Enterotoxigenic Escherichia coli heat labile enterotoxin induces cell death and disrupts effector functions of porcine monocytes

Enterotoxigenic Escherichia coli heat labile enterotoxin induces cell death and disrupts effector functions of porcine monocytes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Enterotoxigenic Escherichia coli heat labile enterotoxin induces cell death and disrupts effector functions of porcine monocytes Jinglin Ma, Hans Van der Weken, Leen Hermans, Matthias Dierick, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5896206/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Jul, 2025 Read the published version in Veterinary Research → Version 1 posted You are reading this latest preprint version Abstract Enterotoxigenic Escherichia coli (ETEC) is a common cause of diarrhea in human and animals, including pigs. Enterotoxins are important virulence factors for ETEC. Although a lot is known on the mechanism of enterotoxin-induced diarrhea, less is known about their effects on innate immune cells like monocytes. Monocytes can differentiate into macrophages and dendritic cells and play a pivotal role as a bridge between the innate and adaptive immune system. Understanding the interaction between ETEC enterotoxins and monocytes can help in the development of more effective preventive and therapeutic strategies to combat this disease. In this study, we aimed to investigate the effects of the heat labile enterotoxin (LT) and the heat stable enterotoxin a (STa) produced by ETEC on porcine monocytes. Our results show that STa did not affect the cell viability and effector functions of monocytes. LT, on the other hand, decreased the cell viability of monocytes. While LT did not alter the production of reactive oxygen species (ROS) production by monocytes, it significantly reduced ROS production induced by phorbol 12-myristate 13-acetate (PMA). In addition, LT decreased the phagocytosis of E. coli by monocytes and enhanced the survival of intracellular ETEC. Furthermore, LT triggered the production of cytokines IL-1β, IL-6 and TNF-α as well as chemokines CCL-3 and CXCL-8. Together, our results show that in contrast to STa, LT can cause cell death in monocytes and disrupt their immune effector functions, potentially acting as an immune evasion strategy to establish infection. heat labile enterotoxin heat stable enterotoxin monocytes immune evasion pig Figures Figure 1 Figure 2 Figure 3 Figure 4 1 Introduction Enterotoxigenic Escherichia coli (ETEC) is a common cause of diarrhea in children and travelers 1 . ETEC infections also cause morbidity and mortality in farm animals, including piglets, leading to significant economic losses to pig farmers. In ETEC-induced diarrhea, the heat labile enterotoxin (LT) and heat stable enterotoxins (ST) enterotoxins secreted by ETEC play a crucial role. Upon secretion, LT enters the host gut epithelial cells through binding with ganglioside M1 (GM1). Once internalized, LT activates adenylate cyclase, which results in an increase in intracellular cyclic adenosine monophosphate (cAMP) levels. The latter in turn activates protein kinase A (PKA), which modulates the activation of membrane ion channels, ultimately leading to the secretion of electrolytes and water into the intestinal lumen 2 , 3 . To date, two distinct types of ST, namely STa and STb, have been identified. The initial phase in STa-induced diarrhea involves the activation of guanylate cyclase C (GC-C) on gut epithelial cells. This leads to increased cyclic guanosine monophosphate (cGMP) levels and subsequent activation of cGMP-dependent protein kinase II (cGMPKII). These molecular cascades induce the secretion of chloride and bicarbonate ions, while inhibiting Na + uptake, thereby causing diarrhea 3 . Although the pathways activated by the enterotoxins in gut epithelial cells that lead to diarrhea during ETEC infections are well-established, less is known about the ability of STs to regulate immune responses. The effect of ST on immune cells is increasingly gaining attention 4 . A recent study demonstrated that STa induces rapid and transient expression of interleukin IL-33 and IL-1Ra in human gut epithelial cells 5 . Additionally, mice deficient in the IL-33 receptor show a reduced susceptibility to STa compared to wildtype mice 6 . In contrast to STs, LT is known to activate immune cells and to enhance cellular and humoral immune responses to antigens 7 . In-depth investigations have elucidated the underlying mechanisms. Some studies indicated that enhancement of T cell proliferation was linked to the functional activation of dendritic cells induced by LT 8 , 9 . However, previous results suggest that the mechanism is complex and various immune cells are involved in this immunomodulation process. For example, in a mice model, administration of LT enhanced the production of IL-1β by dendritic cells 10 . On the other hand, another study indicated that LT-IIa and LT-IIb could suppress the production of IL-1β induced by LPS in THP-1 cells 11 . Furthermore, previous studies have indicated that LT could enhance the antigen uptake by the dendritic cells 12 , 13 , while a recent study demonstrated that LT inhibited the phagocytosis of ETEC by murine macrophages 14 . Although the effect of LT on certain immune cell populations is well established, its effect on monocytes, precursors to macrophages and dendritic cells, remains poorly understood, particularly in pigs. Monocytes play a pivotal role as bridge between the innate and adaptive immune systems. Equipped with various pattern recognition receptors, they can detect both pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) 15 . Upon recognizing these signals, monocytes become activated and undergo chemotaxis, migrating towards the infection site. Once there, they exhibit a certain plasticity by differentiating into either macrophages or dendritic cells, influenced by local cues and signals. This versatility allows monocytes to contribute to tissue homeostasis 16 . Moreover, monocytes themselves serve as antigen-presenting cells, possessing the ability to capture, process, and deliver antigens to T cells, thereby facilitating the coordination of the host immune response 17 . Here, we investigated the effect of LT and STa on the function of porcine monocytes. The obtained findings contribute to a deeper understanding of the immunoregulation by LT and STa. 2 Materials and methods 2.1 Enterotoxins LT was purified from the supernatant of ETEC strain IMM07 as previously described 18 . STa used in this study was purchased from Bachem company (Bubendorf, Switzerland). 2.2 Isolation and culture of monocytes Monocytes were isolated as described previously 19 . In brief, peripheral blood was collected from 10- to 24-week-old pigs via the jugular vein. Then, the PBMCs were isolated by density gradient centrifugation on lymphoprep (Axis-Shield, Dundee, UK). Isolated PBMCs were incubated with mouse anti-porcine CD14 antibodies (clone MIL-2, in-house production) for 40 min. After washing, cells were incubated with secondary goat-anti-mouse IgG Microbeads (Miltenyi, Bergisch Gladbach, Germany) for another 20 min. Subsequently, cells were diluted in 5 mL PBS-EDTA + 1% FCS and applied onto a LS column (Miltenyi) to obtain CD14 + cells. This cell population had a purity exceeding 95% and a cell viability exceeding 90%, as assessed by flow cytometry (Cytoflex, Beckman Coulter Biosciences, Indianapolis, USA). Purified monocytes were resuspended at a density of 2×10 6 cells/mL in phenol red-free RPMI 1640 medium (Gibco, Waltham, USA) containing 10% fetal calf serum (FCS, Gibco) and 1% penicillin/streptomycin (Gibco). The pigs (females, 10 to 24-week-old) used as blood donors were housed under standard conditions. All animal experiments were approved by the animal care and ethics committee of the Faculty of Veterinary Medicine, Ghent University (EC2017/121 and EC2023/22)). 2.3 LT binding assay The binding of LT to the membrane of monocytes was assessed using flow cytometry. Monocytes were seeded at 2×10⁵ cells per well in 96-well plates and incubated at 37°C with 5% CO 2 for 1 hour. Subsequently, monocytes were incubated with 0, 20, or 500 ng/mL LT for an additional 30 min on ice. After incubation, the monocytes were washed three times with ice-cold PBS and then incubated for 3 h on ice with rabbit anti- E. coli LT polyclonal antibody (1:300, Abcam, Cambridge, UK) in ice-cold PBS containing 1% FCS. Following three washes with ice-cold PBS, the monocytes were stained for 1 h on ice with PE-labeled goat anti-rabbit IgG polyclonal antibody (1:300, Invitrogen, Waltham, USA) in ice-cold PBS. After three more washes, the monocytes were stained with the viability dye Sytox™ Blue (1 μM, Invitrogen, Carlsbad, CA, USA) in PBS and analyzed by flow cytometry (Cytoflex, Beckman Coulter). Data were analyzed using CytExpert software (Beckman Coulter). For the GM1 inhibition assay, 0, 25, or 500 ng LT was preincubated with 1 μg GM1 (Sigma, Saint Louis, USA) for 2 h at 37°C before being added to the monocytes. 2.4 cAMP ELISA Monocytes were cultured in 24-well plate at a density of 2×10 6 cells /well. After a 1 h incubation period, monocytes (2×10 6 cells/well) were subsequently pretreated with either LT (0, 20 and 500 ng/ml) for another 1 h at 37°C. After centrifugation, the cell supernatants were collected, and monocytes were lysed with 0.1 M HCl to stop endogenous phosphodiesterase activity. After centrifugation at 660g for 10 min at room temperature to remove cellular debris, the cellular lysates were collected. The cAMP level in the monocyte supernatants and lysates was assayed using a Direct cAMP ELISA Kit (Enzo Life Sciences, New York, USA), following the manufacturer's guidelines. 2.5 Cell viability assay To assess the viability of monocytes, we used propidium iodide (PI, Sigma) to stain the cells. Monocytes (2×10 5 cells/well) were seeded into 96-well plates and then incubated at 37°C in 5% CO 2 for 1 h to allow the monocytes to settle. Subsequently, the monocytes were treated with 0, 4, 20, 100 and 500 ng/ml LT or 0, 100 and 500 ng/ml STa for 4 h or 24 h. Next, monocytes were harvested and transferred to a 96-well V-bottom plate. They were then resuspended in a 1 μg/ml PI solution. Subsequently, the cell viability was analyzed using a flow cytometer from Beckman Coulter, and the resulting data were analyzed using CytExpert software (Beckman Coulter). Doublets were excluded based on FSC-H/FSC-A and SSC-H/SSC-A. A minimum of 10,000 events were counted for each analysis. 