Impact of Temperature Upon Expression Levels of Thrr, Gnrhr, and Fshr Leading to Gonadal Maturation of G5 Transgenicmutiara Strain Female Catfish (Clarias Gariepinus)

Impact of Temperature Upon Expression Levels of Thrr, Gnrhr, and Fshr Leading to Gonadal Maturation of G5 Transgenicmutiara Strain Female Catfish (Clarias Gariepinus) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Impact of Temperature Upon Expression Levels of Thrr, Gnrhr, and Fshr Leading to Gonadal Maturation of G5 Transgenicmutiara Strain Female Catfish (Clarias Gariepinus) Roffi Grandiosa, Ibnu Dwi Buwono, Yuniar Mulyani, Fittrie Meyllianawaty Pratiwy This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4580855/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract This study aims to determine the impact of temperature upon the relative expression ratio of thyroid hormone receptor ( THRr ), gonadotrophin-releasing hormone receptor ( GnRHr ), follicle stimulating hormone receptor ( FSHr ) and ꞵ-actin genes as internal control expression in transgenic G5 mutiara female catfish and non-transgenic catfish using real-time PCR. In addition, the expression of growth hormone ( GH ) and estradiol ( E2 ) levels which both induced gonadal growth was further observed. The temperature treatment (A: 22°C; B: 26°C; C: 30°C for transgenic fish; and A*: 22°C; B*: 26°C; C*: 30°C for non-transgenic fish) were designed with 6 replicates ( n = 6) during a 60-day rearing period. A warm temperature (26°C) was the optimum temperature that induced THRr , GnRHr , FSHr gene expressions (means, 3.40 ± 0.69, 4.23 ± 0.62, 7.25 ± 0.43 respectively) and induced higher GH (means, 6.13 ± 0.78 ng/ml) and E2 (means 5.78 ± 1.05 ng/ml) levels leading to an increase in transgenic ovary weight (means, 59.90 ± 2.20 g) in transgenic fish higher than non-transgenic. Meanwhile, low temperature (22°C) and high temperature (30°C) caused a decrease in the expression levels of THRr , GnRHr , FSHr for transgenic fish and for non-transgenic fish. The presence of CgGH in G5 transgenic catfish was able to maintain adequate GH levels and has the potential to stimulate the growth of female gonads at high temperatures (30°C). Temperature THRr-GnRHr-FSHr G5 transgenic mutiara catfish Oocyte growth GH-E2 Transgenesis-GH Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Introduction GH -transgenesis in fish is a common understanding to promote faster growth than non-transgenic fish. Previous literature stated that the growth of transgenic coho salmon (containing sockeye salmon growth hormone gene inserts) was 10 times greater than that of non-transgenic fish (Mori & Devlin 1999 ; Nam et al. 200). Similar results were found in the growth of G1-G4 transgenic mutiara catfish (containing the African catfish growth hormone gene, Clarias gariepinus growth hormone, CgGH ) by 2–3 times compared to non-transgenic fish (Buwono et al. 2019a ; Buwono et al. 2021 ; Buwono et al. 2023 ). Response to changes in environmental temperature in fish were frequently studied however increasing interest lies in the response of pineal gland cells which both are responsible for reproduction (Singh et al. 2017 ). Changes in temperature were expected to affect the rhythm secretion of melatonin, growth hormone ( GH ) and its receptors, as well as IGF-1 and its receptors. A decrease in temperature was known to inhibit melatonin secretion and suppress the expression of GH and its receptors, thereby reducing GH levels in the fish's body (Sua-Cespedes et al. 2021 ). Thus, melatonin which is a neurotransmitter, acts in response to fluctuations in temperature whose secretion is regulated through the sensitivity of thermal receptor cells in the pineal gland of fish. This neurotransmitter is connected to the endocrine system, namely thyroid hormone secreting cells (including the thyroid hormone receptor, THRr which is found in the pineal gland) which contributes upon the fish reproductive system (Bhat et al. 2015; Chen et al. 2014 ; Crisanti et al. 2001 ; Politis et al. 2017). Furthermore, pineal thyroid hormone affects hypothalamic gonadotrophin releasing hormone ( GnRH ) secreting cells which is involved in the fish reproductive cycle (Levavi-Sivan & Avitan 2005; Saha et al. 2018). It was known that variations in environmental temperature were more dominant in influencing the development of the ovaries of yellow perch ( Perca flavescens ) than photoperiod, while for Eurasian perch ( Perca fluvialis ) a combination of temperature and photoperiod was needed to control the fish's reproductive cycle (Migaud et al. 2006 ). GnRH interactions in hypothalamic neurosecretory cells can modulate the actions of FSH and LH , as well as inducing FSHr receptor expression (Liu & Lin 2017 ; Ma et al. 2020 ). The results of an in vitro study on ovarian follicles from coho salmon show that FSHr and IGF-1 acts as mediators of the action of growth hormone on the growth of fish oocytes which are able to stimulate reproductive function at optimum temperatures. This indication shows that temperature has an effect on improving the activation of genes involved in the reproduction of salmonid fish groups (Anderson et al. 2019 ). The main regulator that regulates the secretion of FSH and LH hormones is a specific receptor ( FSHr or LHr ) in the gonad which is connected to GnRH (regulated by GnRHr ) to induce the release of FSH or LH which influences gonadal cell activity for the production of steroid hormones that stimulate oocyte maturation (Jia & Lei, 2019 ; Ma et al. 2020 ). Fish gonad development and gamete maturation are not only regulated by genes involved in fish reproduction in the hypothalamic-pituitary-gonad pathway, but the expression levels of genes related to this reproduction ( THRr , GnRHr , FSHr ) were further influenced by environmental temperature (Bock et al. 2021 ; Yu et al. 2022 ). The negative effects of high temperatures may potentially damage the reproductive cycle of fish, where high temperatures (37°C) have a negative effect on the gonad growth of female and male sheep shead minnow ( Cyprinodon variegatus ) in the form of lower GSI values ​​compared to fish reared at 27°C (Bock et al. 2021 ). Gonadotrophin-releasing hormone ( GnRH ) gene expression remained high in the hypothalamus of female and male fish, but the expression levels of FSHr and LHr genes in the gonad tissue of both sexes were relatively low at 37°C. This indication was noted in previous studies where a decrease in the expression level of the estrogen receptor gene ( ESR1 ) occurred in the liver of female fish (Bock et al. 2021 ; Hermelink et al. 2013). Spawning of G1-G4 broodstock was successful for the production of transgenic catfish offspring (Buwono et al. 2019b : Buwono et al. 2021 ; Buwono et al. 2023 ). However, the gonad growth of transgenic G5 mutiara catfish (containing the CgGH gene insert) and the expression levels of the THRr , GnRHr , FSHr genes when exposed to temperature variation are not well known. Expression levels of the THRr , GnRHr , FSHr is needed to induce the secretion of GH and E2 hormones leading to sustainable gonad maturation. Therefore, this research contributes on the knowledge of optimum temperature that induces gonad growth and development of mature oocytes in G5 transgenic mutiara catfish. Result comparison with non-transgenic fish may further contribute to an effort to manipulate environmental temperature to induce gonad maturation which leads to effective broodstock spawning for the production of transgenic fish line offspring. Schematically in Fig. 1 below, the influence of environmental temperature stimulation is presented including its effect upon the activity of genes involved in the reproduction of G5 transgenic mutiara catfish hence inducing the gonad maturation of the broodfish. Materials and methods Maintenance of transgenic G4 mutiara catfish broodstock for the production of G5 fish G5 transgenic mutiara catfish was produced from spawning female transgenic G4 mutiara catfish (weight 1095 g, total length 53 cm) and male transgenic G4 mutiara catfish (weight 1250 g; total length 57 cm) (Fig. 2 ). The rearing of G4 transgenic mutiara catfish to become broodstock is part of previous research (Buwono et al. 2023 ). The rearing of G4 transgenic mutiara catfish broodstock was carried out in fiberglass tanks (1.35 m diameter and 1.05 m water depth). During rearing, broodfish were fed commercial feed Prima Feed 128 (protein content, 38%) with a content of 2% biomass weight, and fed twice a day. During broodstock rearing, total water changes are carried out twice a week at a constant temperature (27°C ± 1°C). Rearing of G5 fingerlings to broodstock candidate The rearing of transgenic and non-transgenic G5 mutiara catfish fry was carried out in separate fiber tanks after RT-PCR analysis on transgenic and non-transgenic fish aged one month. During fingerlings rearing, the water temperature was regulated in the range of 26°C ± 1°C using a water heater, setting a photoperiod of 12 h light: 12 h dark and implementing an aeration system to maintain dissolved oxygen levels. Broodstock candidate of G5 transgenic female mutiara catfish The G5 female mutiara catfish broodstock candidate were screened via PCR test to be verified as positive for transgenic (containing CgGH , 600 bp). RNA samples were taken from the tail fin and extracted with the Quick-RNA™ Miniprep Plus kit (Zymo Research Corp., Murphy Avenue Irvine, USA). CgGH amplification used primers GH-F and GH-R (Table 1 ) and the My Taq OneStep RT-PCR kit (Bioline, UK, London) to identify G5 transgenic female mutiara catfish. Primers CgßAct-Fw and CgßAct-Rv were used as internal controls. Table 1 Primers used for screening of G5 transgenic mutiara female catfish Primers Sequence (5' → 3') Amplicons (bp) References GH-F ATGGCTCGAGTTTTGGTGCTGCT 600 Zhang et al. ( 2009 ) GH-R CTACAGAGTGCAGTTGGAATCCAGGG CgβAct-Fw ACCGGAGTCCATCACAATACCAGT 200 Raghuveer & Senthilkumaran (2010) CgβAct-Rv GAGCTGCGTGTTGCCCCTGAC Temperature treatment for induction of growth and maturation of G5 transgenic mutiara catfish female broodstock candidate The broodstock (female and male parent pair) were reared in the cylinder tank consisting of 400 L water finely aerated water with a temperature of 22°C ± 0.5°C (treatment A and A*), 26°C ± 0.5°C (treatment B and B*), 30°C ± 0.5°C (treatment C and C*) (Fig. 3 ). The age of the female and male G5 transgenic mutiara catfish used was around eight months. During rearing, the water temperature stability was regulated using a water heater thermostat, photoperiods was set as 12 h light and 12 h dark, and an aeration system was applied to maintain dissolved oxygen levels. The protocols were conducted to observe sexually maturity induction in the broodfish gonad. The maturity stage was reached approximately two months later after temperature exposure treatment. A Hi-Pro-Vite 789 artificial feed (Central Proteina Prima Tbk, Sidoarjo, East Java, Indonesia) was used to feed the broodstock at 2% by weight of biomass twice a day. THRr, GnRHr , and FSHr expression analysis of G5 fish Expression of genes involved in the reproductive system of G5 transgenic mutiara catfish broodstock candidates was observed in brain, pituitary, and liver tissue samples taken. Expression levels of genes involved in the induction of hormone secretion in the pineal gland ( THRr gene), hypothalamus ( GnRHr gene), pituitary ( FSHr gene) axis were analyzed by real-time PCR ( rt-qPCR ). Brain, pituitary, and liver tissue samples of six G5 female fish were taken from each treatment in each replication. Total RNA was extracted using a Quick-RNA miniprep plus kit (ZymoResearch, UK), and RNA concentrations were measured using a NanoDrop 2000 spectrophotometer (Thermoscientific). cDNA synthesis was performed using ReverTra Ace qPCR RT Master Mix with gDNARemover (TOYOBO, Osaka, Japan), and it was used as a template in rt-qPCR . rt-qPCR was performed in an Agilent AriaMX Real-time PCR machine (Santa Clara, USA) using 2x SensiFAST SYBR® NO-ROX (Bioline, London, UK), with a final concentration of 100 ng µL − 1 cDNA; primers qTHRr-CgF and qTHRr-CgR, qGnRH-CgF and qGnRH-CgR, and qFSHr-CgF, and qFSHr-CgR were used. Primers CgβAct-Fw and CgβAct-Rv were used to amplify C. gariepinus β-actin gene as an internal control and to normalize expression levels (Chaube et al. 2020 ). qPCR primers for THRr , GnRHr , and FSHr genes were designed based on C. gariepinus mRNA sequences in GenBank using Primer3 ( http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi ) (Table 2 ). Table 2 Primers used for rt-qPCR (designed from GenBank) using Primer3 Primers Sequence (5’ → 3’) Amplicons (bp) References qTHRr-CgF qTHRr-CgR CTTCGAGCACTATGTCAACCAG CAGGTAGGAAATGGTCAGTCCTC 95 Genbank acc no. KY978231.1 qGnRHr-CgF qGnRHr-CgR ACTGCATGGATACTCAGCCTACTC GACGAGCAGAGGGAACACATAA 180 Genbank acc no. X97497.2 qFSHr-CgF CTGATTGCCACCTCAGTCTACTCT 190 Genbank acc no. AJ012647.2 qFSHr-CgR CCTCAAAGAAGTATGGCTCCTG CgβAct-Fw ACCGGAGTCCATCACAATACCAGT 200 Raghuveer & Senthilkumaran (2010) CgβAct-Rv GAGCTGCGTGTTGCCCCTGAC q CgGH -F GTC TGA TCG AGT CAT GGG AGTT 200 Designed from genebank acc no MN249238.1 using Primer3 q CgGH -R CTC AGG GTC TGG TAG AAA TCCTC CgβAct-Fw ACC GGA GTC CAT CAC AAT ACC AGT 200 Raghuveer and Senthilkumaran ( 2010 ) CgβAct-Rv GAG CTG CGT GTT GCC CCT GAC The reaction mixture composition and thermal profile were prepared by quantification using 3 µL of cDNA sample in a final reaction volume of 20 µL containing 10 µL 2X SensiFast SYBR Lo-ROX Mix, 400 nmol of each primer, and 5.4 µL ddH 2 O. The rt-qPCR program was set as follows: 120 s at 95°C, 40 amplification phase cycles (5 s at 95°C, 30 s at 56°C, and 20 s at 72°C), and a melting program (30 s at 95°C, 30 s at 60°C, and 30 s at 95°C). Melting curve analysis was performed at the end of the amplification to evaluate the specificity of the reaction. THRr , GnRH and FSHr mRNA expression levels were analyzed using the 2 −ΔΔCT method (Buwono et al. 2023 ; Livak & Schmittgen 2000; Pfaffl 2001 ) after normalization with a β-actin gene. CgGH transmission in G5 transgenic mutiara catfish RNA was isolated from G5 caudal fin tissue following the instructions of the RNeasy Mini kit (Qiagen, Venio, Netherlands). The CgGH transgene transmission was observed from 270 catfish fingerlings, with each sample comprising fins from eight different fish collected 28 days after hatching (dah). Total RNA measurement used for cDNA synthesis followed the instructions of the ReverTra Ace qPCR RT Master Mix with gDNA Remover kit (TOYOBO, Osaka, Japan). The q CgGH -F and q CgGH -R, CgßAct-Fw and CgßAct-Rv primers (Table 2 ), and cDNA templates were utilized to count q CgGH transmission of G5 (amplicons about 200 bp) and ß-actin transgenic fish (amplicons around 200 bp) by PCR assay following My Taq™ HS-Red mix kit instructions (Bioline, London, UK). The PCR reaction mixture final volume was 50 µL containing 25 µL of 2 × My Taq™ HS-Red mix PCR, 2 µL of each primer (10 pmol), 2 µL of cDNA, and 19 µL of nuclease free water. The PCR program was set to: 2 min at 94°C, 35 cycles of amplification phase (15 s at 98°C, 30 s at 56°C, 1 min at 72°C). Electrophoresis was also performed using 2 µL of amplicon sample with a 1% TAE agarose gel. Measurement of G5 fish growth hormone and estradiol levels The serum GH , and estradiol ( E2 ) levels of G5 fish were measured using enzyme-linked immunosorbent assay in each post-temperature treatment. First, the fish were anesthetized with 2-phenoxyethanol, and about 1.5 mL of blood was taken from their caudal artery using a 2-mL heparinized syringe. The blood samples were centrifuged at 3000 rpm at 26°C (room temperature) for 20 min. Serum was stored at − 20°C. GH , and E2 levels were analyzed using a Fish Growth Hormone, and Estradiol ELISA kit (Bioassay Technology Laboratory, Shanghai, China), following the manufacturer's protocol. Female gonad weight of G5 fish The weight of female gonads (ovaries) was measured after 60 days of treatment to determine the effect of temperature on gonad growth. Fish gonads were removed by surgery (section) and the ovaries of each test fish were weighed using digital scales (accuracy 0.001 g). The values was also used to measure Gonadosomatic Index. The gonadosomatic index (GSI) was estimated by the equation: GSI = GoW/ GW*100 (Maddock & Burton, 1998 ), where GoW = gonad weight in grams (g), and GW = gutted weight in grams (g). Histology of G5 female gonads For histology, 5 µm-thick transverse sections of G5 fish ovaries were taken and immersed in Bouin's solution for 12 h. Dehydration, clearance, infiltration, planting, cutting, attachment, and hematoxylin-eosin staining was done, as described by Schulz et al. ( 2012 ) and Campbell et al. ( 2006 ). Statistical analysis One-way analysis of variance (ANOVA) with p ˂ 0.05 (SigmaPlot 12.3) was used to detect significant differences in degrees of spawning induction between G5 transgenic catfish and non-transgenic fish (analysis of THRr, GnRHr , FSHr gene expression and growth hormone, estradiol levels) followed by Duncan's multiple test. Results Verification of G4 transgenic mutiara catfish broodstock Based on RT-PCR results, it shows that the broodstock pair of G4 transgenic mutiara catfish (female and male) contains an exogenous GH insert ( CgGH , 600 bp) indicating that it is positive for transgenics, and can be used for the production of G5 fish (Fig. 4 ). Furthermore, CgGH transmission in 1 month old G5 fish using the RT-PCR test and GH-F and GH-R primers (Table 1 ) increased to 92% (240/260) compared to G4 (74%) (Buwono et al. 2023 ), indicating the stability of transgene inheritance for mass production of transgenic fish (Fig. 5 ). Based on the results of the RT-PCR examination (Fig. 5 ), 260 fish were confirmed as transgenic while 20 fish were non-transgenic. Furthermore, catfish fingerlings were transferred to fiberglass tank (water volume 2 m 3 ) until five months old (broodfish candidate) to examine the sex of the broodstock. For gonadal growth induction using thermal treatment, 18 transgenic females and 18 non-transgenic female fish were used until gonad maturation of G5 fish (Fig. 3 ). Validation of female broodstock candidate of G5 transgenic mutiara catfish Based on RT-PCR of caudal fin tissues of G5 female catfish reared for two months of indoor rearing, 18 female G5 fish carried transgene inserts ( CgGH positive, 600 bp). While 18 female non-transgenic fish did not carry CgGH inserts, thus it could be used for the experiment of temperature treatment to induce gonadal maturation (Fig. 6 ). THRr expression of G5 fish The results of real time PCR analysis (Fig. 7 B) showed that at 22°C and 30°C there was no significant difference between transgenic and non-transgenic fish, but at 26°C there was a significant difference. In addition, this result was confirmed from the electrophoregram in Fig. 7 A. GnRHr expression of G5 fish The GnRHr expression levels of G5 transgenic catfish (treatments A, B) differed significantly and were higher than those of non-transgenic fish (Fig. 8 A), however, in treatment C there was no significant difference between transgenic and non-transgenic fish (Fig. 8 B). FSHr expression in G5 fish The expression level of the FSHr gene in G5 transgenic catfish was higher than in non-transgenic fish at treatment temperatures of 22°C, 26°C and 30°C. The FSHr expression level of transgenic fish treated at 26°C was higher than