intracellular h-\u0026alpha;-Syn distribution in 5-HT axons were examined by confocal microscopy using an inverted Nikon Eclipse Ti2-E microscope (Nikon Instruments, Tokyo, Japan) attached to the spinning disk unit Andor Dragonfly 200 (Oxford Instruments Company, Abindong, UK). For all experiments, a Plan Apochromatic 10-20x, numerical aperture (NA) 0.45 objective was used. A high-precision motorized stage was used to collect the large-scale 3D mosaics of each tissue section. Individual image tiles were 2048 \u0026times; 2048 pixels with a z-section of 35 \u0026micro;m. For specific regions, we used an oil-immersion objective (Plan Apochromatic Lambda blue 40x, NA 1.4). Samples were excited with 405, 488, and 561 nm laser diodes, respectively. The beam was coupled into a multimode fiber going through the Andor Borealis unit reshaping the beam from a Gaussian profile to a homogenous flat top, and from there it was passed through the 40 \u0026micro;m pinhole disk. Tissue sections were imaged on a high resolution scientific complementary metal oxide semiconductor (sCMOS) camera (Zyla 4.2, 2.0 Andor, Oxford Instruments Company). Fusion software (Andor, Oxford Instruments Company) was used for acquisition and for image processing before analysis. Image stitching and deconvolution were performed using Fusion software (Andor, Oxford Instruments Company). Image analysis was performed with Image J/Fiji open source software (Wayne Rasband, NIH, Bethesda, MD, USA) using ImageJ Macro Language to develop custom Macros. Briefly, maximum projections of the channels of interest (red and green) were obtained for each section, and regions of interest (ROI) were delimited for each brain section to cover the maximum analyzable area. Quantification was performed using a group size ranging from four to ten animals and three coronal sections per animal. ROIs were systematically defined in all animals and brain regions. One ROI was analyzed per section in the DR, while two ROIs were analysed per section (bilaterally) in the brain projection areas. These sampling variables were kept constant for all animals in each experimental group.\u003c/p\u003e\n \u003cp\u003eVarious measurements were applied to the resulting images. For images co-labelling m/h-\u0026alpha;-Syn/TPH or h-\u0026alpha;-Syn/TH in the DR, the number of cells in the red channel was quantified after adjusting and homogenizing pixel values. Red-labeled cells were then examined for colocalization with the green channel upon merging and subsequently counted. Due to insufficient contrast with the background, GAD67\u0026thinsp;+\u0026thinsp;cells could not be directly counted. Instead, for images co-labelling p-\u0026alpha;-Syn/GAD67 in the DR, total p-\u0026alpha;-Syn\u0026thinsp;+\u0026thinsp;cells were quantified, and then those colocalizing with GAD67 were identified. In projection brain areas (mPFC, Cg, CPu, HPC), images co-labelling h-\u0026alpha;-Syn/SERT and h-\u0026alpha;-Syn/TH were acquired, and the mean intensity values for the green and red channels were measured for each ROI. Similarly, images of the same projection areas labelling MAP2, SV2A, and SYP were analyzed, and mean intensity values for the red channel were also measured in the defined ROIs.\u003c/p\u003e\n \u003cp\u003eFiber colocalization of h-\u0026alpha;-Syn with SERT and TH in projection areas was analyzed using the JACoP (Just Another Colocalization Plugin) plugin in ImageJ. First, images were standardized by adjusting their minimum and maximum pixel intensity values. Then, segmented images of the defined ROIs for the red and green channels were generated using consistent intensity thresholds across all images. Finally, the JACoP plugin was used to calculate Mander\u0026rsquo;s coefficient 1 (M1), which quantifies the proportion of the red channel overlapping with the green channel.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eProtein extraction and analysis by Western Blot (WB)\u003c/h2\u003e\n \u003cp\u003eThe procedure for WB and all antibodies used were previously validated in mouse models overexpressing human \u0026alpha;-Syn and in postmortem human brain samples \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e47\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e92\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e93\u003c/span\u003e\u003c/sup\u003e. Different brain areas from mice (mPFC, CPu, and HPC, 10 mg/each) and human (dlPFC, CPu, and HPC, 50 mg/each) were homogenized in RIPA lysis buffer (50 mM Tris, 150 mM NaCl, pH 8.0, 1% Triton X-100, 0.5% sodium deoxycholate, 5 mM EDTA, 0.1% SDS) with cOmplete\u0026trade; protease and PhosSTOP\u0026trade; phosphatase inhibitors (Roche; ref.: 05892970001, 4906845001, Basel, Sweden). Protein concentration was determined using the Pierce\u0026trade; BCA Protein Assay Kit (ThermoFisher Scientific, Waltham, MA, USA). 15 \u0026micro;g of protein lysates were separated by 4\u0026ndash;15% SDS-PAGE (Bio-Rad, Hercules, CA, USA) and electrotransferred to a PVDF membrane (Bio-Rad). Protein blots were incubated with primary antibodies overnight at 4\u0026ordm;C. Anti-h/m-\u0026alpha;-Syn (1:1000; ref.: ab212184, Abcam), anti-SYP (1:1000; ref.: ab32127, Abcam), anti-SV2A (1:1000; ref.: PA5-110451, Fisher Scientific), anti-VAMP2 (1:2000; ref.: ab3347, Abcam), anti-SERT (1:1000; ref.: ab102048, Abcam), anti-PDS95 (1:3000; ref.: ab2723, Abcam), and anti-dynein (1:2000; ref.: MAB1618, Millipore) were used (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cstrong\u003e)\u003c/strong\u003e. Protein expression levels were normalized by using the housekeeping \u0026beta;-actin (anti-\u0026beta;-actin-HRP. 1:50000; A3854, Merck). ImageLab software (Bio-Rad) was used for analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eMagnetic resonance imaging (MRI) acquisition, processing and analysis\u003c/h2\u003e\n \u003cp\u003eEach mouse was scanned at 8 weeks after AAV2/5 vector (AAV-\u0026alpha;-Syn or AAV-EV) infusion into DR (n\u0026thinsp;=\u0026thinsp;8 mice/group). Experiments were