Knock-in Mouse Model of Hereditary Myopathy with Early Respiratory Failure Carrying the Titin Variant Corresponding to Human p.N31786K | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Knock-in Mouse Model of Hereditary Myopathy with Early Respiratory Failure Carrying the Titin Variant Corresponding to Human p.N31786K Shaul Raviv, Nofar Mor, Matteo Marcello, Swethaa Natraj Gayathri, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8910535/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract Hereditary Myopathy with Early Respiratory Failure (HMERF) is a progressive titinopathy caused by dominant missense mutations in the A-band region of TTN , a domain essential for sarcomere stability. Patients suffering with HMERF manifest muscle weakness, early respiratory involvement, and reduced life expectancy, yet no effective therapies currently exist. A major barrier has been the lack of an animal model that replicated HMERF pathology. In this study, we established the first CRISPR-Cas9 engineered mouse model of HMERF, carrying a patient-derived missense mutation in Ttn . Homozygous mutant mice exhibited a severe and uniform phenotype, including kyphosis, thoracic deformities, abnormal gait, diaphragm weakness, and premature death. Histological analysis revealed disrupted sarcomeres, abnormal myotilin accumulation, and necklace-like cytoplasmic bodies in diaphragm muscle, resembling human pathology. Multi-omics approach revealed consistent dysregulation of genes and proteins linked to muscle structure, cytoskeletal integrity, and cellular homeostasis, representing disease pathomechanisms. A major limitation of this study was the restricted availability of muscle tissue, which prevented broader analysis across multiple muscle types. Nevertheless, overlapping transcriptomic and proteomic dysregulation, including differential splicing, highlight key molecular effects driving disease progression. In conclusion, this mouse model provides mechanistic insight into HMERF and establishes a platform for evaluating therapeutic strategies. It represents an essential step toward developing targeted interventions for this rare and severe neuromuscular disorder. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction TTN gene, located on chromosome 2, encodes titin, also known as connectin 1 . Titin is the largest known human protein, expressed in striated muscle tissues. This giant protein spans half of the sarcomere, extending from the Z-disk to the M-band. Titin plays an essential role in muscle structure and function, forming a trans-sarcomeric filament that not only provides structural support but also acts as a molecular spring 2 . This spring-like property is crucial for maintaining passive elasticity in muscle fibers, enabling them to return to their resting state after contraction or stretch. Beyond its biomechanical functions, titin interacts with various signaling molecules and contributes to sarcomere assembly, mechanotransduction, and cellular stress responses. Mutations in TTN result in a broad spectrum of inherited disorders 3 – 5 , collectively known as titinopathies, which can exhibit recessive or dominant inheritance patterns. These disorders manifest as myopathies—often with associated respiratory dysfunction—and/or cardiomyopathies, reflecting the diverse and critical roles of titin in muscle and cardiac function 6 , 7 . One of these disorders, Hereditary Myopathy with Early Respiratory Failure (HMERF), is a severe adult-onset titinopathy caused by heterozygous variants in exon 344, encoding for the A-band FN3 domain A150 (FN3-119). To date, at least 19 HMERF-causing variants, within A150 domain and affecting its folding, have been identified in this single domain 8 – 10 . Clinically, HMERF is manifested with muscle weakness, predominantly in the proximal muscles, and early involvement of the respiratory musculature, which can lead to significant respiratory impairment and eventual respiratory failure. The disease progresses insidiously, with patients presenting initially with mild weakness or dyspnea before developing more severe functional limitations. Patient muscles show characteristic cytoplasmic bodies not containing mutant titin itself, pointing to a defect in protein homeostasis 9 . Despite its dramatic impact on quality of life and life expectancy, no effective therapies currently exist for HMERF, highlighting an urgent need for deeper mechanistic insights and the development of targeted interventions. To elucidate the pathophysiological mechanisms underlying skeletal muscle titinopathies, numerous genetically engineered animal models have been developed. Vertebrate models, including mice and fishes (Zebrafish and Medaka), typically involving deletions or missense mutations in key domains of the TTN gene 11 . These models have contributed to characterizing the structural and mechanical properties of specific titin regions, and to mimicking patient mutations. However, until now, no mouse model has been developed to recapitulate the pathogenesis of HMERF titinopathy. In this study, we present a newly established genetically engineered mouse model, corresponding to a missense variant identified in a 50-years old HMERF patient. Exome sequencing, which included sampling of the patient and both of his parents (trio analysis), showed a de-novo missense variant in exon 344 of the TTN gene (NM_001267550 c.95358C > A p.N31786K). This mutation was previously reported 12 and associated with HMERF. This study represents the first mouse model for HMERF, denoting a pivotal advancement in the field of neuromuscular research. It paves way for the identification of potential therapeutic targets and the development of innovative treatment strategies for HMERF. Results 1. Clinical data A male patient of Jewish Ashkenazi ancestry had normal general and motor development during childhood. He noticed enlarged calf muscles when he was 16 years old and an inability to walk on his heels due to ankle dorsiflexion weakness at age 21. Neurological evaluation at that time showed bilateral calf muscle pseudo-hypertrophy and bilateral foot drop. CPK level was around 900, electrodiagnostic evaluation of the lower limbs showed normal motor and sensory nerve conduction studies, while electromyography (EMG) was suggestive of myopathy, without myotonia. A biopsy of the right quadriceps muscle showed internal nuclei in fibers, an abundance of fiber atrophy, as well as rimmed vacuoles. Accordingly, the muscle biopsy diagnosis was vacuolar myopathy. Genetic evaluation at that time included dystrophin gene deletion/duplication analysis which was negative. As both unrelated parents and three siblings showed no weakness and normal CPK, limb-girdle muscular dystrophy (LGMD) was diagnosed and considered an undetermined recessive disorder. In the following years, muscle weakness progressed to involve proximal and cervical muscles. At age 30, orthopnea developed, and non-invasive ventilation at night with a bilevel positive airway pressure (BIPAP) was required for sleep. At age 35, use of a BIPAP was required for any recline, and from age 43, continuous use of BIPAP was mandatory. Ambulation was progressively impaired, requiring a rollator walker at age 32 and he became wheelchair-bound at age 38. A re-evaluation at age 30 included a repeated muscle biopsy, which again revealed a vacuolar myopathy. Western blot analysis of the muscle tissue showed the absence of Calpain-3, and therefore, a calpainopathy (LGMD2A) was suggested. However, both sequencing and MLPA of the CAPN3 gene were normal, discarding this diagnosis. He was evaluated at the Sheba Medical Center at age 48. His examination showed normal cognition and normal cranial nerve function except for moderate neck flexors and mild extensor weakness. The limbs showed no atrophy, masked by obesity, and no clear calf hypertrophy. A flaccid tone was noted in all four limbs. Severe muscle weakness was evident, with complete to nearly complete paralysis (MRC score of 0-2) of proximal and distal upper and lower limb muscles. Deep tendon reflexes were absent in the upper and lower limbs; plantar responses were indifferent, and no pyramidal or extrapyramidal signs were evident. Sensory exam for pain, vibration and proprioception was normal in all extremities. Exome sequencing, which included sampling of the patient and both of his parents (trio analysis), showed a de-novo missense variant in exon 344 of the TTN gene (NM_001267550 c.95358C>A p.(N31786K)). It is rare, located in a highly conserved region and, therefore, classified as pathogenic by ACMG criteria (PM2, PP3, PS1, PS2). 2. Homozygote mutant mice die prematurely and show extensive neuromuscular phenotype We established a mouse model with mutation in Ttn (NM_011652.3 c.87783C>G) corresponding to the human mutation (NM_001267550 C.95358C>A p.N31786K), using CRISPR-Cas9 zygote injection (Supplementary figure 1A), on a C57Bl/6JOlaHsd background. As the human mutation manifests as autosomal dominant HMERF, we first assessed the heterozygote mice carrying the mutation (referred to as HT or Ttn +/- ). Over a three-year follow-up period, the general health and welfare of the mice were evaluated through cage-side observations. Heterozygous mice were found to be viable and fertile, displayed Mendelian inheritance patterns, and were indistinguishable from their WT littermates in terms of body weight (Fig. 1A). They also exhibited normal overall appearance, activity levels, and interactions with their environment, including nest-building behaviour and social interactions with cage mates, showing no differences relative to WT littermates. Furthermore, cage-side assessments did not identify any neuromuscular abnormalities in HT mice, in contrast to human carriers of the corresponding mutation. To further investigate, we assessed the phenotype in homozygous (referred to as HOM or Ttn-/-). Homozygote mice were not born at the Mendelian ratio (Chi-Square test, P.value <0.008) (Supplementary figure 1B). By 21 days of age, HOM mice were significantly smaller than their littermates (Fig. 1A-B, Student’s t-test, p < 0.01 for males and p 4) and displayed reduced fat tissue. The size discrepancy became more pronounced over time, as HOM mice failed to gain weight beyond 21 days of age. Unlike their HT littermates, HOM mice exhibited kyphosis, malformed thoracic cages (Fig. 1B), and abnormal gait. Additionally, HOM mice exhibited premature death, with a median survival of 41 days (Fig. 1C). Interestingly, immunohistochemical analysis revealed myotilin-positive aggregates in necklace formation within a subset of muscle fibers, mainly in diaphragm, in HOM mice at 1 month of age (Fig. 1D). 3. Multi-omics analysis of homozygote HMERF mouse model 3.1 Transcriptomics revealed differentially expressed and spliced skeletal muscle genes To characterize the intrinsic transcriptomic profiles of mutant mice and investigate potential pathomechanisms, bulk RNA sequencing (RNA-Seq) was performed on 32 days old homozygous mutant mice and their WT littermates. Principal component analysis (PCA) revealed clear clustering of the two sample groups (Fig. 2A – missing legend). The RNA-Seq analysis focused on the identification of differentially expressed genes (DEGs) and differentially spliced genes (DSGs) through a comparative analysis of HOM (-/-) and WT (+/+) samples. The analysis of differential gene expression yielded 3,245 genes that exhibited significant upregulation (log₂FC > 0) and 3,350 genes that exhibited significant downregulation (log₂FC < 0) (Figure 2B and Supplementary File 1). Pathway enrichment analysis of all DEGs identified enriched Gene Ontology (GO) terms related to biological process (2,673), cellular component (325), and molecular function (286). Redundant biological process terms were summarized using ReviGO, resulting in 632 non-redundant terms. The most significant enriched biological pathways included actin cytoskeleton organization, muscle structure development, external encapsulating structure organization, metabolism, and apoptotic processes. Furthermore, pathways also associated with respiratory system development and function were found to be significantly enriched. Alternative splicing analysis using Modeling Alternative Junction Inclusion Quantification (MAJIQ) identified 84 DSGs, each exhibiting at least one alternative splicing event (Supplementary File 2). Fifty of these DSGs were found to overlap with the DEGs. These genes, which were both differentially expressed and spliced, were primarily associated with striated muscle structure, cytoskeletal organization, and with key cellular processes involved in muscle homeostasis (Fig. 2C). We observed a significant downregulation and alternative splicing of Myl6 , an integral component of myosin complex that regulate muscle contraction by modulating the myosin motor 13 . Its downregulation is indicative of impaired muscle force generation and proper contraction. Similarly, we identified the significant downregulation of a long non-coding RNA Meg3 that was recently found to regulate muscle mass and metabolic homeostasis in mice models 14 . It also has conserved properties to regulate myogenesis and facilitate the regulation of muscle cell proliferation, differentiation, and regeneration 15,16 . Conversely, upregulation and alternative splicing of Stim1 , a central mediator of store-operated calcium influx, reflected altered calcium stores for muscle contraction, possibly causing muscle dysfunction and wasting 17,18 . Increased Pik3r1 expression further suggested a compensatory upregulation of growth factor pathways in a catabolic milieu 19 . Notably, we also detected a significant upregulation and alternative splicing of Ube4b (UFD2a ortholog), and Naca , both genes that have been investigated to have muscle-specific isoforms and play key roles in ubiquitin-proteasome system (UPS) 20 and myofibril assembly 21 respectively. Transcriptomic analysis also revealed a significant upregulation of the splicing factor Rbm20 , an RNA-binding protein predominantly expressed in skeletal and cardiac muscle. RBM20 is a key regulator of alternative splicing of TTN 22 . In the soleus tissues of mouse models, its increased expression has led to shorter titin isoforms, thereby resulting in the exclusion of PEVK exons and altering sarcomere elasticity properties 23 . In our HMERF mutant mouse model, an increased Rbm20 expression suggests altered splicing dynamics, potentially contributing to disrupted sarcomere structure and impaired muscle function observed in the disease pathology. 3.2 Proteomic profiling showed dysregulated patterns for muscle structure development and respiration To further characterize the molecular pathomechanisms of the HMERF mutant models on protein level, MS-analysis was performed. PCA plot showed distinct segregation of samples (Fig 3 A). Differential protein analysis between the HOM (-/-) and WT (+/+) revealed 90 significantly upregulated (logFC > 0) and 50 down (logFC < 0) proteins (Fig 3B and Supplementary File 3). There is an overlap of 44 differentially expressed proteins that are also dysregulated at transcriptome level (Supplementary File 4). Pathway enrichment analysis on the common features (Fig. 3C), revealed significant terms from CORUM-defined protein complexes, Human Phenotype Ontology (HPO) and Gene Ontology (GO) (Supplementary File 5). Both transcriptomic and proteomic datasets revealed elevated sarcomeric structural, developmental and cytoskeletal-associated components, including Pdlim3 (PDZ and LIM domain protein 3), Myl4 (Myosin light chain 4), Hspb1 (Heat shock protein beta-1), Des (Desmin), Csrp3 (Cysteine and glycine-rich protein 3), Xirp2 (Xin actin-binding repeat-containing protein 2), Nrap (Nebulin-related-anchoring protein), Pdlim5 (PDZ and LIM domain protein 5), Flnc (Filamin C), Myot (Myotilin), Fhl3 (Four and a half LIM domains 3), Ankrd2 (Ankyrin repeat domain-containing protein 2), Klhl40 (Kelch-like protein 40) and Klhl41 (Kelch-like protein 41). The proteasome complexes (PA700-20S-PA28, PA700) and the FHL3 homodimer complex scored among the top CORUM (protein complex) pathway enriched terms, reflecting a robust upregulation of protein degradation machinery and molecular scaffolding within muscle fibers. This is supported by the upregulation of multiple ubiquitin-proteasome system components including Psmb1, Psmb6 (beta-type catalytic core subunits), Psmc1 (ATPase subunit), Psmd11 and Psmd2 (non-ATPase regulatory subunits), and Usp14 (Ubiquitin-specific protease 14), indicating impaired proteostasis in the mutant muscles 24–27 . We also noticed the consistent upregulation of Klhl40 and Klhl41, the two-muscle specific Kelch-like proteins that serve as essential regulators of skeletal muscle integrity by facilitating substrate specificity for cullin-3, an E3 ubiquitin ligase 28 . Loss-of-function mutations in either gene is known to cause nemaline myopathies, characterized by sarcomeric disorganization and cytoplasmic inclusion bodies 28 . Their upregulation in our dataset likely reflects an adaptive response to proteostasis imbalance and improper structural instability, aligning with the enriched HPO terms related to myofibrillar myopathy, cytoplasmic inclusion bodies, and abnormal respiratory processes 28 . Finally, HPO enrichment presented the translational impact of these findings, with significant overlap in conditions such as myopathy, myofibrillar myopathy, muscle fiber cytoplasmic inclusion bodies, and abnormal pattern of respiration. These pathway associations correspond with the observed dysregulation of genes linked to muscle pathology, sarcomere disorganization, and abnormal respiratory processes. 