other treatments, while there was no difference in expression levels at 22°C and 30°C in transgenic fish (Fig. 9 B) and this was confirmed from the electropherogram results in Fig. 9 A. Growth Hormone ( GH ) , and gonad weight of G5 female fish Amongst the G5 transgenic mutiara catfish, the increase in serum GH levels was higher in treatment B (temperature 26°C) compared to treatments A and C and compared to non-transgenic fish (Fig. 10 A). A warm temperatures induce an increase in GH levels in transgenic catfish which is higher than low temperatures (22°C) and high temperatures (30°C), and this equally occurs in non-transgenic fish, but the levels are lower than in transgenic fish. The results of measuring the weight of female gonads (ovaries) between G5 transgenic catfish showed that in the 26°C temperature treatment the weight of the ovaries and testes was higher than in the 22°C and 30°C temperature treatments and higher than in non-transgenic fish. The average ovarian weight of G5 transgenic catfish was significantly higher than that of non-transgenic fish (Fig. 10 B). Estradiol ( E2 ) and female gonad histology of G5 fish Serum E2 levels of G5 transgenic mutiara catfish were significantly higher than those of non-transgenic fish (Fig. 11 A). The warm temperature (treatment B, 26°C) induced higher E2 levels than the other treatments. Meanwhile, the growth and development of the ovaries of G5 transgenic mutiara catfish at a temperature of 26°C was faster than non-transgenic fish and other treatments (Fig. 11 B). Effect of temperature on CgGH expression levels and gonad growth of female G5 transgenic Pearl catfish Gonado Somatic Index (GSI) levels of G5 transgenic mutiara catfish were significantly higher than those of non-transgenic fish in the temperature of 26°C and 30°C while difference was not found between transgenic and non-transgenic in 22°C treatment (Fig. 12 A). The warm temperature (treatment B, 26°C) induced significantly higher CgGH relative expression levels than the other treatments (Fig. 12 B). Discussion Expression levels of THRr gene in G5 fish Changes in external environmental temperature was received upon entering pre-adulthood, thus the activation of the fish's sensor system in response to the temperature showed significant effect. Thermal receptors found in the pineal organ are an important system involved in the activation of fish reproductive pathways (Pankhurst 2016 ). Environmental temperature fluctuations influence the pineal thermal receptor gene (thyroid hormone receptor gene, THRr ) in response to environmental temperature modulation and the information is transmitted to the hypothalamic neuroendocrinal system. THRr expression can further influence the GnRH hormone associated with fish reproduction, including the GnRH receptor ( GnRHr ) (Bhat et al. 2015; Crisanti et al. 2001 ; Kazeto et al. 2005 ). Analysis of THRr gene expression in temperature treatments showed that 26°C had the highest expression effect compared to 22°C and 30°C among transgenic fish, but did not have a significant effect at both temperatures in both transgenic and non-transgenic fish (Figs. 7 A and 7 B). In this research, C. gariepinus treated at 25°C showed the highest level of core clock gene expression in the pineal organ compared to temperatures of 15°C and 35°C (Saha et al. 2018). The similarity in the expression levels of the THRr and core clock genes in the pineal indicates that the response of thermal receptor cells to temperature is in the range of 25–26°C for the catfish group. At high temperatures (30°C) and 35°C there was a decrease in the expression level of the THRr and core clock genes, while at relatively low temperatures (22°C and 15°C), the expression levels were lower than at 30°C and 35°C. Similar results were shown in the development of European eel ( Anguilla anguilla ) larvae which decreased when treated with a temperature of 22°C (Politis et al. 2017). This indication clearly shows that the expression level of the THRr gene is influenced by low temperature or high temperature, where high temperature tends to reduce the expression level, while low temperature causes a decrease in the expression level. The optimal temperature that provides an increase in high expression levels of the THRr gene for transgenic G5 mutiara catfish (average 3.40) and non-transgenic (average 2.30) is at 26°C. The higher expression level of the THRr gene in transgenic catfish compared to non-transgenic fish was thought to be related to GH overexpression in transgenic fish. Thyroid hormone collaborates with growth hormone in the growth and reproduction process of fish (Lema et al. 2022 ; Ojima & Iwata 2020), thus it can be explained that the level of THR gene expression (including THRr ) was found in the highest level when treated at a temperature of 26°C, whereas this condition did not occur in non-transgenic fish. Transgenic G5 catfish containing CgGH inserts is stably transmitted from its transgenic mutiara catfish broodstock while transgenic genes in fish were known to be repeated in a head-to-tail fashion proved in transgenic salmon (containing PRL-lacZ) (Uzbekova et al., 2003 ) and transgenic coho salmon ( Oncorhynchus kisutch ) (containing a salmon growth hormone OnMTGH1) (Uh et al., 2006 ). Expression levels of GnRHr gene in G5 fish Thyroid hormone receptors ( THRr ) are found in the ovarian and testicular tissue of channel catfish (Kazeto et al. 2005 ), indicating that THRr is indirectly involved in the fish reproductive pathway. THRr gene expression in the ovary increases to its highest peak when oocyte growth reaches the vitellogenic phase, this indication shows that THRr plays an important role in vitellogenesis and gonadal maturation. Thyroid hormones work together with other hormones along the hypothalamic-pituitary-gonad pathway which are involved in reproductive aspects, including the GnRHr hormone. So, TRHr is involved in the growth and development of the fish reproductive system (Habibi et al. 2012 ). Indirectly, THRr (pineal) gene expression can influence the level of GnRHr (hypothalamic) gene expression. The GnRHr expression level treated at 26°C (average 4.23) in G5 transgenic mutiara catfish was higher than in other treatments (Figs. 8 A and 8 B). The increase in GnRHr expression levels at 26°C is relatively similar to the THRr gene expression levels at that temperature. This indication shows that the increase in THRr expression is indirectly followed by an increase in GnRHr gene expression. This consistency suggests an influence of THRr on GnRHr expression. In contrast, temperatures of 22°C (average 2.69) and 30°C (average 2.76) tended to reduce the level of GnRHr gene expression, and there was no significant difference between transgenic and non-transgenic fish at 30°C. These results indicated that GH -transgenesis did not induce GnRHr expression levels at 30°C and showed similar effects in non-transgenic fish. The expression level of GnRHr at 22°C was lower than at 26°C in transgenic catfish, indicating that lower temperature decreased the expression level, whereas warm temperatures increased the expression level of GnRHr to a greater extent. Meanwhile, high temperature (30 °) had an effect on reducing GnRHr expression levels. Effect of high temperature (34°C) was known to reduce the expression level of the GnRH gene in Amargosa pupfish ( Cyprinodon nevadensis amargosae ), while a temperature of 24°C is the optimal temperature to stimulate ovarian growth (Lema et al. 2022 ). These results are relevant to the expression level of the GnRHr gene found in G5 transgenic mutiara catfish, that the optimum temperature that induces the highest level of GnRHr expression was 26°C. Expression levels of FSHr gene in G5 fish Temperature is one of the environmental factors involved in regulating fish reproduction, especially during the periods of gonad growth, vitellogenesis, spawning and egg hatching (Bromage et al. 2001 ; Levy et al. 2011 ). Oocyte growth is influenced by fluctuations in environmental temperature which can modulate the expression levels of genes involved in the secretion of gonadotrophin hormones which are important in stimulating oocyte development and growth. Two genes involved in regulating the secretion of fish gonadotropin hormones are follicle stimulating hormone ( FSH ) and luteinizing hormone (LH ) which are found in the pituitary (David & Degani 2011 ; Mateos et al. 2002 ; Yu et al. 2022 ). Pituitary secretion of FSH and LH hormones is regulated by the hypothalamic GnRH hormone, where the expression of the GnRH gene (also including the GnRHr gene) plays a role in regulating the expression of the FSH and LH genes for the production of these two gonadotrophin hormones. The FSH hormone receptor (FSHr ) is located in the gonad, thus this receptor is involved in the gonadal maturation process and can be used as a representation of increased FSH gene expression (Anderson et al. 2019 ). Induction of appropriate temperatures can stimulate increased expression of genes involved in steroidogenesis which leads to spawning of broodstock. During oocyte growth, the expression level of FSH genes (including FSHr ) is influenced by environmental temperature fluctuations. Results of FSHr gene expression analysis of G5 transgenic mutiara catfish at a temperature of 26°C was higher than other treatments and significantly different from non-transgenic fish (Figs. 9 A and 9 B). The expression level of the FSHr gene in transgenic catfish at 22°C (average 4.84) was higher than in non-transgenic fish, but lower than at 26°C (average 7.25) in transgenic fish. Likewise, at 30°C, the FSHr expression level was not much different from that at 22°C. This result is similar to research on juvenile hybrid sturgeon ( Acipenser baerii ♀× Acipenser schrenckii ♂), which the optimal temperature that induces high expression of the FSH gene occurs at 27°C, when compared to 21°C and 30°C (Chen et al. 2022 ). It was further stated that this optimum temperature is needed to regulate the development of fish gonads, especially FSH is needed to increase the size of the oocyte follicle during the development stage of the oogonia into primary oocytes. At 26°C treatment, the increase in FSHr gene expression is inseparable from the influence of hypothalamic GnRHr gene expression where the expression level of the pineal THRr gene equally increase, while at 30°C shows an effect of decreased expression. At the temperature of 22°C, expression levels of the THRr , GnRHr , FSHr genes were found lower compared to the temperature of 26°C treatment (Figs. 7 B, 8 B, 9 B). Optimum temperatures (around 26°C) are needed for gonad maturation and encourage the spawning process of many cyprinids and other warmwater fishes (Chen et al. 2022 ). Low temperatures (22°C) or high temperatures (30°C) do not have much influence on accelerating gonad maturation and stimulating spawning of brood fish. It is therefore understandable that the expression levels of genes involved in the pineal ( THRr )-hypothalamic ( GnRHr )-pituitary ( FSHr ) pathway were consistently at high levels when exposed to 26°C water temperature compared to 22°C and 30°C. GH levels and gonadal growth of G5 Serum GH levels of G5 transgenic mutiara catfish were significantly higher than non-transgenic fish at temperatures of 22°C, 26°C, 30°C and serum GH of transgenic catfish kept at 26°C was higher than other treatments (Fig. 7 A). The results of measuring GH levels show that temperature treatment (especially in 26°C) induced higher GH levels (average 6.13) than temperatures of 22°C and 30°C, both in transgenic and non-transgenic catfish. Pituitary GH secretion involves stimulation of hypothalamic GnRH , because GnRH is a factor that stimulates GH , LH or FSH secretion (Li et al. 2002 ). The level of GnRH expression can be represented by the GnRH gene receptor ( GnRHr ). High temperature induction (30°C) tends to reduce GH levels in transgenic and non-transgenic catfish, as does low temperature (22°C). The decrease in GH levels at high and low temperatures is closely related to the decrease in GnRHr expression levels, indicating that GH secretion levels are indirectly regulated by GnRHr expression levels. The increase in GnRHr expression levels at warm temperatures (26°C) was accompanied by increased secretion of GH levels in both transgenic and non-transgenic fish (Figs. 5 B and 7 A), indicating a close relationship between GnRHr expression and GH levels which is influenced by temperature. The consistency of GH levels in different temperature treatments was also followed by an increase in the ovarian weight of G5 fish, whereas the temperature of 26°C gave a higher increase in the ovarian weight of transgenic and non-transgenic catfish than temperatures of 22°C and 30°C (Fig. 7 B). The decrease in GH levels at temperatures of 22°C and 30°C affected the lower growth of ovarian weight in G5 fish. This was in line with previous studies where an optimum temperature (26°C) induced a higher increase in ovarian weight of tilapia ( Orechromis niloticus ) compared to low temperatures (16°C) (Gopal et al. 2014 ), showing similar results in G5 catfish where increased levels of GH in stimulated the gonad growth of G5 female catfish. Other research shows that a temperature of 27°C can significantly induce increased expression of genes involved in reproduction and growth in the brain and pituitary pathways of female and male blue gouramis fish ( Trichogaster tricopterus ) than temperatures of 23°C and 31°C. The expression level of the FSH gene in the pituitary significantly decreased at 31°C compared to 23°C and 27°C, and was implicated in reducing the GSI value of fish (David & Degani 2011 ). Overall, both GH levels and ovarian weight gain in G5 transgenic mutiara catfish were higher than non-transgenic fish, with an increase in GH levels of 2.92 times at a temperature of 26°C, 2.48 times at a temperature of 22°C and 1.83 times at a temperature of 30°C. The high levels of GH are thought to be closely related to the overexpression of GH in transgenic catfish at a temperature of 26°C, whereas at temperatures of 22°C and 30°C, it causes a decrease in GH levels which is followed by a decrease in ovary weight in both transgenic and non-transgenic fish. Estradiol levels gonadal development of G5 fish The increased FSHr gene expression pituitary leads to increased GH pituitary and E2 levels in the gonad, inducing the enzyme activity 17α-hydroxylase/C17,20-lyase and p450 aromatase a (cyp19a1a) for oocyte maturity, and ovarian weight; as a consequence, female gonad development increases in female coho salmon when treated with optimum temperature (28°C) (Anderson et al. 2019 ; Sua-Cespedes et al. 2021 ). Low temperature (23°C) reduces gene expression levels in the brain (including GnRHr ) which in turn causes a decrease in pituitary GH and E2 levels in the ovaries. E2 plays an important role in carrying out vitellogenesis processes, which involve yolk protein accumulation, causing oocyte growth, and ovary enlargement, as represented by ovaries weight (Levy et al. 2011 ; Melamed et al. 1998 ). So here, it is shown that temperature fluctuations affect the expression of genes involved in the hypothalamic-pituitary-gonadal pathway that induces GH and E2 levels that lead to oocyte maturation. In the warm temperature treatment on G5 transgenic mutiara catfish, the increase average weight of ovaries was associated with the stimulation of E2 levels under 26°C (Figs. 7 B and 8 A) which was higher than non-transgenic fish and other temperature treatments. This increase in GH and E2 levels leads to oocyte growth and as a consequence the development of female gonads leading to the ovarian ripening stage. Similar result was also found in the 27°C temperature treatment in the female blue gourami (Levy et al. 2011 ). The gonad development rate of female transgenic and non-transgenic G5 mutiara catfish was reduced when treated with temperatures of 22°C and 30°C (Fig. 8 B). However, ovary development in transgenic catfish was faster than non-transgenic catfish at a temperature of 30°C, indicating that transgenesis- GH could maintain oocyte growth in transgenic fish. GH can induce the IGF-1 gene in liver and gonads (stimulating E2 production), indicating that GH is involved in yolk protein synthesis during vitellogenesis and steroid production to initiate oocyte growth during gonadal maturation (Buwono et al. 2019b ; Gomez et al. 1999 ; Swanson et al. 2003 ; Wong et al. 2006 ). Rearing female fish broodstock requires an optimum temperature range to initiate the reproductive cycle and sustain oocyte growth and maturation (Uchida et al. 2003). This indicates that the oocyte development stage of G5 transgenic mutiara catfish can reach early-late vitellogenic stages when treated with temperatures of 22°C, 26°C and 30°C, whereas in non-transgenic fish slow down oocyte growth (Fig. 8 B), where at 22°C and 30°C, the oocyte development was in 'immature' status in G5 non-transgenic fish. Meanwhile, at a temperature of 30°C, ovarian development reaches the pre-vitellogenic stage. In treatment A (transgenic 22°C and C* (non-transgenic 30°C) an oogonium containing a nucleus was in the middle of an oocyte follicle, and some oogonium continued to develop to form cortical alveoli (Fig. 8 B), showing the growth from primary oocytes to secondary oocytes to pre-vitellogenic. This oocyte development is similar to the results of research on female blue gourami fish which were reared at a temperature of 23°C for 9 days showing the pre-vitellogenic stage, while at a temperature of 31°C they were at the early vitellogenic stage (Levy et al. 2011 ). This slow oocyte growth is closely related to a decrease in E2 levels and GH levels which stimulate the formation of vitellogenin during the early stages of oocyte maturation (Hermelink et al. 2011 ). Consistent slow development of oocytes (secondary oocyte development stage) was found in non-transgenic G5 catfish at temperatures of 22°C and 26°C as a consequence of reduced levels of GH and E2 . In contrast, in G5 transgenic catfish at temperatures of 22°C, 26°C and 30°C, oocyte development reached the late-vitellogenic stage to the ootid stage, indicating that GH -transgenesis increased oocyte development higher than in non-transgenic fish. The oocytes in non-transgenic fish (treatment A* temperature 22°C and B* temperature 26°C) were in the primary growth stage, the oogonium stage, characterized by oogonia proliferation, which is a common feature found during early oocyte growth. In treatment B, the oocyte was in late-vitellogenic stage, marked with the formation of yolk granule ( YG ) as a stage of yolk accumulation early in the ovary ripening period (Fig. 8 B). Mature oocytes developed, which were characterized by the formation of theca cells and granulosa cells, which play a role in the aromatization of androgens to E2 to induce vitellogenin production during early to mature oocytes. YG formation increases, causing an enlargement in oocyte size and migration of germinal vesicle toward the periphery known as Germinal Vesicle Break Down ( GVBD ), indicating that the oocyte is in the mature stage. During vitellogenesis before the oocyte matures, induction at the hypothalamic level is required, especially GnRH levels. This includes an increase in GnRHr expression to stimulate an increase in LH and FSH levels (including FSHr ) as a signal to start the