2.6 Phagocytosis ass ay Monocytes (2×10 5 cells/well) were pretreated with either LT (0, 4 20, 100 and 500 ng/ml) or STa (0, 100 and 500 ng/ml) for 2 or 8 h at 37°C. Next, 6×10 6 of pHrodo TM red-labeled Escherichia coli particles (Invitrogen) were added to the cells and then incubated at 37°C for an additional 2 h. Subsequently, the monocytes were carefully collected into a 96-well V-bottom plate and were washed three times with cold PBS to remove free-floating E. coli particles. Then, the monocytes were resuspended in 100 μL of PBS containing Sytox TM Blue (1 μM, Invitrogen) and incubated for 10 min at 4°C. Finally, the monocytes were analyzed using flow cytometry (Beckman Coulter) and the resulting data were analyzed using CytExpert software (Beckman Coulter). To measure the effects of LT on the survival of ETEC phagocytosed by porcine monocytes, isolated monocytes were added into 96-well plate at the density of 3×10 5 cells/well. After a rest periode at 37°C for 2 h, monocytes were pretreated with LT (0, 100 and 500 ng/ml) for 24 h at 37°C. Next, 9×10 5 of ETEC were added to the cells and then incubated at 37°C for an additional 2 h to allow phagocytosis. In this assay, three ETEC strains were utilized: GIS26 (O149:K91, F4ac, LT + STa + STb + ) 20 , LT deletion mutant GIS26 (GIS26ΔLT) (O149:K91, F4ac, LT - STa - STb + ) 20 and 2134P (O157, F18ac, LT - STa + STb + ) 21 . Subsequently, the monocytes were collected and transferred to a 96-well V-bottom plate and were three washed three times with cold PBS to remove free-floating ETEC. Then, the monocytes were resuspended in 100 μL of RPMI 1640 medium containing 100 µg/ml gentamicin and incubated for 1 h at 37°C to kill extracellular bacteria. After washing 3 times with cold PBS to remove gentamicin, monocytes were lysed with 200 μl distilled water at room temperature. Finally, 10 μL of the lysate containing intracellular ETEC was plated on brain heart infusion (BHI, Thermo Fisher Scientific) agar to quantify the number of surviving ETEC. 2.7 Analysis of reactive oxygen species (ROS) production We conducted a luminol chemiluminescence assay to assess the production of reactive oxygen species (ROS) by monocytes under two experimental conditions. To measure the ROS production induced by LT, STa and ETEC, monocytes (2×10 5 cells/well) were plated in a 96-well white microplate. After a 1 h incubation period, we replaced the culture medium with 175 μL of a luminol solution at 100 μg/mL. Subsequently, 25 μL of either LT (0, 32, 160, 800 and 4000 ng/mL), STa (0, 800 and 4000 ng/mL) or ETEC (GIS26ΔLT; 1.6×10 8 , 1.6×10 7 and 1.6×10 6 CFU/mL) were added, following a 5 min background measurement. Chemiluminescence was continuously monitored at 5 min intervals for a total of 2 h at 37°C using a Luminoskan Microplate Readers (MTX lab system, Vienna, USA). As a positive control, monocytes were stimulated with 50 μg/mL of phorbol myristate acetate (PMA, Sigma). To investigate the effect of LT and STa on PMA-, MacroGard ® β-glucan (Biotec Pharmacon ASA, Tromsø, Norway)- and ETEC-induced ROS production, monocytes were first pretreated with LT or STa for either 2 or 8 h. Subsequently, the culture medium was replaced with 175 μL of a 100 μg/mL luminol solution to measure background for 5 min, followed by the addition of 25 μL of the PMA (400 μg/mL), β-glucan (4 mg/mL) and GIS26ΔLT (1.6×10 8 CFU/mL) ETEC solution. Chemiluminescence was also recorded at 5 min intervals over a 2 h period at 37°C. 2.8 RT-qPCR Porcine monocytes were stimulated with LT (0, 20 and 500 ng/ml) or STa (0 and 500 ng/ml) treatment for either 2 or 8 h. Following treatment, monocytes were harvested, and total RNA was extracted using the Qia Shredder and RNeasy Mini Kit from Qiagen, adhering to the manufacturer's guidelines. RNA quantity and purity were determined using microvolume UV-Vis spectrophotometry (DeNovix, Wilmington, USA), while RNA integrity was assessed by running samples on denaturing agarose gels stained with ethidium bromide (EtBr, Sigma). To remove potential genomic DNA contamination, RNA (500 ng) was treated with RQ1 RNase-Free DNase (Promega, Madison, USA). Subsequently, the treated RNA was reverse transcribed into cDNA using the SuperScript III Reverse Transcriptase kit from Invitrogen, supplemented with a ribonuclease inhibitor (RNase OUT; Invitrogen) as per the manufacturer's instructions. The resulting cDNA served as a template for quantitative polymerase chain reaction (qPCR) assays. Primers (Table 1) were designed with Primer-BLAST (NIH, USA) or taken from literature and synthesized by Integrated DNA Technologies (IDT, Coralville, IA). Quantitative PCR was carried out using 25 ng of cDNA template, perimers at 250 nM, and an annealing temperature of 60℃ on a StepOnePlus real-time PCR system (Applied Biosystems, Waltham, USA) and SYBR green master mix (Applied Biosystems) in a total volume of 20 μL, following the manufacturer's protocol. Data analysis was performed using the double delta threshold cycle method, with normalization to the expression levels of reference genes (β-actin and GAPDH) and control conditions. The selection of reference genes was based on geNorm analysis using qBase+ software. Table 1. Sequences of primers used in the qPCR assay. Target Accession number Primer Sequence Reference β-actin AY550069 Fw: TCATCACCATCGGCAACG 22 Rv: TTCCTGATGTCCACGTCGC GAPDH AF017079 Fw: GGGCATGAACCATGAGAAGT 23 Rv: AAGCAGGGATGATGTTCTGG IL1β NM_214055.1 Fw: AGCCCAATTCAGGGACCCTAC - Rv: TGCCTGATGCTCTTGTTCCA IL6 NM_214399.1 Fw: CCTGAGATTGATGCCGTCCA - Rv: TCTTCAAGCCGTGTAGCCAT TNFα NM_214022 Fw: ACTGCACTTCGAGGTTATCGG 19 Rv: GGCGACGGGCTTATCTGA CXCL8 NM_213867.1 Fw: GACCCCAAGGAAAAGTGGGT - Rv: TGACCAGCACAGGAATGAGG CCL2 NM_214214.1 Fw: CCAGGACTCCATAAGCCACC - Rv: CAATGTGCCCAAGTCTCCGT CCL3L1 NM_001009579.1 Fw: CCTCGCAAATTCGTAGCCGA - Rv: TCAGCTCCAGGTCAGAGATGT CCL5 NM_001129946.1 Fw: TGCTTCTTGCTCTTGTCCCA - Rv: GTGCCAAGGGTCCAAAGTTC Fw, Forward primer; Rv, reverse primer. 2.9 Cytokine and chemokine ELISA Monocytes (1×10 6 cells/well) were seeded in a 24-well microplate. These monocytes were then treated with LT (0, 20 and 500 ng/ml) or STa (0 and 500 ng/ml) for 4 or 24 h. Following the treatment period, the supernatant was carefully collected and centrifuged (400g, 5 min, 4°C) to remove residual monocytes. The concentrations of IL1β, IL6, CXCL8, and TNFα in the supernatant were then quantified using commercial ELISA kits from R&D systems (Minneapolis, USA) following the manufacturer's instructions. The concentrations of CCL2 and CCL3 in the supernatant were then quantified using commercial ELISA kits from Kingfisher Biotech (Saint Paul, USA) according to the manufacturer's instructions. 2.10 Statistical analysis The experimental data are expressed as mean ± standard deviation (SD). All statistical analysis was performed with IBM SPSS Statistics 26 (USA). We assessed the homogeneity of variances among groups using Levene's test. For comparisons between two groups, a two-tailed paired Student’s t -test was used. For the comparisons of three to five groups, we used one-way ANOVA with Tukey’s multiple comparison test or a Friedman test was used if normality tests did not pass. Probability values ( P ) of 0.05 or less were considered significant. 3 Results 3.1 Assessing the binding and cytotoxic effect of LT on porcine monocytes While it is known that type I LT can bind to intestinal epithelial cells via GM1, its binding to porcine immune cells has been rarely investigated. We first explored whether LT could bind to monocytes. Our results demonstrated that LT can bind to porcine monocytes, and that preincubation of LT with GM1 inhibited this binding (Fig. 1A). Upon binding and internalization by epithelial cells, LT is known to activate adenylate cyclase, leading to cAMP production. Therefore, we measured both intracellular and extracellular cAMP levels following LT treatment. As shown in Fig. 1B, LT significantly increased intracellular cAMP production in monocytes, but did not affect extracellular cAMP levels. During infection, some pathogens use their virulence factors to induce the death of immune cells, thereby evading elimination by the immune system 24, 25 . Thus, we also investigated the cytotoxic effects of LT and STa on monocytes. Figure 1C shows a dose-dependent decrease in cell viability after incubating monocytes with LT for 4 h. In contrast, STa stimulation for 4 or 24 h did not induce cell death in monocytes (Fig. 1D). 3.2 The effect of LT and STa on the phagocytosis and intracellular killing by porcine monocytes Phagocytosis is a pivotal function of monocytes in the clearance of pathogens 16 . Recent research indicated that LT decreased the phagocytic ability of RAW 246.7 cells, a murine macrophage cell line 14 . Therefore, our study investigated whether LT and STa could influence the phagocytic activity of porcine monocytes. Likewise, we found that LT decreased the phagocytosis of E. coli by monocytes at a concentration of 100 or 500 ng/mL after an incubation period of 24 h, as shown in Fig. 2A-B. In contrast, STa did not affect the phagocytotic function of monocytes at the tested conditions (Fig. 2C). Although phagocytosis is a highly effective mechanism for clearing most pathogens, a large body of evidence suggests that specific virulence factors of some pathogenic bacteria can disrupt this process 26, 27 . To determine whether LT acts as a protective mechanism for ETEC, we examined the survival of intracellular ETEC upon their phagocytosis by primary monocytes. The results showed that pretreatment of monocytes with 500 ng/mL LT for 24 h significantly reduced their ability to kill all three ETEC strains taken up by the monocytes, thereby enhancing the survival of intracellular ETEC (Fig. 2D). 