conducted on a 7.0T BioSpec 70/30 horizontal animal scanner (Bruker BioSpin), equipped with an actively shielded gradient system (600 millitesla per metre) with a surface coil for the mouse brain as receiver coil. Animals were sedated (4% isoflurane in 30% oxygen and 70% nitrogen), placed in a supine position in a Plexiglas holder with a nose cone for administering anesthetic gases and fixed using tooth and ear bars. Eyes were protected from dryness with Siccafluid ophthalmologic fluid. Once placed in the holder with constant isoflurane (1.5%), a subcutaneous bolus of medetomidine (Domtor, Orion Pharma; 0.3 mg/kg body weight) was injected. For the next 15 min, the percentage of isoflurane was progressively decreased to 0.5%. Then, a continuous perfusion of 0.6 mg/kg body weight per hour of medetomidine was started and maintained until the end of the acquisition session. After completion of the imaging session, 1 \u0026micro;l/g of atipamezole (Antisedan, Orion Pharma) and saline were injected to reverse the sedative effect and compensate fluid loss. Localizer scans were used to ensure the accurate position of the head at the isocentre of the magnet. Anatomical T2 RARE images were acquired in coronal orientation with effective time of echo (TE)\u0026thinsp;=\u0026thinsp;33 ms, time of repetition (TR)\u0026thinsp;=\u0026thinsp;2.3 s, RARE factor\u0026thinsp;=\u0026thinsp;8, voxel size\u0026thinsp;=\u0026thinsp;0.08 \u0026times; 0.08 mm\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e and slice thickness\u0026thinsp;=\u0026thinsp;0.7 mm. Resting-state functional MRI (fMRI) was acquired with an EPI sequence with TR\u0026thinsp;=\u0026thinsp;2 s, TE\u0026thinsp;=\u0026thinsp;19.4, voxel size 0.21 \u0026times; 0.21 mm\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e and slice thickness\u0026thinsp;=\u0026thinsp;0.5 mm. In total, 420 volumes were acquired resulting in an acquisition time of 14 min.\u003c/p\u003e\n \u003cp\u003eSeed-based analysis was performed as described previously \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e94\u003c/span\u003e\u003c/sup\u003e to evaluate functional connectivity of the CPu, HPC and mPFC with the rest of the brain. Preprocessing of the rs-fMRI data included: slice timing, spatial realignment using SPM8 for motion correction, elastic registration to the T2-weighted volume using ANTs for EPI distortion correction \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e95\u003c/span\u003e\u003c/sup\u003e, detrend, smoothing (FWHM\u0026thinsp;=\u0026thinsp;0.6 mm), frequency filtering of time series between 0.01 and 0.1 Hz, and regression by motion parameters using NiTime (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://nipy.org/nitime\u003c/span\u003e\u003c/span\u003e). Brain parcellation was performed based on the MRI-based atlas of the mouse brain \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e96\u003c/span\u003e\u003c/sup\u003e. The atlas template was elastically registered to each subject T2-weighted volume using ANTs \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e95\u003c/span\u003e\u003c/sup\u003e and the estimated transformation was applied to the label map to obtain specific parcellation for each acquisition T2-weighted image, which was subsequently translated to the resting-state fMRI images. The left CPu, HPC or mPFC was selected as seed regions for seed-based analysis. Extracted average time series in the CPu, HPC or mPFC was correlated with the time series of all the voxels within the brain, resulting in a connectivity map for each seed, containing the value of the seed-to-voxel correlation. Voxel-wise statistics were computed in the seed-based connectivity maps using randomize algorithm from FSL \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e97\u003c/span\u003e\u003c/sup\u003e to identify areas where this connectivity was significantly different between groups. This statistical analysis enabled the evaluation of connectivity between the selected regions and the rest of the brain, and generated a map of the brain coordinates where significant differences were detected. Familywise error (FEW) correction and TFCE (Threshold-free cluster enhancement) were applied to deal with multiple comparisons. Significance was defined as p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. The clusters of voxels where significant differences were identified were used as a mask to quantify average connectivity value in that area that was subsequently compared between groups. Together with this, for exploratory purposes, an additional voxel-based statistical analysis was performed including only the TFCE correction and setting a significance threshold of p\u0026thinsp;\u0026lt;\u0026thinsp;0.005. If no significant differences were identified using FWE-correction p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, results with uncorrected p\u0026thinsp;\u0026lt;\u0026thinsp;0.005 will be reported. As statistically significant differences were detected in clusters, we extracted these and evaluated the average connectivity within them. We then compared this connectivity between clusters to complement the previous voxel-based analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eAll values are mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Data from individual mouse was represented by single points when possible. The immunoreactivity value of the target proteins was corrected by the corresponding \u0026beta;-actin value and calculated as a percentage of a standard sample to control for inter-assay variability. The final estimate was the mean of the experimental replicates obtained in at least two different gels. Statistical comparisons were performed using GraphPad Prism 9.5.1 software. Outlier values were identified and excluded using the Grubbs\u0026rsquo; test (i.e., Extreme Student zed Deviate \u0026ndash; ESD method). Student\u0026apos;s \u003cem\u003et\u003c/em\u003e test, one-way and two-way ANOVA analysis, followed by Bonferroni \u003cem\u003epost hoc\u003c/em\u003e test were performed when appropriate, and indicated in results and figure legends. Non-parametric Kruskal-Wallis test followed by Dunnett\u0026rsquo;s multiple comparison test was used to analyze differences in means between control and different stages of PD. Differences were considered significant if p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Summary of the statistical analysis is shown in \u003cstrong\u003eTable\u0026nbsp;3.