formation of maturing induction hormone in the development of secondary oocytes into ootids (Ohta et al. 2002 ; Yaron & Levavi-Sivan 2006 ). CgGH expression and GSI Levels in G5 fish The following information explains the role of temperature in regulating CgGH expression in transgenic fish in relation to the GSI level. Figure 12 A explains that the GSI value observed from gonad growth of female transgenic fish which was influenced by temperature. This temperature determines the expression level of CgGH at the temperature of 26°C, the average growth of GSI was higher compared to 22°C and 30°C treatment. The consistency was shown from the expression levels in Fig. 12 B where significantly higher expression levels in transgenic fish was regulated at the temperature of 26°C. This proves that the growth of transgenic female catfish is influenced by the expression level of the CgGH insert and this highest expression value is directly supported by a temperature of 26°C. The GSI value at a temperature of 30°C decreased and suppressed the expression level in transgenic fish, while at a low temperature of 22°C the expression level was not maximally induced and was not the ideal temperature for maximum expression of CgGH. The GSI value and average gonad growth in transgenic catfish were also lower than at 26°C. The presence of CgGH is advantageous compared to transgenic fish because the average GSI value in all treatments is higher than the GSI value of transgenic fish except in 26°C. Catfish highly responds to temperature during rearing catfish outside its temperature preferences may cause stress. GSI was used previously as a successful indicator of temperature treatments in catfish (Al-Deghayem et al. 2017 ). In addition to the proven synergism between GH and ovarian development, temperature was also a critical factor affecting catfish (Singh and Lal, 2008 ). Since water rearing temperature affects the fish pineal organ of catfish within the complexity of a receptor rhythm and its infliction upon reproductive cycle (Saha et al. 2020 ), preferred temperature and the presence of CgGH over expression proved to cause accelerated gonad maturation in transgenic female fish compared to non-transgenic counterparts. Conclusion This study showed that fish kept at 26°C temperature inducted the expression of genes involved in the gonadal maturation of G5 transgenic mutiara female catfish in the hypothalamic-pituitary-gonad pathway. A low temperature (22°C) causes decreased THRr , GnRHr , FSHr expression levels, and lower levels of GH and E2 hormones, which led to lower average weight of ovaries and oocyte maturation. In contrast, a warm temperature (26°C) caused a increased in THRr , GnRHr, FSHr gene expression levels, GH and E2 hormone levels, and ovaries weight, and faster oocyte growth in transgenic catfish compared to those in non-transgenic catfish. Increased GH levels in female G5 transgenic mutiara catfish (containing CgGH insert) has the potential to maintain oocyte growth during induction with high temperature (30°C). Abbreviations CgGH Clarias gariepinus growth hormone E2 estradiol 17ꞵ FSH follicle stimulating hormone receptor GH growth hormone GnRHr gonadotrophin releasing hormone receptor GVBD germinal vesicle breaks down IGF 1 insulin - like growth factor - 1 pCMV CgGH plasmid Cytomegalovirus Clarias gariepinus growth hormone ; rt qPCR quantitative real - time PCR RT PCR reverse transcription polymerase chain reaction sqRT PCR semi quantitative reverse transcription PCR THRr thyroid hormone receptor Declarations We would like to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome. We confirm that the manuscript has been read and approved by all named authors and that there are no other persons who satisfied the criteria for authorship but are not listed. We further confirm that the order of authors listed in the manuscript has been approved by all of us. Ethics approval and consent to participate The ethical approval for this research was registered with the University Sebelas Maret Ethics Commission. The registration number is 282/UN 27.14/TU.00/2024. All experimental procedures with fish were carried out in accordance with the guidelines and following the Ethics Committee. Consent for publication Not applicable. Availability of data and materials All data generated or analyzed during this study are included in this published article. Competing interests The authors declare that they have no competing interests. Funding sources This work was supported by a grant from the Directorate of Research and Community Service of Universitas Padjadjaran for the research costs through the Internal Research Grant of Universitas Padjadjaran Number: 1549/UN6.3.1/PT.00/2023. Author contributions RG, IDB, YM, and FMP conducted the fish trial, reared fish, and collected data; RG and IDB statistical analysis and analyzed included interpreted data and wrote the manuscript. The design of the study and data analysis and manuscript formatting involved all authors. All authors critically reviewed the manuscript for intellectual content and gave final approval for the manuscript to be published. Acknowledgments The authors are thankful to the Ministry of Research, Technology, and Higher Education, Directorate General of Research, and Development, Directorate of Research and Community Service, and the Directorate of Research and Community Service of the University of Padjadjaran for the support of research costs through the DIPA BLU (1549/UN6.3.1/PT.00/2023). The authors are grateful to the research team for technical support during the research work. Thanks to Mr. Saefudin, Mr. Feri Ferdiana, Epro Barades, and Ahmad Aunur Rofiq for their help in the rearing of fish and research data collecting. References Al-Deghayem, W. A., Al-Balawi, H. F., Kandeal, S. A., & Suliman, E. A. M. (2017). Gonadosomatic index and some hematological parameters in African catfish Clarias gariepinus (Burchell, 1822) as affected by feed type and temperature level. Brazilian archives of biology and technology , 60 . Anderson K, Luckenbach JA, Yamamoto Y, Elizur A (2019) Impacts of Fsh, Igf1, and high temperature on the expression of genes involved in steroidogenesis, cell communication, and apoptosis in isolated coho salmon previtellogenic ovarian follicles. Aquacult 506:60-69. https://doi.org/10.1016/j.aquaculture.2019.03.025 Bhat IA, Rather MA, Saha R, Ganie PA, Sharma R (2017) Identification and expression analysis of thyroid stimulating hormone receptor (TSHR) in fish gonads following LHRH treatment. Proceedings of the National Academy of Sciences, India Section B: Biological Sciences 87:719-726. https://doi.org/10.1007/s40011-015-0640-8 Bock SL, Chow MI, Forsgren KL, Lema SC (2021) Widespread alterations to hypothalamic-pituitary-gonadal (HPG) axis signaling underlie high temperature reproductive inhibition in the eurythermal sheepshead minnow ( Cyprinodon variegatus ). Mol & Cel Endocrinol 537:1-16, 111447. https://doi.org/10.1016/j.mce.2021.111447 Bromage N, Porter M, Randall C (2001) The environmental regulation of maturation in farmed finfish with special reference to the role of photoperiod and melatonin. Aquacult 197(1-4):63-98. https://doi.org/10.1016/S0044-8486(01)00583-X Buwono ID, Junianto J, Iskandar I, Alimuddin A (2019a) Growth and expression level of growth hormone in transgenic mutiara catfish second generation. J Biotech Res 10:102–109 Buwono ID, Junianto J, Iskandar I, Alimuddin A (2019b) Reproduction performance of transgenic Mutiara catfish (G1) comprising the growth hormone gene. J Biotech Res 10:199-212 Buwono ID, Iskandar I, Grandiosa R (2021) Growth hormone transgenesis and feed composition influence growth and protein and amino acid content in transgenic G 3 mutiara catfish ( Clarias gariepinus ). Aquacult Int 29:431–451. https://doi.org/10.1007/s10499-020-00628-8 Buwono ID, Iskandar I, Grandiosa R (2023) CgGH and IGF-1 expression level and growth response of G4 transgenic mutiara strain catfish ( Clarias gariepinus ) reared at different stocking densities. Aquacult Int 31(2):827-846. https://doi.org/10.1007/s10499-022-01002-6 Campbell B, Dickey J, Beckman B, Young G, Pierce A, Fukada H, Swanson P (2006) Previtellogenic oocyte growth in salmon: relationships among body growth, plasma insulin-like growth factor-1, estradiol-17beta, follicle-stimulating hormone and expression of ovarian genes for insulin-like growth factors, steroidogenic-acute regulatory protein and receptors for gonadotropins, growth hormone, and somatolactin. Biol Reprod 75(1):34-44. https://doi.org/10.1095/biolreprod.105.049494 Chaube R, Sharma S, Senthilkumaran B, Bhat SG, Joy KP (2020) Expression profile of kisspeptin2 and gonadotropin-releasing hormone2 mRNA during photo-thermal and melatonin treatments in the female air-breathing catfish Heteropneustes fossilis . Fish Physiol Biochem 46:2403-2419. https://doi.org/10.1007/s10695-020-00888-4 Chen QL, Luo Z, Tan XY, Pan YX, Zheng JL, Zou M (2014) Molecular cloning and mRNA tissue expression of thyroid hormone receptors in yellow catfish Pelteobagrus fulvidraco and Javelin goby Synechogobius hasta . Gene 536(2):232-237. https://doi.org/10.1016/j.gene.2013.12.035 Chen H, Hu Q, Kong L, Rong H, Bi B (2022) Effects of Temperature on the Growth Performance, Biochemical Indexes and Growth and Development-Related Genes Expression of Juvenile Hybrid Sturgeon ( Acipenser baerii ♀× Acipenser schrenckii ♂). Water 14(15):2-18. https://doi.org/10.3390/w14152368 Crisanti P, Omri B, Hughes EJ, Meduri G, Hery C, Clauser E, Jacquemin C, Saunier B (2001) The expression of thyrotropin receptor in the brain. Endocrinol 142(2):812-822. https://doi.org/10.1210/endo.142.2.7943 David D, Degani G (2011) Temperature affects brain and pituitary gene expression related to reproduction and growth in the male blue gouramis, Trichogaster trichopterus . J Experiment Zool Part A: Ecological Genetics and Physiology 315(4): 203-214. https://doi.org/10.1002/jez.663 Gomez JM, Mourot B, Fostier A,Le Gac F (1999) Growth hormone receptors in ovary and liver during gametogenesis in female rainbow trout (Oncorhynchus mykiss). J Reprod Fert 115:275-285. https://doi.org/10.1530/jrf.0.1150275 Gopal RN, Kumar P, Lal B (2014) Temperature dependent action of growth hormone on somatic growth and testicular activities of the catfish, Clarias batrachus . Gen Comp Endocrinol 195:125-131. https://doi.org/10.1016/j.ygcen.2013.11.003 Habibi HR, Nelson ER, Allan ERO (2012) New insights into thyroid hormone function and modulation of reproduction in goldfish. Gen Comp Endocrinol 175(1):19-26. https://doi.org/10.1016/j.ygcen.2011.11.003 Hermelink B, Wuertz S, Trubiroha A, Rennert B, Kloas W, Schulz C (2011) Influence of temperature on puberty and maturation of pikeperch, Sander lucioperca . Gen Comp Endocrinol 172(2):282-292. https://doi.org/10.1016/j.ygcen.2011.03.013 Jia Y, Lei J (2019) Molecular function of gonadotrophins and their receptors in the ovarian development of turbot ( Scophthalmus maximus ). Gen Comp Endocrino 277:17-19. https://doi.org/10.1016/j.ygcen.2019.02.014 Kazeto Y, Goto-Kazeto R, Trant JM. Membrane-bound progestin receptors in channel catfish and zebrafish ovary: changes in gene expression associated with the reproductive cycles and hormonal reagents. Gen Comp Endocrinol. 2005 May 15;142(1-2):204-11. doi: 10.1016/j.ygcen.2005.01.017 Lema SC, Chow MI, Dittman AH, May D, Housh MJ (2022) Accustomed to the heat: Temperature and thyroid hormone influences on oogenesis and gonadal steroidogenesis pathways vary among populations of Amargosa pupfish ( Cyprinodon nevadensis amargosae ). Comp Biochem Physiol Part A: Molecular & Integrative Physiology 272:1-14. 111280. https://doi.org/10.1016/j.cbpa.2022.111280 Levavi-Sivan B, Bogerd J, Mañanós EL, Gómez A, Lareyre JJ (2010) Perspectives on fish gonadotropins and their receptors. Gen Comp Endocrinol 165(3):412-437. https://doi.org/10.1016/j.ygcen.2009.07.019 Levy G, David D, Degani G (2011) Effect of environmental temperature on growth-and reproduction-related hormones gene expression in the female blue gourami ( Trichogaster trichopterus ). Comp Biochem Physiol Part A: Molecular & Integrative Physiology 160(3):381-389. https://doi.org/10.1016/j.cbpa.2011.07.007 Li WS, Lin HR, Wong AOL (2002) Effects of gonadotropin-releasing hormone on growth hormone secretion and gene expression in common carp pituitary. Comp Biochem Physiol 132B:335–341. https://doi.org/10.1016/S1096-4959(02)00039-8 Liu Y, Lin H (2017) Genetic analysis of the reproductive axis in fish using genome-editing nucleases. Science bulletin, 62(4):302-308. https://doi.org/10.1016/j.scib.2017.01.002 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using realtime quantitative PCR and the 2−△△CT method. Methods 25:402–408. https://doi.org/10.1006/meth.2001.1262 Ma Y, Ladisa C, Chang JP, Habibi HR (2020) Seasonal related multifactorial control of pituitary gonadotropin and growth hormone in female goldfish: Influences of neuropeptides and thyroid hormone. Frontiers in endocrinology 11:1-21. 175. https://doi.org/10.3389/fendo.2020.00175 Maddock, D. M., & Burton, M. P. M. (1998). Gross and histological observations of ovarian development and related condition changes in American plaice. Journal of Fish Biology , 53 (5), 928-944. Mateos J, Mananos E, Carrillo M, Zanuy S (2002) Regulation of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) gene expression by gonadotropin-releasing hormone (GnRH) and sexual steroids in the Mediterranean Sea bass. Comp Biochem Physiol Part B: Biochemistry and Molecular Biology 132(1):75-86. https://doi.org/10.1016/S1096-4959(01)00535-8 Melamed P, Rosenfeld H, Elizur A, Yaron Z (1998) Endocrine regulation of gonadotropin and growth hormone gene transcription in fish. Comp Biochem Physiol Part C: Pharmacology, Toxicology and Endocrinology 119(3):325-338. https://doi.org/10.1016/S0742-8413(98)00021-8 Migaud H, Wang N, Gardeur JN, Fontaine P (2006) Influence of photoperiod on reproductive performances in Eurasian perch Perca fluviatilis . Aquacult 252(2-4):385-393. https://doi.org/10.1016/j.aquaculture.2005.07.029 Mori T, Devlin RH (1999) Transgene and host growth hormone gene expression in pituitary and nonpituitary tissues of normal and growth hormone transgenic salmon. Mol Cel Endocrinol 149:129–139. https://doi.org/10.1016/S0303-7207(98)00248-2 Nam YK, Cho HY, Cho YS, No, JK, Kim CG, Kim DS (2001) Dramatically accelerated growth and extraordinary gigantism of transgenic mud loach Misgurnus mizolepis . Trans Res 10:353–362. https://doi.org/10.1023/A:1016696104185 Ohta K, Yamaguchi S, Yamaguchi A, Okuzawa K, Gen K, Kagawa H, Matsuyama M (2002) Biosynthesis of estradiol-17β in the ovarian follicles of the red seabream Pagrus major during vitellogenesis. Fish Sci 68(3):680-687. https://doi.org/10.1046/j.1444-2906.2002.00477.x Ojima D, Iwata M (2010) Central administration of growth hormone-releasing hormone and corticotropin-releasing hormone stimulate downstream movement and thyroxine secretion in fall-smolting coho salmon ( Oncorhynchus kisutch ). Gen Com Endocrinol 168(1):82-87. https://doi.org/10.1016/j.ygcen.2010.04.007 Pankhurst NW (2016) Reproduction and development. In Fish physiology (Vol. 35, pp. 295-331). Academic Press. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:2002–2007. https://doi.org/10.1093/nar/29.9.e45 Politis SN, Servili A, Mazurais D, Zambonino-Infante JL, Miest JJ, Tomkiewicz J, Butts IAE (2018) Temperature induced variation in gene expression of thyroid hormone receptors and deiodinases of European eel ( Anguilla anguilla ) larvae. Gen Comp Endocrinol 259:54-65. https://doi.org/10.1016/j.ygcen.2017.11.003 Raghuveer K, Senthilkumaran B (2010) Cloning and differential expression pattern of vasa in the developing and recrudescing gonads of catfish, Clarias gariepinus . Comp Biochem Physiol Part A: Molecular & Integrative Physiology, 157(1):79-85. https://doi.org/10.1016/j.cbpa.2010.04.017 Saha S, Manisana Singh K, Gupta BBP (2020) Season-dependent differential effect of temperature on diurnal rhythm of expression of core clock genes in the pineal organ of an air-breathing catfish, Clarias gariepinus . Biol Rhythm Res, 51(1):120-138. https://doi.org/10.1080/09291016.2018.1525139 Schulz RW, van Dijk W, Chaves-Pozo E et al (2012) Sertoli cell proliferation in the adult testis is induced by unilateral gonadectomy in African catfish. Gen Comp Endocrinol 177:160-167. https://doi.org/10.1016/j.ygcen.2012.03.001 Singh KM, Saha S, Gupta BBP (2017) Season-dependent effects of photoperiod and temperature on circadian rhythm of arylalkylamine N-acetyltransferase2 gene expression in pineal organ of an air-breathing catfish, Clarias gariepinus . J Photochem Photobiol B: Biology 173:140-149. https://doi.org/10.1016/j.jphotobiol.2017.05.036 Singh, A. K., & Lal, B. (2008). Seasonal and circadian time-dependent dual action of GH on somatic growth and ovarian development in the Asian catfish, Clarias batrachus (Linn.): role of temperature. General and Comparative Endocrinology , 159 (1), 98-106. Sua-Cespedes CD, David DD, Souto-Neto JA, Lima OG, Moraes MN, de Assis LVM, Castrucci AMDL (2021) Low temperature effect on the endocrine and circadian systems of adult Danio rerio . Frontiers in Physiology 12:1-18. 707067. https://doi.org/10.3389/fphys.2021.707067 Swanson P, Dickey JT, Campbell B (2003) Biochemistry and physiology of fish gonadotropins. Fish Physiol Biochem 28: 53-59. https://doi.org/10.1023/B:FISH.0000030476.73360.07 Uchida D, Yamashita M, Kitano T, Iguchi T (2004) An aromatase inhibitor or high water temperature induce oocyte apoptosis and depletion of P450 aromatase activity in the gonads of genetic female zebrafish during sex-reversal. Comp Biochem Physiol Part A: Molecular & Integrative Physiology 137(1):11-20. https://doi.org/10.1016/S1095-6433(03)00178-8 Uh, M., Khattra, J., & Devlin, R. H. (2006). Transgene constructs in coho salmon ( Oncorhynchus kisutch ) are repeated in a head-to-tail fashion and can be integrated adjacent to horizontally-transmitted parasite DNA. Transgenic research , 15 , 711-727. Uzbekova, S., Amoros, C., Cauty, C., Mambrini, M., Perrot, E., Hew, C. L., Chourrout, D & Prunet, P. (2003). Analysis of cell-specificity and variegation of transgene expression driven by salmon prolactin promoter in stable lines of transgenic rainbow trout. Transgenic research , 12 , 213-227. Wong AO, Zhou H, Jiang Y, Ko WK (2006) Feedback regulation of growth hormone synthesis and secretion in fish and the emerging concept of intrapituitary feedback loop. Comp Biochem Physiol Part A: Molecular & Integrative Physiology, 144(3):284-305. https://doi.org/10.1016/j.cbpa.2005.11.021 Yaron Z, Levavi-Sivan B (2006) Reproduction. In: Evans DH and Claibourne JB (eds.) The Physiology of Fishes, 3rd edn., pp.343–386. Boca Raton, FL: CRC Press/Taylor and Francis Yu, Y., Chen, M., Lu, Z. Y., Liu, Y., Li, B., Gao, Z. X., & Shen, Z. G. (2022). High-temperature stress will put the thermo-sensitive teleost yellow catfish (Tachysurus fulvidraco) in danger through reducing reproductivity. Ecotoxicology and environmental safety , 239 : 1-12. Zhang, M. Q., Chen, C. X., Guo, Y. J., Guo, J., & Wang, X. M. (2009). Cloning and sequence analysis of full-length growth hormone cDNA from Clarias gariepinus. Acta Agric Boreali-Sinica , 24 : 27-32. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4580855","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":321985686,"identity":"62ae33d1-296d-4065-adcf-e9a3f36dd8c5","order_by":0,"name":"Roffi Grandiosa","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHUlEQVRIiWNgGAWjYFACxgcfEiAsgwNAQg7M5AERzAwG2LUwG85A1mJMnBYoC6wgsQGuhQG7FvP2ZsaGBwy1+fyzmzce+PDHLn3D7d6DH94w2MkzsDNvwKZF5sxhxoYEhuOWM+4cKzg4sy05d8Odc8mScxiSDRuY2QqwaZGQyD/+IIHhmAHDjRyDw7wNzLkbgAxpHgbmBAZmHqwOk5BIBtlyzEAepIXnT326wY0c4988DPWEtNQYGIC1sB1OADLMgLYcxq2FB+QXgwMGhjfSQH45bjjzRl6a5RyD44ZtuPzC3szY+KOizkDuRvLmDx/+VMvz3cg9fONNRbU8P/9hrCEGAQaHkXmgSAE6iQ23ehCoQ9cyCkbBKBgFowABAJ3GX5r0Tlh2AAAAAElFTkSuQmCC","orcid":"","institution":"Universitas Padjadjaran","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Roffi","middleName":"","lastName":"Grandiosa","suffix":""},{"id":321985687,"identity":"59505426-6218-4f42-a0eb-763662caf9a6","order_by":1,"name":"Ibnu Dwi Buwono","email":"","orcid":"","institution":"Universitas Padjadjaran","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ibnu","middleName":"Dwi","lastName":"Buwono","suffix":""},{"id":321985688,"identity":"5b8f5a16-54a4-4352-bd1b-4599baf83072","order_by":2,"name":"Yuniar Mulyani","email":"","orcid":"","institution":"Universitas Padjadjaran","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuniar","middleName":"","lastName":"Mulyani","suffix":""},{"id":321985689,"identity":"7aca66dc-ecbf-4d24-abfd-3c3addeff4fc","order_by":3,"name":"Fittrie Meyllianawaty Pratiwy","email":"","orcid":"","institution":"Universitas Padjadjaran","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fittrie","middleName":"Meyllianawaty","lastName":"Pratiwy","suffix":""}],"badges":[],"createdAt":"2024-06-14 09:06:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4580855/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4580855/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59635976,"identity":"9b0cf81b-fe23-4f3d-b8b1-fb2ed724ec0f","added_by":"auto","created_at":"2024-07-04 06:39:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":132493,"visible":true,"origin":"","legend":"\u003cp\u003eManipulation of environmental temperature to activate genes involved in reproduction of G5 transgenic mutiara catfish and induction of growth hormone and steroid levels that lead to growth and maturation of fish gonads\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/b10128826e6aba4c09ea0fe7.png"},{"id":59635983,"identity":"27d03930-a23d-4aed-ba6b-92c353e033ed","added_by":"auto","created_at":"2024-07-04 06:39:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":254853,"visible":true,"origin":"","legend":"\u003cp\u003eFemale transgenic G4 fish \u003cstrong\u003e(A)\u003c/strong\u003eand male transgenic G4 fish \u003cstrong\u003e(B)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/ae47f5781fdf790bb2567daf.png"},{"id":59635988,"identity":"a01d5cd7-cf42-4455-a280-09ac6bdd96c0","added_by":"auto","created_at":"2024-07-04 06:39:46","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":364363,"visible":true,"origin":"","legend":"\u003cp\u003eTemperature treatment of G5 transgenic mutiara catfish broodstock (A: 22 °C; B: 26 °C; C: 30 °C); and non-transgenic (*A: 22 °C; B*: 26 °C; C*: 30 °C). 6 fish: replicates (\u003cem\u003en\u003c/em\u003e = 6)\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/bd6e0550409fd8efc944f2e9.png"},{"id":59635977,"identity":"1fb43896-5382-4f0e-bd87-f14a3fd4a21a","added_by":"auto","created_at":"2024-07-04 06:39:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":55825,"visible":true,"origin":"","legend":"\u003cp\u003eElectropherogram identification of female and male broodstock of G4 transgenic mutiara catfish. \u003cem\u003eCgGH\u003c/em\u003e = exogenous growth hormone gene (600 bp, above) and β actin (200 bp, below) as an internal control of gene expression. Broodstock of female = 1, male = 2. pCMV-\u003cem\u003eCgGH \u003c/em\u003eplasmid = P, M1 = 1 kb DNA ladder, M2 = 100 bp DNA ladder\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/1def20bd08374d21b48a76e1.png"},{"id":59635978,"identity":"6142c914-a24c-4d66-89c7-003aa64255f5","added_by":"auto","created_at":"2024-07-04 06:39:41","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":534007,"visible":true,"origin":"","legend":"\u003cp\u003eElectropherogram of \u003cem\u003eCgGH\u003c/em\u003egene transmission of G5 fingerlings and ß-actin of G5 transgenic mutiara catfsh; M, 100 bp DNA ladder; P, pCMV-\u003cem\u003eCgGH\u003c/em\u003e; No. 1–26, fish sample number (one well was pooled from ten different fish fins)\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/0296931d2825cfd1f198658c.png"},{"id":59636523,"identity":"6cc20bd1-233a-4b99-bacc-53328cfbe11c","added_by":"auto","created_at":"2024-07-04 06:47:41","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":139310,"visible":true,"origin":"","legend":"\u003cp\u003eElectropherogram of female broodstock candidate of G5 transgenic mutiara catfish A\u003csub\u003e1\u003c/sub\u003e, A\u003csub\u003e2\u003c/sub\u003e, A\u003csub\u003e3\u003c/sub\u003e, B\u003csub\u003e1\u003c/sub\u003e, B\u003csub\u003e2\u003c/sub\u003e, B\u003csub\u003e3\u003c/sub\u003e, C\u003csub\u003e1\u003c/sub\u003e, C\u003csub\u003e2\u003c/sub\u003e, C\u003csub\u003e3\u003c/sub\u003e and non-transgenic A*\u003csub\u003e1\u003c/sub\u003e, A*\u003csub\u003e2\u003c/sub\u003e, A*\u003csub\u003e3\u003c/sub\u003e, B*\u003csub\u003e1\u003c/sub\u003e, B*\u003csub\u003e2\u003c/sub\u003e, B*\u003csub\u003e3\u003c/sub\u003e, C*\u003csub\u003e1\u003c/sub\u003e, C*\u003csub\u003e2\u003c/sub\u003e, C*\u003csub\u003e3 \u003c/sub\u003e(one well containing samples pooled from two different fish fins). \u003cem\u003eCgGH\u003c/em\u003e = exogenous growth hormone gene (600 bp, above) and β actin (200 bp, below) as an internal control of gene expression. \u003cem\u003epCMV-CgGH\u003c/em\u003e plasmid = P, M = 1 kb DNA ladder, M\u003csub\u003e1\u003c/sub\u003e = 100 bp DNA ladder, N=sample PCR product without template\u003c/p\u003e","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/606f0d3e5961fa159096edbd.png"},{"id":59637059,"identity":"94d2f60a-115a-4945-a44a-8de6584f26e8","added_by":"auto","created_at":"2024-07-04 06:55:41","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":165709,"visible":true,"origin":"","legend":"\u003cp\u003ePCR product of six samples (n = 6, one well pool of two different fish brain tissues) in transgenic of treatments (A\u003csub\u003e1\u003c/sub\u003e-A\u003csub\u003e3\u003c/sub\u003e; B\u003csub\u003e1\u003c/sub\u003e-B\u003csub\u003e3\u003c/sub\u003e; C\u003csub\u003e1\u003c/sub\u003e-C\u003csub\u003e3\u003c/sub\u003e),\u0026nbsp; and non-transgenic of treatments (A*\u003csub\u003e1\u003c/sub\u003e-A*\u003csub\u003e3\u003c/sub\u003e;\u0026nbsp; B*\u003csub\u003e1\u003c/sub\u003e-B*\u003csub\u003e3\u003c/sub\u003e; C*\u003csub\u003e1\u003c/sub\u003e-C*\u003csub\u003e3\u003c/sub\u003e) using primers qTHRr-CgF and qTHRr-CgR with semiquantitative reverse transcription PCR (\u003cem\u003esqRT-PCR\u003c/em\u003e) on \u003cem\u003eTHRr\u003c/em\u003e gene (THR, 25 cycles) and ꞵ-actin as an internal control of expression (ꞵ-actin, 23 cycles) \u003cstrong\u003e(A) \u003c/strong\u003eand relative expression of G5 transgenic and non-transgenic fish \u003cem\u003eTHRr \u003c/em\u003emRNA after normalization with ꞵ-actin mRNA \u003cstrong\u003e(B)\u003c/strong\u003e. The data shown are means ± SD of each individual transgenic and non-transgenic fish performed in triplicate PCR. Means followed by different letters indicate significant differences (p ˂ 0.05). Temperature treatments 22 °C; 26 °C; 30 °C were exposed to transgenic fish (marked ■) and non-transgenic fish (marked □). N, sample PCR product without a template. Significance marked with asterisk (⁕) and non-significant marked with \u003cstrong\u003ens\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/a29b203a3299efb349c59c8e.png"},{"id":59635981,"identity":"50899cbb-6eaa-4df7-be64-9e94fc4935f3","added_by":"auto","created_at":"2024-07-04 06:39:42","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":174473,"visible":true,"origin":"","legend":"\u003cp\u003ePCR product of six samples (n = 6, one well pool of two different fish brain tissues) in transgenic of treatments (A\u003csub\u003e1\u003c/sub\u003e-A\u003csub\u003e3\u003c/sub\u003e; B\u003csub\u003e1\u003c/sub\u003e-B\u003csub\u003e3\u003c/sub\u003e; C\u003csub\u003e1\u003c/sub\u003e-C\u003csub\u003e3\u003c/sub\u003e),\u0026nbsp; and non-transgenic of treatments (A*\u003csub\u003e1\u003c/sub\u003e-A*\u003csub\u003e3\u003c/sub\u003e;\u0026nbsp; B*\u003csub\u003e1\u003c/sub\u003e-B*\u003csub\u003e3\u003c/sub\u003e; C*\u003csub\u003e1\u003c/sub\u003e-C*\u003csub\u003e3\u003c/sub\u003e) using primers qGnRHr-CgF and qGnRHr-CgR with semi quantitative reverse transcription PCR (\u003cem\u003esqRT-PCR\u003c/em\u003e) on \u003cem\u003eGnRHr\u003c/em\u003e gene (GnRH, 27 cycles) and ꞵ-actin as an internal control of expression (ꞵ-actin, 25 cycles) \u003cstrong\u003e(A) \u003c/strong\u003eand relative expression of G5 transgenic and non-transgenic fish \u003cem\u003eGnRHr \u003c/em\u003emRNA after normalization with ꞵ-actin mRNA \u003cstrong\u003e(B)\u003c/strong\u003e. The data shown are means ± SD of each individual transgenic and non-transgenic fish performed in triplicate PCR. Means followed by different letters indicate significant differences (p ˂ 0.05). Temperature treatments 22 °C; 26 °C; 30 °C were exposed to transgenic fish (marked ■) and non-transgenic fish (marked □). N, sample PCR product without a template. Significance marked with asterisk (⁕) and non-significant marked with \u003cstrong\u003ens\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage12.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/45412ca58957572f8470b890.png"},{"id":59635986,"identity":"395f7a77-24a2-4b99-90f1-219c2d63ac0e","added_by":"auto","created_at":"2024-07-04 06:39:42","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":209116,"visible":true,"origin":"","legend":"\u003cp\u003ePCR product of six samples (n = 6, one well pool of two different fish brain tissues) in transgenic of treatments (A\u003csub\u003e1\u003c/sub\u003e-A\u003csub\u003e3\u003c/sub\u003e; B\u003csub\u003e1\u003c/sub\u003e-B\u003csub\u003e3\u003c/sub\u003e; C\u003csub\u003e1\u003c/sub\u003e-C\u003csub\u003e3\u003c/sub\u003e),\u0026nbsp; and non-transgenic of treatments (A*\u003csub\u003e1\u003c/sub\u003e-A*\u003csub\u003e3\u003c/sub\u003e;\u0026nbsp; B*\u003csub\u003e1\u003c/sub\u003e-B*\u003csub\u003e3\u003c/sub\u003e; C*\u003csub\u003e1\u003c/sub\u003e-C*\u003csub\u003e3\u003c/sub\u003e) using primers qFSHr-CgF and qFSHr-CgR with semiquantitative reverse transcription PCR (\u003cem\u003esqRT-PCR\u003c/em\u003e) on \u003cem\u003eFSHr\u003c/em\u003e gene (FSH, 26 cycles) and ꞵ-actin as an internal control of expression (ꞵ-actin, 24 cycles) \u003cstrong\u003e(A) \u003c/strong\u003eand relative expression of G5 transgenic and non-transgenic fish \u003cem\u003eFSHr \u003c/em\u003emRNA after normalization with ꞵ-actin mRNA \u003cstrong\u003e(B)\u003c/strong\u003e. The data shown are means ± SD of each individual transgenic and non-transgenic fish performed in triplicate PCR. Means followed by different letters indicate significant differences (p ˂ 0.05). Temperature treatments 22 °C; 26 °C; 30 °C were exposed to transgenic fish (marked ■) and non-transgenic fish (marked □). N, sample PCR product without a template. Significance marked with asterisk (⁕)\u003c/p\u003e","description":"","filename":"floatimage13.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/ace1170fa98136d8bee4fe16.png"},{"id":59636525,"identity":"1d6408d4-50b4-4358-829e-cedaec1c1198","added_by":"auto","created_at":"2024-07-04 06:47:42","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":127851,"visible":true,"origin":"","legend":"\u003cp\u003eSerum \u003cem\u003eGH\u003c/em\u003e levels \u003cstrong\u003e(A)\u003c/strong\u003e and ovary weight of G5 fish after thermal induction \u003cstrong\u003e(B)\u003c/strong\u003e. Means followed by different letters indicate significant differences (p ˂ 0.05). Temperature treatments of 22 °C; 26 °C; 30 °C were exposed to transgenic fish (marked ■) and non-transgenic fish (marked □).\u003c/p\u003e","description":"","filename":"floatimage14.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/35ab9cb37ef793b9ab643b5c.png"},{"id":59636526,"identity":"126f0fc7-0621-4f40-b0fe-e52afe64979b","added_by":"auto","created_at":"2024-07-04 06:47:42","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":1252193,"visible":true,"origin":"","legend":"\u003cp\u003eSerum \u003cem\u003eE2\u003c/em\u003e levels in temperature treatments 22 °C; 26 °C; 30 °C were exposed to transgenic fish (marked ■) and non-transgenic fish (marked □). \u003cstrong\u003e(A)\u003c/strong\u003eand representative histological sections of G5 transgenic and non-transgenic mutiara catfish broodstock at different temperature. A\u003cstrong\u003e \u003c/strong\u003e(22 °C); B (26 °C); C (30 °C) in transgenic catfish; A* (22 °C); B* (26 °C); C* (30 °C) in non-transgenic catfish \u003cstrong\u003e(B)\u003c/strong\u003e. CA, cortival aveoli; GV, germinal vesicle; N, nucleus; PG CA, primary growth cortical alveoli;P, primary growth of oogonium;GC, granulosa cell; TC, theca cells; YG, yolk granules. Scale bar = 100 μm. Means followed by different letters indicate significant differences (p ˂ 0.05).\u003c/p\u003e","description":"","filename":"floatimage15.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/a370e35bcdb2a807af13471e.png"},{"id":59635980,"identity":"fa091159-d9d5-464d-8d86-70190461e169","added_by":"auto","created_at":"2024-07-04 06:39:41","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":112532,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of GSI (A) and CgGH relative expression of G5 (B) from transgenic and non-transgenic in rearing temperature of 22 °C; 26 °C; 30 °C\u003c/p\u003e","description":"","filename":"floatimage16.png","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/e7e5f5df29e391cdade02c9c.png"},{"id":60170017,"identity":"d3b85720-fa47-4164-b0ac-3d49f1ed92f2","added_by":"auto","created_at":"2024-07-12 15:02:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5584305,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4580855/v1/37e328e8-ed63-45b4-b8ba-b464b1899be2.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eImpact of Temperature Upon Expression Levels of Thrr, Gnrhr, and Fshr Leading to Gonadal Maturation of G5 Transgenicmutiara Strain Female Catfish (Clarias Gariepinus)\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eGH\u003c/em\u003e-transgenesis in fish is a common understanding to promote faster growth than non-transgenic fish. Previous literature stated that the growth of transgenic coho salmon (containing sockeye salmon growth hormone gene inserts) was 10 times greater than that of non-transgenic fish (Mori \u0026amp; Devlin \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Nam et al. 200). Similar results were found in the growth of G1-G4 transgenic mutiara catfish (containing the African catfish growth hormone gene, \u003cem\u003eClarias gariepinus\u003c/em\u003e growth hormone, \u003cem\u003eCgGH\u003c/em\u003e) by 2\u0026ndash;3 times compared to non-transgenic fish (Buwono et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e; Buwono et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Buwono et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eResponse to changes in environmental temperature in fish were frequently studied however increasing interest lies in the response of pineal gland cells which both are responsible for reproduction (Singh et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Changes in temperature were expected to affect the rhythm secretion of melatonin, growth hormone (\u003cem\u003eGH\u003c/em\u003e) and its receptors, as well as \u003cem\u003eIGF-1\u003c/em\u003e and its receptors. A decrease in temperature was known to inhibit melatonin secretion and suppress the expression of \u003cem\u003eGH\u003c/em\u003e and its receptors, thereby reducing \u003cem\u003eGH\u003c/em\u003e levels in the fish's body (Sua-Cespedes et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Thus, melatonin which is a neurotransmitter, acts in response to fluctuations in temperature whose secretion is regulated through the sensitivity of thermal receptor cells in the pineal gland of fish. This neurotransmitter is connected to the endocrine system, namely thyroid hormone secreting cells (including the thyroid hormone receptor, \u003cem\u003eTHRr\u003c/em\u003e which is found in the pineal gland) which contributes upon the fish reproductive system (Bhat et al. 2015; Chen et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Crisanti et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Politis et al. 2017). Furthermore, pineal thyroid hormone affects hypothalamic gonadotrophin releasing hormone (\u003cem\u003eGnRH\u003c/em\u003e) secreting cells which is involved in the fish reproductive cycle (Levavi-Sivan \u0026amp; Avitan 2005; Saha et al. 2018).\u003c/p\u003e \u003cp\u003eIt was known that variations in environmental temperature were more dominant in influencing the development of the ovaries of yellow perch (\u003cem\u003ePerca flavescens\u003c/em\u003e) than photoperiod, while for Eurasian perch (\u003cem\u003ePerca fluvialis\u003c/em\u003e) a combination of temperature and photoperiod was needed to control the fish's reproductive cycle (Migaud et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). \u003cem\u003eGnRH\u003c/em\u003e interactions in hypothalamic neurosecretory cells can modulate the actions of \u003cem\u003eFSH\u003c/em\u003e and \u003cem\u003eLH\u003c/em\u003e, as well as inducing \u003cem\u003eFSHr\u003c/em\u003e receptor expression (Liu \u0026amp; Lin \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Ma et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The results of an in vitro study on ovarian follicles from coho salmon show that \u003cem\u003eFSHr\u003c/em\u003e and \u003cem\u003eIGF-1\u003c/em\u003e acts as mediators of the action of growth hormone on the growth of fish oocytes which are able to stimulate reproductive function at optimum temperatures. This indication shows that temperature has an effect on improving the activation of genes involved in the reproduction of salmonid fish groups (Anderson et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe main regulator that regulates the secretion of \u003cem\u003eFSH\u003c/em\u003e and \u003cem\u003eLH\u003c/em\u003e hormones is a specific receptor (\u003cem\u003eFSHr\u003c/em\u003e or \u003cem\u003eLHr\u003c/em\u003e) in the gonad which is connected to \u003cem\u003eGnRH\u003c/em\u003e (regulated by \u003cem\u003eGnRHr\u003c/em\u003e) to induce the release of \u003cem\u003eFSH\u003c/em\u003e or \u003cem\u003eLH\u003c/em\u003e which influences gonadal cell activity for the production of steroid hormones that stimulate oocyte maturation (Jia \u0026amp; Lei, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ma et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Fish gonad development and gamete maturation are not only regulated by genes involved in fish reproduction in the hypothalamic-pituitary-gonad pathway, but the expression levels of genes related to this reproduction (\u003cem\u003eTHRr\u003c/em\u003e, \u003cem\u003eGnRHr\u003c/em\u003e, \u003cem\u003eFSHr\u003c/em\u003e) were further influenced by environmental temperature (Bock et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Yu et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The negative effects of high temperatures may potentially damage the reproductive cycle of fish, where high temperatures (37\u0026deg;C) have a negative effect on the gonad growth of female and male sheep shead minnow (\u003cem\u003eCyprinodon variegatus\u003c/em\u003e) in the form of lower GSI values ​​compared to fish reared at 27\u0026deg;C (Bock et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Gonadotrophin-releasing hormone (\u003cem\u003eGnRH\u003c/em\u003e) gene expression remained high in the hypothalamus of female and male fish, but the expression levels of \u003cem\u003eFSHr\u003c/em\u003e and \u003cem\u003eLHr\u003c/em\u003e genes in the gonad tissue of both sexes were relatively low at 37\u0026deg;C. This indication was noted in previous studies where a decrease in the expression level of the estrogen receptor gene (\u003cem\u003eESR1\u003c/em\u003e) occurred in the liver of female fish (Bock et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Hermelink et al. 2013).