3.3 LT but not STa decreased the ROS production by monocytes When exposed to microorganisms, monocytes generate reactive oxygen species (ROS) as part of their defense mechanism to eliminate invading pathogens 16 . Therefore, we wondered whether LT or STa could influence the ROS production by porcine monocytes. Figure 3A and C show that neither LT nor STa treatment induced ROS production by porcine monocytes. To understand whether LT or STa affect ROS production by monocytes induced by PMA, a known activator of the respiratory burst response in innate immune cells, monocytes were pretreated with enterotoxins for 4 h or 24 h. While the ROS production induced by PMA remained unaffected after a 4 h pretreatment with LT or STa, after 24 h LT reduced the PMA-induced ROS production by monocytes, even at the lowest tested concentration (4 ng/ml) (Fig. 3B, D). In contrast to LT, STa was unable to alter ROS production induced by PMA (Fig. 3D). To understand whether this effect of LT was specific to PMA, ROS production was induced by β-glucans 28 . As shown in Fig. 3E, LT also decreased the ROS production induced by β-glucans in monocytes. We then investigated whether similar effects could be observed in monocytes in response to ETEC. To avoid influences from LT produced by ETEC, we first used an LT deletion mutant ETEC strain (GIS26ΔLT) to assess if monocytes responded with increased ROS production. As shown in Fig. 3F, treatment with this strain significantly increased the ROS production by monocytes. However, when monocytes were preincubated with LT, the ROS production induced by ETEC was significantly inhibited (Fig. 3G). 3.4 Evaluation of pro-inflammatory cytokine and chemokine responses in porcine monocytes upon LT or STa stimulation In response to perceived danger signals, monocytes can initiate and drive inflammatory responses by releasing a wide range of cytokines and chemokines 16 . In this study, we assessed the expression of key inflammatory mediators, such as IL-1β, IL-6, TNF-α, CCL-2, CCL-3, and CXCL-8, which play important roles in immune cell migration and activation. LT treatment resulted in a dose-dependent increase in the mRNA expression of IL-1β, IL-6, TNF-α, CCL-3 and CXCL-8 after 4 and 24 h of incubation, while STa had no discernible effect on their expression (Fig. 4A). On the other hand, LT regulated transcript levels of CCL-2 in a different pattern (Fig. 4A). At 4 h and 24 h, LT treatment suppressed CCL-2 expression, whereas STa did not influence the transcript levels of CCL-2 (Fig. 4A). To corroborate these findings, we also assessed cytokine and chemokine release using ELISA. As shown in Fig. 4B, LT treatment elicited a significant increase in the secretion of IL-1β and TNF-α by monocytes at both 4 and 24 hours, whereas STa treatment did not affect their secretion. While LT treatment showed no effect on CXCL-8 secretion at 4 h, a significant increase in CXCL-8 levels was observed in the LT group at 24 h (Fig. 4B). Furthermore, neither LT nor STa exhibited a significant impact on the secretion of IL-6 after incubation for 4 h and 24 h (Fig. 4B). 4 Discussion LT and STa are key virulence factors of ETEC, playing crucial roles in ETEC colonization 29 , 30 and ETEC-induced diarrhea 31 . However, their effects on the immune system, especially monocytes, are poorly understood. In this study, we found that while STa did not affect monocyte viability or function, LT induced cell death, reduced monocyte phagocytic and intracellular killing activity and inhibited ROS production by monocytes. Moreover, LT stimulated the release of IL-1β and TNF-α, and the chemokines CCL-3 and CXCL-8. Under healthy conditions, the body maintains a steady number of monocytes through cell proliferation, differentiation, survival, and cell death 17 . This balance can be disturbed by pathogens, some of which have been shown to increase the death of monocytes 24 , 25 . In this study, we showed that LT increased monocyte death. These findings are consistent with previous studies showing that LT can induce apoptosis in lymphocytes 32 , 33 . Further experiments are necessary to evaluate the cytotoxicity of STa and LT on other innate immune cells. The generation of ROS by monocytes is a critical antimicrobial mechanism to control pathogens 34 , 35 and serves as a major signaling molecule in various physiological pathways 36 , 37 . However, excessive oxidative stress can lead to tissue damage and development of diseases 38 , 39 . While previous studies have shown that LT can induce apoptosis in intestinal epithelial cells by increasing ROS production 40 , our findings indicate that neither LT nor STa significantly alter ROS production by monocytes. These results are consistent with those observed in porcine neutrophils, as published in our previous study 18 . Since LT induced cAMP production in both intestinal epithelial cells 41 , neutrophils 18 and monocytes, this suggests that LT may activate similar signaling pathways in both immune and non-immune cells, but with differing outcomes depending on the cell type. Interestingly, we found that pretreatment with LT inhibited ROS production induced by PMA and β-glucans, which are well-known inducers of ROS in porcine monocytes 28 , 42 . However, our previous results showed that LT did not affect the ROS production induced by PMA in neutrophils 18 . This suggests that LT causes different outcomes in different immune cells, even when similar signaling pathways are activated. Although LT did not induce ROS production in monocytes, our results show that an LT deletion mutant ETEC strain significantly increased ROS production by these cells. Oxidative damage in the intestine of piglets has been observed in previous studies following ETEC infection 43 . Additionally, we found that LT can inhibit ETEC-induced ROS production, suggesting that LT secretion by ETEC may be an effective strategy to counteract ROS-mediated elimination by monocytes. Further experiments could be designed to determine whether the presence of LT might enhance ETEC survival in vivo . In fact, it has been reported that many bacterial pathogens can utilize virulence factors, such as catalases of enterohemorrhagic Escherichia coli 44 and staphyloxanthin of Staphylococcus aureus 45 , to resist elimination by immune cells. Monocytes are professional phagocytes, and phagocytosis is a key innate immune mechanism involved in antibacterial immunity 46 . Our results revealed that LT treatment inhibited the ability of monocytes to phagocytose E. coli . This finding on phagocytosis of monocytes is consistent with our previous study showing that LT decreases uptake of E. coli by neutrophils 18 . Virulence factors of other pathogens, like Staphylococcus aureus and enterohaemorrhagic Escherichia coli , are also known to impair phagocytosis 26 , 27 . Our results also showed that pretreatment of LT inhibited the ability of monocytes to kill intracellular ETEC, which might be connected to the LT-induced inhibition of ROS production by monocytes. Interestingly, our results contrast with a previous study using murine macrophages, showing that LT pretreatment reduced the number of live ETEC taken up by these cells 14 . We hypothesize that this discrepancy might be due to cell- or species-specific differences or technical differences between both studies. Further experiments are needed to explore how LT enhances the survival of intracellular ETEC upon their phagocytosis by monocytes. A key function of monocytes is their capacity to produce cytokines and chemokines in response to different stimuli 47 , 48 . These molecules attract and activate various immune cells, playing a central role in the immune defense against pathogens. In this study, porcine monocytes exhibited increased secretion of IL-1β, IL-6, and TNF-α after stimulation with LT for 4 and 24 h. Similar trends have also been observed for IL-1β production in mice dendritic cells 49 . Furthermore, previous studies have shown increased production of IL-1β, IL-6, and TNF-α in human and mice macrophages in response to stimulation with the B subunit of LT 50 . This suggests that further research should investigate whether the B subunit alone is sufficient to induce cytokine production in monocytes. IL-1β, IL-6, and TNF-α are pro-inflammatory cytokines that can lead to the activation of innate and adaptive immune cells. Furthermore, these pro-inflammatory factors play a crucial role in the differentiation of monocytes towards macrophages or dendritic cells 51 . Further experiments might be conducted to better characterize the impact of LT on this differentiation process. Our results also showed that LT treatment significantly increased the expression and production of CCL-3 and CXCL-8. CCL-3 and CXCL-8 are chemokines that attract macrophages and neutrophils separately, which can enhance inflammation at the infection site to eliminate ETEC. Increased production of CXCL-8 induced by B subunit of LT has also been observed in human and mice macrophages 50 . Therefore, further research should investigate whether the B subunit is responsible for the CXCL-8 production in monocytes stimulated by LT. CCL-2, known as monocyte chemoattractant protein-1, can bind to CCR2 and mediate the recruitment of monocytes 47 . In this study, we found that LT treatment decreased the expression of CCL-2 in monocytes, However, the effect of LT on CCL-2 secretion was not statistically significant. 5 Conclusion In conclusion, while STa did not affect monocyte viability or function, LT increased the release of inflammatory mediators by monocytes, which may contribute to the clearance of ETEC infections. However, ETEC-derived LT also induced monocyte cell death and dampened several effector functions of monocytes. Specifically, LT inhibited ROS production induced by PMA, β-glucan, and ETEC, reduced the uptake of E. coli , and enhanced the survival of phagocytosed E. coli . These effects likely provide an advantage for ETEC to evade monocyte immune responses and establish infection. Declarations Conflict of Interest The authors declare no competing interests. Author Contributions J.M. designed and carried out the experiments, performed data analysis and drafted the manuscript. H.V.d.W. assisted in ELISA and flow cytometry. M.D. assisted in purifying LT and flow cytometry. L.H. assisted in flow cytometry and RT-qPCR. E.C. supervised the project and provided critical feedback. B.D. conceived the presented idea, designed the experiments, supervised the project, provided critical feedback and drafted the manuscript. All authors reviewed the manuscript. Acknowledgments J.M. is supported by a PhD grant from the China Scholarship Council (grant number 201906350196). M.D. is supported by the Flemish fund for scientific research (FWO-SB; 3S036319). This research is supported by grants from the Special Research Fund of Ghent University (BOF/STA/202009/021; BOF/BAS/2015/0029/01). Data Availability Statement The data that support the findings of this study are available from the corresponding author upon reasonable request. Source data are provided with this paper. References Khalil, IA, Troeger, T & Blacker, BF (2018) Escherichia coli diarrhoea. Lancet Infect Dis 18 :1305-1305. Doi: 10.1016/S1473-3099(18)30664-9 