4. Biophysical studies To investigate the effect of the titin mutation on the performance of skeletal muscles, the steady isometric force ( T 0 ) at saturating Ca 2+ (pCa, 4.5) and the unloaded shortening velocity ( V 0 ) were measured in demembranated fibres isolated from extensor digitorum longus (EDL), soleus and diaphragm muscles of WT and HMERF homozygous one-month old mice. With respect to the WT mice, T 0 developed by diaphragm muscle fibres of HOM mice was about 73% lower (P<0.05), while it did not differ significantly in EDL and soleus muscle fibres (Table 1). V 0 was measured in the same samples, at saturating Ca 2+ , using the slack test method 29 . V 0 was determined as the slope of the relation between the amount of rapid shortening imposed to the fibres (ΔL) and the time necessary for force to redevelop (Δt). As shown in Figure 4 and Table 1, with respect to WT mice, V 0 was not significantly different in EDL muscle fibers of HMERF mice, while it was significantly lower in soleus (about 54% lower, P=0.0044) and in diaphragm (about 84% lower, P<0.001) muscle fibres. Table 1. Effect of the HMERF mutation on the relevant mechanical parameters muscle genotype T 0 (kPa) p-value V 0 ( L 0 /s) p-value EDL WT 132±9 (3) 3.60±0.63 (3) HOM 156±26 (3) 0.531 3.85±0.82 (2) 0.871 soleus WT 127±38 (3) 2.22±0.06 (3) HOM 92±19 (3) 0.572 1.01±0.20 (3) 4.4*10 -3 * diaphragm WT 124±19 (3) 3.52±0.05 (2) HOM 33±11 (3) 0.039 * 0.55±0.09 (2) 2.9*10 -5 * Data for EDL, soleus and diaphragm fibre bundles isolated from WT and HMERF HOM mice expressed as mean±sem. In brackets the number of samples used for each condition. T 0 , steady isometric force expressed relative to the cross-sectional area of the fibres bundle (1 kPa corresponds to 1 kN/m 2 ); V 0 , unloaded shortening velocity measured using the slack test method. The statistical significance of the effect of the mutation is assessed with the Student’s t -test with p-value < 0.01 threshold. 5. HMERF mouse model does not show increased levels of Antisense Oligonucleotides in muscles Antisense Oligonucleotides (ASOs) are a therapeutic modality that can target cellular RNA and modulate its expression. While ASOs hold a clinical promise, their delivery to skeletal muscle remains a significant challenge in the development of RNA-targeted therapies for muscle-related diseases. Based on previous publications which reported enhanced delivery of ASOs in dystrophic muscle tissues 30,31 , we set out to find whether the muscle tissue in our HMERF model is more accessible to ASOs. To that end, we injected subcutaneously Malat1 -targeting PS\MOE ASO (40mg/kg) to homozygote TTN mice and WT littermates. ASO distribution and activity were evaluated in different muscle tissues and the liver as a control, by in-situ hybridization (ISH) and RT-PCR analysis. ISH was conducted on sections from Tibialis Anterior (TA), Extensor Digitorum Longus (EDL), Gastrocnemius and Soleus, harvested from 27-days old WT and homozygote mice (n=3), five days post-injection. ISH revealed no significant changes in ASO bio-distribution (WT = 1.8%, HOM= 2.3%, NS) (Fig. 5A-G). RNA collected from the Diaphragm, was subjected to rtPCR analysis, showing similar Malat1 knockdown in the HOM tissue, comparing to WT (n=3) (Fig. 5H). Discussion Hereditary Myopathy with Early Respiratory Failure (HMERF) is a severe neuromuscular disease marked by a cluster of pathological features: respiratory failure, progressive muscle weakness, altered fiber size, and presence of cytoplasmic bodies in the fibres 10 . In this study we report the first CRISPR-Cas9 engineered mouse model of HMERF and provide a comprehensive molecular characterization using transcriptomic and proteomic approaches. We investigated the missense HMERF variant p.(N31786K) in the A-band FN3 domain A150 (FN3-119), a conserved region of titin. Here, we successfully established a mouse model with a mutation in Ttn (NM_011652.3 c.87783C > G) corresponding to the human mutation p.(N31786K). Our cage-side assessments revealed clear phenotypic differences between homozygous mutant mice models, with respect to their WT and heterozygous littermates. Heterozygous mice displayed few neuromuscular complexities and behaved like WT controls, whereas homozygous littermates displayed a severe and uniform phenotype. These included kyphosis, malformed thoracic cages, and abnormal gait, and premature death. Histopathological studies demonstrated disorganized muscle fibers and sarcomeres, with abnormal myotilin accumulation in multiple tissues of HOM mouse. In the diaphragm, myotilin immunostaining revealed cytoplasmic bodies in necklace like formation, an established histological hallmark of HMERF. Additionally, biophysical testing confirmed early functional impairment of diaphragm muscles, mimicking the early respiratory involvement seen in patients. Our multi-omics approach identified robust patterns of upregulation in genes and proteins associated with muscle structure and regulation, cytoskeletal integrity, and homeostasis. A major limitation of this study is the limited availability of muscle tissues, which prevented a broader transcriptomic and proteomic analysis. Given the known differences in fiber type composition and metabolic profile between muscle types, such an analysis could have provided deeper insights into muscle-specific pathogenic signatures. In our study, transcriptomics and proteomics studies have been performed on anatomically different muscles, however, the features showing consistent dysregulation at both the mRNA and protein levels underscore a robust molecular effect strongly tied to the disease molecular pathomechanisms. Similarly, genes that are differentially expressed (DGE) and show alternative splicing (DSG) suggest their profound functional impact on the disease process. Animal models are an essential tool to investigate the pathomechanisms of titin-related diseases and dissect their complex nature 11 . By recapitulating mutation-specific effects on sarcomere assembly, mechanosensing, and cardiac or skeletal muscle remodelling, these models allow for the dissection of genotype–phenotype correlations and disease progression that cannot be fully captured in vitro . Moreover, they may serve as a critical instrument for preclinical evaluation of therapeutic strategies aimed at restoring sarcomeric integrity or modulating the cellular processes underlying the disease. One possible modality is RNA-therapy, including ASOs. However, the dense extracellular matrix, and metabolic activity of muscle tissue present barriers to efficient ASO uptake and biodistribution. While previous publications 30 , 31 show increase in ASO uptake in dystrophic muscle tissue, our HMERF model showed low ASO uptake in muscle, as confirmed by ISH and RT-qPCR. Adjustments to dosing regimens or cohort size may produce marginal changes, but are unlikely to alter therapeutic potential. These findings emphasize the importance of disease-specific models for realistic preclinical evaluation. In conclusion, this study establishes a novel HMERF mouse model and provides a comprehensive molecular characterization of the disease. The integrated approach with histological, functional, and multi-omics analyses reveals possible hints on the disease pathomechanisms and downstream effects. This model not only bridges clinical outcomes with molecular insights but also offers a critical foundation for developing effective, disease-tailored therapies. Materials and Methods Design and the Generation of Mice Carrying Ttn missense mutation All mouse experiments were approved by the Weizmann Institute’s IACUC committee and were carried out in accordance with their approved guidelines. gRNAs were designed using a combination of in-silico design tools, including the MIT CRISPR design tool 32 and sgRNA Designer, Rule set 2 33 , in the Benchling implementations (WT.benchling.com), and CRISPOR 34 . A single gRNA was designed to target Exon 292 of Ttn (5'- ATGAATACACATTCCGCGTG -3'). A single-stranded oligodeoxynucleotide (ssODN) donor repair template flanked asymmetrically by homology to each of the 5′ and 3′ insertion sites was designed (GAAGGGGAATGCCTGACCGCATCCTACGTGGTTACCAGACTCATCAAGAACAATGAATACACATTCCGCGTGcGcGCAGTGAAgAAGTACGGCCTCGGCGTGCCAGTTGAGTCAGAGCCTATTGTGGCCAGAAACTCTTTCAGTAAGTATGATT). Cas9 nuclease, crRNA, tracrRNAs and ssODN were purchased from Integrated DNA Technologies (IDT). C57Bl/6JOlaHsd mice were generated at the Transgenic Facility at the Weizmann Institute of Science using CRISPR/Cas9 genome editing in isolated one-cell mouse embryos as described 35 . C57Bl/6JOlaHsd mice were purchased from Envigo, Israel and maintained in specific pathogen-free (SPF) conditions. Mice were maintained on a 12 hr light/dark cycle, and food and water were provided ad libitum. Cas9-gRNA ribonucleoproteins (RNP) complexes together with donor repair template were delivered to one-cell embryos via electroporation, using the Biorad Genepulser. Electroporated embryos were transferred into the oviducts of pseudopregnant ICR females (Envigo, Israel). Genomic DNA from F0 pups was analyzed at weaning by PCR and Sanger sequencing using primers (TTN_WT_R: CCGTACTTGTTCACTGCCCT, TTN_MUT_R: CCGTACTTCTTCACTGCGCG, TTN_F: CACAGGAAGATGGAGGAGCA). Mice carrying the modification were bred to wild-type C57Bl/6JOlaHsd mice to determine germline transmission. F1 pups were selected for further breeding. ASO Biodistribution To compare Malat -1 targeting ASO biodistribution between homozygous and wild-type skeletal muscles, male and female mice were genotyped and weighed at 21 days of age. On day 22, a single subcutaneous injection of Malat1 -targeting ASO (40 mg/kg) was administered at the nape of the neck using a BD Ultra-Fine Insulin Syringe (30G), with the ASO solution diluted based on body weight to a total injection volume of 60–110 μL. Tissues were harvested on day 27, 5 days post-injection. Muscle groups (extensor digitorum longus [EDL], tibialis anterior [TA], soleus [SOL], gastrocnemius [GA]), and liver (positive control) were dissected from 3 HOM and 3 WT ASO-injected mice and from 1 HOM and 1 WT un-injected control mice. Left-side muscles and liver were fixed in 4% paraformaldehyde (24 WT), stored in 70% ethanol, and embedded in paraffin for in situ hybridization. Right-side TA, EDL, and diaphragm tissues were retained for RNA analysis. In-Situ Hybridization In-situ hybridization was performed using a digoxigenin (DIG)-labeled RNA probe to detect Malat1-targeting ASO in paraffin-embedded tissue sections. Sections were deparaffinized through successive xylene and graded ethanol washes, followed by rehydration in cold tap water. Target retrieval was performed by boiling the slides in 0.1% sodium citrate with 0.1% Triton X-100 for 20 minutes, followed by three PBS rinses. Hybridization was carried out overnight at 42°C in a humidified chamber using DIG Easy Hyb™ buffer (Roche) containing the DIG-labeled probe, diluted to 4,000 pmol/ml. Post-hybridization, sections were subjected to high-stringency washes in 50% formamide in 2× SSC at 37°C, 1x SSC at 37°C and MABT (Maleic Acid Buffer supplemented with Tween 20), to reduce nonspecific hybridization. Blocking was conducted in MABT with 5% serum for 30 minutes at room temperature. Sections were incubated for 1 hour in room temperature with anti-DIG-fluorescein antibody (Roche) diluted 1:40 in blocking buffer, followed by three MABT washes. Counterstaining was performed with DAPI (1:1000) for nuclear visualization, and slides were mounted with aqueous mounting media for imaging. ASO quantification in slides Slides from uninjected mice served as negative controls for background staining. Tissue sections were analyzed using QuPath and imageJ, defining cell expansion as 10 μm. A positive cell was characterized by the presence of FITC signal in the nucleus or cytoplasm. Three intensity thresholds were used to detect all positive cells (representing positive cells, in which ASO was detected by DIG labeled probe), with the percentage of positive cells differing by threshold but maintaining consistent WT vs. HOM trends. qRT-PCR RNA isolation of from muscles was performed using ReliaPrep(TM) RNA Cell Miniprep System (Promega), according to the manufacturer’s instructions. 1000 nanograms of isolated RNA of each sample was reverse transcribed to cDNA by using High Capacity cDNA RT Synthesis Kit (Applied biosystems). Quantitative real-time PCR was performed on BioRad CFX96 system in triplicate per sample by adding 5ul cDNA (5 ng/uL) and primer pairs to SYBR Green Master Mix (Applied Biosystems). GAPDH was used as housekeeping gene and relative quantification (RQ) values (RQmin/RQmax) were determined using CFX Maestro system. For amplification the following primers were used – Malat1-f: AGCTTTTGAGGGCTGACTGC. Malat1-r: CCATTCATTCCCCTCTGAGC. mGapdh-r: CCATTCATTCCCCTCTGAGC. mGapdh-f: AATGTGTCCGTCGTGGATCT RNA-Sequencing and transcriptomic analysis Total RNA was extracted from frozen skeletal muscle tissues (soleus, gastrocnemius, and tibialis anterior) of three samples using the MagMax RNA isolation kit (Thermo Fisher), with 10 ng input per tissue. For each sample, two technical replicate libraries were prepared using the SMART-Seq Stranded Kit (Takara Bio). All libraries passed quality control. Paired-end sequencing (2 × 101 bp) was performed on the Illumina NovaSeq 6000 platform at CeGaT (Tübingen, Germany). Reads were aligned to the Mus musculus reference genome (GRCm39, GENCODE Release M35, STAR v2.7.3) using STAR aligner tool 36 . Gene-level counts were generated using HTSeq 37 with the --stranded=reverse option. The principal component analysis (PCA) plot was generated using variance stabilized transformed (vst) counts. Differential gene expression (DGE) analysis was performed between homozygous samples HOM (-/-) and wild type (WT +/+) using the DESeq2 38 package in R (v4.3.2). Genes exhibiting a log2foldchange (log2FC) greater than 0 and an adjusted p-value (padj) determined using the Benjamini-Hochberg (BH) method lesser than 0.05 were significantly upregulated, and genes with a log2FC less than 0 and a padj lesser than 0.05 were significantly downregulated. The volcano plot was made in R. Differential splicing analysis was performed using MAJIQ v2 39 . In MAJIQ, LSV stands for "local splicing variation". The tool aims to quantify the inclusion levels of each splice junction coming or leaving an exon in a defined splice graph. MAJIQ Quantifier’s delta PSI (percentage spliced in) function was used to quantify changes of local splice variations (LSVs) inclusion levels between two sample groups HOM (-/-) and wild type (WT +/+). By default, any splicing event that has a threshold of a change of |dPSI| >= 0.2 (20%) between the sample groups and confidence thresholds of 0.05 was considered as differentially spliced. The pipeline involved finding those splice junctions that are seen across 80% of the samples in each of the two sample groups, with respect to the GRCm39 GENCODE Release M35 files. The denovo detection of junctions, splice sites and exons were disabled. After quantification, MAJIQ’s VOILA package was used to convert the data into readable formats (.tsv) and visualize gene specific splicing events. Pathway enrichment analyses was performed in R using the gprofiler2 package 40,41 using a custom background list. The Benjamini–Hochberg false discovery rate (FDR) correction method was applied to control for multiple testing, as implemented in gprofiler2 (correction_method = "fdr"). Fold enrichment was calculated as the measure of how much more a pathway term could be represented in the differential gene set than expected by chance as background. The calculation was performed as follows: Fold Enrichment = Intersection size/query size term size/effective domain size Redundant biological process terms were summarized using ReviGO 42 to narrow the long list of redundant pathway terms. ReviGO was used with the following parameters: GO metric = p-value (lower value is better), remove obsolete GO terms = yes, species = Whole UniProt database, similarity measure = SimRel. From the summarized pathway terms list, the top pathway terms with high significance and >10 genes contributing to the enrichment were chosen. Proteomic Profiling Sample preparation for MS-Analysis For proteomic analysis, extensor digitorum longus (EDL) muscles were collected from three biological replicates per group. Homozygous mutants and wild-type (WT) controls were age-matched at 34 days to ensure comparability. The snap frozen samples were lysed by adding 200 µl of 50 mM Tris-HCl (pH 7.8) buffer, 5% SDS, and complete ULTRA protease inhibitor (Roche) using the Bioruptor® (Diagenode) for 10 minutes (30 seconds on, 30 seconds off, 10 cycles) at 4 °C. To ensure complete lysis we conducted an additional sonication step using an ultra-sonic probe (30s, 1s/1s, amplitude 40%) followed by centrifugation at 4 °C and 20,000 g for 15 min. A BCA assay was used to determine the protein concentration in the supernatant according to the manufacturer's instructions. Free sulfhydryl bonds were