\u003c/p\u003e \u003cp\u003eSpawning of G1-G4 broodstock was successful for the production of transgenic catfish offspring (Buwono et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019b\u003c/span\u003e: Buwono et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Buwono et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). However, the gonad growth of transgenic G5 mutiara catfish (containing the \u003cem\u003eCgGH\u003c/em\u003e gene insert) and the expression levels of the \u003cem\u003eTHRr\u003c/em\u003e, \u003cem\u003eGnRHr\u003c/em\u003e, \u003cem\u003eFSHr\u003c/em\u003e genes when exposed to temperature variation are not well known. Expression levels of the \u003cem\u003eTHRr\u003c/em\u003e, \u003cem\u003eGnRHr\u003c/em\u003e, \u003cem\u003eFSHr\u003c/em\u003e is needed to induce the secretion of \u003cem\u003eGH\u003c/em\u003e and \u003cem\u003eE2\u003c/em\u003e hormones leading to sustainable gonad maturation. Therefore, this research contributes on the knowledge of optimum temperature that induces gonad growth and development of mature oocytes in G5 transgenic mutiara catfish. Result comparison with non-transgenic fish may further contribute to an effort to manipulate environmental temperature to induce gonad maturation which leads to effective broodstock spawning for the production of transgenic fish line offspring. Schematically in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e below, the influence of environmental temperature stimulation is presented including its effect upon the activity of genes involved in the reproduction of G5 transgenic mutiara catfish hence inducing the gonad maturation of the broodfish.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMaintenance of transgenic G4 mutiara catfish broodstock for the production of G5 fish\u003c/h2\u003e \u003cp\u003eG5 transgenic mutiara catfish was produced from spawning female transgenic G4 mutiara catfish (weight 1095 g, total length 53 cm) and male transgenic G4 mutiara catfish (weight 1250 g; total length 57 cm) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The rearing of G4 transgenic mutiara catfish to become broodstock is part of previous research (Buwono et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The rearing of G4 transgenic mutiara catfish broodstock was carried out in fiberglass tanks (1.35 m diameter and 1.05 m water depth). During rearing, broodfish were fed commercial feed Prima Feed 128 (protein content, 38%) with a content of 2% biomass weight, and fed twice a day. During broodstock rearing, total water changes are carried out twice a week at a constant temperature (27\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eRearing of G5 fingerlings to broodstock candidate\u003c/h2\u003e \u003cp\u003eThe rearing of transgenic and non-transgenic G5 mutiara catfish fry was carried out in separate fiber tanks after RT-PCR analysis on transgenic and non-transgenic fish aged one month. During fingerlings rearing, the water temperature was regulated in the range of 26\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C using a water heater, setting a photoperiod of 12 h light: 12 h dark and implementing an aeration system to maintain dissolved oxygen levels.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eBroodstock candidate of G5 transgenic female mutiara catfish\u003c/h2\u003e \u003cp\u003eThe G5 female mutiara catfish broodstock candidate were screened via PCR test to be verified as positive for transgenic (containing \u003cem\u003eCgGH\u003c/em\u003e, 600 bp). RNA samples were taken from the tail fin and extracted with the Quick-RNA\u0026trade; Miniprep Plus kit (Zymo Research Corp., Murphy Avenue Irvine, USA). \u003cem\u003eCgGH\u003c/em\u003e amplification used primers GH-F and GH-R (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and the My Taq OneStep RT-PCR kit (Bioline, UK, London) to identify G5 transgenic female mutiara catfish. Primers Cg\u0026szlig;Act-Fw and Cg\u0026szlig;Act-Rv were used as internal controls.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for screening of G5 transgenic mutiara female catfish\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5' \u0026rarr; 3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmplicons (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReferences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGCTCGAGTTTTGGTGCTGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e600\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eZhang et al. (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2009\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGH-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTACAGAGTGCAGTTGGAATCCAGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCgβAct-Fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCGGAGTCCATCACAATACCAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRaghuveer \u0026amp; Senthilkumaran (2010)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCgβAct-Rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGCTGCGTGTTGCCCCTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTemperature treatment for induction of growth and maturation of G5 transgenic mutiara catfish female broodstock candidate\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe broodstock (female and male parent pair) were reared in the cylinder tank consisting of 400 L water finely aerated water with a temperature of 22\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u0026deg;C (treatment A and A*), 26\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u0026deg;C (treatment B and B*), 30\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u0026deg;C (treatment C and C*) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The age of the female and male G5 transgenic mutiara catfish used was around eight months. During rearing, the water temperature stability was regulated using a water heater thermostat, photoperiods was set as 12 h light and 12 h dark, and an aeration system was applied to maintain dissolved oxygen levels. The protocols were conducted to observe sexually maturity induction in the broodfish gonad. The maturity stage was reached approximately two months later after temperature exposure treatment. A Hi-Pro-Vite 789 artificial feed (Central Proteina Prima Tbk, Sidoarjo, East Java, Indonesia) was used to feed the broodstock at 2% by weight of biomass twice a day.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTHRr, GnRHr\u003c/b\u003e, \u003cb\u003eand FSHr\u003c/b\u003e \u003cb\u003eexpression analysis of G5 fish\u003c/b\u003e\u003c/p\u003e \u003cp\u003eExpression of genes involved in the reproductive system of G5 transgenic mutiara catfish broodstock candidates was observed in brain, pituitary, and liver tissue samples taken. Expression levels of genes involved in the induction of hormone secretion in the pineal gland (\u003cem\u003eTHRr\u003c/em\u003e gene), hypothalamus (\u003cem\u003eGnRHr\u003c/em\u003e gene), pituitary (\u003cem\u003eFSHr\u003c/em\u003e gene) axis were analyzed by real-time PCR (\u003cem\u003ert-qPCR\u003c/em\u003e). Brain, pituitary, and liver tissue samples of six G5 female fish were taken from each treatment in each replication. Total RNA was extracted using a Quick-RNA miniprep plus kit (ZymoResearch, UK), and RNA concentrations were measured using a NanoDrop 2000 spectrophotometer (Thermoscientific). cDNA synthesis was performed using ReverTra Ace qPCR RT Master Mix with gDNARemover (TOYOBO, Osaka, Japan), and it was used as a template in \u003cem\u003ert-qPCR\u003c/em\u003e. \u003cem\u003ert-qPCR\u003c/em\u003e was performed in an Agilent AriaMX Real-time PCR machine (Santa Clara, USA) using 2x SensiFAST SYBR\u0026reg; NO-ROX (Bioline, London, UK), with a final concentration of 100 ng \u0026micro;L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003ecDNA; primers qTHRr-CgF and qTHRr-CgR, qGnRH-CgF and qGnRH-CgR, and qFSHr-CgF, and qFSHr-CgR were used. Primers CgβAct-Fw and CgβAct-Rv were used to amplify \u003cem\u003eC. gariepinus\u003c/em\u003e β-actin gene as an internal control and to normalize expression levels (Chaube et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). qPCR primers for \u003cem\u003eTHRr\u003c/em\u003e, \u003cem\u003eGnRHr\u003c/em\u003e, and \u003cem\u003eFSHr\u003c/em\u003e genes were designed based on \u003cem\u003eC. gariepinus\u003c/em\u003e mRNA sequences in GenBank using Primer3 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi\u003c/span\u003e\u003cspan address=\"http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for \u003cem\u003ert-qPCR\u003c/em\u003e (designed from GenBank) using Primer3\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo; \u0026rarr; 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmplicons (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReferences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eqTHRr-CgF\u003c/p\u003e \u003cp\u003eqTHRr-CgR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTCGAGCACTATGTCAACCAG\u003c/p\u003e \u003cp\u003eCAGGTAGGAAATGGTCAGTCCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGenbank acc no.\u003c/p\u003e \u003cp\u003eKY978231.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eqGnRHr-CgF\u003c/p\u003e \u003cp\u003eqGnRHr-CgR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTGCATGGATACTCAGCCTACTC\u003c/p\u003e \u003cp\u003eGACGAGCAGAGGGAACACATAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e180\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGenbank acc no.\u003c/p\u003e \u003cp\u003eX97497.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eqFSHr-CgF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGATTGCCACCTCAGTCTACTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e190\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGenbank acc no.\u003c/p\u003e \u003cp\u003eAJ012647.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eqFSHr-CgR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTCAAAGAAGTATGGCTCCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCgβAct-Fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCGGAGTCCATCACAATACCAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRaghuveer \u0026amp; Senthilkumaran (2010)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCgβAct-Rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGCTGCGTGTTGCCCCTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eq\u003cem\u003eCgGH\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTC TGA TCG AGT CAT GGG AGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDesigned from genebank acc no MN249238.1 using Primer3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eq\u003cem\u003eCgGH\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTC AGG GTC TGG TAG AAA TCCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCgβAct-Fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACC GGA GTC CAT CAC AAT ACC AGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRaghuveer and Senthilkumaran (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2010\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCgβAct-Rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAG CTG CGT GTT GCC CCT GAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe reaction mixture composition and thermal profile were prepared by quantification using 3 \u0026micro;L of cDNA sample in a final reaction volume of 20 \u0026micro;L containing 10 \u0026micro;L 2X SensiFast SYBR Lo-ROX Mix, 400 nmol of each primer, and 5.4 \u0026micro;L ddH\u003csub\u003e2\u003c/sub\u003eO. The \u003cem\u003ert-qPCR\u003c/em\u003e program was set as follows: 120 s at 95\u0026deg;C, 40 amplification phase cycles (5 s at 95\u0026deg;C, 30 s at 56\u0026deg;C, and 20 s at 72\u0026deg;C), and a melting program (30 s at 95\u0026deg;C, 30 s at 60\u0026deg;C, and 30 s at 95\u0026deg;C). Melting curve analysis was performed at the end of the amplification to evaluate the specificity of the reaction. \u003cem\u003eTHRr\u003c/em\u003e, \u003cem\u003eGnRH\u003c/em\u003e and \u003cem\u003eFSHr\u003c/em\u003e mRNA expression levels were analyzed using the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method (Buwono et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Livak \u0026amp; Schmittgen 2000; Pfaffl \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) after normalization with a β-actin gene.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCgGH transmission in G5 transgenic mutiara catfish\u003c/h2\u003e \u003cp\u003eRNA was isolated from G5 caudal fin tissue following the instructions of the RNeasy Mini kit (Qiagen, Venio, Netherlands). The \u003cem\u003eCgGH\u003c/em\u003e transgene transmission was observed from 270 catfish fingerlings, with each sample comprising fins from eight different fish collected 28 days after hatching (dah). Total RNA measurement used for cDNA synthesis followed the instructions of the ReverTra Ace qPCR RT Master Mix with gDNA Remover kit (TOYOBO, Osaka, Japan). The q\u003cem\u003eCgGH\u003c/em\u003e-F and q\u003cem\u003eCgGH\u003c/em\u003e-R, Cg\u0026szlig;Act-Fw and Cg\u0026szlig;Act-Rv primers (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), and cDNA templates were utilized to count q\u003cem\u003eCgGH\u003c/em\u003e transmission of G5 (amplicons about 200 bp) and \u0026szlig;-actin transgenic fish (amplicons around 200 bp) by \u003cem\u003ePCR\u003c/em\u003e assay following My Taq\u0026trade; HS-Red mix kit instructions (Bioline, London, UK). The \u003cem\u003ePCR\u003c/em\u003e reaction mixture final volume was 50 \u0026micro;L containing 25 \u0026micro;L of 2 \u0026times; My Taq\u0026trade; HS-Red mix PCR, 2 \u0026micro;L of each primer (10 pmol), 2 \u0026micro;L of cDNA, and 19 \u0026micro;L of nuclease free water. The \u003cem\u003ePCR\u003c/em\u003e program was set to: 2 min at 94\u0026deg;C, 35 cycles of amplification phase (15 s at 98\u0026deg;C, 30 s at 56\u0026deg;C, 1 min at 72\u0026deg;C). Electrophoresis was also performed using 2 \u0026micro;L of amplicon sample with a 1% \u003cem\u003eTAE\u003c/em\u003e agarose gel.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of G5 fish growth hormone and estradiol levels\u003c/h2\u003e \u003cp\u003eThe serum \u003cem\u003eGH\u003c/em\u003e, and estradiol (\u003cem\u003eE2\u003c/em\u003e) levels of G5 fish were measured using enzyme-linked immunosorbent assay in each post-temperature treatment. First, the fish were anesthetized with 2-phenoxyethanol, and about 1.5 mL of blood was taken from their caudal artery using a 2-mL heparinized syringe. The blood samples were centrifuged at 3000 rpm at 26\u0026deg;C (room temperature) for 20 min. Serum was stored at \u0026minus;\u0026thinsp;20\u0026deg;C. \u003cem\u003eGH\u003c/em\u003e, and \u003cem\u003eE2\u003c/em\u003e levels were analyzed using a Fish Growth Hormone, and Estradiol ELISA kit (Bioassay Technology Laboratory, Shanghai, China), following the manufacturer's protocol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eFemale gonad weight of G5 fish\u003c/h2\u003e \u003cp\u003eThe weight of female gonads (ovaries) was measured after 60 days of treatment to determine the effect of temperature on gonad growth. Fish gonads were removed by surgery (section) and the ovaries of each test fish were weighed using digital scales (accuracy 0.001 g). The values was also used to measure Gonadosomatic Index. The gonadosomatic index (GSI) was estimated by the equation: GSI\u0026thinsp;=\u0026thinsp;GoW/ GW*100 (Maddock \u0026amp; Burton, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1998\u003c/span\u003e), where GoW\u0026thinsp;=\u0026thinsp;gonad weight in grams (g), and GW\u0026thinsp;=\u0026thinsp;gutted weight in grams (g).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eHistology of G5 female gonads\u003c/h2\u003e \u003cp\u003eFor histology, 5 \u0026micro;m-thick transverse sections of G5 fish ovaries were taken and immersed in Bouin's solution for 12 h. Dehydration, clearance, infiltration, planting, cutting, attachment, and hematoxylin-eosin staining was done, as described by Schulz et al. (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) and Campbell et al. (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2006\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eOne-way analysis of variance (ANOVA) with p ˂ 0.05 (SigmaPlot 12.3) was used to detect significant differences in degrees of spawning induction between G5 transgenic catfish and non-transgenic fish (analysis of \u003cem\u003eTHRr, GnRHr\u003c/em\u003e, \u003cem\u003eFSHr\u003c/em\u003e gene expression and growth hormone, estradiol levels) followed by Duncan's multiple test.