\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eOther information\u003c/p\u003e\n \u003cp\u003eThe images of the full immunoblots are in Fig. Suppl 4 and Fig. Suppl 5.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAcbC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eaccumbens nucleus core\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eB9\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eserotonin cells\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHPC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehippocampus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHyp\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehypothamus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emedial geniculate nucleus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eOB\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eolfactory bulb\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePAG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eperiaqueductal gray\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePn\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epontine nucleus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSNr\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003esubstantia nigra reticulata\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eVDB\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003enucleus of the vertical limb of the diagonal band\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGEMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by MCIU/AEI/FEDER, UE grant (PID2019-105136RB-100, PID2022-141700OB-I00, MCIN/AEI/10.13039/501100011033 to A.B.), and AGAUR 2021-SGR-01358, Catalan Government. CB/07/09/0034 Center for Networked Biomedical Research on Mental Health (CIBERSAM). We also thank the Spanish Stress Research Network, MCIN/AEI /10.13039/501100011033. U.S.S. is a recipient of a fellowship from the Non- Doctor Researcher Formation Pre-doctoral Program of Basque Government, Spain. U.A. is a recipient of a fellowship from the State Research Agency for the training of predoctoral research personnel (PREP2022-000676) associated to a generation of knowledge project (PID2022-141700OB-I00). The authors would like to thank the staff members of the Biobank of the Clinic Hospital Barcelona - IDIBAPS for their collaboration in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization and supervision of the research: A.B. Methodology: L.M.R. and U.S.S. performed stereotaxic surgeries in mice; L.M.R. processed human brain tissue samples; L.M.R., J.J.E, U.S.S., C.Y.C., U.A., and M.T.L. performed immunohistochemistry and WB experiments; V.P. performed \u003cem\u003ein situ\u003c/em\u003e hybridization; C.C. provided advice on the acquisition and analysis of images on the Dragonfly confocal microscopy system; E.M.M. and X.L.G. conducted the rs-fMRI experiments, image acquisition, and data analysis. L.M.R. analyzed and supervised the data. Writing: A.B. with all nine authors’ inputs. Funding acquisition: A.B. All authors edited and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCOMPETING INTERESTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare no competing interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eADDITIONAL INFORMATION\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSupplementary information\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDATA AVAILABILITY\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll relevant data that support the findings of this study are presented in the main text and supplementary information. Other source data are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbsalyamova, M. \u003cem\u003eet al.\u003c/em\u003e Molecular basis of the development of Parkinson\u0026rsquo;s disease. \u003cem\u003eNeuroscience\u003c/em\u003e 565, 292\u0026ndash;300 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJankovic, J. Parkinson\u0026rsquo;s disease: clinical features and diagnosis. \u003cem\u003eJ. Neurol. Neurosurg. Psychiatry\u003c/em\u003e 79, 368\u0026ndash;376 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePoplawska-Domaszewicz, K., Qamar, M. A., Falup Pecurariu, C. \u0026amp; Chaudhuri, K. R. Recognition and characterising non-motor profile in early onset Parkinson\u0026rsquo;s disease (EOPD). \u003cem\u003eParkinsonism Relat. Disord.\u003c/em\u003e 129, 107123 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZis, P., Erro, R., Walton, C. C., Sauerbier, A. \u0026amp; Chaudhuri, K. R. The range and nature of non-motor symptoms in drug-naive Parkinson\u0026rsquo;s disease patients: a state-of-the-art systematic review. \u003cem\u003eNPJ Park. Dis.\u003c/em\u003e 1, 15013 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan, Y. \u003cem\u003eet al.\u003c/em\u003e Serum neurotransmitter analysis of motor and non-motor symptoms in Parkinson\u0026rsquo;s patients. \u003cem\u003eFront. Aging Neurosci.\u003c/em\u003e 16, 1423120 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHayley, S., Vahid-Ansari, F., Sun, H. \u0026amp; Albert, P. R. Mood disturbances in Parkinson\u0026rsquo;s disease: From prodromal origins to application of animal models. \u003cem\u003eNeurobiol. Dis.\u003c/em\u003e 181, 106115 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStocchi, F. \u003cem\u003eet al.\u003c/em\u003e Exploring depression in Parkinson\u0026rsquo;s disease: an Italian Delphi Consensus on phenomenology, diagnosis, and management. \u003cem\u003eNeurol. Sci. Off. J. Ital. Neurol. Soc. Ital. Soc. Clin. Neurophysiol.