O'Neal, CJ, Jobling, MG, Holmes, RK & Hol, WG (2005) Structural basis for the activation of cholera toxin by human ARF6-GTP. Science 309 :1093-1096. Doi: 10.1126/science.1113398 Weiglmeier, PR, Rosch, P & Berkner, H (2010) Cure and curse: E. coli heat-stable enterotoxin and its receptor guanylyl cyclase C. Toxins (Basel) 2 :2213-2229. Doi: 10.3390/toxins2092213 Wang, HX, Zhong, ZF, Luo, Y, Cox, E & Devriendt, B (2019) Heat-Stable Enterotoxins of Enterotoxigenic Escherichia coli and Their Impact on Host Immunity. Toxins 11 . Doi: 10.3390/toxins11010024 Motyka, NI, Stewart, SR, Hollifield, IE, Kyllo, TR, Mansfield, JA, Norton, EB, Clements, JD & Bitoun, JP (2021) Elevated Extracellular cGMP Produced after Exposure to Enterotoxigenic Escherichia coli Heat-Stable Toxin Induces Epithelial IL-33 Release and Alters Intestinal Immunity. Infect Immun 89 . Doi: 10.1128/IAI.00707-20 Motyka, NI, Stewart, SR, Porretta, CP, Hollifield, IE, Bauer, DL & Bitoun, JP (2022) Enterotoxigenic Escherichia coli Enterotoxins Regulate Epithelial to Immune Relay of IL-33 and IL-1Ra Cytokines. Infect Immun 90 . Doi: 10.1128/iai.00637-21 Knapp, MPA, Johnson, TA, Ritter, MK, Rainer, RO, Fiester, SE, Grier, JT, Connell, TD & Arce, S (2021) Immunomodulatory regulation by heat-labile enterotoxins and potential therapeutic applications. Expert Rev Vaccines 20 :975-987. Doi: 10.1080/14760584.2021.1945449 Lee, CH, Masso-Welch, P, Hajishengallis, G & Connell, TD (2011) TLR2-dependent modulation of dendritic cells by LT-IIa-B, a novel mucosal adjuvant derived from a type II heat-labile enterotoxin. J Leukocyte Biol 90 :911-921. Doi: 10.1189/jlb.0511236 Liang, S, Hosur, KB, Nawar, HF, Russell, MW, Connell, TD & Hajishengallis, G (2009) In vivo and in vitro adjuvant activities of the B subunit of Type IIb heat-labile enterotoxin (LT-IIb-B) from Escherichia coli . Vaccine 27 :4302-4308. Doi: 10.1016/j.vaccine.2009.05.027 Brereton, CF, Sutton, CE, Ross, PJ, Iwakura, Y, Pizza, M, Rappuoli, R, Lavelle, EC & Mills, KHG (2011) Heat-Labile Enterotoxin Promotes Protective Th17 Responses against Infection by Driving Innate IL-1 and IL-23 Production. J Immunol 186 :5896-5906. Doi: 10.4049/jimmunol.1003789 Hajishengallis, G, Nawar, H, Tapping, RI, Russell, MW & Connell, TD (2004) The type II heat-labile enterotoxins LT-IIa and LT-IIb and their respective B pentamers differentially induce and regulate cytokine production in human monocytic cells. Infect Immun 72 :6351-6358. Doi: 10.1128/Iai.72.11.6351-6358.2004 Lee, CH, Nawar, HF, Mandell, L, Liang, S, Hajishengallis, G & Connell, TD (2010) Enhanced antigen uptake by dendritic cells induced by the B pentamer of the type II heat-labile enterotoxin LT-IIa requires engagement of TLR2. Vaccine 28 :3696-3705. Doi: 10.1016/j.vaccine.2010.03.016 Nawar, HF, Greene, CJ, Lee, CH, Mandell, LM, Hajishengallis, G & Connell, TD (2011) LT-IIc, a new member of the type II heat-labile enterotoxin family, exhibits potent immunomodulatory properties that are different from those induced by LT-IIa or LT-IIb. Vaccine 29 :721-727. Doi: 10.1016/j.vaccine.2010.11.020 Hollifield, IE, Motyka, NI, Fernando, KA & Bitoun, JP (2023) Heat-Labile Enterotoxin Decreases Macrophage Phagocytosis of Enterotoxigenic Escherichia coli . Microorganisms 11 . Doi: 10.3390/microorganisms11082121 Li, DY & Wu, MH (2021) Pattern recognition receptors in health and diseases. Signal Transduct Tar 6 . Doi: 10.1038/s41392-021-00687-0 Guilliams, M, Mildner, A & Yona, S (2018) Developmental and Functional Heterogeneity of Monocytes. Immunity 49 :595-613. Doi: 10.1016/j.immuni.2018.10.005 Jakubzick, CV, Randolph, GJ & Henson, PM (2017) Monocyte differentiation and antigen-presenting functions. Nat Rev Immunol 17 :349-362. Doi: 10.1038/nri.2017.28 Ma, JL, Hermans, L, Dierick, M, van der Weken, H, Cox, E & Devriendt, B (2024) Enterotoxigenic Escherichia coli heat labile enterotoxin affects neutrophil effector functions via cAMP/PKA/ERK signaling. Gut Microbes 16 . Doi: 10.1080/19490976.2024.2399215 Hermans, L, De Pelsmaeker, S, Denaeghel, S, Cox, E, Favoreel, HW & Devriendt, B (2021) beta-Glucan-Induced IL-10 Secretion by Monocytes Triggers Porcine NK Cell Cytotoxicity. Front Immunol 12 :634402. Doi: 10.3389/fimmu.2021.634402 Loos, M, Geens, M, Schauvliege, S, Gasthuys, F, van der Meulen, J, Dubreuil, JD, Goddeeris, BM, Niewold, T & Cox, E (2012) Role of Heat-Stable Enterotoxins in the Induction of Early Immune Responses in Piglets after Infection with Enterotoxigenic Escherichia coli . Plos One 7 . Doi: 10.1371/journal.pone.0041041 Dierick, M, Van der Weken, H, Rybarczyk, J, Vanrompay, D, Devriendt, B & Cox, E (2020) Porcine and Bovine Forms of Lactoferrin Inhibit Growth of Porcine Enterotoxigenic Escherichia coli and Degrade Its Virulence Factors. Appl Environ Microbiol 86 . Doi: 10.1128/AEM.00524-20 Von der Hardt, K, Kandler, MA, Fink, L, Schoof, E, Dotsch, J, Brandenstein, O, Bohle, RM & Rascher, W (2004) High frequency oscillatory ventilation suppresses inflammatory response in lung tissue and microdissected alveolar macrophages in surfactant depleted piglets. Pediatr Res 55 :339-346. Doi: 10.1203/01.Pdr.0000106802.55721.8a Melkebeek, V, Verdonck, F, Goddeeris, BM & Cox, E (2007) Comparison of immune responses in parenteral FaeG DNA primed pigs boosted orally with F4 protein or reimmunized with the DNA vaccine. Vet Immunol Immunop 116 :199-214. Doi: 10.1016/j.vetimm.2007.01.021 Laforge, M, Campillo-Gimenez, L, Monceaux, V, Cumont, MC, Hurtrel, B, Corbeil, J, Zaunders, J, Elbim, C & Estaquier, J (2011) HIV/SIV Infection Primes Monocytes and Dendritic Cells for Apoptosis. Plos Pathog 7 . Doi: 10.1371/journal.ppat.1002087 Melehani, JH, James, DBA, DuMont, AL, Torres, VJ & Duncan, JA (2015) Staphylococcus aureus Leukocidin A/B (LukAB) Kills Human Monocytes via Host NLRP3 and ASC when Extracellular, but Not Intracellular. Plos Pathog 11 . Doi: 10.1371/journal.ppat.1004970 Humphreys, D, Singh, V & Koronakis, V (2016) Inhibition of WAVE Regulatory Complex Activation by a Bacterial Virulence Effector Counteracts Pathogen Phagocytosis. Cell Rep 17 :697-707. Doi: 10.1016/j.celrep.2016.09.039 Itoh, S, Hamada, E, Kamoshida, G, Yokoyama, R, Takii, T, Onozaki, K & Tsuji, T (2010) Staphylococcal superantigen-like protein 10 (SSL10) binds to human immunoglobulin G (IgG) and inhibits complement activation via the classical pathway. Mol Immunol 47 :932-938. Doi: 10.1016/j.molimm.2009.09.027 Sonck, E, Stuyven, E, Goddeeris, B & Cox, E (2010) The effect of beta-glucans on porcine leukocytes. Vet Immunol Immunopathol 135 :199-207. Doi: 10.1016/j.vetimm.2009.11.014 Johnson, AM, Kaushik, RS, Francis, DH, Fleckenstein, JM & Hardwidge, PR (2009) Heat-Labile Enterotoxin Promotes Escherichia coli Adherence to Intestinal Epithelial Cells. J Bacteriol 191 :178-186. Doi: 10.1128/Jb.00822-08 Allen, KP, Randolph, MM & Fleckenstein, JM (2006) Importance of heat-labile enterotoxin in colonization of the adult mouse small intestine by human enterotoxigenic Escherichia coli strains. Infect Immun 74 :869-875. Doi: 10.1128/Iai.74.2.869-875.2006 Dubreuil, JD, Isaacson, RE & Schifferli, DM (2016) Animal Enterotoxigenic Escherichia coli . EcoSal Plus 7 . Doi: 10.1128/ecosalplus.ESP-0006-2016 Tamayo, E, Postigo, J, Del Giudice, G, Rappuoli, R, Benito, A, Yagita, H, Merino, R & Merino, J (2009) Involvement of the intrinsic and extrinsic cell-death pathways in the induction of apoptosis of mature lymphocytes by the heat-labile enterotoxin. Eur J Immunol 39 :439-446. Doi: 10.1002/eji.200838993 Tamayo, E, Merino, R, González-Rojas, J, Marquina, R, Santiuste, I, Amado, JA, Rappuoli, R, Del Giudice, G & Merino, J (2005) The heat-labile enterotoxin induces apoptosis of immature lymphocytes via a glucocorticoid-dependent pathway. Eur J Immunol 35 :3505-3515. Doi: 10.1002/eji.200526326 Novais, FO, Nguyen, BT, Beiting, DP, Carvalho, LP, Glennie, ND, Passos, S, Carvalho, EM & Scott, P (2014) Human classical monocytes control the intracellular stage of Leishmania braziliensis by reactive oxygen species. J Infect Dis 209 :1288-1296. Doi: 10.1093/infdis/jiu013 Pizzolla, A, Hultqvist, M, Nilson, B, Grimm, MJ, Eneljung, T, Jonsson, IM, Verdrengh, M, Kelkka, T, Gjertsson, I, Segal, BH & Holmdahl, R (2012) Reactive oxygen species produced by the NADPH oxidase 2 complex in monocytes protect mice from bacterial infections. J Immunol 188 :5003-5011. Doi: 10.4049/jimmunol.1103430 Gilardini Montani, MS, Santarelli, R, Granato, M, Gonnella, R, Torrisi, MR, Faggioni, A & Cirone, M (2019) EBV reduces autophagy, intracellular ROS and mitochondria to impair monocyte survival and differentiation. Autophagy 15 :652-667. Doi: 10.1080/15548627.2018.1536530 Han, CY, Umemoto, T, Omer, M, Den Hartigh, LJ, Chiba, T, LeBoeuf, R, Buller, CL, Sweet, IR, Pennathur, S, Abel, ED & Chait, A (2012) NADPH oxidase-derived reactive oxygen species increases expression of monocyte chemotactic factor genes in cultured adipocytes. J Biol Chem 287 :10379-10393. Doi: 10.1074/jbc.M111.304998 Degasperi, GR, Denis, RG, Morari, J, Solon, C, Geloneze, B, Stabe, C, Pareja, JC, Vercesi, AE & Velloso, LA (2009) Reactive oxygen species production is increased in the peripheral blood monocytes of obese patients. Metabolism 58 :1087-1095. Doi: 10.1016/j.metabol.2009.04.002 Jacinto, TA, Meireles, GS, Dias, AT, Aires, R, Porto, ML, Gava, AL, Vasquez, EC, Pereira, TMC, Campagnaro, BP & Meyrelles, SS (2018) Increased ROS production and DNA damage in monocytes are biomarkers of aging and atherosclerosis. Biol Res 51 :33. Doi: 10.1186/s40659-018-0182-7 Lu, X, Li, C, Li, C, Li, P, Fu, E, Xie, Y & Jin, F (2017) Heat-Labile Enterotoxin-Induced PERK-CHOP Pathway Activation Causes Intestinal Epithelial Cell Apoptosis. Front Cell Infect Microbiol 7 :244. Doi: 10.3389/fcimb.2017.00244 Wang, HX, Garcia, RS, Cox, E & Devriendt, B (2020) Porcine Enterotoxigenic Strains Differ in Their Capacity To Secrete Enterotoxins through Varying YghG Levels. Appl Environ Microb 86 . Doi: 10.1128/AEM.00523-20 Donne, E, Pasmans, F, Boyen, F, Van Immerseel, F, Adriaensen, C, Hernalsteens, JP, Ducatelle, R & Haesebrouck, F (2005) Survival of Salmonella serovar Typhimurium inside porcine monocytes is associated with complement binding and suppression of the production of reactive oxygen species. Vet Microbiol 107 :205-214. Doi: 10.1016/j.vetmic.2005.01.027 Jin, S, Xu, H, Yang, C & O, K (2024) Regulation of oxidative stress in the intestine of piglets after enterotoxigenic Escherichia coli (ETEC) infection. Biochim Biophys Acta Mol Cell Res 1871 :119711. Doi: 10.1016/j.bbamcr.2024.119711 Wan, B, Zhang, Q, Ni, J, Li, S, Wen, D, Li, J, Xiao, H, He, P, Ou, HY, Tao, J, Teng, Q, Lu, J, Wu, W & Yao, YF (2017) Type VI secretion system contributes to Enterohemorrhagic Escherichia coli virulence by secreting catalase against host reactive oxygen species (ROS). Plos Pathog 13 :e1006246. Doi: 10.1371/journal.ppat.1006246 Clauditz, A, Resch, A, Wieland, KP, Peschel, A & Gotz, F (2006) Staphyloxanthin plays a role in the fitness of Staphylococcus aureus and its ability to cope with oxidative stress. Infect Immun 74 :4950-4953. Doi: 10.1128/IAI.00204-06 Dale, DC, Boxer, L & Liles, WC (2008) The phagocytes: neutrophils and monocytes. Blood 112 :935-945. Doi: 10.1182/blood-2007-12-077917 Serbina, NV, Jia, T, Hohl, TM & Pamer, EG (2008) Monocyte-mediated defense against microbial pathogens. Annu Rev Immunol 26 :421-452. Doi: 10.1146/annurev.immunol.26.021607.090326 Zimmermann, HW, Bruns, T, Weston, CJ, Curbishley, SM, Liaskou, E, Li, KK, Resheq, YJ, Badenhorst, PW & Adams, DH (2016) Bidirectional transendothelial migration of monocytes across hepatic sinusoidal endothelium shapes monocyte differentiation and regulates the balance between immunity and tolerance in liver. Hepatology 63 :233-246. Doi: 10.1002/hep.28285 Brereton, CF, Sutton, CE, Ross, PJ, Iwakura, Y, Pizza, M, Rappuoli, R, Lavelle, EC & Mills, KHG (2011) Escherichia coli Heat-Labile Enterotoxin Promotes Protective Th17 Responses against Infection by Driving Innate IL-1 and IL-23 Production. J Immunol 186 :5896-5906. Doi: 10.4049/jimmunol.1003789 Hajishengallis, G, Tapping, RI, Martin, MH, Nawar, H, Lyle, EA, Russell, MW & Connell, TD (2005) Toll-like receptor 2 mediates cellular activation by the B subunits of type II heat-labile enterotoxins. Infect Immun 73 :1343-1349. Doi: 10.1128/Iai.73.3.1343-1349.2005 Orozco, SL, Canny, SP & Hamerman, JA (2021) Signals governing monocyte differentiation during inflammation. Curr Opin Immunol 73 :16-24. Doi: 10.1016/j.coi.2021.07.007 Cite Share Download PDF Status: Published Journal Publication published 06 Jul, 2025 Read the published version in Veterinary Research → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5896206","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":412021291,"identity":"d4c8bc9b-3b8c-4682-b277-7e1f4579aa5c","order_by":0,"name":"Jinglin Ma","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIie2RsQrCMBCGrxQ6VV0bWvQVTgpBJ18lIDgpOjqIFAo6+jbOgUBdCl0dHOpSHBwqiDiImGZwbDoK5oMcJNzH/UkADIYfxIplyREAuZ146shrojCpDLkz8ZSgUxRMrhF3aTPF3rbEhS1OQA/pg9yXpzX4MdcEa08GDAug6WzvB2nhQZAwjeJSZCiAcqmQjZDBpthMwexa+ORdKfNSp4S5Uo5Th9wiNaXWUFPkIwsXj0UYQiLIJkjqg/V3aViWL9HFbHw+P1ei0/HjvF6JwKk+wq02dlWd+lgAPdn4va311LUbDAbDX/IBcElI42RHKCIAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-7348-7655","institution":"Ghent University: Universiteit Gent","correspondingAuthor":true,"prefix":"","firstName":"Jinglin","middleName":"","lastName":"Ma","suffix":""},{"id":412021292,"identity":"6398249d-3fe7-4828-82f4-8fb0d9a1edf9","order_by":1,"name":"Hans Van der Weken","email":"","orcid":"","institution":"Ghent University: Universiteit Gent","correspondingAuthor":false,"prefix":"","firstName":"Hans","middleName":"Van der","lastName":"Weken","suffix":""},{"id":412021293,"identity":"aaa7451f-29e7-41f5-8cff-a01a3af81645","order_by":2,"name":"Leen Hermans","email":"","orcid":"","institution":"Ghent University: Universiteit Gent","correspondingAuthor":false,"prefix":"","firstName":"Leen","middleName":"","lastName":"Hermans","suffix":""},{"id":412021294,"identity":"5ca483a6-e1fa-44b9-a84e-27de7883a12b","order_by":3,"name":"Matthias Dierick","email":"","orcid":"","institution":"Ghent University: Universiteit Gent","correspondingAuthor":false,"prefix":"","firstName":"Matthias","middleName":"","lastName":"Dierick","suffix":""},{"id":412021295,"identity":"0c524d64-a94d-432b-9046-826215233ae8","order_by":4,"name":"Eric Cox","email":"","orcid":"","institution":"Ghent University: Universiteit Gent","correspondingAuthor":false,"prefix":"","firstName":"Eric","middleName":"","lastName":"Cox","suffix":""},{"id":412021296,"identity":"ed452e03-a7e8-452f-81fc-c6f8b242059b","order_by":5,"name":"Bert Devriendt","email":"","orcid":"https://orcid.org/0000-0002-3222-8769","institution":"Ghent University: Universiteit Gent","correspondingAuthor":false,"prefix":"","firstName":"Bert","middleName":"","lastName":"Devriendt","suffix":""}],"badges":[],"createdAt":"2025-01-24 13:59:43","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5896206/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5896206/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13567-025-01540-w","type":"published","date":"2025-07-06T15:58:08+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":75876650,"identity":"f2b558b6-60ea-45f0-a369-c1cbc61d43e8","added_by":"auto","created_at":"2025-02-10 07:54:04","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5815097,"visible":true,"origin":"","legend":"\u003cp\u003eAssessing the interaction and cytotoxic effect of LT on porcine monocytes.\u003cem\u003e \u003c/em\u003e(A) Monocytes (1x10\u003csup\u003e5\u003c/sup\u003e) were incubated with LT or LT pre-treated with 1 μg/mL GM1 for 1 h at 4°C. The binding of LT to the monocyte membrane was analyzed by immunostaining and flow cytometry\u003cem\u003e.\u003c/em\u003e (B) Monocytes (1x10\u003csup\u003e6\u003c/sup\u003e) were incubated with 0, 20 or 500 ng/mL LT for 1 h at 37°C. The cAMP level in lysed monocytes (left panel) and cell supernatant (right panel) was measured by ELISA.\u003cem\u003e \u003c/em\u003e(C-D) Representative dot plots of monocyte viability upon treatment with LT or STa for 4 h. Monocytes (2x10\u003csup\u003e5\u003c/sup\u003e) were incubated with 0, 4, 20, 100 or 500 ng/mL LT or 0, 100 or 500 ng/mL STa for 4 or 24 h.\u003cem\u003e \u003c/em\u003eThe treated monocytes were stained with PI and analyzed by flow cytometry. n = 3 or 4 individual blood donors. The bars represent the mean ± SD. The data of the binding assay were analyzed with a Friedman test. The data of cAMP level and cell vaibility were analyzed with one-way ANOVA with a post hoc Tukey test to compare LT or STa treatment groups to the control group. *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01. A paired student T test was used to compare two groups with or without GM1. ##, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5896206/v1/0107cfeaf130b2d1ffe12d98.png"},{"id":75876651,"identity":"2a0aa6d2-b1d3-4ecf-9b4f-2e1f3ba72847","added_by":"auto","created_at":"2025-02-10 07:54:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":4845391,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of LT and STa on the phagocytosis\u003cem\u003e \u003c/em\u003eand intracellular killing by porcine monocytes. (A) The gating strategy to assess uptake of pHrodo\u003csup\u003eTM\u003c/sup\u003e red \u003cem\u003eE. coli\u003c/em\u003e by flow cytometry. Sytox blue staining was used to exclude dead cells from the analysis. (B-C) Representative histograms showing the phagocytosis of pHrodo\u003csup\u003eTM\u003c/sup\u003e red \u003cem\u003eE. coli\u003c/em\u003e by monocytes upon incubation with LT (B) or STa (C) for 24 h at the indicated concentrations. Phagocytosis of pHrodo\u003csup\u003eTM\u003c/sup\u003e red \u003cem\u003eE. coli\u003c/em\u003e by monocytes (2x10\u003csup\u003e5\u003c/sup\u003e) after treatment with LT or STa for 4 or 24 h at the indicated concentrations. MFI: mean fluorescence intensity. (D) Monocytes (3 × 10⁵) were pretreated with 0, 100, or 500 ng/mL LT for 24 h and then incubated with 9 × 10⁵ CFU of ETEC (strains GIS26, GIS26ΔLT, and 2134P) for another 2 h to allow phagocytosis. Extracellular bacteria were then killed using 100 μg/mL gentamicin, and monocyte lysates were plated to quantify viable intracellular bacteria. \u0026nbsp;CFU: colony-forming units. n = 3 to 4 individual blood donors. The bars represent the mean ± SD. Data were analyzed with one-way ANOVA with a post hoc Tukey test to compare LT or STa treatment groups to the control group. *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01. A paired student T test was used to compare two groups with or without \u003cem\u003eE. coli\u003c/em\u003e. ###, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001. The data of ETEC survival assay were analyzed with a non-parametric Friedman test *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5896206/v1/7f1abd9ecb38cdf0779df9ee.png"},{"id":75876656,"identity":"6036591e-04d2-4623-a688-41d48a738823","added_by":"auto","created_at":"2025-02-10 07:54:04","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3079573,"visible":true,"origin":"","legend":"\u003cp\u003eLT, but not STa, decreased the PMA, β-glucan and ETEC-induced ROS production by monocytes. (A) Monocytes (2x10\u003csup\u003e5\u003c/sup\u003e) were incubated with 0-500 ng/mL LT or 0-500 ng/mL STa (C) or for 2 h at 37°C. The ROS production of monocytes was analysed by chemiluminescence. RLU: relative light units. (B) Monocytes (2x10\u003csup\u003e5\u003c/sup\u003e) were first pretreated with 0-500 ng/mL LT or STa (D) for 4 or 24 h at 37°C, and then incubated with 50 μg/ml PMA for another 2 h. (E) Monocytes (2x10\u003csup\u003e5\u003c/sup\u003e/well) were first pretreated with 0, 100 and 500 ng/mL LT for 24 h at 37°C, and then incubated with β-glucan (Macrogard; 500 μg/ml) for another 2 h. (F) Monocytes (2x10\u003csup\u003e5\u003c/sup\u003e/well) were incubated with 2x10\u003csup\u003e5\u003c/sup\u003e, 2x10\u003csup\u003e6\u003c/sup\u003e or 2x10\u003csup\u003e7\u003c/sup\u003e CFU GIS26ΔLT for 2 h at 37°C. The ROS production of monocytes was analysed by chemiluminescence. (G) Monocytes (2x10\u003csup\u003e5\u003c/sup\u003e/well) were first pretreated with 0, 100 and 500 ng/mL LT for 24 h at 37 °C, and then incubated with 2x10\u003csup\u003e7\u003c/sup\u003e CFU GIS26ΔLT for another 2 h. n = 3 to 4 individual blood donors. The bars represent the mean ± SD. Data were analysed with one-way ANOVA with a Tukey test to compare LT or STa treatment groups to the control group. **, p \u0026lt; 0.05, **, p \u0026lt; 0.01. A paired student T test was used to compare two groups with or without PMA. ###, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5896206/v1/abf3ff793c7df995e78eb74d.png"},{"id":75876654,"identity":"d7b11f57-d097-433b-af96-73d3410b1454","added_by":"auto","created_at":"2025-02-10 07:54:04","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3859997,"visible":true,"origin":"","legend":"\u003cp\u003eEvaluation