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eVerification of G4 transgenic mutiara catfish broodstock\u003c/h2\u003e \u003cp\u003eBased on RT-PCR results, it shows that the broodstock pair of G4 transgenic mutiara catfish (female and male) contains an exogenous GH insert (\u003cem\u003eCgGH\u003c/em\u003e, 600 bp) indicating that it is positive for transgenics, and can be used for the production of G5 fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Furthermore, \u003cem\u003eCgGH\u003c/em\u003e transmission in 1 month old G5 fish using the RT-PCR test and GH-F and GH-R primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) increased to 92% (240/260) compared to G4 (74%) (Buwono et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), indicating the stability of transgene inheritance for mass production of transgenic fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBased on the results of the RT-PCR examination (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), 260 fish were confirmed as transgenic while 20 fish were non-transgenic. Furthermore, catfish fingerlings were transferred to fiberglass tank (water volume 2 m\u003csup\u003e3\u003c/sup\u003e) until five months old (broodfish candidate) to examine the sex of the broodstock. For gonadal growth induction using thermal treatment, 18 transgenic females and 18 non-transgenic female fish were used until gonad maturation of G5 fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eValidation of female broodstock candidate of G5 transgenic mutiara catfish\u003c/h2\u003e \u003cp\u003eBased on \u003cem\u003eRT-PCR\u003c/em\u003e of caudal fin tissues of G5 female catfish reared for two months of indoor rearing, 18 female G5 fish carried transgene inserts (\u003cem\u003eCgGH\u003c/em\u003e positive, 600 bp). While 18 female non-transgenic fish did not carry \u003cem\u003eCgGH\u003c/em\u003e inserts, thus it could be used for the experiment of temperature treatment to induce gonadal maturation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTHRr\u003c/b\u003e \u003cb\u003eexpression of G5 fish\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe results of real time PCR analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB) showed that at 22\u0026deg;C and 30\u0026deg;C there was no significant difference between transgenic and non-transgenic fish, but at 26\u0026deg;C there was a significant difference. In addition, this result was confirmed from the electrophoregram in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eGnRHr\u003c/b\u003e \u003cb\u003eexpression of G5 fish\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eGnRHr\u003c/em\u003e expression levels of G5 transgenic catfish (treatments A, B) differed significantly and were higher than those of non-transgenic fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA), however, in treatment C there was no significant difference between transgenic and non-transgenic fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFSHr\u003c/b\u003e \u003cb\u003eexpression in G5 fish\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe expression level of the \u003cem\u003eFSHr\u003c/em\u003e gene in G5 transgenic catfish was higher than in non-transgenic fish at treatment temperatures of 22\u0026deg;C, 26\u0026deg;C and 30\u0026deg;C. The \u003cem\u003eFSHr\u003c/em\u003e expression level of transgenic fish treated at 26\u0026deg;C was higher than other treatments, while there was no difference in expression levels at 22\u0026deg;C and 30\u0026deg;C in transgenic fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB) and this was confirmed from the electropherogram results in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eGrowth Hormone\u003c/b\u003e \u003cb\u003e(\u003c/b\u003e\u003cb\u003eGH\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e, \u003cb\u003eand gonad weight of G5 female fish\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAmongst the G5 transgenic mutiara catfish, the increase in serum \u003cem\u003eGH\u003c/em\u003e levels was higher in treatment B (temperature 26\u0026deg;C) compared to treatments A and C and compared to non-transgenic fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA). A warm temperatures induce an increase in GH levels in transgenic catfish which is higher than low temperatures (22\u0026deg;C) and high temperatures (30\u0026deg;C), and this equally occurs in non-transgenic fish, but the levels are lower than in transgenic fish. The results of measuring the weight of female gonads (ovaries) between G5 transgenic catfish showed that in the 26\u0026deg;C temperature treatment the weight of the ovaries and testes was higher than in the 22\u0026deg;C and 30\u0026deg;C temperature treatments and higher than in non-transgenic fish. The average ovarian weight of G5 transgenic catfish was significantly higher than that of non-transgenic fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEstradiol (\u003c/b\u003e \u003cb\u003eE2\u003c/b\u003e \u003cb\u003e) and female gonad histology of G5 fish\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSerum \u003cem\u003eE2\u003c/em\u003e levels of G5 transgenic mutiara catfish were significantly higher than those of non-transgenic fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eA). The warm temperature (treatment B, 26\u0026deg;C) induced higher \u003cem\u003eE2\u003c/em\u003e levels than the other treatments. Meanwhile, the growth and development of the ovaries of G5 transgenic mutiara catfish at a temperature of 26\u0026deg;C was faster than non-transgenic fish and other treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of temperature on CgGH expression levels and gonad growth of female G5 transgenic Pearl catfish\u003c/b\u003e \u003c/p\u003e \u003cp\u003eGonado Somatic Index (GSI) levels of G5 transgenic mutiara catfish were significantly higher than those of non-transgenic fish in the temperature of 26\u0026deg;C and 30\u0026deg;C while difference was not found between transgenic and non-transgenic in 22\u0026deg;C treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003eA). The warm temperature (treatment B, 26\u0026deg;C) induced significantly higher \u003cem\u003eCgGH\u003c/em\u003e relative expression levels than the other treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003e \u003cb\u003eExpression levels of\u003c/b\u003e \u003cb\u003eTHRr\u003c/b\u003e \u003cb\u003egene in G5 fish\u003c/b\u003e\u003c/p\u003e \u003cp\u003eChanges in external environmental temperature was received upon entering pre-adulthood, thus the activation of the fish's sensor system in response to the temperature showed significant effect. Thermal receptors found in the pineal organ are an important system involved in the activation of fish reproductive pathways (Pankhurst \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Environmental temperature fluctuations influence the pineal thermal receptor gene (thyroid hormone receptor gene, \u003cem\u003eTHRr\u003c/em\u003e) in response to environmental temperature modulation and the information is transmitted to the hypothalamic neuroendocrinal system. \u003cem\u003eTHRr\u003c/em\u003e expression can further influence the \u003cem\u003eGnRH\u003c/em\u003e hormone associated with fish reproduction, including the GnRH receptor (\u003cem\u003eGnRHr\u003c/em\u003e) (Bhat et al. 2015; Crisanti et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Kazeto et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2005\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAnalysis of \u003cem\u003eTHRr\u003c/em\u003e gene expression in temperature treatments showed that 26\u0026deg;C had the highest expression effect compared to 22\u0026deg;C and 30\u0026deg;C among transgenic fish, but did not have a significant effect at both temperatures in both transgenic and non-transgenic fish (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). In this research, \u003cem\u003eC. gariepinus\u003c/em\u003e treated at 25\u0026deg;C showed the highest level of core clock gene expression in the pineal organ compared to temperatures of 15\u0026deg;C and 35\u0026deg;C (Saha et al. 2018). The similarity in the expression levels of the \u003cem\u003eTHRr\u003c/em\u003e and core clock genes in the pineal indicates that the response of thermal receptor cells to temperature is in the range of 25\u0026ndash;26\u0026deg;C for the catfish group. At high temperatures (30\u0026deg;C) and 35\u0026deg;C there was a decrease in the expression level of the \u003cem\u003eTHRr\u003c/em\u003e and core clock genes, while at relatively low temperatures (22\u0026deg;C and 15\u0026deg;C), the expression levels were lower than at 30\u0026deg;C and 35\u0026deg;C. Similar results were shown in the development of European eel (\u003cem\u003eAnguilla anguilla\u003c/em\u003e) larvae which decreased when treated with a temperature of 22\u0026deg;C (Politis et al. 2017). This indication clearly shows that the expression level of the \u003cem\u003eTHRr\u003c/em\u003e gene is influenced by low temperature or high temperature, where high temperature tends to reduce the expression level, while low temperature causes a decrease in the expression level. The optimal temperature that provides an increase in high expression levels of the \u003cem\u003eTHRr\u003c/em\u003e gene for transgenic G5 mutiara catfish (average 3.40) and non-transgenic (average 2.30) is at 26\u0026deg;C. The higher expression level of the \u003cem\u003eTHRr\u003c/em\u003e gene in transgenic catfish compared to non-transgenic fish was thought to be related to \u003cem\u003eGH\u003c/em\u003e overexpression in transgenic fish. Thyroid hormone collaborates with growth hormone in the growth and reproduction process of fish (Lema et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Ojima \u0026amp; Iwata 2020), thus it can be explained that the level of \u003cem\u003eTHR\u003c/em\u003e gene expression (including \u003cem\u003eTHRr\u003c/em\u003e) was found in the highest level when treated at a temperature of 26\u0026deg;C, whereas this condition did not occur in non-transgenic fish. Transgenic G5 catfish containing \u003cem\u003eCgGH\u003c/em\u003e inserts is stably transmitted from its transgenic mutiara catfish broodstock while transgenic genes in fish were known to be repeated in a head-to-tail fashion proved in transgenic salmon (containing PRL-lacZ) (Uzbekova et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2003\u003c/span\u003e) and transgenic coho salmon (\u003cem\u003eOncorhynchus kisutch\u003c/em\u003e) (containing a salmon growth hormone OnMTGH1) (Uh et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2006\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression levels of\u003c/b\u003e \u003cb\u003eGnRHr\u003c/b\u003e \u003cb\u003egene in G5 fish\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThyroid hormone receptors (\u003cem\u003eTHRr\u003c/em\u003e) are found in the ovarian and testicular tissue of channel catfish (Kazeto et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2005\u003c/span\u003e), indicating that \u003cem\u003eTHRr\u003c/em\u003e is indirectly involved in the fish reproductive pathway. \u003cem\u003eTHRr\u003c/em\u003e gene expression in the ovary increases to its highest peak when oocyte growth reaches the vitellogenic phase, this indication shows that \u003cem\u003eTHRr\u003c/em\u003e plays an important role in vitellogenesis and gonadal maturation. Thyroid hormones work together with other hormones along the hypothalamic-pituitary-gonad pathway which are involved in reproductive aspects, including the \u003cem\u003eGnRHr\u003c/em\u003e hormone. So, \u003cem\u003eTRHr\u003c/em\u003e is involved in the growth and development of the fish reproductive system (Habibi et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Indirectly, \u003cem\u003eTHRr\u003c/em\u003e (pineal) gene expression can influence the level of \u003cem\u003eGnRHr\u003c/em\u003e (hypothalamic) gene expression.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eGnRHr\u003c/em\u003e expression level treated at 26\u0026deg;C (average 4.23) in G5 transgenic mutiara catfish was higher than in other treatments (Figs.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA and \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). The increase in \u003cem\u003eGnRHr\u003c/em\u003e expression levels at 26\u0026deg;C is relatively similar to the \u003cem\u003eTHRr\u003c/em\u003e gene expression levels at that temperature. This indication shows that the increase in \u003cem\u003eTHRr\u003c/em\u003e expression is indirectly followed by an increase in \u003cem\u003eGnRHr\u003c/em\u003e gene expression. This consistency suggests an influence of \u003cem\u003eTHRr\u003c/em\u003e on \u003cem\u003eGnRHr\u003c/em\u003e expression. In contrast, temperatures of 22\u0026deg;C (average 2.69) and 30\u0026deg;C (average 2.76) tended to reduce the level of \u003cem\u003eGnRHr\u003c/em\u003e gene expression, and there was no significant difference between transgenic and non-transgenic fish at 30\u0026deg;C. These results indicated that \u003cem\u003eGH\u003c/em\u003e-transgenesis did not induce \u003cem\u003eGnRHr\u003c/em\u003e expression levels at 30\u0026deg;C and showed similar effects in non-transgenic fish. The expression level of \u003cem\u003eGnRHr\u003c/em\u003e at 22\u0026deg;C was lower than at 26\u0026deg;C in transgenic catfish, indicating that lower temperature decreased the expression level, whereas warm temperatures increased the expression level of \u003cem\u003eGnRHr\u003c/em\u003e to a greater extent. Meanwhile, high temperature (30 \u0026deg;) had an effect on reducing \u003cem\u003eGnRHr\u003c/em\u003e expression levels. Effect of high temperature (34\u0026deg;C) was known to reduce the expression level of the \u003cem\u003eGnRH\u003c/em\u003e gene in Amargosa pupfish (\u003cem\u003eCyprinodon nevadensis amargosae\u003c/em\u003e), while a temperature of 24\u0026deg;C is the optimal temperature to stimulate ovarian growth (Lema et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). These results are relevant to the expression level of the \u003cem\u003eGnRHr\u003c/em\u003e gene found in G5 transgenic mutiara catfish, that the optimum temperature that induces the highest level of \u003cem\u003eGnRHr\u003c/em\u003e expression was 26\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression levels of\u003c/b\u003e \u003cb\u003eFSHr\u003c/b\u003e \u003cb\u003egene in G5 fish\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTemperature is one of the environmental factors involved in regulating fish reproduction, especially during the periods of gonad growth, vitellogenesis, spawning and egg hatching (Bromage et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Levy et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Oocyte growth is influenced by fluctuations in environmental temperature which can modulate the expression levels of genes involved in the secretion of gonadotrophin hormones which are important in stimulating oocyte development and growth. Two genes involved in regulating the secretion of fish gonadotropin hormones are follicle stimulating hormone (\u003cem\u003eFSH\u003c/em\u003e) and luteinizing hormone \u003cem\u003e(LH\u003c/em\u003e) which are found in the pituitary (David \u0026amp; Degani \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Mateos et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Yu et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Pituitary secretion of \u003cem\u003eFSH\u003c/em\u003e and \u003cem\u003eLH\u003c/em\u003e hormones is regulated by the hypothalamic \u003cem\u003eGnRH\u003c/em\u003e hormone, where the expression of the \u003cem\u003eGnRH\u003c/em\u003e gene (also including the \u003cem\u003eGnRHr\u003c/em\u003e gene) plays a role in regulating the expression of the \u003cem\u003eFSH\u003c/em\u003e and \u003cem\u003eLH\u003c/em\u003e genes for the production of these two gonadotrophin hormones. The \u003cem\u003eFSH\u003c/em\u003e hormone receptor \u003cem\u003e(FSHr\u003c/em\u003e) is located in the gonad, thus this receptor is involved in the gonadal maturation process and can be used as a representation of increased \u003cem\u003eFSH\u003c/em\u003e gene expression (Anderson et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Induction of appropriate temperatures can stimulate increased expression of genes involved in steroidogenesis which leads to spawning of broodstock. During oocyte growth, the expression level of \u003cem\u003eFSH\u003c/em\u003e genes (including \u003cem\u003eFSHr\u003c/em\u003e) is influenced by environmental temperature fluctuations.\u003c/p\u003e \u003cp\u003eResults of \u003cem\u003eFSHr\u003c/em\u003e gene expression analysis of G5 transgenic mutiara catfish at a temperature of 26\u0026deg;C was higher than other treatments and significantly different from non-transgenic fish (Figs.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA and \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB). The expression level of the \u003cem\u003eFSHr\u003c/em\u003e gene in transgenic catfish at 22\u0026deg;C (average 4.84) was higher than in non-transgenic fish, but lower than at 26\u0026deg;C (average 7.25) in transgenic fish. Likewise, at 30\u0026deg;C, the \u003cem\u003eFSHr\u003c/em\u003e expression level was not much different from that at 22\u0026deg;C. This result is similar to research on juvenile hybrid sturgeon (\u003cem\u003eAcipenser baerii\u003c/em\u003e ♀\u0026times; \u003cem\u003eAcipenser schrenckii\u003c/em\u003e ♂), which the optimal temperature that induces high expression of the \u003cem\u003eFSH\u003c/em\u003e gene occurs at 27\u0026deg;C, when compared to 21\u0026deg;C and 30\u0026deg;C (Chen et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). It was further stated that this optimum temperature is needed to regulate the development of fish gonads, especially \u003cem\u003eFSH\u003c/em\u003e is needed to increase the size of the oocyte follicle during the development stage of the oogonia into primary oocytes. At 26\u0026deg;C treatment, the increase in \u003cem\u003eFSHr\u003c/em\u003e gene expression is inseparable from the influence of hypothalamic \u003cem\u003eGnRHr\u003c/em\u003e gene expression where the expression level of the pineal \u003cem\u003eTHRr\u003c/em\u003e gene equally increase, while at 30\u0026deg;C shows an effect of decreased expression. At the temperature of 22\u0026deg;C, expression levels of the \u003cem\u003eTHRr\u003c/em\u003e, \u003cem\u003eGnRHr\u003c/em\u003e, \u003cem\u003eFSHr\u003c/em\u003e genes were found lower compared to the temperature of 26\u0026deg;C treatment (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB, \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB). Optimum temperatures (around 26\u0026deg;C) are needed for gonad maturation and encourage the spawning process of many cyprinids and other warmwater fishes (Chen et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Low temperatures (22\u0026deg;C) or high temperatures (30\u0026deg;C) do not have much influence on accelerating gonad maturation and stimulating spawning of brood fish. It is therefore understandable that the expression levels of genes involved in the pineal (\u003cem\u003eTHRr\u003c/em\u003e)-hypothalamic (\u003cem\u003eGnRHr\u003c/em\u003e)-pituitary (\u003cem\u003eFSHr\u003c/em\u003e) pathway were consistently at high levels when exposed to 26\u0026deg;C water temperature compared to 22\u0026deg;C and 30\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGH\u003c/b\u003e \u003cb\u003elevels and gonadal growth of G5\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSerum \u003cem\u003eGH\u003c/em\u003e levels of G5 transgenic mutiara catfish were significantly higher than non-transgenic fish at temperatures of 22\u0026deg;C, 26\u0026deg;C, 30\u0026deg;C and serum \u003cem\u003eGH\u003c/em\u003e of transgenic catfish kept at 26\u0026deg;C was higher than other treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). The results of measuring \u003cem\u003eGH\u003c/em\u003e levels show that temperature treatment (especially in 26\u0026deg;C) induced higher \u003cem\u003eGH\u003c/em\u003e levels (average 6.13) than temperatures of 22\u0026deg;C and 30\u0026deg;C, both in transgenic and non-transgenic catfish. Pituitary \u003cem\u003eGH\u003c/em\u003e secretion involves stimulation of hypothalamic \u003cem\u003eGnRH\u003c/em\u003e, because \u003cem\u003eGnRH\u003c/em\u003e is a factor that stimulates \u003cem\u003eGH\u003c/em\u003e, \u003cem\u003eLH\u003c/em\u003e or \u003cem\u003eFSH\u003c/em\u003e secretion (Li et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). The level of \u003cem\u003eGnRH\u003c/em\u003e expression can be represented by the \u003cem\u003eGnRH\u003c/em\u003e gene receptor (\u003cem\u003eGnRHr\u003c/em\u003e). High temperature induction (30\u0026deg;C) tends to reduce \u003cem\u003eGH\u003c/em\u003e levels in transgenic and non-transgenic catfish, as does low temperature (22\u0026deg;C). The decrease in \u003cem\u003eGH\u003c/em\u003e levels at high and low temperatures is closely related to the decrease in \u003cem\u003eGnRHr\u003c/em\u003e expression levels, indicating that \u003cem\u003eGH\u003c/em\u003e secretion levels are indirectly regulated by \u003cem\u003eGnRHr\u003c/em\u003e expression levels. The increase in \u003cem\u003eGnRHr\u003c/em\u003e expression levels at warm temperatures (26\u0026deg;C) was accompanied by increased secretion of \u003cem\u003eGH\u003c/em\u003e levels in both transgenic and non-transgenic fish (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA), indicating a close relationship between \u003cem\u003eGnRHr\u003c/em\u003e expression and GH levels which is influenced by temperature.