\u003c/em\u003e 44, 3123\u0026ndash;3131 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBareeqa, S. B. \u003cem\u003eet al.\u003c/em\u003e Prodromal depression and subsequent risk of developing Parkinson\u0026rsquo;s disease: a systematic review with meta-analysis. \u003cem\u003eNeurodegener. Dis. Manag.\u003c/em\u003e 12, 155\u0026ndash;164 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcDonald, W. M., Richard, I. H. \u0026amp; DeLong, M. R. Prevalence, etiology, and treatment of depression in Parkinson\u0026rsquo;s disease. \u003cem\u003eBiol. Psychiatry\u003c/em\u003e 54, 363\u0026ndash;375 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePostuma, R. B. \u0026amp; Berg, D. Prodromal Parkinson\u0026rsquo;s Disease: The Decade Past, the Decade to Come. \u003cem\u003eMov. Disord.\u003c/em\u003e 34, 665\u0026ndash;675 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorgonovo, J. \u003cem\u003eet al.\u003c/em\u003e Changes in neural circuitry associated with depression at pre-clinical, pre-motor and early motor phases of Parkinson\u0026rsquo;s disease. \u003cem\u003eParkinsonism Relat. Disord.\u003c/em\u003e 35, 17\u0026ndash;24 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBraak, H. \u003cem\u003eet al.\u003c/em\u003e Staging of brain pathology related to sporadic Parkinson\u0026rsquo;s disease. \u003cem\u003eNeurobiol. Aging\u003c/em\u003e 24, 197\u0026ndash;211 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJellinger, K. A. The pathobiological basis of depression in Parkinson disease: challenges and outlooks. \u003cem\u003eJ. Neural Transm.\u003c/em\u003e 129, 1397\u0026ndash;1418 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBallanger, B. \u003cem\u003eet al.\u003c/em\u003e Role of serotonergic 1A receptor dysfunction in depression associated with Parkinson\u0026rsquo;s disease. \u003cem\u003eMov. Disord. Off. J. Mov. Disord. Soc.\u003c/em\u003e 27, 84\u0026ndash;89 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaillet, A. \u003cem\u003eet al.\u003c/em\u003e The prominent role of serotonergic degeneration in apathy, anxiety and depression in de novo Parkinson\u0026rsquo;s disease. \u003cem\u003eBrain J. Neurol.\u003c/em\u003e 139, 2486\u0026ndash;2502 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiquel-Rio, L., Sarri\u0026eacute;s-Serrano, U., Pavia-Collado, R., Meana, J. J. \u0026amp; Bortolozzi, A. The Role of α-Synuclein in the Regulation of Serotonin System: Physiological and Pathological Features. \u003cem\u003eBiomedicines\u003c/em\u003e 11, 541 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePolitis, M. \u003cem\u003eet al.\u003c/em\u003e Depressive symptoms in PD correlate with higher 5-HTT binding in raphe and limbic structures. \u003cem\u003eNeurology\u003c/em\u003e 75, 1920\u0026ndash;1927 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaillet, A. \u003cem\u003eet al.\u003c/em\u003e Serotonergic and Dopaminergic Lesions Underlying Parkinsonian Neuropsychiatric Signs. \u003cem\u003eMov. Disord. Off. J. Mov. Disord. Soc.\u003c/em\u003e 36, 2888\u0026ndash;2900 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRemy, P., Doder, M., Lees, A., Turjanski, N. \u0026amp; Brooks, D. Depression in Parkinson\u0026rsquo;s disease: loss of dopamine and noradrenaline innervation in the limbic system. \u003cem\u003eBrain J. Neurol.\u003c/em\u003e 128, 1314\u0026ndash;1322 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlexander, L., Wood, C. M. \u0026amp; Roberts, A. C. The ventromedial prefrontal cortex and emotion regulation: lost in translation? \u003cem\u003eJ. Physiol.\u003c/em\u003e 601, 37\u0026ndash;50 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMayberg, H. S. Targeted electrode-based modulation of neural circuits for depression. \u003cem\u003eJ. Clin. Invest.\u003c/em\u003e 119, 717\u0026ndash;725 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng, W., Chen, Z., Yin, L., Jia, Z. \u0026amp; Gong, Q. Essential brain structural alterations in major depressive disorder: A voxel-wise meta-analysis on first episode, medication-naive patients. \u003cem\u003eJ. Affect. Disord.\u003c/em\u003e 199, 114\u0026ndash;123 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWise, T. \u003cem\u003eet al.\u003c/em\u003e Common and distinct patterns of grey-matter volume alteration in major depression and bipolar disorder: evidence from voxel-based meta-analysis. \u003cem\u003eMol. Psychiatry\u003c/em\u003e 22, 1455\u0026ndash;1463 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmarg\u0026oacute;s-Bosch, M. \u003cem\u003eet al.\u003c/em\u003e Co-expression and In Vivo Interaction of Serotonin1A and Serotonin2A Receptors in Pyramidal Neurons of Prefrontal Cortex. \u003cem\u003eCereb. Cortex\u003c/em\u003e 14, 281\u0026ndash;299 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantana, N., Bortolozzi, A., Serrats, J., Mengod, G. \u0026amp; Artigas, F. Expression of serotonin1A and serotonin2A receptors in pyramidal and GABAergic neurons of the rat prefrontal cortex. \u003cem\u003eCereb. Cortex N. Y. N 1991\u003c/em\u003e 14, 1100\u0026ndash;1109 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSancho-Alonso, M. \u003cem\u003eet al.\u003c/em\u003e New insights into the effects of serotonin on Parkinson\u0026rsquo;s disease and depression through its role in the gastrointestinal tract. \u003cem\u003eSpan. J. Psychiatry Ment. Health\u003c/em\u003e S2950-2853(24)00039\u0026ndash;5 (2024) doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.sjpmh.2024.07.002\u003c/span\u003e\u003cspan address=\"10.1016/j.sjpmh.2024.07.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Schipper, L. J., van der Grond, J., Marinus, J., Henselmans, J. M. L. \u0026amp; van Hilten, J. J. Loss of integrity and atrophy in cingulate structural covariance networks in Parkinson\u0026rsquo;s disease. \u003cem\u003eNeuroImage Clin.\u003c/em\u003e 15, 587\u0026ndash;593 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin, H. \u003cem\u003eet al.\u003c/em\u003e Functional connectivity markers of depression in advanced Parkinson\u0026rsquo;s disease. \u003cem\u003eNeuroImage Clin.