of pro-inflammatory cytokine and chemokine responses in porcine monocytes upon LT or STa stimulation. (A) Monocytes (1x10\u003csup\u003e6\u003c/sup\u003e) were treated with LT at the indicated concentrations for 4 or 24 h. IL-1β, IL-6, TNF-α, CCL-2 and CCL-3 and CXCL-8 transcript levels were evaluated by qPCR. (B) IL-1β, IL-6,\u0026nbsp;TNF-α, CCL-2, CCL-3 and CXCL-8 secretion levels were measured by ELISA in the culture supernatant of monocytes (1x10\u003csup\u003e6\u003c/sup\u003e) after treatment with LT or STa at the indicated concentrations for 4 or 24 h. n = 3 to 5 individual blood donors. The bars represent the mean ± SD. Data of mRNA expression of IL1β (4 h), CCL-3 (4 h) and CXCL-8 (24 h) as well as protein secretion of IL1β (24 h), IL-6 (4 h), TNFα (4 and 24 h), CCL-2 (4 h), CCL-3 (4 and 24 h) and CXCL-8 (4 and 24 h)were analyzed with one-way ANOVA with a post hoc Tukey test to compare LT treatment groups to the control group. Data of mRNA expression of IL1β (24 h), IL-6 (4 and 24 h), TNFα (4 and 24 h), CCL-2 (4 and 24 h), CCL-3 (24 h) and CXCL-8 (4 h) as well as protein secretion of IL1β (4 h), IL-6 (24 h) and CCL-2 (24 h) were analyzed with a non-parametric Friedman test to compare LT treatment groups to the control group. A paired student T test was used to compare STa treatment group to the control group. *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5896206/v1/2fbd5e540e1ae942a56afffd.png"},{"id":86179822,"identity":"f2e820ba-fce4-41c5-b74b-fa1bb9df2966","added_by":"auto","created_at":"2025-07-07 16:19:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":17169819,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5896206/v1/a9f9404b-ef33-4f0c-92a9-d8cf7170ce39.pdf"}],"financialInterests":"","formattedTitle":"Enterotoxigenic Escherichia coli heat labile enterotoxin induces cell death and disrupts effector functions of porcine monocytes","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eEnterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e (ETEC) is a common cause of diarrhea in children and travelers\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. ETEC infections also cause morbidity and mortality in farm animals, including piglets, leading to significant economic losses to pig farmers. In ETEC-induced diarrhea, the heat labile enterotoxin (LT) and heat stable enterotoxins (ST) enterotoxins secreted by ETEC play a crucial role. Upon secretion, LT enters the host gut epithelial cells through binding with ganglioside M1 (GM1). Once internalized, LT activates adenylate cyclase, which results in an increase in intracellular cyclic adenosine monophosphate (cAMP) levels. The latter in turn activates protein kinase A (PKA), which modulates the activation of membrane ion channels, ultimately leading to the secretion of electrolytes and water into the intestinal lumen\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. To date, two distinct types of ST, namely STa and STb, have been identified. The initial phase in STa-induced diarrhea involves the activation of guanylate cyclase C (GC-C) on gut epithelial cells. This leads to increased cyclic guanosine monophosphate (cGMP) levels and subsequent activation of cGMP-dependent protein kinase II (cGMPKII). These molecular cascades induce the secretion of chloride and bicarbonate ions, while inhibiting Na\u003csup\u003e+\u003c/sup\u003e uptake, thereby causing diarrhea\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAlthough the pathways activated by the enterotoxins in gut epithelial cells that lead to diarrhea during ETEC infections are well-established, less is known about the ability of STs to regulate immune responses. The effect of ST on immune cells is increasingly gaining attention\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. A recent study demonstrated that STa induces rapid and transient expression of interleukin IL-33 and IL-1Ra in human gut epithelial cells \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Additionally, mice deficient in the IL-33 receptor show a reduced susceptibility to STa compared to wildtype mice\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. In contrast to STs, LT is known to activate immune cells and to enhance cellular and humoral immune responses to antigens\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. In-depth investigations have elucidated the underlying mechanisms. Some studies indicated that enhancement of T cell proliferation was linked to the functional activation of dendritic cells induced by LT\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. However, previous results suggest that the mechanism is complex and various immune cells are involved in this immunomodulation process. For example, in a mice model, administration of LT enhanced the production of IL-1β by dendritic cells\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. On the other hand, another study indicated that LT-IIa and LT-IIb could suppress the production of IL-1β induced by LPS in THP-1 cells\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Furthermore, previous studies have indicated that LT could enhance the antigen uptake by the dendritic cells\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, while a recent study demonstrated that LT inhibited the phagocytosis of ETEC by murine macrophages\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Although the effect of LT on certain immune cell populations is well established, its effect on monocytes, precursors to macrophages and dendritic cells, remains poorly understood, particularly in pigs.\u003c/p\u003e \u003cp\u003eMonocytes play a pivotal role as bridge between the innate and adaptive immune systems. Equipped with various pattern recognition receptors, they can detect both pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs)\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Upon recognizing these signals, monocytes become activated and undergo chemotaxis, migrating towards the infection site. Once there, they exhibit a certain plasticity by differentiating into either macrophages or dendritic cells, influenced by local cues and signals. This versatility allows monocytes to contribute to tissue homeostasis\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Moreover, monocytes themselves serve as antigen-presenting cells, possessing the ability to capture, process, and deliver antigens to T cells, thereby facilitating the coordination of the host immune response\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Here, we investigated the effect of LT and STa on the function of porcine monocytes. The obtained findings contribute to a deeper understanding of the immunoregulation by LT and STa.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 Enterotoxins\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLT was purified from the supernatant of ETEC strain IMM07 as previously described\u003csup\u003e18\u003c/sup\u003e.\u0026nbsp;STa used in this study was purchased from Bachem company (Bubendorf, Switzerland).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Isolation and culture of monocytes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMonocytes were isolated as described previously\u003csup\u003e19\u003c/sup\u003e. In brief, peripheral blood was collected from 10- to 24-week-old pigs via the jugular vein. Then, the PBMCs were isolated by density gradient centrifugation on\u0026nbsp;lymphoprep (Axis-Shield,\u0026nbsp;Dundee, UK). Isolated PBMCs were incubated with mouse anti-porcine CD14 antibodies (clone MIL-2, in-house production) for 40 min. After washing, cells were incubated with secondary goat-anti-mouse IgG Microbeads (Miltenyi, Bergisch Gladbach, Germany) for another 20 min. Subsequently, cells were diluted in 5 mL PBS-EDTA + 1% FCS and applied onto a LS column (Miltenyi) to obtain CD14\u003csup\u003e+\u003c/sup\u003e cells. This cell population had a purity exceeding 95% and a cell viability exceeding 90%, as assessed by flow cytometry (Cytoflex, Beckman Coulter Biosciences, Indianapolis, USA). Purified monocytes were resuspended at a density of 2\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/mL in phenol red-free RPMI 1640 medium (Gibco, Waltham, USA) containing 10% fetal calf serum (FCS, Gibco) and 1% penicillin/streptomycin (Gibco). The pigs (females, 10 to 24-week-old) used as blood donors were housed under standard conditions. All animal experiments were approved by the animal care and ethics committee of the Faculty of Veterinary Medicine, Ghent University (EC2017/121 and EC2023/22)).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 LT binding assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe binding of LT to the membrane of monocytes was assessed using flow cytometry. Monocytes were seeded at 2\u0026times;10⁵ cells per well in 96-well plates and incubated at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e for 1 hour. Subsequently, monocytes were incubated with 0, 20, or 500 ng/mL LT for an additional 30 min on ice. After incubation, the monocytes were washed three times with ice-cold PBS and then incubated for 3 h on ice with rabbit anti-\u003cem\u003eE. coli\u003c/em\u003e LT polyclonal antibody (1:300, Abcam, Cambridge, UK) in ice-cold PBS containing 1% FCS. Following three washes with ice-cold PBS, the monocytes were stained for 1 h on ice with PE-labeled goat anti-rabbit IgG polyclonal antibody (1:300, Invitrogen, Waltham, USA) in ice-cold PBS. After three more washes, the monocytes were stained with the viability dye Sytox\u0026trade; Blue (1 \u0026mu;M, Invitrogen, Carlsbad, CA, USA) in PBS and analyzed by flow cytometry (Cytoflex, Beckman Coulter). Data were analyzed using CytExpert software (Beckman Coulter). For the GM1 inhibition assay, 0, 25, or 500 ng LT was preincubated with 1 \u0026mu;g GM1 (Sigma, Saint Louis, USA) for 2 h at 37\u0026deg;C before being added to the monocytes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 cAMP ELISA\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMonocytes were cultured in 24-well plate at a density of 2\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells /well. After a 1 h incubation period, monocytes (2\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/well) were subsequently pretreated with either LT (0, 20 and 500 ng/ml) for another 1 h at 37\u0026deg;C. After centrifugation, the cell supernatants were collected, and monocytes were lysed with 0.1 M HCl to stop endogenous phosphodiesterase activity. After centrifugation