alkylated with 15 mM IAA at room temperature (RT) in the dark for 30 minutes after disulfide bonds were reduced with 10 mM TCEP at 37 °C for 30 minutes. Proteolysis was performed on 100 µg of protein from each sample using the S-Trap procedure (Protifi) with a protein to trypsin ratio of 20:1. The trypsin incubation period was set to 2 hours at 42 °C. Formic acid was used to stop proteolysis (pH < 3.0). After desalting, all proteolytic digests were checked for complete digestion using monolithic column separation (PepSwift monolithic PS-DVB PL-CAP200-PM, Dionex) on an inert Ultimate 3000 HPLC (Dionex, Germering, Germany) by direct injection of 1 µg sample. At a flow rate of 2.2 µL/min and 60 °C, a binary gradient (solvent A: 0.1% TFA, solvent B: 0.08% TFA, 84% ACN) ranging from 5-12% B in 5 minutes and then from 12-50% B in 15 minutes was used. UV traces were taken at a wavelength of 214 nm 43 . LC-MS/MS Analysis A total of 1 g of the respective peptide samples was separated on an Ultimate 3000 Rapid Separation Liquid chromatography (RSLC) nano system with a ProFlow flow control device coupled to a Q Exactive HF orbitrap mass spectrometer (Thermo Scientific, Schwerte, Germany). For peptide concentration, a trapping column was used (Acclaim C18 PepMap100, 100 m, 2 cm, Thermo Fisher Scientific, Schwerte, Germany); 0.1% TFA (Sigma-Aldrich, Hamburg, Germany), flowrate 10 L/min). For the following reversed phase chromatography (Acclaim C18 PepMap100, 75 µm, 50 cm), we used a binary gradient (solvent A 0.1% FA (Sigma-Aldrich, Hamburg, Germany)/ solvent B 84% ACN (Sigma-Aldrich, Hamburg, Germany) with 0.1% FA; 5% B for 3 min, linear increase to 25% for 102 min, a further linear increase to 33% for 10 min, and then a final linear increase to 95% for 2 min followed by a linear decrease to 5% for 5 min). For MS survey scans, the following settings were used: MS was operated in data dependent acquisition mode (DDA) with full MS scans from 300 to 1600 m/z (resolution 60,000) with the polysiloxane ion at 371.10124 m/z as lock mass. Maximum injection time was set to 120 ms. The automatic gain control (AGC) was set to 1E6. For fragmentation, the 15 most intense ions (above the threshold ion count of 5E3) were chosen at a normalized collision energy (nCE) of 27% in each cycle, following each survey scan. Fragment ions were acquired (resolution 15,000) with an AGC of 5E4 and a maximum injection time of 50 ms. Dynamic exclusion was set to 15 s. Data Analysis For all data processing, the Proteome Discoverer software 2.5.0.400 (Thermo Scientific, Schwerte, Germany) was used and searches were done in a target/decoy mode against a mouse UniProt database (downloaded 30 November 2019, UniProt (WT.uniprot.org)) using the MASCOT and SEAQUEST algorithm. The following search parameters were used: precursor and fragment ion tolerances of 10 ppm and 0.02 Da for MS and MS/MS; a trypsin set as the enzyme with a maximum of two missed cleavages; carbamidomethylation of a cysteines set as the fixed modification and the oxidation of methionine was set as a dynamic modification; and using a percolator false discovery rate set to 0.01 for PSM, peptide and protein identifications. A label-free quantification (LFQ) analysis was performed for each condition. Proteins were considered as significantly regulated with p-value 0.05 after identification with at least 2 unique peptides and a ratio of 2 (2-fold upregulation) or 0.5 (2-fold downregulation). For statistical analysis of differential protein expression, normalized protein abundance values were used. Differential expression was assessed using the limma package 44 with proteins considered significantly dysregulated based on both p-value < 0.05 and adjusted p-value (Benjamini-Hochberg) < 0.05. The overlapping features seen in both transcriptomics and proteomics, with dysregulation observed in the same direction were examined. Pathway enrichment analyses on the common overlapping features were checked directly on the gprofiler website (https://biit.cs.ut.ee/gprofiler/gost) using the Benjamini–Hochberg FDR significance threshold and custom background list. This resulted in providing pathway enrichment with not only GO terms, but also from Reactome and HP databases. The significant pathway terms for the overlapping features were plotted using Python. Preparation of fibres for mechanical experiments Fibre bundles were obtained from Extensor Digitorum Longus (EDL), soleus and diaphragm muscles of three WT and three HMERF mice, one month-old. Muscles were dissected, chemically skinned and stored at -20°C in relaxing solution containing 50% glycerol (for details on the solutions and procedures 45 ). Muscles were delivered to the laboratory of Florence for the mechanical experiments. On the day of the experiments, a small bundle of 2-5 fibres was dissected under a stereomicroscope (Stemi SV11; Zeiss Inc) with dark field illumination. Extremities of the bundle were clamped by aluminum clips for attachment to transducer hooks. Mechanical protocol The fibre bundle was mounted in a drop of relaxing solution between the lever arms of a loudspeaker motor 46 and a capacitance force transducer 47 . The extremities of the fibre were fixed first with a rigor solution containing glutaraldehyde (5% v/v) and then glued to the clips with shellac dissolved in ethanol (8.3% w/v, 48,49 ). This procedure prevents the sliding of the ends of the bundle inside the clips and minimizes the shortening of the activated sample against the damaged sarcomeres at the ends of the segment during force development. The drop of solution where the bundle is mounted is one of the series of drops of a system that allows for rapid solution exchange 45 . Using a 40x dry objective and a 25x eyepiece (Zeiss Inc) the average sarcomere length (SL), the width (w) and the height (h) of the bundle were measured at 2-3 points along the bundle after setting the SL at 2.3-2.5 mm. The cross-sectional area (CSA) was calculated assuming elliptical geometry as p/4*w*h. CSA was 4100 ± 1200 (mean ± SEM, three bundles) in WT EDL bundles and 3900 ± 1600 in HMERF EDL bundles (three bundles); 1950 ± 380 (mean ± SEM, three bundles) in WT soleus bundles and 1420 ± 220 in HMERF soleus bundles (three bundles) and 8580 ± 1630 (mean ± SEM, three bundles) in WT diaphragm bundles and 15300 ± 3000 in HMERF diaphragm bundles (three bundles). Fibres were activated by temperature jump using a solution exchange system 45 . Starting from the relaxing solution at low temperature (2°C), the bundle was transferred to pre-activating solution at the same low temperature and, after 3 minutes, to activating solution at low temperature, where the isometric force is 0.1-0.2 the isometric force developed at the test temperature (25.1 ± 0.1°C). The bundle was then transferred to the activating solution at the test temperature for 4-10 seconds to have a steady isometric force, and subsequentially transferred to relaxing solution at the same temperature. This protocol prevents the development of most of the force during Ca 2+ diffusion, minimizing the development of sarcomere non uniformities because of the diffusion-limited time of activation across the bundle. Details on the composition of the solutions have been previously reported 45 . 4% dextran T-500 (Thermo Fisher Scientific) was added to all solutions to restore the lattice spacing before skinning 45,50–52 . The unloaded shortening velocity was measured by the slack test method 29 as shown in Figure 6. Force and motor position were recorded with a multifunction I/O board (PXIe-6358, National Instruments). A program written in LabVIEW (National Instrument) was used for signal generation and data acquisition. All data were analysed using dedicated programs written in LabVIEW (National Instruments) and Microsoft Excel and Origin 2018 (OriginLab Corp., Northampton, MA, USA) software. Declarations This study falls under the ethical approval HUS/16896/2022 by the ethics committee of the Hospital District of Helsinki and Uusimaa (HUS). The patient provided written informed consent to the referring clinician. The study, approved by the ethics committee of the Helsinki University Hospital, was performed in accordance with the Declaration of Helsinki. Ethics approval and consent to participate This study falls under the ethical approval HUS/16896/2022 by the ethics committee of the Hospital District of Helsinki and Uusimaa (HUS). All animal studies were conducted in strict accordance with the institutional guidelines for animal research (approval 1229-20ANIM). Consent for publication: Not applicable Competing interests: No conflict of interest to declare Availability of data and materials: All data generated in this study are available in the manuscript or from the authors upon reasonable request. Funding This study was funded by the European Commission under the HORIZON EUROPE Framework Program (grant approval #101080874 to MS), the Research Council of Finland (#351510 to BU, #339437 to MS), Samfundet Folkhälsan (to MS and BU), the Sigrid Jusélius Foundation (#230217 to MS and BU), European Joint Program on Rare Diseases (‘Improved diagnostic output in large sarcomeric genes IDOLS-G’ EJPRD19-126 to BU and ML), AFM-Téléthon (#25116 BU and ML), Recovery plan for Europe (Next Generation EU program) (DM 1557 11.10.2022, Investment PE8–Project Age-It, to ML), and Italian Ministry of University and Research (MUR, PRIN2022-PNRR, P2022XPT32, CUP: B53D23033280001 to ML). AH acknowledges the support by the “Ministerium für Kultur und Wissenschaft des Landes Nordrhein-Westfalen” and “Der Regierende Bürgermeister von Berlin, Senatskanzlei Wissenschaft und Forschung” and the Bundesministerium für Forschung, Technologie und Raumfahrt (BMFTR). AR acknowledges the financial support of the „Deutsche Gesellschaft für Muskelkranke“ (DGM) e.V. Authors' contributions Conceptualization: SV, MS, JS, BU, DD. Experimental data preparation and analysis: SV, NM, MM, SNG, AD, AH, VU, SBD, EHK, MC, AV, AR, ML, MS. Manuscript writing and editing: SV, NM, MM, SNG, AR, ML, MS. Manuscript final review and editing: all authors. Acknowledgement We thank Jaakko Sarparanta for his careful reading of the manuscript and his constructive remarks. References Bang ML, Centner T, Fornoff F, et al. The complete gene sequence of titin, expression of an unusual approximately 700-kDa titin isoform, and its interaction with obscurin identify a novel Z-line to I-band linking system. Circ Res . 2001;89(11):1065-1072. doi:10.1161/hh2301.100981 Granzier H, Labeit S. Discovery of Titin and Its Role in Heart Function and Disease. Circ Res . 2025;136(1):135-157. doi:10.1161/CIRCRESAHA.124.323051. Herman DS, Lam L, Taylor MR, et al. Truncations of titin causing dilated cardiomyopathy. N Engl J Med . Published online February 16, 2012. doi:10.1056/NEJMoa1110186. Savarese M, Vihola A, Oates EC. Genotype-phenotype correlations in recessive titinopathies. Genet Med . 2020;22(12):2029-2040. doi:10.1038/S41436-020-0914-2 MF F, A O, E N, et al. Inferring disease course from differential exon usage in the wide titinopathy spectrum. Ann Clin Transl Neurol . 2024;Oct;11(10):2745-2755. doi:10.1002/acn3.52189. Savarese M, Sarparanta J, Vihola A, Udd B, Hackman P. Increasing role of titin mutations in neuromuscular disorders. J Neuromuscul Dis . 2016;3(3):293-308. doi:10.3233/JND-160158 MF F, V L, M J. The crucial role of titin in fetal development: recurrent miscarriages and bone, heart and muscle anomalies characterise the severe end of titinopathies spectrum. J Med Genet . 2023;60(9):866-873. doi:10.1136/jmg-2022-109018 Hedberg C, Toledo AG, Gustafsson CM, Larson G, Oldfors A, Macao B. Hereditary myopathy with early respiratory failure is associated with misfolding of the titin fibronectin III 119 subdomain. Neuromuscul Disord . 2014;24(5):373-379. doi:10.1016/j.nmd.2014.02.003 Palmio J, Evila A, Chapon F, et al. Hereditary myopathy with early respiratory failure: occurrence in various populations. J Neurol Neurosurg Psychiatry . 2014;85(3):345-353. doi:10.1136/jnnp-2013-304965 Palmio J, Leonard-Louis S, Sacconi S, et al. Expanding the importance of HMERF titinopathy: new mutations and clinical aspects. J Neurol . Published online March 3, 2019. doi:10.1007/s00415-019-09187-2. Marcello M, Cetrangolo V, Savarese M, Udd B. Use of animal models to understand titin physiology and pathology. J Cell Mol Med . 2022;26(20):5103-5112. doi:10.1111/jcmm.17533 Pfeffer G, Barresi R, Wilson IJ, et al. Titin founder mutation is a common cause of myofibrillar myopathy with early respiratory failure. J Neurol Neurosurg Psychiatry . 2014;85(3):331-338. doi:10.1136/jnnp-2012-304728 Park I, Han C, Jin S, et al. Myosin regulatory light chains are required to maintain the stability of myosin II and cellular integrity. Biochem J . Published online February 15, 2011. Yao Y, Yan C, Huang H, et al. LncRNA-MEG3 Regulates Muscle Mass and Metabolic Homeostasis by Facilitating SUZ12 Liquid-Liquid Phase Separation. Adv Sci Weinh Baden-Wurtt Ger . 2025;12(23):e2417715. doi:10.1002/advs.202417715 Yao Y, Wang Z, Chen Y, et al. Single-cell analysis reveals the lncRNA-MEG3/miRNA-133a-3p/PRRT2 axis regulates skeletal muscle regeneration and myogenesis. Genes Dis . Published online May 5, 2022. Yu X, Wang Z, Sun H, Yang Y, Li K, Tang Z. Long non-coding MEG3 is a marker for skeletal muscle development and meat production traits in pigs. Anim Genet . Published online December 6, 2018. Stiber J, Hawkins A, Zhang ZS, et al. STIM1 signalling controls store-operated calcium entry required for development and contractile function in skeletal muscle. Nat Cell Biol . Published online June 10, 2008. doi:10.1038/ncb1731 Goonasekera SA, Davis J, Kwong JQ, et al. Enhanced Ca2+ influx from STIM1-Orai1 induces muscle pathology in mouse models of muscular dystrophy. Hum Mol Genet . Published online July 15, 2014. doi:10.1093/hmg/ddu079 Chen TC, Kuo T, Dandan M, et al. The role of striated muscle Pik3r1 in glucose and protein metabolism following chronic glucocorticoid exposure. J Biol Chem . Published online January 2021. doi:10.1016/j.jbc.2021.100395 Mammen AL, Mahoney JA, Germain A, et al. A novel conserved isoform of the ubiquitin ligase UFD2a/UBE4B is expressed exclusively in mature striated muscle cells. PLoS One . Published online 2011. doi:10.1371/journal.pone.0028861 Li H, Randall WR, Du SJ. skNAC (skeletal Naca), a muscle‐specific isoform of Naca (nascent polypeptide‐associated complex alpha), is required for myofibril organization. FASEB J . 2009;23(6):1988-2000. doi:10.1096/fj.08-125542 Guo W, Schafer S, Greaser M. RBM20, a gene for hereditary cardiomyopathy, regulates titin splicing. Nat Med . 2012;18:766-773. doi:10.1038/nm.2693 Buck D, Smith JE, Chung CS, et al. Removal of immunoglobulin-like domains from titin’s spring segment alters titin splicing in mouse skeletal muscle and causes myopathy. J Gen Physiol . 2014;143(2):215-230. doi:10.1085/jgp.201311129 Hendil KB, Khan S, Tanaka K. Simultaneous binding of PA28 and PA700 activators to 20 S proteasomes. Biochem J . 1998;15;332 ( Pt 3)(Pt 3):749-54. doi:10.1042/bj3320749 Kopp F, Dahlmann B, Kuehn L. Reconstitution of hybrid proteasomes from purified PA700-20 S complexes and PA28alphabeta activator: ultrastructure and peptidase activities. J Mol Biol . Published online October 26, 2001. Tanaka K. The proteasome: overview of structure and functions. Proc Jpn Acad Ser B Phys Biol Sci . 2009;85(1):12-36. doi:10.2183/pjab.85.12 Lee BH, Lee M, Park S. Enhancement of proteasome activity by a small-molecule inhibitor of USP14. Nature . 2010;467:179-184. doi:10.1038/nature09299 Garg A, O’Rourke J, Long C, et al. KLHL40 deficiency destabilizes thin filament proteins and promotes nemaline myopathy. J Clin Invest . 2014;Aug;124(8):3529-39. doi:10.1172/JCI74994. Edman KA. The velocity of unloaded shortening and its relation to sarcomere length and isometric force in vertebrate muscle fibres. J Physiol . 1979;291(1):143-159. doi:10.1113/jphysiol.1979.sp012804 Heemskerk H, de Winter C, van Kuik P, et al. Preclinical PK and PD Studies on 2′-O-Methyl-phosphorothioate RNA Antisense Oligonucleotides in the mdx Mouse Model. Mol Ther . 2010;18(6):1210-1217. doi:https://doi.org/10.1038/mt.2010.72 Bremmer-Bout M, Aartsma-Rus A, de Meijer EJ, et al. Targeted Exon Skipping in Transgenic hDMD Mice: A Model for Direct Preclinical Screening of Human-Specific Antisense Oligonucleotides. Mol Ther . 2004;10(2):232-240. doi:https://doi.org/10.1016/j.ymthe.2004.05.031 Hsu PD, Scott DA, Weinstein JA, et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol . 2013;31(9):827-832. doi:10.1038/nbt.2647 Doench JG, Fusi N, Sullender M, et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol . 2016;34(2):184-191. doi:10.1038/nbt.3437 Concordet JP, Haeussler M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res . 2018;46(W1):W242-W245. doi:10.1093/nar/gky354 Gertsenstein M, Nutter LMJ. Production of knockout mouse lines with Cas9. Methods San Diego Calif . 2021;191:32-43. doi:10.1016/j.ymeth.2021.01.005 Dobin A, Davis CA, Schlesinger F, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics . Published online January 1, 2013. doi:10.1093/bioinformatics/bts635 Anders S, Pyl PT, Huber W. HTSeq–a Python framework to work with high-throughput sequencing data. Bioinformatics . Published online January 15, 2015. doi:10.1093/bioinformatics/btu638 Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol . 2014;15:550. doi:10.1186/s13059-014-0550-8 Green CJ, Gazzara MR, Barash Y. MAJIQ-SPEL: web-tool to interrogate classical and complex splicing variations from RNA-Seq data. Bioinformatics . Published online January 15, 2018. doi:10.1093/bioinformatics/btx565 Reimand J, Kull M, Peterson H, Hansen J. Jaak Vilo: g:Profiler — a web-based toolset for functional profiling of gene lists from large-scale experiments. Published online 2007. doi:10.1093/nar/gkm226 Kolberg L, Raudvere U, Kuzmin I, Adler P, Vilo J. Hedi Peterson: g:Profiler—interoperable web service for functional enrichment analysis and gene identifier mapping (2023 update. Nucleic Acids Res . Published online May 2023. doi:10.1093/nar/gkad347 Supek F, Bošnjak M, Škunca N, Šmuc T. REVIGO Summarizes and Visualizes Long Lists of Gene Ontology Terms. PLoS ONE . 2011;6(7):21800. doi:10.1371/journal.pone.0021800 Burkhart JM, Schumbrutzki C, Wortelkamp S, Sickmann A, Zahedi RP. Systematic and quantitative comparison of digest efficiency and specificity reveals the impact of trypsin quality on MS-based proteomics. J Proteomics . 2012;75(4):1454-1462. doi:10.1016/j.jprot.2011.11.016 Ritchie ME, Phipson B, Wu D, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res . 2015;20;43(7):e47. doi:10.1093/nar/gkv007 Linari M, Caremani M, Piperio C, Brandt P, Lombardi V. Stiffness and Fraction of Myosin Motors Responsible for Active Force in Permeabilized Muscle Fibers from Rabbit Psoas. Biophys J . 2007;92(ue 7):2476-2490,. doi:10.1529/biophysj.106.099549. Lombardi V, Piazzesi G. The contractile response during steady lengthening of stimulated frog muscle fibres. J Physiol . 1990;431(1):141-171. doi:10.1113/jphysiol.1990.sp018324 Huxley AF, Lombardi V. A sensitive force transducer with resonant-frequency 50 kHz. 40 WEST 20TH . 1980;305(AUG). Linari M, Dobbie I, Reconditi M, et al. The Stiffness of Skeletal Muscle in Isometric Contraction and Rigor: The Fraction of Myosin Heads Bound to Actin. Biophys J . 1998;74(5):2459-2473. doi:10.1016/S0006-3495(98)77954-8 Bershitsky SY, Tsaturyan AK. Force generation and work production by covalently cross-linked actin-myosin cross-bridges in rabbit muscle fibers. Biophys J . 1995;69(3):1011-1021. doi:https://doi.org/10.1016/S0006-3495(95)79976-3 Percario V, Boncompagni S, Protasi F, Pertici I, Pinzauti F, Caremani M. Mechanical parameters of the molecular motor myosin II determined in permeabilised fibres from slow and fast skeletal muscles of the rabbit. J Physiol . 2018;596(7):1243-1257. doi:10.1113/JP275404 Brenner B, Yu LC. Characterization of radial force and radial stiffness in Ca (2+)‐activated skinned fibres of the rabbit psoas muscle. J Physiol . 1991;441(1):703-718. Kawai M, Wray JS, Zhao Y. The effect of lattice spacing change on cross-bridge kinetics in chemically skinned rabbit psoas muscle fibers. I. Proportionality between the lattice spacing and the fiber width. Biophys J . 1993;64(1):187-196. doi:https://doi.org/10.1016/S0006-3495(93)81356-0 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFile4.xlsx SupplementaryFile2.xlsx SupplementaryFile5.csv SupplementaryFile1.xlsx SupplementaryFile3.xlsx SupplementaryFigure1.png Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8910535","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":593894634,"identity":"e65379d9-c337-49ff-9e83-ce4828d4d038","order_by":0,"name":"Shaul Raviv","email":"","orcid":"","institution":"Cancer Research Center and Wohl Institute for Translational Medicine, Tel Hashomer","correspondingAuthor":false,"prefix":"","firstName":"Shaul","middleName":"","lastName":"Raviv","suffix":""},{"id":593894635,"identity":"8ab95ca5-ea4c-4409-913a-ae6dc5827bfd","order_by":1,"name":"Nofar Mor","email":"","orcid":"","institution":"Cancer Research Center and Wohl Institute for Translational Medicine, Tel Hashomer","correspondingAuthor":false,"prefix":"","firstName":"Nofar","middleName":"","lastName":"Mor","suffix":""},{"id":593894636,"identity":"44c55d33-acb5-4263-a01b-e122f448f0e8","order_by":2,"name":"Matteo Marcello","email":"","orcid":"","institution":"University of Florence","correspondingAuthor":false,"prefix":"","firstName":"Matteo","middleName":"","lastName":"Marcello","suffix":""},{"id":593894637,"identity":"df1bbc42-b64c-4010-b939-3ce0a246167e","order_by":3,"name":"Swethaa Natraj Gayathri","email":"","orcid":"","institution":"Folkhälsans Forskningscentrum","correspondingAuthor":false,"prefix":"","firstName":"Swethaa","middleName":"Natraj","lastName":"Gayathri","suffix":""},{"id":593894638,"identity":"c4960847-c7a2-480e-b05a-904062dc0966","order_by":4,"name":"Amir Dory","email":"","orcid":"","institution":"Tel Aviv University","correspondingAuthor":false,"prefix":"","firstName":"Amir","middleName":"","lastName":"Dory","suffix":""},{"id":593894639,"identity":"37a13f2f-1a41-4e37-83ff-abcedc817d62","order_by":5,"name":"Andreas Hentschel","email":"","orcid":"","institution":"Leibniz Institute for Analytical Sciences - ISAS","correspondingAuthor":false,"prefix":"","firstName":"Andreas","middleName":"","lastName":"Hentschel","suffix":""},{"id":593894640,"identity":"ee944a3b-8c8b-4023-88c7-6a6a6f8a0d6f","order_by":6,"name":"Victoria Urin","email":"","orcid":"","institution":"Cancer Research Center and Wohl Institute for Translational Medicine, Tel Hashomer","correspondingAuthor":false,"prefix":"","firstName":"Victoria","middleName":"","lastName":"Urin","suffix":""},{"id":593894641,"identity":"9a3056a1-c16c-42a6-8a02-e60fde612865","order_by":7,"name":"Shifra Ben-Dor","email":"","orcid":"","institution":"Weizmann Institute of Science","correspondingAuthor":false,"prefix":"","firstName":"Shifra","middleName":"","lastName":"Ben-Dor","suffix":""},{"id":593894642,"identity":"af9aac52-f038-460b-9887-d780ebc9f8a2","order_by":8,"name":"Rebecca Haffner-Krausz","email":"","orcid":"","institution":"Weizmann Institute of Science","correspondingAuthor":false,"prefix":"","firstName":"Rebecca","middleName":"","lastName":"Haffner-Krausz","suffix":""},{"id":593894643,"identity":"bbe8bc2c-b910-42e7-9baa-08aec139b8c5","order_by":9,"name":"Marco Caremani","email":"","orcid":"","institution":"University of Florence","correspondingAuthor":false,"prefix":"","firstName":"Marco","middleName":"","lastName":"Caremani","suffix":""},{"id":593894644,"identity":"424e3d74-7079-4c98-aae3-a917248ddb86","order_by":10,"name":"Anna Vihola","email":"","orcid":"","institution":"University of Helsinki","correspondingAuthor":false,"prefix":"","firstName":"Anna","middleName":"","lastName":"Vihola","suffix":""},{"id":593894645,"identity":"aef562c2-f116-42fc-ae79-64654474919a","order_by":11,"name":"Andreas Roos","email":"","orcid":"","institution":"University of Duisburg-Essen","correspondingAuthor":false,"prefix":"","firstName":"Andreas","middleName":"","lastName":"Roos","suffix":""},{"id":593894646,"identity":"ffceb577-0c7c-44b2-977e-315367e3ced2","order_by":12,"name":"Marco Linari","email":"","orcid":"","institution":"University of Florence","correspondingAuthor":false,"prefix":"","firstName":"Marco","middleName":"","lastName":"Linari","suffix":""},{"id":593894647,"identity":"6e17ea49-5d47-4ff0-8986-f1fd648f91c5","order_by":13,"name":"Marco Savarese","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABB0lEQVRIie3PMUvDQBTA8RcOcsuTrBcK+gmEk4I4qP0qPQrnJoJLBwmFQjNmTb9FvoEHD+qSmjXQxSBkPnFpF2kaHJPaVbj/dBzvx7sDcLn+Qbdj4AAGjAA+P43oMbBfgnQaoZYcEKDpHrmM15W1EF3It3VVbafFY8B4RU/5DSDvJtf5wzBMga6y5jDEfPMczlFSWjYPYz3EaJ8hGG850/7AW2xURgiEVsCojxT1gUSjZVLz3e7nXb0S/2hJ75ay3cJUIrQPZzOjMgaS8NjDypqFqaRJImo2wNVEpdT8BXOBvaTQnrXT6G4RaO9r+3Kvkjj+/MZVdI6B6TZtsuMOj8y7XC6X64/2ythYx981h2cAAAAASUVORK5CYII=","orcid":"","institution":"University of Helsinki","correspondingAuthor":true,"prefix":"","firstName":"Marco","middleName":"","lastName":"Savarese","suffix":""},{"id":593894648,"identity":"41419aea-4a7a-4441-925e-40bafc804cdd","order_by":14,"name":"Bjarne Udd","email":"","orcid":"","institution":"Folkhälsans Forskningscentrum","correspondingAuthor":false,"prefix":"","firstName":"Bjarne","middleName":"","lastName":"Udd","suffix":""},{"id":593894649,"identity":"0fbdfbc8-d430-45cf-872e-b055ddfd6cb5","order_by":15,"name":"Dan Dominissini","email":"","orcid":"","institution":"Cancer Research Center and Wohl Institute for Translational Medicine, Tel Hashomer","correspondingAuthor":false,"prefix":"","firstName":"Dan","middleName":"","lastName":"Dominissini","suffix":""}],"badges":[],"createdAt":"2026-02-18 15:08:43","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8910535/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8910535/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103210710,"identity":"a9ca23d0-e791-45cb-85b0-aa878a2c00bf","added_by":"auto","created_at":"2026-02-23 08:31:04","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":754676,"visible":true,"origin":"","legend":"\u003cp\u003ePremature mortality and neuromuscular phenotypes in Ttn homozygous mutant mice.\u003cbr\u003e\n(A) Body weight measurements of wild-type (WT, +/+), heterozygous (Ht, +/-), and homozygous mutant (HM, -/-) mice at postnatal days 21 and 27, for both male and female mice. While heterozygous mice show comparable weights to WT mice, homozygous mutants are significantly smaller and fail to gain weight following weaning at day 21 (n \u0026gt; 8, **p \u0026lt; 0.005, ****p \u0026lt; 0.00005). (B) Representative images of homozygous Ttn mutant mice (in the pictures- marked with a black asterisk), compared to heterozygous littermates, at day 60 (upper panel) and day 27 (lower panel). (C) Survival probability curves comparing heterozygous mice to homozygous mutant mice (n \u0026gt; 8).\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/c67f9b693daedf44f0502449.png"},{"id":103210719,"identity":"723a848f-e62f-43ad-8e2a-7508d36f060b","added_by":"auto","created_at":"2026-02-23 08:31:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":241118,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptomics analysis of HOM muscles versus WT. \u0026nbsp;A. PCA plot showing the clustering of the sample groups. B. Volcano plot highlighting the presence of 3,245 significantly upregulated and 3,350 significantly downregulated genes. C. MAJIQ splicing analysis revealing alternatively spliced genes in the HOM mice, including Naca, Ube4b, Myl6, Meg3, Stim1, and Pik3r1. The violin plots show the relative inclusion level of each junction as delta PSI (ΔY). Each color represents a specific junction.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/49da8ee216d962575fe0918f.png"},{"id":103210714,"identity":"f87f6232-81e8-4689-9a6f-46e86316bb39","added_by":"auto","created_at":"2026-02-23 08:31:04","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":228983,"visible":true,"origin":"","legend":"\u003cp\u003eProteomics analysis of HOM muscles versus WT. A. PCA plot showing the clustering of the sample groups. B. Volcano plot highlighting the presence of 90 significantly upregulated 50 significantly downregulated proteins. C. Pathway enrichment analysis on the common features (n=44) showing significant terms from CORUM-defined protein complexes, Human Phenotype Ontology (HPO) and Gene Ontology (GO).\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/0c405691f6043c58fc29255c.png"},{"id":103505877,"identity":"a58431f7-6877-4c43-966c-27b2daf06b74","added_by":"auto","created_at":"2026-02-26 13:33:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":137760,"visible":true,"origin":"","legend":"\u003cp\u003eUnloaded shortening velocity V0 determined using the slack test in fibre bundles from WT (black traces, symbols and lines) and HMERF HOM (blue traces, symbols and lines) mice. V0 was measured in EDL (A), soleus (B) and diaphragm (C) muscle fibres. In each panel: on the left, force responses to a rapid ramp shortening of about 10% of the initial sample length (L0) and 3ms duration superimposed during an isometric contraction at saturating Ca2+; on the right, relation between ΔL and Δt in WT and HOM muscle fibres. Different symbols indicate different fibres; continuous lines are fist order regressions fitted to the experimental points. The slope of the regression is an estimate of V\u003csub\u003e0\u003c/sub\u003e. (A). Temperature range, 24.9 - 25.2 °C\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/9a85d89c981f5dd1cb7f562d.png"},{"id":103210720,"identity":"e2e6c534-0327-4b43-8848-215eefeafe24","added_by":"auto","created_at":"2026-02-23 08:31:04","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":489728,"visible":true,"origin":"","legend":"\u003cp\u003eTtn homozygous mutant mice exhibit no differences in ASO uptake and bio-distribution comparing to WT mice. (A) Ttn homozygous mutant mice and WT littermates were administered ASO (subcutaneous injection, 40 mg/kg), and tissues were harvested and fixed five days post-injection. ASO uptake in liver and skeletal muscle tissues was assessed through GFP signal detection by ISH with an ASO-specific DIG-tagged LNA probe and anti-DIG-fluorescein antibody. (B-G) Representative images of tissue sections stained via ISH for ASO (FITC) and counterstained for nuclei with DAPI, including liver sections (B-D) and lower hind limb muscle sections (E-G). (H) Relative Malat1 mRNA expression levels in the diaphragm following treatment with PBS or Malat1-targeting ASO (n = 3).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/ddc12b57fc31987bb9bfce36.png"},{"id":104397699,"identity":"0c296780-6de3-4109-b779-dd958dfeb557","added_by":"auto","created_at":"2026-03-11 11:54:42","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":75053,"visible":true,"origin":"","legend":"\u003cp\u003eMeasurements of the unloaded shortening velocity using the slack test method. A. Force responses (bottom panel) to rapid shortening ramp (complete in 3 ms) of different amplitude (ΔL, top panel). Δt is the time necessary for the force to being redeveloped. Different colors refer to different amplitude of the length change. B. Relation between ΔL and Δt. V\u003csub\u003e0\u003c/sub\u003e, measured by the slope of the relation, is 3.67 ± 0.41 L\u003csub\u003e0\u003c/sub\u003e/s. Colored points correspond to that measured from the traces in A. Bundle from EDL muscle of WT mice. Bundle length at rest, 1.78 mm; average sarcomere length at rest, 2.46 µm; cross-sectional area, 2700 µm2; T0, 128 kPa, temperature, 25.0°C.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/3a33aa25d5b2d52673e44810.png"},{"id":104407358,"identity":"b777b6ec-e57a-455c-8e4a-738515629374","added_by":"auto","created_at":"2026-03-11 12:37:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2891960,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/091f5811-2e8a-41c6-a8e0-10711943bfa8.pdf"},{"id":103210711,"identity":"3c6599e4-299f-45f5-abac-c7aba80c1054","added_by":"auto","created_at":"2026-02-23 08:31:04","extension":"xlsx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":38270,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/716ae54d44918bc46a30f578.xlsx"},{"id":103505867,"identity":"3dfb315f-8ae8-4c46-94f1-b33504dc6dc0","added_by":"auto","created_at":"2026-02-26 13:33:17","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":33530,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/bdbae5716bfab3e2bfb4dc12.xlsx"},{"id":103210721,"identity":"0ab7719c-7e56-4f86-b43f-29c1ec468af6","added_by":"auto","created_at":"2026-02-23 08:31:04","extension":"csv","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":52052,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile5.csv","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/789e8203b290af8034c8eeee.csv"},{"id":103210715,"identity":"fcd8ba30-1b1e-4399-ad6f-499e0d43167f","added_by":"auto","created_at":"2026-02-23 08:31:04","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":706809,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/df208ccb80bccc7cbf650ab5.xlsx"},{"id":103210722,"identity":"bb28817c-b4d5-497e-afe0-0f10541fc94f","added_by":"auto","created_at":"2026-02-23 08:31:04","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":120028,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFile3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/2fa784c022b5e522640de5d5.xlsx"},{"id":103210717,"identity":"5ef17bd9-baf3-4fcf-b492-6f53a1a4c2ce","added_by":"auto","created_at":"2026-02-23 08:31:04","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":4524606,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8910535/v1/392b6b1d63cdd7b029de1402.