\u003c/p\u003e \u003cp\u003eThe consistency of \u003cem\u003eGH\u003c/em\u003e levels in different temperature treatments was also followed by an increase in the ovarian weight of G5 fish, whereas the temperature of 26\u0026deg;C gave a higher increase in the ovarian weight of transgenic and non-transgenic catfish than temperatures of 22\u0026deg;C and 30\u0026deg;C (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). The decrease in \u003cem\u003eGH\u003c/em\u003e levels at temperatures of 22\u0026deg;C and 30\u0026deg;C affected the lower growth of ovarian weight in G5 fish. This was in line with previous studies where an optimum temperature (26\u0026deg;C) induced a higher increase in ovarian weight of tilapia (\u003cem\u003eOrechromis niloticus\u003c/em\u003e) compared to low temperatures (16\u0026deg;C) (Gopal et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), showing similar results in G5 catfish where increased levels of \u003cem\u003eGH\u003c/em\u003e in stimulated the gonad growth of G5 female catfish. Other research shows that a temperature of 27\u0026deg;C can significantly induce increased expression of genes involved in reproduction and growth in the brain and pituitary pathways of female and male blue gouramis fish (\u003cem\u003eTrichogaster tricopterus\u003c/em\u003e) than temperatures of 23\u0026deg;C and 31\u0026deg;C. The expression level of the \u003cem\u003eFSH\u003c/em\u003e gene in the pituitary significantly decreased at 31\u0026deg;C compared to 23\u0026deg;C and 27\u0026deg;C, and was implicated in reducing the GSI value of fish (David \u0026amp; Degani \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Overall, both \u003cem\u003eGH\u003c/em\u003e levels and ovarian weight gain in G5 transgenic mutiara catfish were higher than non-transgenic fish, with an increase in \u003cem\u003eGH\u003c/em\u003e levels of 2.92 times at a temperature of 26\u0026deg;C, 2.48 times at a temperature of 22\u0026deg;C and 1.83 times at a temperature of 30\u0026deg;C. The high levels of \u003cem\u003eGH\u003c/em\u003e are thought to be closely related to the overexpression of \u003cem\u003eGH\u003c/em\u003e in transgenic catfish at a temperature of 26\u0026deg;C, whereas at temperatures of 22\u0026deg;C and 30\u0026deg;C, it causes a decrease in \u003cem\u003eGH\u003c/em\u003e levels which is followed by a decrease in ovary weight in both transgenic and non-transgenic fish.\u003c/p\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eEstradiol levels gonadal development of G5 fish\u003c/h2\u003e \u003cp\u003eThe increased FSHr gene expression pituitary leads to increased GH pituitary and E2 levels in the gonad, inducing the enzyme activity 17α-hydroxylase/C17,20-lyase and p450 aromatase a (cyp19a1a) for oocyte maturity, and ovarian weight; as a consequence, female gonad development increases in female coho salmon when treated with optimum temperature (28\u0026deg;C) (Anderson et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Sua-Cespedes et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Low temperature (23\u0026deg;C) reduces gene expression levels in the brain (including \u003cem\u003eGnRHr\u003c/em\u003e) which in turn causes a decrease in pituitary \u003cem\u003eGH\u003c/em\u003e and \u003cem\u003eE2\u003c/em\u003e levels in the ovaries. \u003cem\u003eE2\u003c/em\u003e plays an important role in carrying out vitellogenesis processes, which involve yolk protein accumulation, causing oocyte growth, and ovary enlargement, as represented by ovaries weight (Levy et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Melamed et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). So here, it is shown that temperature fluctuations affect the expression of genes involved in the hypothalamic-pituitary-gonadal pathway that induces \u003cem\u003eGH\u003c/em\u003e and \u003cem\u003eE2\u003c/em\u003e levels that lead to oocyte maturation.\u003c/p\u003e \u003cp\u003eIn the warm temperature treatment on G5 transgenic mutiara catfish, the increase average weight of ovaries was associated with the stimulation of \u003cem\u003eE2\u003c/em\u003e levels under 26\u0026deg;C (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB and \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA) which was higher than non-transgenic fish and other temperature treatments. This increase in \u003cem\u003eGH\u003c/em\u003e and \u003cem\u003eE2\u003c/em\u003e levels leads to oocyte growth and as a consequence the development of female gonads leading to the ovarian ripening stage. Similar result was also found in the 27\u0026deg;C temperature treatment in the female blue gourami (Levy et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The gonad development rate of female transgenic and non-transgenic G5 mutiara catfish was reduced when treated with temperatures of 22\u0026deg;C and 30\u0026deg;C (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). However, ovary development in transgenic catfish was faster than non-transgenic catfish at a temperature of 30\u0026deg;C, indicating that transgenesis-\u003cem\u003eGH\u003c/em\u003e could maintain oocyte growth in transgenic fish. \u003cem\u003eGH\u003c/em\u003e can induce the \u003cem\u003eIGF-1\u003c/em\u003e gene in liver and gonads (stimulating \u003cem\u003eE2\u003c/em\u003e production), indicating that \u003cem\u003eGH\u003c/em\u003e is involved in yolk protein synthesis during vitellogenesis and steroid production to initiate oocyte growth during gonadal maturation (Buwono et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019b\u003c/span\u003e; Gomez et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Swanson et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Wong et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Rearing female fish broodstock requires an optimum temperature range to initiate the reproductive cycle and sustain oocyte growth and maturation (Uchida et al. 2003).\u003c/p\u003e \u003cp\u003eThis indicates that the oocyte development stage of G5 transgenic mutiara catfish can reach early-late vitellogenic stages when treated with temperatures of 22\u0026deg;C, 26\u0026deg;C and 30\u0026deg;C, whereas in non-transgenic fish slow down oocyte growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB), where at 22\u0026deg;C and 30\u0026deg;C, the oocyte development was in 'immature' status in G5 non-transgenic fish. Meanwhile, at a temperature of 30\u0026deg;C, ovarian development reaches the pre-vitellogenic stage. In treatment A (transgenic 22\u0026deg;C and C* (non-transgenic 30\u0026deg;C) an oogonium containing a nucleus was in the middle of an oocyte follicle, and some oogonium continued to develop to form cortical alveoli (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB), showing the growth from primary oocytes to secondary oocytes to pre-vitellogenic. This oocyte development is similar to the results of research on female blue gourami fish which were reared at a temperature of 23\u0026deg;C for 9 days showing the pre-vitellogenic stage, while at a temperature of 31\u0026deg;C they were at the early vitellogenic stage (Levy et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). This slow oocyte growth is closely related to a decrease in \u003cem\u003eE2\u003c/em\u003e levels and \u003cem\u003eGH\u003c/em\u003e levels which stimulate the formation of vitellogenin during the early stages of oocyte maturation (Hermelink et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Consistent slow development of oocytes (secondary oocyte development stage) was found in non-transgenic G5 catfish at temperatures of 22\u0026deg;C and 26\u0026deg;C as a consequence of reduced levels of \u003cem\u003eGH\u003c/em\u003e and \u003cem\u003eE2\u003c/em\u003e. In contrast, in G5 transgenic catfish at temperatures of 22\u0026deg;C, 26\u0026deg;C and 30\u0026deg;C, oocyte development reached the late-vitellogenic stage to the ootid stage, indicating that \u003cem\u003eGH\u003c/em\u003e-transgenesis increased oocyte development higher than in non-transgenic fish. The oocytes in non-transgenic fish (treatment A* temperature 22\u0026deg;C and B* temperature 26\u0026deg;C) were in the primary growth stage, the oogonium stage, characterized by oogonia proliferation, which is a common feature found during early oocyte growth. In treatment B, the oocyte was in late-vitellogenic stage, marked with the formation of yolk granule (\u003cem\u003eYG\u003c/em\u003e) as a stage of yolk accumulation early in the ovary ripening period (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). Mature oocytes developed, which were characterized by the formation of theca cells and granulosa cells, which play a role in the aromatization of androgens to \u003cem\u003eE2\u003c/em\u003e to induce vitellogenin production during early to mature oocytes. \u003cem\u003eYG\u003c/em\u003e formation increases, causing an enlargement in oocyte size and migration of germinal vesicle toward the periphery known as \u003cem\u003eGerminal Vesicle Break Down\u003c/em\u003e (\u003cem\u003eGVBD\u003c/em\u003e), indicating that the oocyte is in the mature stage. During vitellogenesis before the oocyte matures, induction at the hypothalamic level is required, especially \u003cem\u003eGnRH\u003c/em\u003e levels. This includes an increase in \u003cem\u003eGnRHr\u003c/em\u003e expression to stimulate an increase in \u003cem\u003eLH and FSH\u003c/em\u003e levels (including \u003cem\u003eFSHr\u003c/em\u003e) as a signal to start the formation of maturing induction hormone in the development of secondary oocytes into ootids (Ohta et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Yaron \u0026amp; Levavi-Sivan \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2006\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eCgGH expression and GSI Levels in G5 fish\u003c/h2\u003e \u003cp\u003eThe following information explains the role of temperature in regulating CgGH expression in transgenic fish in relation to the GSI level. Figure\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003eA explains that the GSI value observed from gonad growth of female transgenic fish which was influenced by temperature. This temperature determines the expression level of CgGH at the temperature of 26\u0026deg;C, the average growth of GSI was higher compared to 22\u0026deg;C and 30\u0026deg;C treatment. The consistency was shown from the expression levels in Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003eB where significantly higher expression levels in transgenic fish was regulated at the temperature of 26\u0026deg;C. This proves that the growth of transgenic female catfish is influenced by the expression level of the CgGH insert and this highest expression value is directly supported by a temperature of 26\u0026deg;C. The GSI value at a temperature of 30\u0026deg;C decreased and suppressed the expression level in transgenic fish, while at a low temperature of 22\u0026deg;C the expression level was not maximally induced and was not the ideal temperature for maximum expression of CgGH. The GSI value and average gonad growth in transgenic catfish were also lower than at 26\u0026deg;C. The presence of CgGH is advantageous compared to transgenic fish because the average GSI value in all treatments is higher than the GSI value of transgenic fish except in 26\u0026deg;C. Catfish highly responds to temperature during rearing catfish outside its temperature preferences may cause stress. GSI was used previously as a successful indicator of temperature treatments in catfish (Al-Deghayem et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In addition to the proven synergism between GH and ovarian development, temperature was also a critical factor affecting catfish (Singh and Lal, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Since water rearing temperature affects the fish pineal organ of catfish within the complexity of a receptor rhythm and its infliction upon reproductive cycle (Saha et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), preferred temperature and the presence of CgGH over expression proved to cause accelerated gonad maturation in transgenic female fish compared to non-transgenic counterparts.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study showed that fish kept at 26\u0026deg;C temperature inducted the expression of genes involved in the gonadal maturation of G5 transgenic mutiara female catfish in the hypothalamic-pituitary-gonad pathway. A low temperature (22\u0026deg;C) causes decreased \u003cem\u003eTHRr\u003c/em\u003e, \u003cem\u003eGnRHr\u003c/em\u003e, \u003cem\u003eFSHr\u003c/em\u003e expression levels, and lower levels of \u003cem\u003eGH\u003c/em\u003e and \u003cem\u003eE2\u003c/em\u003e hormones, which led to lower average weight of ovaries and oocyte maturation.\u003c/p\u003e \u003cp\u003eIn contrast, a warm temperature (26\u0026deg;C) caused a increased in \u003cem\u003eTHRr\u003c/em\u003e, \u003cem\u003eGnRHr, FSHr\u003c/em\u003e gene expression levels, \u003cem\u003eGH\u003c/em\u003e and \u003cem\u003eE2\u003c/em\u003e hormone levels, and ovaries weight, and faster oocyte growth in transgenic catfish compared to those in non-transgenic catfish. Increased \u003cem\u003eGH\u003c/em\u003e levels in female G5 transgenic mutiara catfish (containing \u003cem\u003eCgGH\u003c/em\u003e insert) has the potential to maintain oocyte growth during induction with high temperature (30\u0026deg;C).\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv id=\"AGS1\" class=\"AbbreviationGroupSection\"\u003e \u003cdiv class=\"Heading\"\u003eCgGH Clarias gariepinus growth hormone\u003c/div\u003e \u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eE2 estradiol\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e \u003cem\u003e17ꞵ\u003c/em\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"AGS2\" class=\"AbbreviationGroupSection\"\u003e \u003cdiv class=\"Heading\"\u003eFSH follicle stimulating hormone receptor\u003c/div\u003e \u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGH growth hormone\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eGnRHr gonadotrophin\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e \u003cem\u003ereleasing hormone receptor\u003c/em\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"AGS3\" class=\"AbbreviationGroupSection\"\u003e \u003cdiv class=\"Heading\"\u003eGVBD germinal vesicle breaks down\u003c/div\u003e \u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eIGF\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e \u003cem\u003e1 insulin\u003c/em\u003e-\u003cem\u003elike growth factor\u003c/em\u003e-\u003cem\u003e1\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003epCMV\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e \u003cem\u003eCgGH plasmid Cytomegalovirus Clarias gariepinus growth hormone\u003c/em\u003e;\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003ert\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e \u003cem\u003eqPCR quantitative real\u003c/em\u003e-\u003cem\u003etime PCR\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eRT\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e \u003cem\u003ePCR reverse transcription polymerase chain reaction\u003c/em\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003esqRT\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e \u003cem\u003ePCR semi quantitative reverse transcription PCR\u003c/em\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTHRr \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ethyroid hormone receptor\u003c/span\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e\u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003eWe would like to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome. We confirm that the manuscript has been read and approved by all named authors and that there are no other persons who satisfied the criteria for authorship but are not listed. We further confirm that the order of authors listed in the manuscript has been approved by all of us. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u0026nbsp; The ethical approval for this research was registered with the University Sebelas Maret Ethics Commission. The registration number is 282/UN 27.14/TU.00/2024. All experimental procedures with fish were carried out in accordance with the guidelines and following the Ethics Committee.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u0026nbsp; \u0026nbsp;Not applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u0026nbsp; All data generated or analyzed during this study are included in this published article.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u0026nbsp; \u0026nbsp; The authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding sources\u003c/strong\u003e This work was supported by a grant from the Directorate of Research and Community Service of Universitas Padjadjaran for the research costs through the Internal Research Grant of Universitas Padjadjaran Number: 1549/UN6.3.1/PT.00/2023.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e RG, IDB, YM, and FMP conducted the fish trial, reared fish, and collected data; RG and IDB statistical analysis and analyzed included interpreted data and wrote the manuscript. The design of the study and data analysis and manuscript formatting involved all authors. All authors critically reviewed the manuscript for intellectual content and gave final approval for the manuscript to be published.\u003c/p\u003e\n\u003cp\u003eAcknowledgments The authors are thankful to the Ministry of Research, Technology, and Higher Education, Directorate General of Research, and Development, Directorate of Research and Community Service, and the Directorate of Research and Community Service of the University of Padjadjaran for the support of research costs through the DIPA BLU (1549/UN6.3.1/PT.00/2023). The authors are grateful to the research team for technical support during the research work. Thanks to Mr. Saefudin, Mr. Feri Ferdiana, Epro Barades, and Ahmad Aunur Rofiq for their help in the rearing of fish and research data collecting.