at 660g for 10 min at room temperature to remove cellular debris, the cellular lysates were collected. The cAMP level in the monocyte supernatants and lysates was assayed using a Direct cAMP ELISA Kit (Enzo Life Sciences, New York, USA), following the manufacturer\u0026apos;s guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Cell\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eviability\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo assess the viability of monocytes, we used propidium iodide (PI, Sigma) to stain the cells. Monocytes (2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well) were seeded into 96-well plates and then incubated at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e for 1 h to allow the monocytes to settle. Subsequently, the monocytes were treated with 0, 4, 20, 100 and 500 ng/ml LT or 0, 100 and 500 ng/ml STa for 4 h or 24 h. Next, monocytes were harvested and transferred to a 96-well V-bottom plate. They were then resuspended in a 1 \u0026mu;g/ml PI solution. Subsequently, the cell viability was analyzed using a flow cytometer from Beckman Coulter, and the resulting data were analyzed using CytExpert software (Beckman Coulter). Doublets were excluded based on FSC-H/FSC-A and SSC-H/SSC-A. A minimum of 10,000 events were counted for each analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Phagocytosis\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eass\u003c/strong\u003e\u003cstrong\u003eay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMonocytes (2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well) were pretreated with either LT (0, 4 20, 100 and 500 ng/ml) or STa (0, 100 and 500 ng/ml) for 2 or 8 h at 37\u0026deg;C. Next, 6\u0026times;10\u003csup\u003e6\u003c/sup\u003e of pHrodo\u003csup\u003eTM\u003c/sup\u003e red-labeled \u003cem\u003eEscherichia coli\u003c/em\u003e particles (Invitrogen) were added to the cells and then incubated at 37\u0026deg;C for an additional 2 h. Subsequently, the monocytes were carefully collected into a 96-well V-bottom plate and were washed three times with cold PBS to remove free-floating \u003cem\u003eE. coli\u003c/em\u003e particles. Then, the monocytes were resuspended in 100 \u0026mu;L of PBS containing Sytox\u003csup\u003eTM\u003c/sup\u003e Blue (1 \u0026mu;M, Invitrogen) and incubated for 10 min at 4\u0026deg;C. Finally, the monocytes were analyzed using flow cytometry (Beckman Coulter) and the resulting data were analyzed using CytExpert software (Beckman Coulter).\u003c/p\u003e\n\u003cp\u003eTo measure the effects of LT on the survival of ETEC phagocytosed by porcine monocytes, isolated monocytes were added into 96-well plate at the density of 3\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well. After a rest periode at 37\u0026deg;C for 2 h, monocytes were pretreated with LT (0, 100 and 500 ng/ml) for 24 h at 37\u0026deg;C. Next, 9\u0026times;10\u003csup\u003e5\u003c/sup\u003e of ETEC were added to the cells and then incubated at 37\u0026deg;C for an additional 2 h to allow phagocytosis. In this assay, three ETEC strains were utilized: GIS26 (O149:K91, F4ac, LT\u003csup\u003e+\u003c/sup\u003eSTa\u003csup\u003e+\u003c/sup\u003eSTb\u003csup\u003e+\u003c/sup\u003e)\u003csup\u003e20\u003c/sup\u003e, LT deletion mutant GIS26 (GIS26\u0026Delta;LT) (O149:K91, F4ac, LT\u003csup\u003e-\u003c/sup\u003eSTa\u003csup\u003e-\u003c/sup\u003eSTb\u003csup\u003e+\u003c/sup\u003e)\u003csup\u003e20\u003c/sup\u003e and 2134P (O157, F18ac, LT\u003csup\u003e-\u003c/sup\u003eSTa\u003csup\u003e+\u003c/sup\u003eSTb\u003csup\u003e+\u003c/sup\u003e)\u003csup\u003e21\u003c/sup\u003e. Subsequently, the monocytes were collected and transferred to a 96-well V-bottom plate and were three washed three times with cold PBS to remove free-floating ETEC. Then, the monocytes were resuspended in 100 \u0026mu;L of RPMI 1640 medium containing 100 \u0026micro;g/ml gentamicin and incubated for 1 h at 37\u0026deg;C to kill extracellular bacteria. After washing 3 times with cold PBS to remove gentamicin, monocytes were lysed with 200 \u0026mu;l distilled water at room temperature. Finally, 10 \u0026mu;L of the lysate containing intracellular ETEC was plated on brain heart infusion (BHI, Thermo Fisher Scientific) agar to quantify the number of surviving ETEC.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 Analysis of reactive oxygen species (ROS) production\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe conducted a luminol chemiluminescence assay to assess the production of reactive oxygen species (ROS) by monocytes under two experimental conditions. To measure the ROS production induced by LT, STa and ETEC, monocytes (2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well) were plated in a 96-well white microplate. After a 1 h incubation period, we replaced the culture medium with 175 \u0026mu;L of a luminol solution at 100 \u0026mu;g/mL. Subsequently, 25 \u0026mu;L of either LT (0, 32, 160, 800 and 4000 ng/mL), STa (0, 800 and 4000 ng/mL) or ETEC (GIS26\u0026Delta;LT; 1.6\u0026times;10\u003csup\u003e8\u003c/sup\u003e, 1.6\u0026times;10\u003csup\u003e7\u003c/sup\u003e and 1.6\u0026times;10\u003csup\u003e6\u003c/sup\u003e CFU/mL) were added, following a 5 min background measurement. Chemiluminescence was continuously monitored at 5 min intervals for a total of 2 h at 37\u0026deg;C using a Luminoskan Microplate Readers (MTX lab system, Vienna, USA). As a positive control, monocytes were stimulated with 50 \u0026mu;g/mL of phorbol myristate acetate (PMA, Sigma).\u003c/p\u003e\n\u003cp\u003eTo investigate the effect of LT and STa on PMA-, MacroGard\u003csup\u003e\u0026reg;\u0026nbsp;\u003c/sup\u003e\u0026beta;-glucan (Biotec Pharmacon ASA, Troms\u0026oslash;, Norway)- and ETEC-induced ROS production, monocytes were first pretreated with LT or STa for either 2 or 8 h. Subsequently, the culture medium was replaced with 175 \u0026mu;L of a 100 \u0026mu;g/mL luminol solution to measure background for 5 min, followed by the addition of 25 \u0026mu;L of the PMA (400 \u0026mu;g/mL), \u0026beta;-glucan (4 mg/mL) and GIS26\u0026Delta;LT (1.6\u0026times;10\u003csup\u003e8\u0026nbsp;\u003c/sup\u003eCFU/mL) ETEC solution. Chemiluminescence was also recorded at 5 min intervals over a 2 h period at 37\u0026deg;C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8 RT-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePorcine monocytes were stimulated with LT (0, 20 and 500 ng/ml) or STa (0 and 500 ng/ml) treatment for either 2 or 8 h. Following treatment, monocytes were harvested, and total RNA was extracted using the Qia Shredder and RNeasy Mini Kit from Qiagen, adhering to the manufacturer\u0026apos;s guidelines. RNA quantity and purity were determined using microvolume UV-Vis spectrophotometry (DeNovix, Wilmington, USA), while RNA integrity was assessed by running samples on denaturing agarose gels stained with ethidium bromide (EtBr, Sigma). To remove potential genomic DNA contamination, RNA (500 ng) was treated with RQ1 RNase-Free DNase (Promega, Madison, USA). Subsequently, the treated RNA was reverse transcribed into cDNA using the SuperScript III Reverse Transcriptase kit from Invitrogen, supplemented with a ribonuclease inhibitor (RNase OUT; Invitrogen) as per the manufacturer\u0026apos;s instructions. The resulting cDNA served as a template for quantitative polymerase chain reaction (qPCR) assays. Primers (Table 1) were designed with Primer-BLAST (NIH, USA) or taken from literature and synthesized by Integrated DNA Technologies (IDT,\u0026nbsp;Coralville,\u0026nbsp;IA).\u0026nbsp;Quantitative PCR was carried out using 25 ng of cDNA template, perimers at 250 nM, and\u0026nbsp;an annealing temperature of 60℃ on a StepOnePlus real-time PCR system (Applied Biosystems,\u0026nbsp;Waltham, USA) and SYBR green master mix (Applied Biosystems)\u0026nbsp;in a total volume of 20 \u0026mu;L, following the manufacturer\u0026apos;s protocol. Data analysis was performed using the double delta threshold cycle method, with normalization to the expression levels of reference genes (\u0026beta;-actin and GAPDH) and control conditions. The selection of reference genes was based on geNorm analysis using qBase+ software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e Sequences of primers used in the qPCR assay.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"636\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 68px;\"\u003e\n \u003cp\u003eTarget\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003eAccession number\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 282px;\"\u003e\n \u003cp\u003ePrimer Sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 154px;\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 68px;\"\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 132px;\"\u003e\n \u003cp\u003eAY550069\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFw:\u003c/strong\u003e TCATCACCATCGGCAACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"bottom\" style=\"width: 154px;\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRv:\u003c/strong\u003e TTCCTGATGTCCACGTCGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 68px;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 132px;\"\u003e\n \u003cp\u003eAF017079\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFw:\u003c/strong\u003e GGGCATGAACCATGAGAAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"bottom\" style=\"width: 154px;\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRv:\u003c/strong\u003e AAGCAGGGATGATGTTCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 68px;\"\u003e\n \u003cp\u003eIL1\u0026beta;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 132px;\"\u003e\n \u003cp\u003eNM_214055.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFw:\u003c/strong\u003e AGCCCAATTCAGGGACCCTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 154px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRv:\u003c/strong\u003e TGCCTGATGCTCTTGTTCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 68px;\"\u003e\n \u003cp\u003eIL6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 132px;\"\u003e\n \u003cp\u003eNM_214399.