\u003c/em\u003e 25, 102130 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVogt, B. A. Cingulate cortex in Parkinson\u0026rsquo;s disease. in \u003cem\u003eHandbook of Clinical Neurology\u003c/em\u003e vol. 166 253\u0026ndash;266 (Elsevier, 2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMayberg, H. S. \u003cem\u003eet al.\u003c/em\u003e Selective hypometabolism in the inferior frontal lobe in depressed patients with Parkinson\u0026rsquo;s disease. \u003cem\u003eAnn. Neurol.\u003c/em\u003e 28, 57\u0026ndash;64 (1990).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRing, H. A. \u003cem\u003eet al.\u003c/em\u003e Depression in Parkinson\u0026rsquo;s disease. A positron emission study. \u003cem\u003eBr. J. Psychiatry J. Ment. Sci.\u003c/em\u003e 165, 333\u0026ndash;339 (1994).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoto, M. \u003cem\u003eet al.\u003c/em\u003e Depressive symptoms in Parkinson\u0026rsquo;s disease are related to decreased left hippocampal volume: correlation with the 15-item shortened version of the Geriatric Depression Scale. \u003cem\u003eActa Radiol. Stockh. Swed. 1987\u003c/em\u003e 59, 341\u0026ndash;345 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, P. \u003cem\u003eet al.\u003c/em\u003e Cortical abnormalities in Parkinson\u0026rsquo;s disease patients and relationship to depression: A surface-based morphometry study. \u003cem\u003ePsychiatry Res. Neuroimaging\u003c/em\u003e 250, 24\u0026ndash;28 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo, C. \u003cem\u003eet al.\u003c/em\u003e Cortical thinning in drug-naive Parkinson\u0026rsquo;s disease patients with depression. \u003cem\u003eJ. Neurol.\u003c/em\u003e 263, 2114\u0026ndash;2119 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeldmann, A. \u003cem\u003eet al.\u003c/em\u003e Morphometric changes of gray matter in Parkinson\u0026rsquo;s disease with depression: a voxel-based morphometry study. \u003cem\u003eMov. Disord. Off. J. Mov. Disord. Soc.\u003c/em\u003e 23, 42\u0026ndash;46 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Mierlo, T. J., Chung, C., Foncke, E. M., Berendse, H. W. \u0026amp; van den Heuvel, O. A. Depressive symptoms in Parkinson\u0026rsquo;s disease are related to decreased hippocampus and amygdala volume. \u003cem\u003eMov. Disord. Off. J. Mov. Disord. Soc.\u003c/em\u003e 30, 245\u0026ndash;252 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu, X. \u003cem\u003eet al.\u003c/em\u003e Abnormal functional connectivity of the amygdala is associated with depression in Parkinson\u0026rsquo;s disease. \u003cem\u003eMov. Disord. Off. J. Mov. Disord. Soc.\u003c/em\u003e 30, 238\u0026ndash;244 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNakano, T. \u003cem\u003eet al.\u003c/em\u003e Neural networks associated with quality of life in patients with Parkinson\u0026rsquo;s disease. \u003cem\u003eParkinsonism Relat. Disord.\u003c/em\u003e 89, 6\u0026ndash;12 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiu, Y.-H. \u003cem\u003eet al.\u003c/em\u003e Alterations in intrinsic functional networks in Parkinson\u0026rsquo;s disease patients with depression: A resting-state functional magnetic resonance imaging study. \u003cem\u003eCNS Neurosci. Ther.\u003c/em\u003e 27, 289\u0026ndash;298 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLou, Y. \u003cem\u003eet al.\u003c/em\u003e Altered brain network centrality in depressed Parkinson\u0026rsquo;s disease patients. \u003cem\u003eMov. Disord. Off. J. Mov. Disord. Soc.\u003c/em\u003e 30, 1777\u0026ndash;1784 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheng, K. \u003cem\u003eet al.\u003c/em\u003e Altered spontaneous brain activity in patients with Parkinson\u0026rsquo;s disease accompanied by depressive symptoms, as revealed by regional homogeneity and functional connectivity in the prefrontal-limbic system. \u003cem\u003ePloS One\u003c/em\u003e 9, e84705 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGigu\u0026egrave;re, N., Burke Nanni, S. \u0026amp; Trudeau, L.-E. On Cell Loss and Selective Vulnerability of Neuronal Populations in Parkinson\u0026rsquo;s Disease. \u003cem\u003eFront. Neurol.\u003c/em\u003e 9, (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBellucci, A., Longhena, F. \u0026amp; Spillantini, M. G. The Role of Rab Proteins in Parkinson\u0026rsquo;s Disease Synaptopathy. \u003cem\u003eBiomedicines\u003c/em\u003e 10, 1941 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVolpicelli-Daley, L. A. Effects of α-synuclein on axonal transport. \u003cem\u003eNeurobiol. Dis.\u003c/em\u003e 105, 321\u0026ndash;327 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiquel-Rio, L. \u003cem\u003eet al.\u003c/em\u003e Human α-synuclein overexpression in mouse serotonin neurons triggers a depressive-like phenotype. Rescue by oligonucleotide therapy. \u003cem\u003eTransl. Psychiatry\u003c/em\u003e 12, 79 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshiguro, M. \u003cem\u003eet al.\u003c/em\u003e Increased Serum Levels of α-Synuclein in Patients With Major Depressive Disorder. \u003cem\u003eAm. J. Geriatr. Psychiatry\u003c/em\u003e 27, 280\u0026ndash;286 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarri\u0026eacute;s-Serrano, U. \u003cem\u003eet al.\u003c/em\u003e Impaired unfolded protein response, BDNF and synuclein markers in postmortem dorsolateral prefrontal cortex and caudate nucleus of patients with depression and Parkinson\u0026rsquo;s disease. \u003cem\u003eProg. Neuropsychopharmacol. Biol. Psychiatry\u003c/em\u003e 111299 (2025) doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pnpbp.2025.111299\u003c/span\u003e\u003cspan address=\"10.1016/j.pnpbp.2025.111299\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSerrano, U. S., Miquel-Rio, L., Paz, V., Meana, J. J. \u0026amp; Bortolozzi, A. Sex-based modulation of endoplasmic reticulum stress and antidepressant response in a mouse model of α-synucleinopathy. \u003cem\u003eNeurosci. Appl.