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Knock-in Mouse Model of Hereditary Myopathy with Early Respiratory Failure Carrying the Titin Variant Corresponding to Human p.N31786K","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eTTN\u003c/em\u003e gene, located on chromosome 2, encodes titin, also known as connectin\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Titin is the largest known human protein, expressed in striated muscle tissues. This giant protein spans half of the sarcomere, extending from the Z-disk to the M-band. Titin plays an essential role in muscle structure and function, forming a trans-sarcomeric filament that not only provides structural support but also acts as a molecular spring\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. This spring-like property is crucial for maintaining passive elasticity in muscle fibers, enabling them to return to their resting state after contraction or stretch. Beyond its biomechanical functions, titin interacts with various signaling molecules and contributes to sarcomere assembly, mechanotransduction, and cellular stress responses. Mutations in \u003cem\u003eTTN\u003c/em\u003e result in a broad spectrum of inherited disorders\u003csup\u003e\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e, collectively known as titinopathies, which can exhibit recessive or dominant inheritance patterns. These disorders manifest as myopathies\u0026mdash;often with associated respiratory dysfunction\u0026mdash;and/or cardiomyopathies, reflecting the diverse and critical roles of titin in muscle and cardiac function\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. One of these disorders, Hereditary Myopathy with Early Respiratory Failure (HMERF), is a severe adult-onset titinopathy caused by heterozygous variants in exon 344, encoding for the A-band FN3 domain A150 (FN3-119). To date, at least 19 HMERF-causing variants, within A150 domain and affecting its folding, have been identified in this single domain\u003csup\u003e\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eClinically, HMERF is manifested with muscle weakness, predominantly in the proximal muscles, and early involvement of the respiratory musculature, which can lead to significant respiratory impairment and eventual respiratory failure. The disease progresses insidiously, with patients presenting initially with mild weakness or dyspnea before developing more severe functional limitations. Patient muscles show characteristic cytoplasmic bodies not containing mutant titin itself, pointing to a defect in protein homeostasis\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Despite its dramatic impact on quality of life and life expectancy, no effective therapies currently exist for HMERF, highlighting an urgent need for deeper mechanistic insights and the development of targeted interventions.\u003c/p\u003e \u003cp\u003eTo elucidate the pathophysiological mechanisms underlying skeletal muscle titinopathies, numerous genetically engineered animal models have been developed. Vertebrate models, including mice and fishes (Zebrafish and Medaka), typically involving deletions or missense mutations in key domains of the \u003cem\u003eTTN\u003c/em\u003e gene\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. These models have contributed to characterizing the structural and mechanical properties of specific titin regions, and to mimicking patient mutations. However, until now, no mouse model has been developed to recapitulate the pathogenesis of HMERF titinopathy. In this study, we present a newly established genetically engineered mouse model, corresponding to a missense variant identified in a 50-years old HMERF patient. Exome sequencing, which included sampling of the patient and both of his parents (trio analysis), showed a de-novo missense variant in exon 344 of the \u003cem\u003eTTN\u003c/em\u003e gene (NM_001267550 c.95358C\u0026thinsp;\u0026gt;\u0026thinsp;A p.N31786K). This mutation was previously reported\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e and associated with HMERF.\u003c/p\u003e \u003cp\u003eThis study represents the first mouse model for HMERF, denoting a pivotal advancement in the field of neuromuscular research. It paves way for the identification of potential therapeutic targets and the development of innovative treatment strategies for HMERF.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e1. Clinical data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA male patient of Jewish Ashkenazi ancestry had normal general and motor development during childhood. He noticed enlarged calf muscles when he was 16 years old and an inability to walk on his heels due to ankle dorsiflexion weakness at age 21. Neurological evaluation at that time showed bilateral calf muscle pseudo-hypertrophy and bilateral foot drop. CPK level was around 900, electrodiagnostic evaluation of the lower limbs showed normal motor and sensory nerve conduction studies, while electromyography (EMG) was suggestive of myopathy, without myotonia. A biopsy of the right quadriceps muscle showed internal nuclei in fibers, an abundance of fiber atrophy, as well as rimmed vacuoles. Accordingly, the muscle biopsy diagnosis was vacuolar myopathy. Genetic evaluation at that time included dystrophin gene deletion/duplication analysis which was negative. As both unrelated parents and three siblings showed no weakness and normal CPK, limb-girdle muscular dystrophy (LGMD) was diagnosed and considered an undetermined recessive disorder. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the following years, muscle weakness progressed to involve proximal and cervical muscles. At age 30, orthopnea developed, and non-invasive ventilation at night with a bilevel positive airway pressure (BIPAP) was required for sleep. At age 35, use of a BIPAP was required for any recline, and from age 43, continuous use of BIPAP was mandatory. Ambulation was progressively impaired, requiring a rollator walker at age 32 and he became wheelchair-bound at age 38. A re-evaluation at age 30 included a repeated muscle biopsy, which again revealed a vacuolar myopathy. Western blot analysis of the muscle tissue showed the absence of Calpain-3, and therefore, a calpainopathy (LGMD2A) was suggested. However, both sequencing and MLPA of the \u003cem\u003eCAPN3\u003c/em\u003e gene were normal, discarding this diagnosis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHe was evaluated at the Sheba Medical Center at age 48. His examination showed normal cognition and normal cranial nerve function except for moderate neck flexors and mild extensor weakness. The limbs showed no atrophy, masked by obesity, and no clear calf hypertrophy. A flaccid tone was noted in all four limbs. Severe muscle weakness was evident, with complete to nearly complete paralysis (MRC score of 0-2) of proximal and distal upper and lower limb muscles. Deep tendon reflexes were absent in the upper and lower limbs; plantar responses were indifferent, and no pyramidal or extrapyramidal signs were evident. Sensory exam for pain, vibration and proprioception was normal in all extremities.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eExome sequencing, which included sampling of the patient and both of his parents (trio analysis), showed a de-novo missense variant in exon 344 of the \u003cem\u003eTTN\u003c/em\u003e gene (NM_001267550 c.95358C\u0026gt;A p.(N31786K)). It is rare, located in a highly conserved region and, therefore, classified as pathogenic by ACMG criteria (PM2, PP3, PS1, PS2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003eHomozygote mutant mice die prematurely and show extensive neuromuscular phenotype\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe established a mouse model with mutation in \u003cem\u003eTtn\u003c/em\u003e (NM_011652.3 c.87783C\u0026gt;G) corresponding to the human mutation (NM_001267550 C.95358C\u0026gt;A p.N31786K), using CRISPR-Cas9 zygote injection (Supplementary figure 1A), on a C57Bl/6JOlaHsd background. As the human mutation manifests as autosomal dominant HMERF, we first assessed the heterozygote mice carrying the mutation (referred to as HT or Ttn\u003csup\u003e+/-\u003c/sup\u003e). Over a three-year follow-up period, the general health and welfare of the mice were evaluated through cage-side observations. \u0026nbsp;Heterozygous mice were found to be viable and fertile, displayed Mendelian inheritance patterns, and were indistinguishable from their WT littermates in terms of body weight (Fig. 1A). They also exhibited normal overall appearance, activity levels, and interactions with their environment, including nest-building behaviour and social interactions with cage mates, showing no differences relative to WT littermates. Furthermore, cage-side assessments did not identify any neuromuscular abnormalities in HT mice, in contrast to human carriers of the corresponding mutation.\u003c/p\u003e\n\u003cp\u003eTo further investigate, we assessed the phenotype in homozygous (referred to as HOM or Ttn-/-). Homozygote mice were not born at the Mendelian ratio (Chi-Square test, P.value \u0026lt;0.008) (Supplementary figure 1B). By 21 days of age, HOM mice were significantly smaller than their littermates (Fig. 1A-B, Student\u0026rsquo;s t-test, p \u0026lt; 0.01 for males and p \u0026lt; 0.02 for females, n\u0026gt;4) and displayed reduced fat tissue. The size discrepancy became more pronounced over time, as HOM mice failed to gain weight beyond 21 days of age. Unlike their HT littermates, HOM mice exhibited kyphosis, malformed thoracic cages (Fig. 1B), and abnormal gait. Additionally, HOM mice exhibited premature death, with a median survival of 41 days (Fig. 1C). Interestingly, immunohistochemical analysis revealed myotilin-positive aggregates in necklace formation within a subset of muscle fibers, mainly in diaphragm, in HOM mice at 1 month of age (Fig. 1D).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3. Multi-omics analysis of\u003c/strong\u003e \u003cstrong\u003ehomozygote\u003cem\u003e\u0026nbsp;HMERF\u0026nbsp;\u003c/em\u003emouse model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.1 Transcriptomics revealed differentially expressed and spliced skeletal muscle genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo characterize the intrinsic transcriptomic profiles of mutant mice and investigate potential pathomechanisms, bulk RNA sequencing (RNA-Seq) was performed on 32 days old homozygous mutant mice and their WT littermates. Principal component analysis (PCA) revealed clear clustering of the two sample groups (Fig. 2A \u0026ndash; missing legend). The RNA-Seq analysis focused on the identification of differentially expressed genes (DEGs) and differentially spliced genes (DSGs) through a comparative analysis of HOM (-/-) and WT (+/+) samples.\u003c/p\u003e\n\u003cp\u003eThe analysis of differential gene expression yielded 3,245 genes that exhibited significant upregulation (log₂FC \u0026gt; 0) and 3,350 genes that exhibited significant downregulation (log₂FC \u0026lt; 0) (Figure 2B and Supplementary File 1). Pathway enrichment analysis of all DEGs identified enriched Gene Ontology (GO) terms related to biological process (2,673), cellular component (325), and molecular function (286). Redundant biological process terms were summarized using ReviGO, resulting in 632 non-redundant terms. The most significant enriched biological pathways included actin cytoskeleton organization, muscle structure development, external encapsulating structure organization, metabolism, and apoptotic processes. Furthermore, pathways also associated with respiratory system development and function were found to be significantly enriched.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAlternative splicing analysis using Modeling Alternative Junction Inclusion Quantification (MAJIQ) identified 84 DSGs, each exhibiting at least one alternative splicing event (Supplementary File 2). Fifty of these DSGs were found to overlap with the DEGs. These genes, which were both differentially expressed and spliced, were primarily associated with striated muscle structure, cytoskeletal organization, and with key cellular processes involved in muscle homeostasis (Fig. 2C).\u003c/p\u003e\n\u003cp\u003eWe observed a significant downregulation and alternative splicing of \u003cem\u003eMyl6\u003c/em\u003e, an integral component of myosin complex that regulate muscle contraction by modulating the myosin motor\u003csup\u003e13\u003c/sup\u003e. Its downregulation is indicative of impaired muscle force generation and proper contraction. Similarly, we identified the significant downregulation of a long non-coding RNA Meg3 that was recently found to regulate muscle mass and metabolic homeostasis in mice models\u003csup\u003e14\u003c/sup\u003e. It also has conserved properties to regulate myogenesis and facilitate the regulation of muscle cell proliferation, differentiation, and regeneration\u003csup\u003e15,16\u003c/sup\u003e. Conversely, upregulation and alternative splicing of \u003cem\u003eStim1\u003c/em\u003e, a central mediator of store-operated calcium influx,\u0026nbsp;reflected altered calcium stores for muscle contraction, possibly causing muscle dysfunction and wasting\u003csup\u003e17,18\u003c/sup\u003e. Increased \u003cem\u003ePik3r1\u003c/em\u003e expression further suggested a compensatory upregulation of growth factor pathways in a catabolic milieu\u003csup\u003e19\u003c/sup\u003e. Notably, we also detected a significant upregulation and alternative splicing of \u003cem\u003eUbe4b\u003c/em\u003e (UFD2a ortholog), and \u003cem\u003eNaca\u003c/em\u003e, both genes that have been investigated to have muscle-specific isoforms and play key roles in ubiquitin-proteasome system (UPS)\u003csup\u003e20\u003c/sup\u003e and myofibril assembly\u003csup\u003e21\u003c/sup\u003e respectively.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTranscriptomic analysis also revealed a significant upregulation of the splicing factor \u003cem\u003eRbm20\u003c/em\u003e, an RNA-binding protein predominantly expressed in skeletal and cardiac muscle. RBM20 is a key regulator of alternative splicing of \u003cem\u003eTTN\u003c/em\u003e\u003csup\u003e22\u003c/sup\u003e. In the soleus tissues of mouse models, its increased expression has led to shorter titin isoforms, thereby resulting in the exclusion of PEVK exons and altering sarcomere elasticity properties\u003csup\u003e23\u003c/sup\u003e. In our HMERF mutant mouse model, an increased \u003cem\u003eRbm20\u003c/em\u003e expression suggests altered splicing dynamics, potentially contributing to disrupted sarcomere structure and impaired muscle function observed in the disease pathology.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Proteomic profiling showed dysregulated patterns for muscle structure development and respiration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further characterize the molecular pathomechanisms of the HMERF mutant models on protein level, MS-analysis was performed. PCA plot showed distinct segregation of samples (Fig 3 A). Differential protein analysis between the HOM (-/-) and WT (+/+) revealed 90 significantly upregulated (logFC \u0026gt; 0) and 50 down (logFC \u0026lt; 0) proteins (Fig 3B and Supplementary File 3). There is an overlap of 44 differentially expressed proteins that are also dysregulated at transcriptome level (Supplementary File 4). Pathway enrichment analysis on the common features (Fig. 3C), revealed significant terms from CORUM-defined protein complexes, Human Phenotype Ontology (HPO) and Gene Ontology (GO) (Supplementary File 5).\u003c/p\u003e\n\u003cp\u003eBoth transcriptomic and proteomic datasets revealed elevated\u0026nbsp;sarcomeric structural, developmental and cytoskeletal-associated components, including Pdlim3 (PDZ and LIM domain protein 3), Myl4 (Myosin light chain 4), Hspb1 (Heat shock protein beta-1), Des (Desmin), Csrp3 (Cysteine and glycine-rich protein 3), Xirp2 (Xin actin-binding repeat-containing protein 2), Nrap (Nebulin-related-anchoring protein), Pdlim5 (PDZ and LIM domain protein 5), Flnc (Filamin C), Myot (Myotilin), Fhl3 (Four and a half LIM domains 3), Ankrd2 (Ankyrin repeat domain-containing protein 2), Klhl40 (Kelch-like protein 40) and Klhl41 (Kelch-like protein 41). The proteasome complexes (PA700-20S-PA28, PA700) and the FHL3 homodimer complex scored among the top CORUM (protein complex) pathway enriched terms, reflecting a robust upregulation of protein degradation machinery and molecular scaffolding within muscle fibers. This is supported by the upregulation of multiple ubiquitin-proteasome system components including Psmb1, Psmb6 (beta-type catalytic core subunits), Psmc1 (ATPase subunit), Psmd11 and Psmd2 (non-ATPase regulatory subunits), and Usp14 (Ubiquitin-specific protease 14), indicating impaired proteostasis in the mutant muscles\u003csup\u003e24\u0026ndash;27\u003c/sup\u003e. We also noticed the consistent upregulation of Klhl40 and Klhl41, the two-muscle specific Kelch-like proteins that serve as essential regulators of skeletal muscle integrity by facilitating substrate specificity for cullin-3, an E3 ubiquitin ligase\u003csup\u003e28\u003c/sup\u003e. Loss-of-function mutations in either gene is known to cause nemaline myopathies, characterized by sarcomeric disorganization and cytoplasmic inclusion bodies\u003csup\u003e28\u003c/sup\u003e. \u0026nbsp;Their upregulation in our dataset likely reflects an adaptive response to proteostasis imbalance and improper structural instability, aligning with the enriched HPO terms related to myofibrillar myopathy, cytoplasmic inclusion bodies, and abnormal respiratory processes\u003csup\u003e28\u003c/sup\u003e. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFinally, HPO enrichment presented the translational impact of these findings, with significant overlap in conditions such as myopathy, myofibrillar myopathy, muscle fiber cytoplasmic inclusion bodies, and abnormal pattern of respiration. These pathway associations correspond with the observed dysregulation of genes linked to muscle pathology, sarcomere disorganization, and abnormal respiratory processes. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4. Biophysical studies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the effect of the titin mutation on the performance of skeletal muscles, the steady isometric force (\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e) at saturating Ca\u003csup\u003e2+\u003c/sup\u003e (pCa, 4.5)\u003cem\u003e\u0026nbsp;\u003c/em\u003eand the unloaded shortening velocity (\u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e) were measured in demembranated fibres isolated from extensor digitorum longus (EDL), soleus and diaphragm muscles of WT\u003cem\u003e\u0026nbsp;\u003c/em\u003eand HMERF homozygous one-month old mice. With respect to the WT mice, \u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e developed by diaphragm muscle fibres of HOM mice was about 73% lower (P\u0026lt;0.05), while it did not differ significantly in EDL and soleus muscle fibres (Table 1). \u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e was measured in the same samples, at saturating Ca\u003csup\u003e2+\u003c/sup\u003e, using the slack test method\u003csup\u003e29\u003c/sup\u003e. \u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e was determined as the slope of the relation between the amount of rapid shortening imposed to the fibres (\u0026Delta;L) and the time necessary for force to redevelop (\u0026Delta;t). As shown in Figure 4 and Table 1, with respect to WT mice, \u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e was not significantly different in EDL muscle fibers of HMERF mice, while it was significantly lower in soleus (about 54% lower, P=0.0044) and in diaphragm (about 84% lower, P\u0026lt;0.001) muscle fibres.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1. Effect of the\u003cem\u003e\u0026nbsp;HMERF\u003c/em\u003e mutation on the relevant mechanical parameters\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.5618%;\"\u003e\n \u003cp\u003emuscle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.239%;\"\u003e\n \u003cp\u003egenotype\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.6583%;\"\u003e\n \u003cp\u003e\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e (kPa)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8365%;\"\u003e\n \u003cp\u003ep-value\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e\u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e (\u003cem\u003eL\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e/s)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003ep-value\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.5618%;\"\u003e\n \u003cp\u003eEDL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.239%;\"\u003e\n \u003cp\u003eWT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.6583%;\"\u003e\n \u003cp\u003e132\u0026plusmn;9 (3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8365%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e3.60\u0026plusmn;0.63 (3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.5618%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.239%;\"\u003e\n \u003cp\u003eHOM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.6583%;\"\u003e\n \u003cp\u003e156\u0026plusmn;26 (3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8365%;\"\u003e\n \u003cp\u003e0.531\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e3.85\u0026plusmn;0.82 (2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e0.871\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.5618%;\"\u003e\n \u003cp\u003esoleus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.239%;\"\u003e\n \u003cp\u003eWT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.6583%;\"\u003e\n \u003cp\u003e127\u0026plusmn;38 (3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8365%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e2.22\u0026plusmn;0.06 (3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.5618%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.239%;\"\u003e\n \u003cp\u003eHOM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.6583%;\"\u003e\n \u003cp\u003e92\u0026plusmn;19 (3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8365%;\"\u003e\n \u003cp\u003e0.572\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e1.01\u0026plusmn;0.20 (3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e4.4*10\u003csup\u003e-3\u003c/sup\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.5618%;\"\u003e\n \u003cp\u003ediaphragm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.239%;\"\u003e\n \u003cp\u003eWT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.6583%;\"\u003e\n \u003cp\u003e124\u0026plusmn;19 (3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8365%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e3.52\u0026plusmn;0.05 (2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.5618%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.239%;\"\u003e\n \u003cp\u003eHOM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.6583%;\"\u003e\n \u003cp\u003e33\u0026plusmn;11 (3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8365%;\"\u003e\n \u003cp\u003e0.039 *\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e0.55\u0026plusmn;0.09 (2)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 16.3522%;\"\u003e\n \u003cp\u003e2.9*10\u003csup\u003e-5\u0026nbsp;\u003c/sup\u003e*\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eData for EDL, soleus and diaphragm fibre bundles isolated from WT and HMERF HOM mice expressed as mean\u0026plusmn;sem. In brackets the number of samples used for each condition. \u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e, steady isometric force expressed relative to the cross-sectional area of the fibres bundle (1 kPa corresponds to 1 kN/m\u003csup\u003e2\u003c/sup\u003e); \u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e, unloaded shortening velocity measured using the slack test method. The statistical significance of the effect of the mutation is assessed with the Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test with p-value \u0026lt; 0.01 threshold. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e5. HMERF mouse model does not show increased levels of Antisense Oligonucleotides in muscles\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAntisense Oligonucleotides (ASOs) are a therapeutic modality that can target cellular RNA and modulate its expression. While ASOs hold a clinical promise, their delivery to skeletal muscle remains a significant challenge in the development of RNA-targeted therapies for muscle-related diseases. Based on previous publications which reported enhanced delivery of ASOs in dystrophic muscle tissues\u003csup\u003e30,31\u003c/sup\u003e, we set out to find whether the muscle tissue in our HMERF model is more accessible to ASOs.\u003c/p\u003e\n\u003cp\u003eTo that end, we injected subcutaneously \u003cem\u003eMalat1\u003c/em\u003e-targeting PS\\MOE ASO (40mg/kg) to homozygote TTN mice and WT littermates. ASO distribution and activity were evaluated in different muscle tissues and the liver as a control, by in-situ hybridization (ISH) and RT-PCR analysis. ISH was conducted on sections from Tibialis Anterior (TA), Extensor Digitorum Longus (EDL), Gastrocnemius and Soleus, harvested from 27-days old WT and homozygote mice (n=3), five days post-injection. ISH revealed no significant changes in ASO bio-distribution (WT = 1.8%, HOM= 2.3%, NS) (Fig. 5A-G). RNA collected from the Diaphragm, was subjected to rtPCR analysis, showing similar \u003cem\u003eMalat1\u003c/em\u003e knockdown in the HOM tissue, comparing to WT (n=3) (Fig. 5H).\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eHereditary Myopathy with Early Respiratory Failure (HMERF) is a severe neuromuscular disease marked by a cluster of pathological features: respiratory failure, progressive muscle weakness, altered fiber size, and presence of cytoplasmic bodies in the fibres\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. In this study we report the first CRISPR-Cas9 engineered mouse model of HMERF and provide a comprehensive molecular characterization using transcriptomic and proteomic approaches.\u003c/p\u003e \u003cp\u003eWe investigated the missense HMERF variant p.(N31786K) in the A-band FN3 domain A150 (FN3-119), a conserved region of titin. Here, we successfully established a mouse model with a mutation in \u003cem\u003eTtn\u003c/em\u003e (NM_011652.3 c.87783C\u0026thinsp;\u0026gt;\u0026thinsp;G) corresponding to the human mutation p.(N31786K). Our cage-side assessments revealed clear phenotypic differences between homozygous mutant mice models, with respect to their WT and heterozygous littermates. Heterozygous mice displayed few neuromuscular complexities and behaved like WT controls, whereas homozygous littermates displayed a severe and uniform phenotype. These included kyphosis, malformed thoracic cages, and abnormal gait, and premature death. Histopathological studies demonstrated disorganized muscle fibers and sarcomeres, with abnormal myotilin accumulation in multiple tissues of HOM mouse. In the diaphragm, myotilin immunostaining revealed cytoplasmic bodies in necklace like formation, an established histological hallmark of HMERF. Additionally, biophysical testing confirmed early functional impairment of diaphragm muscles, mimicking the early respiratory involvement seen in patients.\u003c/p\u003e \u003cp\u003eOur multi-omics approach identified robust patterns of upregulation in genes and proteins associated with muscle structure and regulation, cytoskeletal integrity, and homeostasis. A major limitation of this study is the limited availability of muscle tissues, which prevented a broader transcriptomic and proteomic analysis. Given the known differences in fiber type composition and metabolic profile between muscle types, such an analysis could have provided deeper insights into muscle-specific pathogenic signatures.\u003c/p\u003e \u003cp\u003eIn our study, transcriptomics and proteomics studies have been performed on anatomically different muscles, however, the features showing consistent dysregulation at both the mRNA and protein levels underscore a robust molecular effect strongly tied to the disease molecular pathomechanisms. Similarly, genes that are differentially expressed (DGE) and show alternative splicing (DSG) suggest their profound functional impact on the disease process.\u003c/p\u003e \u003cp\u003eAnimal models are an essential tool to investigate the pathomechanisms of titin-related diseases and dissect their complex nature\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. By recapitulating mutation-specific effects on sarcomere assembly, mechanosensing, and cardiac or skeletal muscle remodelling, these models allow for the dissection of genotype\u0026ndash;phenotype correlations and disease progression that cannot be fully captured \u003cem\u003ein vitro\u003c/em\u003e. Moreover, they may serve as a critical instrument for preclinical evaluation of therapeutic strategies aimed at restoring sarcomeric integrity or modulating the cellular processes underlying the disease. One possible modality is RNA-therapy, including ASOs. However, the dense extracellular matrix, and metabolic activity of muscle tissue present barriers to efficient ASO uptake and biodistribution. While previous publications\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e show increase in ASO uptake in dystrophic muscle tissue, our HMERF model showed low ASO uptake in muscle, as confirmed by ISH and RT-qPCR. Adjustments to dosing regimens or cohort size may produce marginal changes, but are unlikely to alter therapeutic potential. These findings emphasize the importance of disease-specific models for realistic preclinical evaluation.\u003c/p\u003e \u003cp\u003eIn conclusion, this study establishes a novel HMERF mouse model and provides a comprehensive molecular characterization of the disease. The integrated approach with histological, functional, and multi-omics analyses reveals possible hints on the disease pathomechanisms and downstream effects. This model not only bridges clinical outcomes with molecular insights but also offers a critical foundation for developing effective, disease-tailored therapies.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eDesign and the Generation of Mice Carrying \u003cem\u003eTtn\u003c/em\u003e missense mutation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll mouse experiments were approved by the Weizmann Institute\u0026rsquo;s IACUC committee and were carried out in accordance with their approved guidelines.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003egRNAs were designed using a combination of \u003cem\u003ein-silico\u003c/em\u003e design tools, including the MIT CRISPR design tool\u003csup\u003e32\u003c/sup\u003e and sgRNA Designer, Rule set 2\u003csup\u003e33\u003c/sup\u003e, in the Benchling implementations (WT.benchling.com), and CRISPOR\u003csup\u003e34\u003c/sup\u003e . A single gRNA was designed to target Exon 292 of \u003cem\u003eTtn\u003c/em\u003e (5\u0026apos;- ATGAATACACATTCCGCGTG -3\u0026apos;). A single-stranded oligodeoxynucleotide (ssODN) donor repair template flanked asymmetrically by homology to each of the 5\u0026prime; and 3\u0026prime; insertion sites was designed (GAAGGGGAATGCCTGACCGCATCCTACGTGGTTACCAGACTCATCAAGAACAATGAATACACATTCCGCGTGcGcGCAGTGAAgAAGTACGGCCTCGGCGTGCCAGTTGAGTCAGAGCCTATTGTGGCCAGAAACTCTTTCAGTAAGTATGATT). Cas9 nuclease, crRNA, tracrRNAs and ssODN were purchased from Integrated DNA Technologies (IDT).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eC57Bl/6JOlaHsd mice were generated at the Transgenic Facility at the Weizmann Institute of Science using CRISPR/Cas9 genome editing in isolated one-cell mouse embryos as described\u003csup\u003e35\u003c/sup\u003e. C57Bl/6JOlaHsd mice were purchased from Envigo, Israel\u0026nbsp;and maintained in specific pathogen-free (SPF) conditions. Mice were maintained on a 12 hr light/dark cycle, and food and water were provided ad libitum.\u003c/p\u003e\n\u003cp\u003eCas9-gRNA ribonucleoproteins (RNP) complexes together with donor repair template were delivered to one-cell embryos via electroporation, using the Biorad Genepulser.\u0026nbsp;Electroporated embryos were transferred into the oviducts of pseudopregnant ICR females\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e(Envigo, Israel). Genomic DNA from F0 pups was analyzed at weaning by PCR and Sanger sequencing using primers (TTN_WT_R: CCGTACTTGTTCACTGCCCT, TTN_MUT_R: CCGTACTTCTTCACTGCGCG, TTN_F: CACAGGAAGATGGAGGAGCA). Mice carrying the modification were bred to wild-type C57Bl/6JOlaHsd mice to determine germline transmission. F1 pups were selected for further breeding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eASO Biodistribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo compare \u003cem\u003eMalat\u003c/em\u003e-1 targeting ASO biodistribution between homozygous and wild-type skeletal muscles, male and female mice were genotyped and weighed at 21 days of age. On day 22, a single subcutaneous injection of \u003cem\u003eMalat1\u003c/em\u003e-targeting ASO (40 mg/kg) was administered at the nape of the neck using a BD Ultra-Fine Insulin Syringe (30G), with the ASO solution diluted based on body weight to a total injection volume of 60\u0026ndash;110 \u0026mu;L. Tissues were harvested on day 27, 5 days post-injection. Muscle groups (extensor digitorum longus [EDL], tibialis anterior [TA], soleus [SOL], gastrocnemius [GA]), and liver (positive control) were dissected from 3 HOM and 3 WT ASO-injected mice and from 1 HOM and 1 WT un-injected control mice. Left-side muscles and liver were fixed in 4% paraformaldehyde (24 WT), stored in 70% ethanol, and embedded in paraffin for in situ hybridization. Right-side TA, EDL, and diaphragm tissues were retained for RNA analysis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIn-Situ Hybridization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn-situ hybridization was performed using a digoxigenin (DIG)-labeled RNA probe to detect Malat1-targeting ASO in paraffin-embedded tissue sections. Sections were deparaffinized through successive xylene and graded ethanol washes, followed by rehydration in cold tap water. Target retrieval was performed by boiling the slides in 0.1% sodium citrate with 0.1% Triton X-100 for 20 minutes, followed by three PBS rinses. Hybridization was carried out overnight at 42\u0026deg;C in a humidified chamber using DIG Easy Hyb\u0026trade; buffer (Roche) containing the DIG-labeled probe, diluted to 4,000 pmol/ml. Post-hybridization, sections were subjected to high-stringency washes in 50% formamide in 2\u0026times; SSC at 37\u0026deg;C, 1x SSC at 37\u0026deg;C and MABT (Maleic Acid Buffer supplemented with Tween 20), to reduce nonspecific hybridization. Blocking was conducted in MABT with 5% serum for 30 minutes at room temperature. Sections were incubated for 1 hour in room temperature with anti-DIG-fluorescein antibody (Roche) diluted 1:40 in blocking buffer, followed by three MABT washes. Counterstaining was performed with DAPI (1:1000) for nuclear visualization, and slides were mounted with aqueous mounting media for imaging.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eASO quantification in slides\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSlides from uninjected mice served as negative controls for background staining. Tissue sections were analyzed using QuPath and imageJ, defining cell expansion as 10 \u0026mu;m. A positive cell was characterized by the presence of FITC signal in the nucleus or cytoplasm. Three intensity thresholds were used to detect all positive cells (representing positive cells, in which ASO was detected by DIG labeled probe), with the percentage of positive cells differing by threshold but maintaining consistent WT vs. HOM trends.