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAl-Deghayem, W. A., Al-Balawi, H. F., Kandeal, S. A., \u0026amp; Suliman, E. A. M. (2017). Gonadosomatic index and some hematological parameters in African catfish \u003cem\u003eClarias gariepinus\u003c/em\u003e (Burchell, 1822) as affected by feed type and temperature level. \u003cem\u003eBrazilian archives of biology and technology\u003c/em\u003e, \u003cem\u003e60\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eAnderson K, Luckenbach JA, Yamamoto Y, Elizur A (2019) Impacts of Fsh, Igf1, and high temperature on the expression of genes involved in steroidogenesis, cell communication, and apoptosis in isolated coho salmon previtellogenic ovarian follicles. Aquacult 506:60-69. \u003cstrong\u003ehttps://doi.org/10.1016/j.aquaculture.2019.03.025\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eBhat IA, Rather MA, Saha R, Ganie PA, Sharma R (2017) Identification and expression analysis of thyroid stimulating hormone receptor (TSHR) in fish gonads following LHRH treatment. Proceedings of the National Academy of Sciences, India Section B: Biological Sciences 87:719-726. https://doi.org/10.1007/s40011-015-0640-8\u003c/li\u003e\n\u003cli\u003eBock SL, Chow MI, Forsgren KL, Lema SC (2021) Widespread alterations to hypothalamic-pituitary-gonadal (HPG) axis signaling underlie high temperature reproductive inhibition in the eurythermal sheepshead minnow (\u003cem\u003eCyprinodon variegatus\u003c/em\u003e). Mol \u0026amp; Cel Endocrinol 537:1-16, 111447. \u003cstrong\u003ehttps://doi.org/10.1016/j.mce.2021.111447\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eBromage N, Porter M, Randall C (2001) The environmental regulation of maturation in farmed finfish with special reference to the role of photoperiod and melatonin. Aquacult 197(1-4):63-98. \u003cstrong\u003ehttps://doi.org/10.1016/S0044-8486(01)00583-X\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eBuwono ID, Junianto J, Iskandar I, Alimuddin A (2019a) Growth and expression level of growth hormone in transgenic mutiara catfish second generation. J Biotech Res 10:102\u0026ndash;109\u003c/li\u003e\n\u003cli\u003eBuwono ID, Junianto J, Iskandar I, Alimuddin A (2019b) Reproduction performance of transgenic Mutiara catfish (G1) comprising the growth hormone gene. J Biotech Res 10:199-212\u003c/li\u003e\n\u003cli\u003eBuwono ID, Iskandar I, Grandiosa R (2021) Growth hormone transgenesis and feed composition influence growth and protein and amino acid content in transgenic G 3 mutiara catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e). Aquacult Int 29:431\u0026ndash;451. \u003cstrong\u003ehttps://doi.org/10.1007/s10499-020-00628-8\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eBuwono ID, Iskandar I, Grandiosa R (2023) CgGH and IGF-1 expression level and growth response of G4 transgenic mutiara strain catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e) reared at different stocking densities. Aquacult Int 31(2):827-846. https://doi.org/10.1007/s10499-022-01002-6\u003c/li\u003e\n\u003cli\u003eCampbell B, Dickey J, Beckman B, Young G, Pierce A, Fukada H, Swanson P (2006) Previtellogenic oocyte growth in salmon: relationships among body growth, plasma insulin-like growth factor-1, estradiol-17beta, follicle-stimulating hormone and expression of ovarian genes for insulin-like growth factors, steroidogenic-acute regulatory protein and receptors for gonadotropins, growth hormone, and somatolactin. Biol Reprod 75(1):34-44. https://doi.org/10.1095/biolreprod.105.049494 \u003c/li\u003e\n\u003cli\u003eChaube R, Sharma S, Senthilkumaran B, Bhat SG, Joy KP (2020) Expression profile of kisspeptin2 and gonadotropin-releasing hormone2 mRNA during photo-thermal and melatonin treatments in the female air-breathing catfish \u003cem\u003eHeteropneustes fossilis\u003c/em\u003e. Fish Physiol Biochem 46:2403-2419. https://doi.org/10.1007/s10695-020-00888-4 \u003c/li\u003e\n\u003cli\u003eChen QL, Luo Z, Tan XY, Pan YX, Zheng JL, Zou M (2014) Molecular cloning and mRNA tissue expression of thyroid hormone receptors in yellow catfish \u003cem\u003ePelteobagrus fulvidraco\u003c/em\u003e and Javelin goby \u003cem\u003eSynechogobius hasta\u003c/em\u003e. Gene 536(2):232-237. https://doi.org/10.1016/j.gene.2013.12.035\u003c/li\u003e\n\u003cli\u003eChen H, Hu Q, Kong L, Rong H, Bi B (2022) Effects of Temperature on the Growth Performance, Biochemical Indexes and Growth and Development-Related Genes Expression of Juvenile Hybrid Sturgeon (\u003cem\u003eAcipenser baerii\u003c/em\u003e♀\u0026times; \u003cem\u003eAcipenser schrenckii\u003c/em\u003e♂). Water 14(15):2-18. https://doi.org/10.3390/w14152368\u003c/li\u003e\n\u003cli\u003eCrisanti P, Omri B, Hughes EJ, Meduri G, Hery C, Clauser E, Jacquemin C, Saunier B (2001) The expression of thyrotropin receptor in the brain. Endocrinol 142(2):812-822. https://doi.org/10.1210/endo.142.2.7943\u003c/li\u003e\n\u003cli\u003eDavid D, Degani G (2011) Temperature affects brain and pituitary gene expression related to reproduction and growth in the male blue gouramis, \u003cem\u003eTrichogaster trichopterus\u003c/em\u003e. J Experiment Zool Part A: Ecological Genetics and Physiology 315(4): 203-214. https://doi.org/10.1002/jez.663 \u003c/li\u003e\n\u003cli\u003eGomez JM, Mourot B, Fostier A,Le Gac F (1999) Growth hormone receptors in ovary and liver during gametogenesis in female rainbow trout (Oncorhynchus mykiss). J Reprod Fert 115:275-285. \u003cstrong\u003ehttps://doi.org/10.1530/jrf.0.1150275\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eGopal RN, Kumar P, Lal B (2014) Temperature dependent action of growth hormone on somatic growth and testicular activities of the catfish, \u003cem\u003eClarias batrachus\u003c/em\u003e. Gen Comp Endocrinol 195:125-131. https://doi.org/10.1016/j.ygcen.2013.11.003\u003c/li\u003e\n\u003cli\u003eHabibi HR, Nelson ER, Allan ERO (2012) New insights into thyroid hormone function and modulation of reproduction in goldfish. Gen Comp Endocrinol 175(1):19-26. https://doi.org/10.1016/j.ygcen.2011.11.003\u003c/li\u003e\n\u003cli\u003eHermelink B, Wuertz S, Trubiroha A, Rennert B, Kloas W, Schulz C (2011) Influence of temperature on puberty and maturation of pikeperch, \u003cem\u003eSander lucioperca\u003c/em\u003e. Gen Comp Endocrinol 172(2):282-292. https://doi.org/10.1016/j.ygcen.2011.03.013\u003c/li\u003e\n\u003cli\u003eJia Y, Lei J (2019) Molecular function of gonadotrophins and their receptors in the ovarian development of turbot (\u003cem\u003eScophthalmus maximus\u003c/em\u003e). Gen Comp Endocrino 277:17-19. https://doi.org/10.1016/j.ygcen.2019.02.014\u003c/li\u003e\n\u003cli\u003eKazeto Y, Goto-Kazeto R, Trant JM. Membrane-bound progestin receptors in channel catfish and zebrafish ovary: changes in gene expression associated with the reproductive cycles and hormonal reagents. Gen Comp Endocrinol. 2005 May 15;142(1-2):204-11. doi: 10.1016/j.ygcen.2005.01.017\u003c/li\u003e\n\u003cli\u003eLema SC, Chow MI, Dittman AH, May D, Housh MJ (2022) Accustomed to the heat: Temperature and thyroid hormone influences on oogenesis and gonadal steroidogenesis pathways vary among populations of Amargosa pupfish (\u003cem\u003eCyprinodon nevadensis amargosae\u003c/em\u003e). Comp Biochem Physiol Part A: Molecular \u0026amp; Integrative Physiology 272:1-14. 111280. https://doi.org/10.1016/j.cbpa.2022.111280\u003c/li\u003e\n\u003cli\u003eLevavi-Sivan B, Bogerd J, Ma\u0026ntilde;an\u0026oacute;s EL, G\u0026oacute;mez A, Lareyre JJ (2010) Perspectives on fish gonadotropins and their receptors. Gen Comp Endocrinol 165(3):412-437. https://doi.org/10.1016/j.ygcen.2009.07.019\u003c/li\u003e\n\u003cli\u003eLevy G, David D, Degani G (2011) Effect of environmental temperature on growth-and reproduction-related hormones gene expression in the female blue gourami (\u003cem\u003eTrichogaster trichopterus\u003c/em\u003e). Comp Biochem Physiol Part A: Molecular \u0026amp; Integrative Physiology 160(3):381-389. https://doi.org/10.1016/j.cbpa.2011.07.007\u003c/li\u003e\n\u003cli\u003eLi WS, Lin HR, Wong AOL (2002) Effects of gonadotropin-releasing hormone on growth hormone secretion and gene expression in common carp pituitary. Comp Biochem Physiol 132B:335\u0026ndash;341. https://doi.org/10.1016/S1096-4959(02)00039-8\u003c/li\u003e\n\u003cli\u003eLiu Y, Lin H (2017) Genetic analysis of the reproductive axis in fish using genome-editing nucleases. Science bulletin, 62(4):302-308. https://doi.org/10.1016/j.scib.2017.01.002\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using realtime quantitative PCR and the 2\u0026minus;△△CT method. Methods 25:402\u0026ndash;408. https://doi.org/10.1006/meth.2001.1262\u003c/li\u003e\n\u003cli\u003eMa Y, Ladisa C, Chang JP, Habibi HR (2020) Seasonal related multifactorial control of pituitary gonadotropin and growth hormone in female goldfish: Influences of neuropeptides and thyroid hormone. Frontiers in endocrinology 11:1-21. 175. https://doi.org/10.3389/fendo.2020.00175\u003c/li\u003e\n\u003cli\u003eMaddock, D. M., \u0026amp; Burton, M. P. M. (1998). Gross and histological observations of ovarian development and related condition changes in American plaice. \u003cem\u003eJournal of Fish Biology\u003c/em\u003e, \u003cem\u003e53\u003c/em\u003e(5), 928-944.\u003c/li\u003e\n\u003cli\u003eMateos J, Mananos E, Carrillo M, Zanuy S (2002) Regulation of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) gene expression by gonadotropin-releasing hormone (GnRH) and sexual steroids in the Mediterranean Sea bass. Comp Biochem Physiol Part B: Biochemistry and Molecular Biology 132(1):75-86. https://doi.org/10.1016/S1096-4959(01)00535-8\u003c/li\u003e\n\u003cli\u003eMelamed P, Rosenfeld H, Elizur A, Yaron Z (1998) Endocrine regulation of gonadotropin and growth hormone gene transcription in fish. Comp Biochem Physiol Part C: Pharmacology, Toxicology and Endocrinology 119(3):325-338. https://doi.org/10.1016/S0742-8413(98)00021-8\u003c/li\u003e\n\u003cli\u003eMigaud H, Wang N, Gardeur JN, Fontaine P (2006) Influence of photoperiod on reproductive performances in Eurasian perch \u003cem\u003ePerca fluviatilis\u003c/em\u003e. Aquacult 252(2-4):385-393. https://doi.org/10.1016/j.aquaculture.2005.07.029\u003c/li\u003e\n\u003cli\u003eMori T, Devlin RH (1999) Transgene and host growth hormone gene expression in pituitary and nonpituitary tissues of normal and growth hormone transgenic salmon. Mol Cel Endocrinol 149:129\u0026ndash;139. https://doi.org/10.1016/S0303-7207(98)00248-2\u003c/li\u003e\n\u003cli\u003eNam YK, Cho HY, Cho YS, No, JK, Kim CG, Kim DS (2001) Dramatically accelerated growth and extraordinary gigantism of transgenic mud loach \u003cem\u003eMisgurnus mizolepis\u003c/em\u003e. Trans Res 10:353\u0026ndash;362. https://doi.org/10.1023/A:1016696104185\u003c/li\u003e\n\u003cli\u003eOhta K, Yamaguchi S, Yamaguchi A, Okuzawa K, Gen K, Kagawa H, Matsuyama M (2002) Biosynthesis of estradiol-17\u0026beta; in the ovarian follicles of the red seabream \u003cem\u003ePagrus major\u003c/em\u003e during vitellogenesis. Fish Sci 68(3):680-687. https://doi.org/10.1046/j.1444-2906.2002.00477.x\u003c/li\u003e\n\u003cli\u003eOjima D, Iwata M (2010) Central administration of growth hormone-releasing hormone and corticotropin-releasing hormone stimulate downstream movement and thyroxine secretion in fall-smolting coho salmon (\u003cem\u003eOncorhynchus kisutch\u003c/em\u003e). Gen Com Endocrinol 168(1):82-87. https://doi.org/10.1016/j.ygcen.2010.04.007\u003c/li\u003e\n\u003cli\u003ePankhurst NW (2016) Reproduction and development. In Fish physiology (Vol. 35, pp. 295-331). Academic Press.\u003c/li\u003e\n\u003cli\u003ePfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:2002\u0026ndash;2007. https://doi.org/10.1093/nar/29.9.e45 \u003c/li\u003e\n\u003cli\u003ePolitis SN, Servili A, Mazurais D, Zambonino-Infante JL, Miest JJ, Tomkiewicz J, Butts IAE (2018) Temperature induced variation in gene expression of thyroid hormone receptors and deiodinases of European eel (\u003cem\u003eAnguilla anguilla\u003c/em\u003e) larvae. Gen Comp Endocrinol 259:54-65. https://doi.org/10.1016/j.ygcen.2017.11.003\u003c/li\u003e\n\u003cli\u003eRaghuveer K, Senthilkumaran B (2010) Cloning and differential expression pattern of vasa in the developing and recrudescing gonads of catfish, \u003cem\u003eClarias gariepinus\u003c/em\u003e. Comp Biochem Physiol Part A: Molecular \u0026amp; Integrative Physiology, 157(1):79-85. https://doi.org/10.1016/j.cbpa.2010.04.017\u003c/li\u003e\n\u003cli\u003eSaha S, Manisana Singh K, Gupta BBP (2020) Season-dependent differential effect of temperature on diurnal rhythm of expression of core clock genes in the pineal organ of an air-breathing catfish, \u003cem\u003eClarias gariepinus\u003c/em\u003e. Biol Rhythm Res, 51(1):120-138. https://doi.org/10.1080/09291016.2018.1525139\u003c/li\u003e\n\u003cli\u003eSchulz RW, van Dijk W, Chaves-Pozo E et al (2012) Sertoli cell proliferation in the adult testis is induced by unilateral gonadectomy in African catfish. Gen Comp Endocrinol 177:160-167. https://doi.org/10.1016/j.ygcen.2012.03.001\u003c/li\u003e\n\u003cli\u003eSingh KM, Saha S, Gupta BBP (2017) Season-dependent effects of photoperiod and temperature on circadian rhythm of arylalkylamine N-acetyltransferase2 gene expression in pineal organ of an air-breathing catfish, \u003cem\u003eClarias gariepinus\u003c/em\u003e. J Photochem Photobiol B: Biology 173:140-149. https://doi.org/10.1016/j.jphotobiol.2017.05.036\u003c/li\u003e\n\u003cli\u003eSingh, A. K., \u0026amp; Lal, B. (2008). Seasonal and circadian time-dependent dual action of GH on somatic growth and ovarian development in the Asian catfish, \u003cem\u003eClarias batrachus\u003c/em\u003e (Linn.): role of temperature. \u003cem\u003eGeneral and Comparative Endocrinology\u003c/em\u003e, \u003cem\u003e159\u003c/em\u003e(1), 98-106.\u003c/li\u003e\n\u003cli\u003eSua-Cespedes CD, David DD, Souto-Neto JA, Lima OG, Moraes MN, de Assis LVM, Castrucci AMDL (2021) Low temperature effect on the endocrine and circadian systems of adult \u003cem\u003eDanio rerio\u003c/em\u003e. Frontiers in Physiology 12:1-18. 707067. https://doi.org/10.3389/fphys.2021.707067\u003c/li\u003e\n\u003cli\u003eSwanson P, Dickey JT, Campbell B (2003) Biochemistry and physiology of fish gonadotropins. Fish Physiol Biochem 28: 53-59. https://doi.org/10.1023/B:FISH.0000030476.73360.07\u003c/li\u003e\n\u003cli\u003eUchida D, Yamashita M, Kitano T, Iguchi T (2004) An aromatase inhibitor or high water temperature induce oocyte apoptosis and depletion of P450 aromatase activity in the gonads of genetic female zebrafish during sex-reversal. Comp Biochem Physiol Part A: Molecular \u0026amp; Integrative Physiology 137(1):11-20. \u003cstrong\u003ehttps://doi.org/10.1016/S1095-6433(03)00178-8\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eUh, M., Khattra, J., \u0026amp; Devlin, R. H. (2006). Transgene constructs in coho salmon (\u003cem\u003eOncorhynchus kisutch\u003c/em\u003e) are repeated in a head-to-tail fashion and can be integrated adjacent to horizontally-transmitted parasite DNA. \u003cem\u003eTransgenic research\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e, 711-727.\u003c/li\u003e\n\u003cli\u003eUzbekova, S., Amoros, C., Cauty, C., Mambrini, M., Perrot, E., Hew, C. L., Chourrout, D \u0026amp; Prunet, P. (2003). Analysis of cell-specificity and variegation of transgene expression driven by salmon prolactin promoter in stable lines of transgenic rainbow trout. \u003cem\u003eTransgenic research\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e, 213-227.\u003c/li\u003e\n\u003cli\u003eWong AO, Zhou H, Jiang Y, Ko WK (2006) Feedback regulation of growth hormone synthesis and secretion in fish and the emerging concept of intrapituitary feedback loop. Comp Biochem Physiol Part A: Molecular \u0026amp; Integrative Physiology, 144(3):284-305. \u003cstrong\u003ehttps://doi.org/10.1016/j.cbpa.2005.11.021\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eYaron Z, Levavi-Sivan B (2006) Reproduction. In: Evans DH and Claibourne JB (eds.) The Physiology of Fishes, 3rd edn., pp.343\u0026ndash;386. Boca Raton, FL: CRC Press/Taylor and Francis\u003c/li\u003e\n\u003cli\u003eYu, Y., Chen, M., Lu, Z. Y., Liu, Y., Li, B., Gao, Z. X., \u0026amp; Shen, Z. G. (2022). High-temperature stress will put the thermo-sensitive teleost yellow catfish (Tachysurus fulvidraco) in danger through reducing reproductivity. \u003cem\u003eEcotoxicology and environmental safety\u003c/em\u003e, \u003cem\u003e239\u003c/em\u003e: 1-12.\u003c/li\u003e\n\u003cli\u003eZhang, M. Q., Chen, C. X., Guo, Y. J., Guo, J., \u0026amp; Wang, X. M. (2009). Cloning and sequence analysis of full-length growth hormone cDNA from Clarias gariepinus. \u003cem\u003eActa Agric Boreali-Sinica\u003c/em\u003e, \u003cem\u003e24\u003c/em\u003e: 27-32.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Temperature, THRr-GnRHr-FSHr, G5 transgenic mutiara catfish, Oocyte growth, GH-E2, Transgenesis-GH","lastPublishedDoi":"10.21203/rs.3.rs-4580855/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4580855/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study aims to determine the impact of temperature upon the relative expression ratio of thyroid hormone receptor (\u003cem\u003eTHRr\u003c/em\u003e), gonadotrophin-releasing hormone receptor (\u003cem\u003eGnRHr\u003c/em\u003e), follicle stimulating hormone receptor (\u003cem\u003eFSHr\u003c/em\u003e) and ꞵ-actin genes as internal control expression in transgenic G5 mutiara female catfish and non-transgenic catfish using real-time PCR. In addition, the expression of growth hormone (\u003cem\u003eGH\u003c/em\u003e) and estradiol (\u003cem\u003eE2\u003c/em\u003e) levels which both induced gonadal growth was further observed. The temperature treatment (A: 22\u0026deg;C; B: 26\u0026deg;C; C: 30\u0026deg;C for transgenic fish; and A*: 22\u0026deg;C; B*: 26\u0026deg;C; C*: 30\u0026deg;C for non-transgenic fish) were designed with 6 replicates (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6) during a 60-day rearing period. A warm temperature (26\u0026deg;C) was the optimum temperature that induced \u003cem\u003eTHRr\u003c/em\u003e, \u003cem\u003eGnRHr\u003c/em\u003e, \u003cem\u003eFSHr\u003c/em\u003e gene expressions (means, 3.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69, 4.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.62, 7.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43 respectively) and induced higher \u003cem\u003eGH\u003c/em\u003e (means, 6.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.78 ng/ml) and \u003cem\u003eE2\u003c/em\u003e (means 5.78\u0026thinsp;\u0026plusmn;\u0026thinsp;1.05 ng/ml) levels leading to an increase in transgenic ovary weight (means, 59.90\u0026thinsp;\u0026plusmn;\u0026thinsp;2.20 g) in transgenic fish higher than non-transgenic. Meanwhile, low temperature (22\u0026deg;C) and high temperature (30\u0026deg;C) caused a decrease in the expression levels of \u003cem\u003eTHRr\u003c/em\u003e, \u003cem\u003eGnRHr\u003c/em\u003e, \u003cem\u003eFSHr\u003c/em\u003e for transgenic fish and for non-transgenic fish. The presence of \u003cem\u003eCgGH\u003c/em\u003e in G5 transgenic catfish was able to maintain adequate \u003cem\u003eGH\u003c/em\u003e levels and has the potential to stimulate the growth of female gonads at high temperatures (30\u0026deg;C).\u003c/p\u003e","manuscriptTitle":"Impact of Temperature Upon Expression Levels of Thrr, Gnrhr, and Fshr Leading to Gonadal Maturation of G5 Transgenicmutiara Strain Female Catfish (Clarias Gariepinus)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-04 06:39:37","doi":"10.21203/rs.3.rs-4580855/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cdcc19a0-35f5-4965-a717-002eab9b1b28","owner":[],"postedDate":"July 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-07-12T14:54:47+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-04 06:39:37","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4580855","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4580855","identity":"rs-4580855","version":["v1"]},"buildId":"cTy_lsJlmDsVRNrSptgXS","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}