\u003c/em\u003e 2, 101028 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, K. W. \u003cem\u003eet al.\u003c/em\u003e Molecular and anatomical organization of the dorsal raphe nucleus. \u003cem\u003eeLife\u003c/em\u003e 8, e46464 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlarc\u0026oacute;n-Ar\u0026iacute;s, D. \u003cem\u003eet al.\u003c/em\u003e Anti-α-synuclein ASO delivered to monoamine neurons prevents α-synuclein accumulation in a Parkinson\u0026rsquo;s disease-like mouse model and in monkeys. \u003cem\u003eEBioMedicine\u003c/em\u003e 59, 102944 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurr\u0026eacute;, J. The Synaptic Function of α-Synuclein. \u003cem\u003eJ. Park. Dis.\u003c/em\u003e 5, 699\u0026ndash;713 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLonghena, F., Faustini, G., Spillantini, M. G. \u0026amp; Bellucci, A. Living in Promiscuity: The Multiple Partners of Alpha-Synuclein at the Synapse in Physiology and Pathology. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e 20, 141 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGudi, V. \u003cem\u003eet al.\u003c/em\u003e Synaptophysin Is a Reliable Marker for Axonal Damage. \u003cem\u003eJ. Neuropathol. Exp. Neurol.\u003c/em\u003e 76, 109\u0026ndash;125 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeGiosio, R. A. \u003cem\u003eet al.\u003c/em\u003e More than a marker: potential pathogenic functions of MAP2. \u003cem\u003eFront. Mol. Neurosci.\u003c/em\u003e 15, 974890 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDurairajan, S. S. K. \u003cem\u003eet al.\u003c/em\u003e Unraveling the interplay of kinesin-1, tau, and microtubules in neurodegeneration associated with Alzheimer\u0026rsquo;s disease. \u003cem\u003eFront. Cell. Neurosci.\u003c/em\u003e 18, (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo, T. \u003cem\u003eet al.\u003c/em\u003e Clinically relevant connectivity features define three subtypes of Parkinson\u0026rsquo;s disease patients. \u003cem\u003eHum. Brain Mapp.\u003c/em\u003e 41, 4077\u0026ndash;4092 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin, H. \u003cem\u003eet al.\u003c/em\u003e Functional connectivity markers of depression in advanced Parkinson\u0026rsquo;s disease. \u003cem\u003eNeuroImage Clin.\u003c/em\u003e 25, 102130 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo, C. \u003cem\u003eet al.\u003c/em\u003e Resting-state fMRI study on drug-naive patients with Parkinson\u0026rsquo;s disease and with depression. \u003cem\u003eJ. Neurol. Neurosurg. Psychiatry\u003c/em\u003e 85, 675\u0026ndash;683 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorgan, H. E., Ledbetter, C. R., Ferrier, C., Zweig, R. M. \u0026amp; Disbrow, E. A. Altered Cortico-Limbic Network Connectivity in Parkinsonian Depression: The Effect of Antidepressants. \u003cem\u003eJ. Park. Dis.\u003c/em\u003e 8, 429\u0026ndash;440 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrange, S. \u003cem\u003eet al.\u003c/em\u003e Limbic Serotonergic Plasticity Contributes to the Compensation of Apathy in Early Parkinson\u0026rsquo;s Disease. \u003cem\u003eMov. Disord. Off. J. Mov. Disord. Soc.\u003c/em\u003e 37, 1211\u0026ndash;1221 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, J. \u003cem\u003eet al.\u003c/em\u003e Common and unique dysconnectivity profiles of dorsal and median raphe in Parkinson\u0026rsquo;s disease. \u003cem\u003eHum. Brain Mapp.\u003c/em\u003e 44, 1070\u0026ndash;1078 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHendriks, M., Vinke, R. S. \u0026amp; Georgiev, D. Gender discrepancies and differences in motor and non-motor symptoms, cognition, and psychological outcomes in the treatment of Parkinson\u0026rsquo;s disease with subthalamic deep brain stimulation. \u003cem\u003eFront. Neurol.\u003c/em\u003e 14, 1257781 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartinez-Martin, P. \u003cem\u003eet al.\u003c/em\u003e Gender-related differences in the burden of non-motor symptoms in Parkinson\u0026rsquo;s disease. \u003cem\u003eJ. Neurol.\u003c/em\u003e 259, 1639\u0026ndash;1647 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCerri, S., Mus, L. \u0026amp; Blandini, F. Parkinson\u0026rsquo;s Disease in Women and Men: What\u0026rsquo;s the Difference? \u003cem\u003eJ. Park. Dis.\u003c/em\u003e 9, 501\u0026ndash;515 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVeyrac, A., Besnard, A., Caboche, J., Davis, S. \u0026amp; Laroche, S. The transcription factor Zif268/Egr1, brain plasticity, and memory. \u003cem\u003eProg. Mol. Biol. Transl. Sci.\u003c/em\u003e 122, 89\u0026ndash;129 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie, B. \u003cem\u003eet al.\u003c/em\u003e Egr-1 transactivates Bim gene expression to promote neuronal apoptosis. \u003cem\u003eJ. Neurosci. Off. J. Soc. Neurosci.\u003c/em\u003e 31, 5032\u0026ndash;5044 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu, Q. \u003cem\u003eet al.\u003c/em\u003e Early activation of Egr-1 promotes neuroinflammation and dopaminergic neurodegeneration in an experimental model of Parkinson\u0026rsquo;s disease. \u003cem\u003eExp. Neurol.\u003c/em\u003e 302, 145\u0026ndash;154 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen, J. \u003cem\u003eet al.\u003c/em\u003e Single-cell transcriptomes and whole-brain projections of serotonin neurons in the mouse dorsal and median raphe nuclei. \u003cem\u003eeLife\u003c/em\u003e 8, e49424 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKohl, Z. \u003cem\u003eet al.\u003c/em\u003e Severely impaired hippocampal neurogenesis associates with an early serotonergic deficit in a BAC α-synuclein transgenic rat model of Parkinson\u0026rsquo;s disease. \u003cem\u003eNeurobiol. Dis.\u003c/em\u003e 85, 206\u0026ndash;217 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWan, O. W. \u003cem\u003eet al.\u003c/em\u003e α-Synuclein induced toxicity in brain stem serotonin neurons mediated by an AAV vector driven by the tryptophan hydroxylase promoter. \u003cem\u003eSci. Rep.