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eqRT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRNA isolation of from muscles was performed using ReliaPrep(TM) RNA Cell Miniprep System (Promega), according to the manufacturer\u0026rsquo;s instructions. 1000 nanograms of isolated RNA of each sample was reverse transcribed to cDNA by using High Capacity cDNA RT Synthesis Kit (Applied biosystems). Quantitative real-time PCR was performed on BioRad CFX96 system in triplicate per sample by adding 5ul cDNA (5 ng/uL) and primer pairs to SYBR Green Master Mix (Applied Biosystems). GAPDH was used as housekeeping gene and relative quantification (RQ) values (RQmin/RQmax) were determined using CFX Maestro system.\u003c/p\u003e\n\u003cp\u003eFor amplification the following primers were used \u0026ndash; Malat1-f: AGCTTTTGAGGGCTGACTGC. Malat1-r: CCATTCATTCCCCTCTGAGC. mGapdh-r: CCATTCATTCCCCTCTGAGC. mGapdh-f: AATGTGTCCGTCGTGGATCT\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA-Sequencing and transcriptomic analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from frozen skeletal muscle tissues (soleus, gastrocnemius, and tibialis anterior) of three samples using the MagMax RNA isolation kit (Thermo Fisher), with 10 ng input per tissue. For each sample, two technical replicate libraries were prepared using the SMART-Seq Stranded Kit (Takara Bio). All libraries passed quality control. Paired-end sequencing (2 \u0026times; 101 bp) was performed on the Illumina NovaSeq 6000 platform at CeGaT (T\u0026uuml;bingen, Germany). Reads were aligned to the Mus musculus reference genome (GRCm39, GENCODE Release M35, STAR v2.7.3) using STAR aligner tool\u003csup\u003e36\u003c/sup\u003e. Gene-level counts were generated using HTSeq\u003csup\u003e37\u003c/sup\u003e with the --stranded=reverse option.\u003c/p\u003e\n\u003cp\u003eThe principal component analysis (PCA) plot was generated using variance stabilized transformed (vst) counts. Differential gene expression (DGE) analysis was performed between homozygous samples HOM (-/-) and wild type (WT +/+) using the DESeq2\u003csup\u003e38\u003c/sup\u003e package in R (v4.3.2). Genes exhibiting a log2foldchange (log2FC) greater than 0 and an adjusted p-value (padj) determined using the Benjamini-Hochberg (BH) method lesser than 0.05 were significantly upregulated, and genes with a log2FC less than 0 and a padj lesser than 0.05 were significantly downregulated. The volcano plot was made in R. Differential splicing analysis was performed using MAJIQ v2\u003csup\u003e39\u003c/sup\u003e. In MAJIQ, LSV stands for \u0026quot;local splicing variation\u0026quot;. The tool aims to quantify the inclusion levels of each splice junction coming or leaving an exon in a defined splice graph. MAJIQ Quantifier\u0026rsquo;s delta PSI (percentage spliced in) function was used to quantify changes of local splice variations (LSVs) inclusion levels between two sample groups HOM (-/-) and wild type (WT +/+). By default, any splicing event that has a threshold of a change of |dPSI| \u0026gt;= 0.2 (20%) between the sample groups and confidence thresholds of 0.05 was considered as differentially spliced. \u0026nbsp;The pipeline involved finding those splice junctions that are seen across 80% of the samples in each of the two sample groups, with respect to the GRCm39 GENCODE Release M35 files. The denovo detection of junctions, splice sites and exons were disabled. After quantification, MAJIQ\u0026rsquo;s VOILA package was used to convert the data into readable formats (.tsv) and visualize gene specific splicing events.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePathway enrichment analyses was performed in R using the gprofiler2 package\u003csup\u003e40,41\u003c/sup\u003e using a custom background list. The Benjamini\u0026ndash;Hochberg false discovery rate (FDR) correction method was applied to control for multiple testing, as implemented in gprofiler2 (correction_method = \u0026quot;fdr\u0026quot;). Fold enrichment was calculated as the measure of how much more a pathway term could be represented in the differential gene set than expected by chance as background. The calculation was performed as follows:\u003c/p\u003e\n\u003cp\u003eFold Enrichment \u0026nbsp;= \u003cu\u003eIntersection size/query size\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; term size/effective domain size\u003c/p\u003e\n\u003cp\u003eRedundant biological process terms were summarized using ReviGO\u003csup\u003e42\u003c/sup\u003e to narrow the long list of redundant pathway terms. ReviGO was used with the following parameters: GO metric = p-value (lower value is better), remove obsolete GO terms = yes, species = Whole UniProt database, similarity measure = SimRel. From the summarized pathway terms list, the top pathway terms with high significance and \u0026gt;10 genes contributing to the enrichment were chosen.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProteomic Profiling\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSample preparation for MS-Analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor proteomic analysis, extensor digitorum longus (EDL) muscles were collected from three biological replicates per group. Homozygous mutants and wild-type (WT) controls were age-matched at 34 days to ensure comparability. The snap frozen samples were lysed by adding 200 \u0026micro;l of 50 mM Tris-HCl (pH 7.8) buffer, 5% SDS, and complete ULTRA protease inhibitor (Roche) using the Bioruptor\u0026reg; (Diagenode) for 10 minutes (30 seconds on, 30 seconds off, 10 cycles) at 4 \u0026deg;C. To ensure complete lysis we conducted an additional sonication step using an ultra-sonic probe (30s, 1s/1s, amplitude 40%) followed by centrifugation at 4 \u0026deg;C and 20,000 g for 15 min. A BCA assay was used to determine the protein concentration in the supernatant according to the manufacturer\u0026apos;s instructions. Free sulfhydryl bonds were alkylated with 15 mM IAA at room temperature (RT) in the dark for 30 minutes after disulfide bonds were reduced with 10 mM TCEP at 37 \u0026deg;C for 30 minutes. Proteolysis was performed on 100 \u0026micro;g of protein from each sample using the S-Trap procedure (Protifi) with a protein to trypsin ratio of 20:1. The trypsin incubation period was set to 2 hours at 42 \u0026deg;C. Formic acid was used to stop proteolysis (pH \u0026lt; 3.0).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAfter desalting, all proteolytic digests were checked for complete digestion using monolithic column separation (PepSwift monolithic PS-DVB PL-CAP200-PM, Dionex) on an inert Ultimate 3000 HPLC (Dionex, Germering, Germany) by direct injection of 1 \u0026micro;g sample. At a flow rate of 2.2 \u0026micro;L/min and 60 \u0026deg;C, a binary gradient (solvent A: 0.1% TFA, solvent B: 0.08% TFA, 84% ACN) ranging from 5-12% B in 5 minutes and then from 12-50% B in 15 minutes was used. UV traces were taken at a wavelength of 214 nm\u003csup\u003e43\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLC-MS/MS Analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 1 g of the respective peptide samples was separated on an Ultimate 3000 Rapid Separation Liquid chromatography (RSLC) nano system with a ProFlow flow control device coupled to a Q Exactive HF orbitrap mass spectrometer (Thermo Scientific, Schwerte, Germany). For peptide concentration, a trapping column was used (Acclaim C18 PepMap100, 100 m, 2 cm, Thermo Fisher Scientific, Schwerte, Germany); 0.1% TFA (Sigma-Aldrich, Hamburg, Germany), flowrate 10 L/min). For the following reversed phase chromatography (Acclaim C18 PepMap100, 75 \u0026micro;m, 50 cm), we used a binary gradient (solvent A 0.1% FA (Sigma-Aldrich, Hamburg, Germany)/ solvent B 84% ACN (Sigma-Aldrich, Hamburg, Germany) with 0.1% FA; 5% B for 3 min, linear increase to 25% for 102 min, a further linear increase to 33% for 10 min, and then a final linear increase to 95% for 2 min followed by a linear decrease to 5% for 5 min). For MS survey scans, the following settings were used: MS was operated in data dependent acquisition mode (DDA) with full MS scans from 300 to 1600 m/z (resolution 60,000) with the polysiloxane ion at 371.10124 m/z as lock mass. Maximum injection time was set to 120 ms. The automatic gain control (AGC) was set to 1E6. For fragmentation, the 15 most intense ions (above the threshold ion count of 5E3) were chosen at a normalized collision energy (nCE) of 27% in each cycle, following each survey scan. Fragment ions were acquired (resolution 15,000) with an AGC of 5E4 and a maximum injection time of 50 ms. Dynamic exclusion was set to 15 s.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor all data processing, the Proteome Discoverer software 2.5.0.400 (Thermo Scientific, Schwerte, Germany) was used and searches were done in a target/decoy mode against a mouse UniProt database (downloaded 30 November 2019, UniProt (WT.uniprot.org)) using the MASCOT and SEAQUEST algorithm. The following search parameters were used: precursor and fragment ion tolerances of 10 ppm and 0.02 Da for MS and MS/MS; a trypsin set as the enzyme with a maximum of two missed cleavages; carbamidomethylation of a cysteines set as the fixed modification and the oxidation of methionine was set as a dynamic modification; and using a percolator false discovery rate set to 0.01 for PSM, peptide and protein identifications. A label-free quantification (LFQ) analysis was performed for each condition. Proteins were considered as significantly regulated with p-value 0.05 after identification with at least 2 unique peptides and a ratio of 2 (2-fold upregulation) or 0.5 (2-fold downregulation). For statistical analysis of differential protein expression, normalized protein abundance values were used. Differential expression was assessed using the limma package\u003csup\u003e44\u003c/sup\u003e with proteins considered significantly dysregulated based on both p-value \u0026lt; 0.05 and adjusted p-value (Benjamini-Hochberg) \u0026lt; 0.05. The overlapping features seen in both transcriptomics and proteomics, with dysregulation observed in the same direction were examined. Pathway enrichment analyses on the common overlapping features were checked directly on the gprofiler website (https://biit.cs.ut.ee/gprofiler/gost) using the Benjamini\u0026ndash;Hochberg FDR significance threshold and custom background list. This resulted in providing pathway enrichment with not only GO terms, but also from Reactome and HP databases. The significant pathway terms for the overlapping features were plotted using Python.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePreparation of fibres for mechanical experiments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFibre bundles were obtained from Extensor Digitorum Longus (EDL), soleus and diaphragm muscles of three WT and three HMERF mice, one month-old. Muscles were dissected, chemically skinned and stored at -20\u0026deg;C in relaxing solution containing 50% glycerol (for details on the solutions and procedures\u003csup\u003e45\u003c/sup\u003e). Muscles were delivered to the laboratory of Florence for the mechanical experiments. On the day of the experiments, a small bundle of 2-5 fibres was dissected under a stereomicroscope (Stemi SV11; Zeiss Inc) with dark field illumination. Extremities of the bundle were clamped by aluminum clips for attachment to transducer hooks.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMechanical protocol\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe fibre bundle was mounted in a drop of relaxing solution between the lever arms of a loudspeaker motor\u003csup\u003e46\u003c/sup\u003e and a capacitance force transducer\u003csup\u003e47\u003c/sup\u003e. The extremities of the fibre were fixed first with a rigor solution containing glutaraldehyde (5% v/v) and then glued to the clips with shellac dissolved in ethanol (8.3% w/v,\u003csup\u003e48,49\u003c/sup\u003e). This procedure prevents the sliding of the ends of the bundle inside the clips and minimizes the shortening of the activated sample against the damaged sarcomeres at the ends of the segment during force development.\u003c/p\u003e\n\u003cp\u003eThe drop of solution where the bundle is mounted is one of the series of drops of a system that allows for rapid solution exchange\u003csup\u003e45\u003c/sup\u003e. Using a 40x dry objective and a 25x eyepiece (Zeiss Inc) the average sarcomere length (SL), the width (w) and the height (h) of the bundle were measured at 2-3 points along the bundle after setting the SL at 2.3-2.5\u0026nbsp;mm. The cross-sectional area (CSA) was calculated assuming elliptical geometry as\u0026nbsp;p/4*w*h. CSA was 4100\u0026nbsp;\u0026plusmn;\u0026nbsp;1200 (mean\u0026nbsp;\u0026plusmn; SEM, three bundles)\u0026nbsp;in WT EDL bundles and 3900\u0026nbsp;\u0026plusmn;\u0026nbsp;1600 in HMERF EDL bundles (three bundles); 1950\u0026nbsp;\u0026plusmn;\u0026nbsp;380 (mean\u0026nbsp;\u0026plusmn; SEM, three bundles)\u0026nbsp;in WT soleus bundles and 1420\u0026nbsp;\u0026plusmn;\u0026nbsp;220 in HMERF soleus bundles (three bundles) and 8580\u0026nbsp;\u0026plusmn;\u0026nbsp;1630 (mean\u0026nbsp;\u0026plusmn; SEM, three bundles)\u0026nbsp;in WT diaphragm bundles and 15300\u0026nbsp;\u0026plusmn;\u0026nbsp;3000 in HMERF diaphragm bundles (three bundles). Fibres were activated by temperature jump using a solution exchange system\u003csup\u003e45\u003c/sup\u003e. Starting from the relaxing solution at low temperature (2\u0026deg;C), the bundle was transferred to pre-activating solution at the same low temperature and, after 3 minutes, to activating solution at low temperature, where the isometric force is 0.1-0.2 the isometric force developed at the test temperature (25.1\u0026nbsp;\u0026plusmn; 0.1\u0026deg;C). The bundle was then transferred to the activating solution at the test temperature for 4-10 seconds to have a steady isometric force, and subsequentially transferred to relaxing solution at the same temperature. This protocol prevents the development of most of the force during Ca\u003csup\u003e2+\u003c/sup\u003e diffusion, minimizing the development of sarcomere non uniformities because of the diffusion-limited time of activation across the bundle. Details on the composition of the solutions have been previously reported\u003csup\u003e45\u003c/sup\u003e.\u0026nbsp;4% dextran T-500 (Thermo Fisher Scientific) was added to all solutions to restore the lattice spacing before skinning\u003csup\u003e45,50\u0026ndash;52\u003c/sup\u003e. The unloaded shortening velocity was measured by the slack test method\u003csup\u003e29\u003c/sup\u003e as shown in Figure 6.\u003c/p\u003e\n\u003cp\u003eForce and motor position were recorded with a multifunction I/O board (PXIe-6358, National Instruments). A program written in LabVIEW (National Instrument) was used for signal generation and data acquisition. All data were analysed using dedicated programs written in LabVIEW (National Instruments) and Microsoft Excel and Origin 2018 (OriginLab Corp., Northampton, MA, USA) software.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cspan\u003eThis study falls under the ethical approval HUS/16896/2022 by the ethics committee of the Hospital District of Helsinki and Uusimaa (HUS). The patient provided written informed consent to the referring clinician. The study, approved by the ethics committee of the Helsinki University Hospital, was performed in accordance with the Declaration of Helsinki.\u003c/span\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study falls under the ethical approval HUS/16896/2022 by the ethics committee of the Hospital District of Helsinki and Uusimaa (HUS). All animal studies were conducted in strict accordance with the institutional guidelines for animal research (approval 1229-20ANIM).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u0026nbsp;\u003c/strong\u003eNot applicable\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u0026nbsp;\u003c/strong\u003eNo conflict of interest to declare\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u0026nbsp;\u003c/strong\u003eAll data generated in this study are available in the manuscript or from the authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by the European Commission under the HORIZON EUROPE Framework Program (grant approval #101080874 to MS), the Research Council of Finland (#351510 to BU, #339437 to MS), Samfundet Folkh\u0026auml;lsan (to MS and BU), the Sigrid Jus\u0026eacute;lius Foundation (#230217 to MS and BU), European Joint Program on Rare Diseases (\u0026lsquo;Improved diagnostic output in large sarcomeric genes IDOLS-G\u0026rsquo; EJPRD19-126 \u0026nbsp;to BU and ML), AFM-T\u0026eacute;l\u0026eacute;thon (#25116 BU and ML), Recovery plan for Europe (Next Generation EU program) (DM 1557 11.10.2022, Investment PE8\u0026ndash;Project Age-It, to ML), and Italian Ministry of University and Research (MUR, PRIN2022-PNRR, P2022XPT32, CUP: B53D23033280001 to ML). AH acknowledges the support by the \u0026ldquo;Ministerium f\u0026uuml;r Kultur und Wissenschaft des Landes Nordrhein-Westfalen\u0026rdquo; and \u0026ldquo;Der Regierende B\u0026uuml;rgermeister von Berlin, Senatskanzlei Wissenschaft und Forschung\u0026rdquo; and the Bundesministerium f\u0026uuml;r Forschung, Technologie und Raumfahrt (BMFTR). AR acknowledges the financial support of the \u0026bdquo;Deutsche Gesellschaft f\u0026uuml;r Muskelkranke\u0026ldquo; (DGM) e.V.