\u003c/em\u003e 6, 26285 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOaks, A. W. \u0026amp; Sidhu, A. Synuclein modulation of monoamine transporters. \u003cem\u003eFEBS Lett.\u003c/em\u003e 585, 1001\u0026ndash;1006 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlarc\u0026oacute;n-Ar\u0026iacute;s, D. \u003cem\u003eet al.\u003c/em\u003e Selective α-Synuclein Knockdown in Monoamine Neurons by Intranasal Oligonucleotide Delivery: Potential Therapy for Parkinson\u0026rsquo;s Disease. \u003cem\u003eMol. Ther. J. Am. Soc. Gene Ther.\u003c/em\u003e 26, 550\u0026ndash;567 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBellucci, A. \u003cem\u003eet al.\u003c/em\u003e Review: Parkinson\u0026rsquo;s disease: from synaptic loss to connectome dysfunction. \u003cem\u003eNeuropathol. Appl. Neurobiol.\u003c/em\u003e 42, 77\u0026ndash;94 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrigerio, I. \u003cem\u003eet al.\u003c/em\u003e Regional differences in synaptic degeneration are linked to alpha-synuclein burden and axonal damage in Parkinson\u0026rsquo;s disease and dementia with Lewy bodies. \u003cem\u003eActa Neuropathol. Commun.\u003c/em\u003e 12, 4 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim, K., Wi, S., Seo, J. H., Pyo, S. \u0026amp; Cho, S.-R. Reduced Interaction of Aggregated α-Synuclein and VAMP2 by Environmental Enrichment Alleviates Hyperactivity and Anxiety in a Model of Parkinson\u0026rsquo;s Disease. \u003cem\u003eGenes\u003c/em\u003e 12, 392 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRichter, F., Stanojlovic, M., K\u0026auml;ufer, C., Gericke, B. \u0026amp; Feja, M. A Mouse Model to Test Novel Therapeutics for Parkinson\u0026rsquo;s Disease: an Update on the Thy1-aSyn (\u0026ldquo;line 61\u0026rdquo;) Mice. \u003cem\u003eNeurotherapeutics\u003c/em\u003e 20, 97\u0026ndash;116 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShin, M.-S., Jeong, H.-Y., An, D.-I., Lee, H.-Y. \u0026amp; Sung, Y.-H. Treadmill exercise facilitates synaptic plasticity on dopaminergic neurons and fibers in the mouse model with Parkinson\u0026rsquo;s disease. \u003cem\u003eNeurosci. Lett.\u003c/em\u003e 621, 28\u0026ndash;33 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiong, M. \u003cem\u003eet al. In vivo\u003c/em\u003e imaging of synaptic density with [11C]UCB-J PET in two mouse models of neurodegenerative disease. \u003cem\u003eNeuroImage\u003c/em\u003e 239, 118302 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang, C. H., Lim, K. L. \u0026amp; Foo, J. N. Synaptic Vesicle Glycoprotein 2C: a role in Parkinson\u0026rsquo;s disease. \u003cem\u003eFront. Cell. Neurosci.\u003c/em\u003e 18, (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDunn, A. R. \u003cem\u003eet al.\u003c/em\u003e Synaptic vesicle glycoprotein 2C (SV2C) modulates dopamine release and is disrupted in Parkinson disease. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e 114, E2253\u0026ndash;E2262 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrigerio, I. \u003cem\u003eet al.\u003c/em\u003e Neurofilament light chain is increased in the parahippocampal cortex and associates with pathological hallmarks in Parkinson\u0026rsquo;s disease dementia. \u003cem\u003eTransl. Neurodegener.\u003c/em\u003e 12, 3 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKish, S. J. \u003cem\u003eet al.\u003c/em\u003e Preferential loss of serotonin markers in caudate versus putamen in Parkinson\u0026rsquo;s disease. \u003cem\u003eBrain\u003c/em\u003e awm239 (2007) doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/brain/awm239\u003c/span\u003e\u003cspan address=\"10.1093/brain/awm239\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaisman, R., Cash, R. \u0026amp; Agid, Y. Parkinson\u0026rsquo;s disease: decreased density of 3H-imipramine and 3H-paroxetine binding sites in putamen. \u003cem\u003eNeurology\u003c/em\u003e 36, 556\u0026ndash;560 (1986).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWaterman-Storer, C. M. \u003cem\u003eet al.\u003c/em\u003e The interaction between cytoplasmic dynein and dynactin is required for fast axonal transport. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e 94, 12180\u0026ndash;12185 (1997).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChung, C. Y., Koprich, J. B., Siddiqi, H. \u0026amp; Isacson, O. Dynamic Changes in Presynaptic and Axonal Transport Proteins Combined with Striatal Neuroinflammation Precede Dopaminergic Neuronal Loss in a Rat Model of AAV α-Synucleinopathy. \u003cem\u003eJ. Neurosci.\u003c/em\u003e 29, 3365\u0026ndash;3373 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Y. \u003cem\u003eet al.\u003c/em\u003e The increase of α-synuclein and alterations of dynein in A53T transgenic and aging mouse. \u003cem\u003eJ. Clin. Neurosci. Off. J. Neurosurg. Soc. Australas.\u003c/em\u003e 96, 154\u0026ndash;162 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu, Y. \u003cem\u003eet al.\u003c/em\u003e Alterations in axonal transport motor proteins in sporadic and experimental Parkinson\u0026rsquo;s disease. \u003cem\u003eBrain\u003c/em\u003e 135, 2058\u0026ndash;2073 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEsteves, A. R. \u0026amp; Cardoso, S. M. Differential protein expression in diverse brain areas of Parkinson\u0026rsquo;s and Alzheimer\u0026rsquo;s disease patients. \u003cem\u003eSci. Rep.\u003c/em\u003e 10, 13149 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFourie, C. \u003cem\u003eet al.\u003c/em\u003e Differential Changes in Postsynaptic Density Proteins in Postmortem Huntington\u0026rsquo;s Disease and Parkinson\u0026rsquo;s Disease Human Brains. \u003cem\u003eJ. Neurodegener. Dis.\u003c/em\u003e 2014, 938530 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhitfield, D. R. \u003cem\u003eet al.\u003c/em\u003e Assessment of ZnT3 and PSD95 protein levels in Lewy body dementias and Alzheimer\u0026rsquo;s disease: association with cognitive impairment. \u003cem\u003eNeurobiol. Aging\u003c/em\u003e 35, 2836\u0026ndash;2844 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFullana, M. N. \u003cem\u003eet al.