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: SV, MS, JS, BU, DD. Experimental data preparation and analysis: SV, NM, MM, SNG, AD, AH, VU, SBD, EHK, MC, AV, AR, ML, MS. Manuscript writing and editing: SV, NM, MM, SNG, AR, ML, MS. Manuscript final review and editing: all authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Jaakko Sarparanta for his careful reading of the manuscript and his constructive remarks.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBang ML, Centner T, Fornoff F, et al. The complete gene sequence of titin, expression of an unusual approximately 700-kDa titin isoform, and its interaction with obscurin identify a novel Z-line to I-band linking system. \u003cem\u003eCirc Res\u003c/em\u003e. 2001;89(11):1065-1072. doi:10.1161/hh2301.100981\u003c/li\u003e\n\u003cli\u003eGranzier H, Labeit S. Discovery of Titin and Its Role in Heart Function and Disease. \u003cem\u003eCirc Res\u003c/em\u003e. 2025;136(1):135-157. doi:10.1161/CIRCRESAHA.124.323051.\u003c/li\u003e\n\u003cli\u003eHerman DS, Lam L, Taylor MR, et al. Truncations of titin causing dilated cardiomyopathy. \u003cem\u003eN Engl J Med\u003c/em\u003e. Published online February 16, 2012. doi:10.1056/NEJMoa1110186.\u003c/li\u003e\n\u003cli\u003eSavarese M, Vihola A, Oates EC. Genotype-phenotype correlations in recessive titinopathies. \u003cem\u003eGenet Med\u003c/em\u003e. 2020;22(12):2029-2040. doi:10.1038/S41436-020-0914-2\u003c/li\u003e\n\u003cli\u003eMF F, A O, E N, et al. Inferring disease course from differential exon usage in the wide titinopathy spectrum. \u003cem\u003eAnn Clin Transl Neurol\u003c/em\u003e. 2024;Oct;11(10):2745-2755. doi:10.1002/acn3.52189.\u003c/li\u003e\n\u003cli\u003eSavarese M, Sarparanta J, Vihola A, Udd B, Hackman P. Increasing role of titin mutations in neuromuscular disorders. \u003cem\u003eJ Neuromuscul Dis\u003c/em\u003e. 2016;3(3):293-308. doi:10.3233/JND-160158\u003c/li\u003e\n\u003cli\u003eMF F, V L, M J. The crucial role of titin in fetal development: recurrent miscarriages and bone, heart and muscle anomalies characterise the severe end of titinopathies spectrum. \u003cem\u003eJ Med Genet\u003c/em\u003e. 2023;60(9):866-873. doi:10.1136/jmg-2022-109018\u003c/li\u003e\n\u003cli\u003eHedberg C, Toledo AG, Gustafsson CM, Larson G, Oldfors A, Macao B. Hereditary myopathy with early respiratory failure is associated with misfolding of the titin fibronectin III 119 subdomain. \u003cem\u003eNeuromuscul Disord\u003c/em\u003e. 2014;24(5):373-379. doi:10.1016/j.nmd.2014.02.003\u003c/li\u003e\n\u003cli\u003ePalmio J, Evila A, Chapon F, et al. Hereditary myopathy with early respiratory failure: occurrence in various populations. \u003cem\u003eJ Neurol Neurosurg Psychiatry\u003c/em\u003e. 2014;85(3):345-353. doi:10.1136/jnnp-2013-304965\u003c/li\u003e\n\u003cli\u003ePalmio J, Leonard-Louis S, Sacconi S, et al. Expanding the importance of HMERF titinopathy: new mutations and clinical aspects. \u003cem\u003eJ Neurol\u003c/em\u003e. Published online March 3, 2019. doi:10.1007/s00415-019-09187-2.\u003c/li\u003e\n\u003cli\u003eMarcello M, Cetrangolo V, Savarese M, Udd B. Use of animal models to understand titin physiology and pathology. \u003cem\u003eJ Cell Mol Med\u003c/em\u003e. 2022;26(20):5103-5112. doi:10.1111/jcmm.17533\u003c/li\u003e\n\u003cli\u003ePfeffer G, Barresi R, Wilson IJ, et al. Titin founder mutation is a common cause of myofibrillar myopathy with early respiratory failure. \u003cem\u003eJ Neurol Neurosurg Psychiatry\u003c/em\u003e. 2014;85(3):331-338. doi:10.1136/jnnp-2012-304728\u003c/li\u003e\n\u003cli\u003ePark I, Han C, Jin S, et al. Myosin regulatory light chains are required to maintain the stability of myosin II and cellular integrity. \u003cem\u003eBiochem J\u003c/em\u003e. Published online February 15, 2011.\u003c/li\u003e\n\u003cli\u003eYao Y, Yan C, Huang H, et al. LncRNA-MEG3 Regulates Muscle Mass and Metabolic Homeostasis by Facilitating SUZ12 Liquid-Liquid Phase Separation. \u003cem\u003eAdv Sci Weinh Baden-Wurtt Ger\u003c/em\u003e. 2025;12(23):e2417715. doi:10.1002/advs.202417715\u003c/li\u003e\n\u003cli\u003eYao Y, Wang Z, Chen Y, et al. Single-cell analysis reveals the lncRNA-MEG3/miRNA-133a-3p/PRRT2 axis regulates skeletal muscle regeneration and myogenesis. \u003cem\u003eGenes Dis\u003c/em\u003e. Published online May 5, 2022.\u003c/li\u003e\n\u003cli\u003eYu X, Wang Z, Sun H, Yang Y, Li K, Tang Z. Long non-coding MEG3 is a marker for skeletal muscle development and meat production traits in pigs. \u003cem\u003eAnim Genet\u003c/em\u003e. Published online December 6, 2018.\u003c/li\u003e\n\u003cli\u003eStiber J, Hawkins A, Zhang ZS, et al. STIM1 signalling controls store-operated calcium entry required for development and contractile function in skeletal muscle. \u003cem\u003eNat Cell Biol\u003c/em\u003e. Published online June 10, 2008. doi:10.1038/ncb1731\u003c/li\u003e\n\u003cli\u003eGoonasekera SA, Davis J, Kwong JQ, et al. Enhanced Ca2+ influx from STIM1-Orai1 induces muscle pathology in mouse models of muscular dystrophy. \u003cem\u003eHum Mol Genet\u003c/em\u003e. Published online July 15, 2014. doi:10.1093/hmg/ddu079\u003c/li\u003e\n\u003cli\u003eChen TC, Kuo T, Dandan M, et al. The role of striated muscle Pik3r1 in glucose and protein metabolism following chronic glucocorticoid exposure. \u003cem\u003eJ Biol Chem\u003c/em\u003e. Published online January 2021. doi:10.1016/j.jbc.2021.100395\u003c/li\u003e\n\u003cli\u003eMammen AL, Mahoney JA, Germain A, et al. A novel conserved isoform of the ubiquitin ligase UFD2a/UBE4B is expressed exclusively in mature striated muscle cells. \u003cem\u003ePLoS One\u003c/em\u003e. Published online 2011. doi:10.1371/journal.pone.0028861\u003c/li\u003e\n\u003cli\u003eLi H, Randall WR, Du SJ. skNAC (skeletal Naca), a muscle‐specific isoform of Naca (nascent polypeptide‐associated complex alpha), is required for myofibril organization. \u003cem\u003eFASEB J\u003c/em\u003e. 2009;23(6):1988-2000. doi:10.1096/fj.08-125542\u003c/li\u003e\n\u003cli\u003eGuo W, Schafer S, Greaser M. RBM20, a gene for hereditary cardiomyopathy, regulates titin splicing. \u003cem\u003eNat Med\u003c/em\u003e. 2012;18:766-773. doi:10.1038/nm.2693\u003c/li\u003e\n\u003cli\u003eBuck D, Smith JE, Chung CS, et al. Removal of immunoglobulin-like domains from titin\u0026rsquo;s spring segment alters titin splicing in mouse skeletal muscle and causes myopathy. \u003cem\u003eJ Gen Physiol\u003c/em\u003e. 2014;143(2):215-230. doi:10.1085/jgp.201311129\u003c/li\u003e\n\u003cli\u003eHendil KB, Khan S, Tanaka K. Simultaneous binding of PA28 and PA700 activators to 20 S proteasomes. \u003cem\u003eBiochem J\u003c/em\u003e. 1998;15;332 ( Pt 3)(Pt 3):749-54. doi:10.1042/bj3320749\u003c/li\u003e\n\u003cli\u003eKopp F, Dahlmann B, Kuehn L. Reconstitution of hybrid proteasomes from purified PA700-20 S complexes and PA28alphabeta activator: ultrastructure and peptidase activities. \u003cem\u003eJ Mol Biol\u003c/em\u003e. Published online October 26, 2001.\u003c/li\u003e\n\u003cli\u003eTanaka K. The proteasome: overview of structure and functions. \u003cem\u003eProc Jpn Acad Ser B Phys Biol Sci\u003c/em\u003e. 2009;85(1):12-36. doi:10.2183/pjab.85.12\u003c/li\u003e\n\u003cli\u003eLee BH, Lee M, Park S. Enhancement of proteasome activity by a small-molecule inhibitor of USP14. \u003cem\u003eNature\u003c/em\u003e. 2010;467:179-184. doi:10.1038/nature09299\u003c/li\u003e\n\u003cli\u003eGarg A, O\u0026rsquo;Rourke J, Long C, et al. KLHL40 deficiency destabilizes thin filament proteins and promotes nemaline myopathy. \u003cem\u003eJ Clin Invest\u003c/em\u003e. 2014;Aug;124(8):3529-39. doi:10.1172/JCI74994.\u003c/li\u003e\n\u003cli\u003eEdman KA. The velocity of unloaded shortening and its relation to sarcomere length and isometric force in vertebrate muscle fibres. \u003cem\u003eJ Physiol\u003c/em\u003e. 1979;291(1):143-159. doi:10.1113/jphysiol.1979.sp012804\u003c/li\u003e\n\u003cli\u003eHeemskerk H, de Winter C, van Kuik P, et al. Preclinical PK and PD Studies on 2\u0026prime;-O-Methyl-phosphorothioate RNA Antisense Oligonucleotides in the mdx Mouse Model. \u003cem\u003eMol Ther\u003c/em\u003e. 2010;18(6):1210-1217. doi:https://doi.org/10.1038/mt.2010.72\u003c/li\u003e\n\u003cli\u003eBremmer-Bout M, Aartsma-Rus A, de Meijer EJ, et al. Targeted Exon Skipping in Transgenic hDMD Mice: A Model for Direct Preclinical Screening of Human-Specific Antisense Oligonucleotides. \u003cem\u003eMol Ther\u003c/em\u003e. 2004;10(2):232-240. doi:https://doi.org/10.1016/j.ymthe.2004.05.031\u003c/li\u003e\n\u003cli\u003eHsu PD, Scott DA, Weinstein JA, et al. DNA targeting specificity of RNA-guided Cas9 nucleases. \u003cem\u003eNat Biotechnol\u003c/em\u003e. 2013;31(9):827-832. doi:10.1038/nbt.2647\u003c/li\u003e\n\u003cli\u003eDoench JG, Fusi N, Sullender M, et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. \u003cem\u003eNat Biotechnol\u003c/em\u003e. 2016;34(2):184-191. doi:10.1038/nbt.3437\u003c/li\u003e\n\u003cli\u003eConcordet JP, Haeussler M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. \u003cem\u003eNucleic Acids Res\u003c/em\u003e. 2018;46(W1):W242-W245. doi:10.1093/nar/gky354\u003c/li\u003e\n\u003cli\u003eGertsenstein M, Nutter LMJ. Production of knockout mouse lines with Cas9. \u003cem\u003eMethods San Diego Calif\u003c/em\u003e. 2021;191:32-43. doi:10.1016/j.ymeth.2021.01.005\u003c/li\u003e\n\u003cli\u003eDobin A, Davis CA, Schlesinger F, et al. STAR: ultrafast universal RNA-seq aligner. \u003cem\u003eBioinformatics\u003c/em\u003e. Published online January 1, 2013. doi:10.1093/bioinformatics/bts635\u003c/li\u003e\n\u003cli\u003eAnders S, Pyl PT, Huber W. HTSeq\u0026ndash;a Python framework to work with high-throughput sequencing data. \u003cem\u003eBioinformatics\u003c/em\u003e. Published online January 15, 2015. doi:10.1093/bioinformatics/btu638\u003c/li\u003e\n\u003cli\u003eLove MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. \u003cem\u003eGenome Biol\u003c/em\u003e. 2014;15:550. doi:10.1186/s13059-014-0550-8\u003c/li\u003e\n\u003cli\u003eGreen CJ, Gazzara MR, Barash Y. MAJIQ-SPEL: web-tool to interrogate classical and complex splicing variations from RNA-Seq data. \u003cem\u003eBioinformatics\u003c/em\u003e. Published online January 15, 2018. doi:10.1093/bioinformatics/btx565\u003c/li\u003e\n\u003cli\u003eReimand J, Kull M, Peterson H, Hansen J. Jaak Vilo: g:Profiler \u0026mdash; a web-based toolset for functional profiling of gene lists from large-scale experiments. Published online 2007. doi:10.1093/nar/gkm226\u003c/li\u003e\n\u003cli\u003eKolberg L, Raudvere U, Kuzmin I, Adler P, Vilo J. Hedi Peterson: g:Profiler\u0026mdash;interoperable web service for functional enrichment analysis and gene identifier mapping (2023 update. \u003cem\u003eNucleic Acids Res\u003c/em\u003e. Published online May 2023. doi:10.1093/nar/gkad347\u003c/li\u003e\n\u003cli\u003eSupek F, Bo\u0026scaron;njak M, \u0026Scaron;kunca N, \u0026Scaron;muc T. REVIGO Summarizes and Visualizes Long Lists of Gene Ontology Terms. \u003cem\u003ePLoS ONE\u003c/em\u003e. 2011;6(7):21800. doi:10.1371/journal.pone.0021800\u003c/li\u003e\n\u003cli\u003eBurkhart JM, Schumbrutzki C, Wortelkamp S, Sickmann A, Zahedi RP. Systematic and quantitative comparison of digest efficiency and specificity reveals the impact of trypsin quality on MS-based proteomics. \u003cem\u003eJ Proteomics\u003c/em\u003e. 2012;75(4):1454-1462. doi:10.1016/j.jprot.2011.11.016\u003c/li\u003e\n\u003cli\u003eRitchie ME, Phipson B, Wu D, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. \u003cem\u003eNucleic Acids Res\u003c/em\u003e. 2015;20;43(7):e47. doi:10.1093/nar/gkv007\u003c/li\u003e\n\u003cli\u003eLinari M, Caremani M, Piperio C, Brandt P, Lombardi V. Stiffness and Fraction of Myosin Motors Responsible for Active Force in Permeabilized Muscle Fibers from Rabbit Psoas. \u003cem\u003eBiophys J\u003c/em\u003e. 2007;92(ue 7):2476-2490,. doi:10.1529/biophysj.106.099549.\u003c/li\u003e\n\u003cli\u003eLombardi V, Piazzesi G. The contractile response during steady lengthening of stimulated frog muscle fibres. \u003cem\u003eJ Physiol\u003c/em\u003e. 1990;431(1):141-171. doi:10.1113/jphysiol.1990.sp018324\u003c/li\u003e\n\u003cli\u003eHuxley AF, Lombardi V. A sensitive force transducer with resonant-frequency 50 kHz. \u003cem\u003e40 WEST 20TH\u003c/em\u003e. 1980;305(AUG).\u003c/li\u003e\n\u003cli\u003eLinari M, Dobbie I, Reconditi M, et al. The Stiffness of Skeletal Muscle in Isometric Contraction and Rigor: The Fraction of Myosin Heads Bound to Actin. \u003cem\u003eBiophys J\u003c/em\u003e. 1998;74(5):2459-2473. doi:10.1016/S0006-3495(98)77954-8\u003c/li\u003e\n\u003cli\u003eBershitsky SY, Tsaturyan AK. Force generation and work production by covalently cross-linked actin-myosin cross-bridges in rabbit muscle fibers. \u003cem\u003eBiophys J\u003c/em\u003e. 1995;69(3):1011-1021. doi:https://doi.org/10.1016/S0006-3495(95)79976-3\u003c/li\u003e\n\u003cli\u003ePercario V, Boncompagni S, Protasi F, Pertici I, Pinzauti F, Caremani M. Mechanical parameters of the molecular motor myosin II determined in permeabilised fibres from slow and fast skeletal muscles of the rabbit. \u003cem\u003eJ Physiol\u003c/em\u003e. 2018;596(7):1243-1257. doi:10.1113/JP275404\u003c/li\u003e\n\u003cli\u003eBrenner B, Yu LC. Characterization of radial force and radial stiffness in Ca (2+)‐activated skinned fibres of the rabbit psoas muscle. \u003cem\u003eJ Physiol\u003c/em\u003e. 1991;441(1):703-718.\u003c/li\u003e\n\u003cli\u003eKawai M, Wray JS, Zhao Y. The effect of lattice spacing change on cross-bridge kinetics in chemically skinned rabbit psoas muscle fibers. I. Proportionality between the lattice spacing and the fiber width. \u003cem\u003eBiophys J\u003c/em\u003e. 1993;64(1):187-196. doi:https://doi.org/10.1016/S0006-3495(93)81356-0\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"acta-neuropathologica-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"anec","sideBox":"Learn more about [Acta Neuropathologica Communications](https://actaneurocomms.biomedcentral.com/)","snPcode":"40478","submissionUrl":"https://submission.springernature.com/new-submission/40478/3","title":"Acta Neuropathologica Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8910535/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8910535/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHereditary Myopathy with Early Respiratory Failure (HMERF) is a progressive titinopathy caused by dominant missense mutations in the A-band region of \u003cem\u003eTTN\u003c/em\u003e, a domain essential for sarcomere stability. Patients suffering with HMERF manifest muscle weakness, early respiratory involvement, and reduced life expectancy, yet no effective therapies currently exist. A major barrier has been the lack of an animal model that replicated HMERF pathology. In this study, we established the first CRISPR-Cas9 engineered mouse model of HMERF, carrying a patient-derived missense mutation in \u003cem\u003eTtn\u003c/em\u003e. Homozygous mutant mice exhibited a severe and uniform phenotype, including kyphosis, thoracic deformities, abnormal gait, diaphragm weakness, and premature death. Histological analysis revealed disrupted sarcomeres, abnormal myotilin accumulation, and necklace-like cytoplasmic bodies in diaphragm muscle, resembling human pathology. Multi-omics approach revealed consistent dysregulation of genes and proteins linked to muscle structure, cytoskeletal integrity, and cellular homeostasis, representing disease pathomechanisms. A major limitation of this study was the restricted availability of muscle tissue, which prevented broader analysis across multiple muscle types. Nevertheless, overlapping transcriptomic and proteomic dysregulation, including differential splicing, highlight key molecular effects driving disease progression. In conclusion, this mouse model provides mechanistic insight into HMERF and establishes a platform for evaluating therapeutic strategies. It represents an essential step toward developing targeted interventions for this rare and severe neuromuscular disorder.\u003c/p\u003e","manuscriptTitle":"Knock-in Mouse Model of Hereditary Myopathy with Early Respiratory Failure Carrying the Titin Variant Corresponding to Human p.N31786K","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-23 08:30:59","doi":"10.21203/rs.3.rs-8910535/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"acta-neuropathologica-communications","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"anec","sideBox":"Learn more about [Acta Neuropathologica Communications](https://actaneurocomms.biomedcentral.com/)","snPcode":"40478","submissionUrl":"https://submission.springernature.com/new-submission/40478/3","title":"Acta Neuropathologica Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6d47118b-0a23-49e3-a38f-560e0221917e","owner":[],"postedDate":"February 23rd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-04-02T13:09:46+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-23 08:30:59","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8910535","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8910535","identity":"rs-8910535","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.