\u003c/em\u003e Regionally selective knockdown of astroglial glutamate transporters in infralimbic cortex induces a depressive phenotype in mice. \u003cem\u003eGlia\u003c/em\u003e 67, 1122\u0026ndash;1137 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiquel-Rio, L. \u003cem\u003eet al.\u003c/em\u003e ER-stress in mouse serotonin neurons triggers a depressive phenotype alleviated by ketamine targeting eIF2α signaling. \u003cem\u003eiScience\u003c/em\u003e (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlarc\u0026oacute;n-Ar\u0026iacute;s, D. \u003cem\u003eet al.\u003c/em\u003e Anti-α-synuclein ASO delivered to monoamine neurons prevents α-synuclein accumulation in a Parkinson\u0026rsquo;s disease-like mouse model and in monkeys. \u003cem\u003eEBioMedicine\u003c/em\u003e 59, 102944 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFernandez-Garcia, C., Alonso-Frech, F., Monje, M. H. G. \u0026amp; Matias-Guiu, J. Role of deep brain stimulation therapy in the magnetic resonance-guided high-frequency focused ultrasound era: current situation and future prospects. \u003cem\u003eExpert Rev. Neurother.\u003c/em\u003e 20, 7\u0026ndash;21 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAvants, B. \u003cem\u003eet al.\u003c/em\u003e Multivariate analysis of structural and diffusion imaging in traumatic brain injury. \u003cem\u003eAcad. Radiol.\u003c/em\u003e 15, 1360\u0026ndash;1375 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa, Y. \u003cem\u003eet al.\u003c/em\u003e In Vivo 3D Digital Atlas Database of the Adult C57BL/6J Mouse Brain by Magnetic Resonance Microscopy. \u003cem\u003eFront. Neuroanat.\u003c/em\u003e 2, 1 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWinkler, A. M., Ridgway, G. R., Webster, M. A., Smith, S. M. \u0026amp; Nichols, T. E. Permutation inference for the general linear model. \u003cem\u003eNeuroImage\u003c/em\u003e 92, 381\u0026ndash;397 (2014).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1 to 3 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"npj-parkinsons-disease","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjparkd","sideBox":"Learn more about [npj Parkinson's Disease](http://www.nature.com/npjparkd/)","snPcode":"41531","submissionUrl":"https://submission.springernature.com/new-submission/41531/3","title":"npj Parkinson's Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6179126/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6179126/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAnxiety and depression are common in Parkinson's disease (PD), affecting quality of life. Aggregates of α-synuclein (α-Syn) are found in serotonergic (5-HT) raphe nuclei early in the disease, but their relationship to brain changes is unclear. We investigated synaptic plasticity, neuronal activity, and functional magnetic resonance imaging (fMRI)-based brain connectivity in a PD-like mouse model with depressive phenotype. AAV-induced human α-Syn accumulation in raphe 5-HT neurons causes progressive synaptic pathology in interconnected brain regions. This is marked by lower MAP-2, PSD95 and higher SV2A, VAMP2, which are key to synaptic structure and function, as confirmed in human brain tissue samples. Abnormalities in Egr-1-dependent neuronal activity and region-specific differences in resting-state functional brain activity were also detected eight weeks post-AAV infusion, before neurodegeneration. This provides evidence for synaptic and fMRI markers associated with α-Syn pathology in emotional brain circuits, and has translational importance for identifying PD patients at risk for depression.\u003c/p\u003e","manuscriptTitle":"Early synaptic changes and reduced brain connectivity in PD-like mice with depressive phenotype","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-30 05:03:49","doi":"10.21203/rs.3.rs-6179126/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accepted","date":"2025-07-08T08:17:24+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-07T10:32:20+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-02T17:11:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"179027047866712933299287191706768688221","date":"2025-06-30T11:13:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"112452047483258974518565335140829328752","date":"2025-06-26T15:27:56+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-06-26T07:56:21+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-26T06:55:07+00:00","index":"","fulltext":""},{"type":"submitted","content":"npj Parkinson's Disease","date":"2025-06-17T14:43:24+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"npj-parkinsons-disease","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"npjparkd","sideBox":"Learn more about [npj Parkinson's Disease](http://www.nature.com/npjparkd/)","snPcode":"41531","submissionUrl":"https://submission.springernature.com/new-submission/41531/3","title":"npj Parkinson's Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fff14b85-a8e3-411b-9b7a-0f297b16ab82","owner":[],"postedDate":"June 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":50649724,"name":"Biological sciences/Molecular biology"},{"id":50649725,"name":"Biological sciences/Neuroscience"},{"id":50649726,"name":"Biological sciences/Systems biology"},{"id":50649727,"name":"Health sciences/Diseases"},{"id":50649728,"name":"Health sciences/Neurology"}],"tags":[],"updatedAt":"2025-08-18T16:02:32+00:00","versionOfRecord":{"articleIdentity":"rs-6179126","link":"https://doi.org/10.1038/s41531-025-01073-1","journal":{"identity":"npj-parkinsons-disease","isVorOnly":false,"title":"npj Parkinson's Disease"},"publishedOn":"2025-08-13 15:57:46","publishedOnDateReadable":"August 13th, 2025"},"versionCreatedAt":"2025-06-30 05:03:49","video":"","vorDoi":"10.1038/s41531-025-01073-1","vorDoiUrl":"https://doi.org/10.1038/s41531-025-01073-1","workflowStages":[]},"version":"v1","identity":"rs-6179126","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6179126","identity":"rs-6179126","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.