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFw:\u003c/strong\u003e CCTGAGATTGATGCCGTCCA\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 154px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRv:\u003c/strong\u003e TCTTCAAGCCGTGTAGCCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 68px;\"\u003e\n \u003cp\u003eTNF\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 132px;\"\u003e\n \u003cp\u003eNM_214022\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFw:\u003c/strong\u003e ACTGCACTTCGAGGTTATCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 154px;\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRv:\u003c/strong\u003e GGCGACGGGCTTATCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 68px;\"\u003e\n \u003cp\u003eCXCL8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 132px;\"\u003e\n \u003cp\u003eNM_213867.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFw:\u003c/strong\u003e GACCCCAAGGAAAAGTGGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 154px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRv:\u003c/strong\u003e TGACCAGCACAGGAATGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 68px;\"\u003e\n \u003cp\u003eCCL2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 132px;\"\u003e\n \u003cp\u003eNM_214214.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFw:\u003c/strong\u003e CCAGGACTCCATAAGCCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 154px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRv:\u003c/strong\u003e CAATGTGCCCAAGTCTCCGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 68px;\"\u003e\n \u003cp\u003eCCL3L1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 132px;\"\u003e\n \u003cp\u003eNM_001009579.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFw:\u003c/strong\u003e CCTCGCAAATTCGTAGCCGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 154px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRv:\u003c/strong\u003e TCAGCTCCAGGTCAGAGATGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" style=\"width: 68px;\"\u003e\n \u003cp\u003eCCL5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" style=\"width: 132px;\"\u003e\n \u003cp\u003eNM_001129946.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFw:\u003c/strong\u003e TGCTTCTTGCTCTTGTCCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 154px;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 282px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRv:\u003c/strong\u003e GTGCCAAGGGTCCAAAGTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eFw, Forward primer; Rv, reverse primer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.9 Cytokine and chemokine ELISA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMonocytes (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/well) were seeded in a 24-well microplate. These monocytes were then treated with LT (0, 20 and 500 ng/ml) or STa (0 and 500 ng/ml) for 4 or 24 h. Following the treatment period, the supernatant was carefully collected and centrifuged (400g, 5 min, 4\u0026deg;C) to remove residual monocytes. The concentrations of IL1\u0026beta;, IL6, CXCL8, and TNF\u0026alpha; in the supernatant were then quantified using commercial ELISA kits from R\u0026amp;D systems (Minneapolis, USA) following the manufacturer\u0026apos;s instructions. The concentrations of CCL2 and CCL3 in the supernatant were then quantified using commercial ELISA kits from Kingfisher Biotech (Saint Paul, USA) according to the manufacturer\u0026apos;s instructions.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10 Statistical\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eanalysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experimental data are expressed as mean \u0026plusmn; standard deviation (SD). All statistical analysis was performed with IBM SPSS Statistics 26 (USA). We assessed the homogeneity of variances among groups using Levene\u0026apos;s test. For comparisons between two groups, a two-tailed paired Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test was used. For the comparisons of three to five groups, we used one-way ANOVA with Tukey\u0026rsquo;s multiple comparison test or a Friedman test was used if normality tests did not pass. Probability values (\u003cem\u003eP\u003c/em\u003e) of 0.05 or less were considered significant.\u003c/p\u003e"},{"header":"3 Results","content":"\u003ch2\u003e3.1 Assessing the binding and cytotoxic effect of LT on porcine monocytes\u003c/h2\u003e\n\u003cp\u003eWhile it is known that type I LT can bind to intestinal epithelial cells via GM1, its binding to porcine immune cells has been rarely investigated. We first explored whether LT could bind to monocytes. Our results demonstrated that LT can bind to porcine monocytes, and that preincubation of LT with GM1 inhibited this binding (Fig. 1A). Upon binding and internalization by epithelial cells, LT is known to activate adenylate cyclase, leading to cAMP production. Therefore, we measured both intracellular and extracellular cAMP levels following LT treatment. As shown in Fig. 1B, LT significantly increased intracellular cAMP production in monocytes, but did not affect extracellular cAMP levels. During infection, some pathogens use their virulence factors to induce the death of immune cells, thereby evading elimination by the immune system\u003csup\u003e24, 25\u003c/sup\u003e. Thus, we also investigated the cytotoxic effects of LT and STa on monocytes. Figure 1C shows a dose-dependent decrease in cell viability after incubating monocytes with LT for 4 h. In contrast, STa stimulation for 4 or 24 h did not induce cell death in monocytes (Fig. 1D).\u003c/p\u003e\n\u003ch2\u003e3.2 The effect of LT and STa on the phagocytosis and intracellular killing by porcine monocytes\u003c/h2\u003e\n\u003cp\u003ePhagocytosis is a pivotal function of monocytes in the clearance of pathogens\u003csup\u003e16\u003c/sup\u003e. Recent research indicated that LT decreased the phagocytic ability of RAW 246.7 cells, a murine macrophage cell line \u003csup\u003e14\u003c/sup\u003e. Therefore, our study investigated whether LT and STa could influence the phagocytic activity of porcine monocytes. Likewise, we found that LT decreased the phagocytosis of \u003cem\u003eE. coli\u003c/em\u003e by monocytes at a concentration of 100 or 500 ng/mL after an incubation period of 24 h, as shown in Fig. 2A-B. In contrast, STa did not affect the phagocytotic function of monocytes at the tested conditions (Fig. 2C). Although phagocytosis is a highly effective mechanism for clearing most pathogens, a large body of evidence suggests that specific virulence factors of some pathogenic bacteria can disrupt this process\u003csup\u003e26, 27\u003c/sup\u003e. To determine whether LT acts as a protective mechanism for ETEC, we examined the survival of intracellular ETEC upon their phagocytosis by primary monocytes. The results showed that pretreatment of monocytes with 500 ng/mL LT for 24 h significantly reduced their ability to kill all three ETEC strains taken up by the monocytes, thereby enhancing the survival of intracellular ETEC (Fig. 2D).\u003c/p\u003e\n\u003ch2\u003e3.3 LT but not STa decreased the ROS production by monocytes\u003c/h2\u003e\n\u003cp\u003eWhen exposed to microorganisms, monocytes generate reactive oxygen species (ROS) as part of their defense mechanism to eliminate invading pathogens\u003csup\u003e16\u003c/sup\u003e. Therefore, we wondered whether LT or STa could influence the ROS production by porcine monocytes. Figure 3A\u0026nbsp;and C show that neither LT nor\u0026nbsp;STa treatment induced\u0026nbsp;ROS production by porcine monocytes. To understand whether LT or STa affect ROS production by monocytes induced by PMA, a known activator of the respiratory burst response in innate immune cells, monocytes were pretreated with enterotoxins for 4 h or 24 h. While the ROS production induced by PMA remained unaffected after a 4 h pretreatment with LT or STa, after 24 h LT reduced the PMA-induced ROS production by monocytes, even at the lowest tested concentration (4 ng/ml) (Fig. 3B,\u0026nbsp;D). In contrast to LT, STa was unable to alter ROS production induced by PMA (Fig. 3D). To understand whether this effect of LT was specific to PMA, ROS production was induced by \u0026beta;-glucans\u003csup\u003e28\u003c/sup\u003e. As shown in Fig. 3E, LT also decreased the ROS production induced by \u0026beta;-glucans in monocytes. We then investigated whether similar effects could be observed in monocytes in response to ETEC. To avoid influences from LT produced by ETEC, we first used an LT deletion mutant ETEC strain (GIS26\u0026Delta;LT) to assess if monocytes responded with increased ROS production. As shown in Fig. 3F, treatment with this strain significantly increased the ROS production by monocytes. However, when monocytes were preincubated with LT, the ROS production induced by ETEC was significantly inhibited (Fig. 3G).\u003c/p\u003e\n\u003ch2\u003e3.4 Evaluation of pro-inflammatory cytokine and chemokine responses in porcine monocytes upon LT or STa stimulation\u003c/h2\u003e\n\u003cp\u003eIn response to perceived danger signals, monocytes can initiate and drive inflammatory responses by releasing a wide range of cytokines and chemokines\u003csup\u003e16\u003c/sup\u003e. In this study, we assessed the expression of key inflammatory mediators, such as IL-1\u0026beta;, IL-6, TNF-\u0026alpha;, CCL-2, CCL-3, and CXCL-8, which play important roles in immune cell migration and activation. LT treatment resulted in a dose-dependent increase in the mRNA expression of IL-1\u0026beta;, IL-6, TNF-\u0026alpha;, CCL-3 and CXCL-8 after 4 and 24 h of incubation, while STa had no discernible effect on their expression (Fig. 4A). On the other hand, LT regulated transcript levels of CCL-2 in a different pattern (Fig. 4A). At 4 h and 24 h, LT treatment suppressed CCL-2 expression, whereas STa did not influence the transcript levels of CCL-2 (Fig. 4A). To corroborate these findings, we also assessed cytokine and chemokine release using ELISA. As shown in Fig. 4B, LT treatment elicited a significant increase in the secretion of IL-1\u0026beta; and TNF-\u0026alpha; by monocytes at both 4 and 24 hours, whereas STa treatment did not affect their secretion. While LT treatment showed no effect on CXCL-8 secretion at 4 h, a significant increase in CXCL-8 levels was observed in the LT group at 24 h (Fig. 4B). Furthermore, neither LT nor STa exhibited a significant impact on the secretion of IL-6 after incubation for 4 h and 24 h (Fig. 4B).\u0026nbsp;\u003c/p\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eLT and STa are key virulence factors of ETEC, playing crucial roles in ETEC colonization\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e and ETEC-induced diarrhea\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. However, their effects on the immune system, especially monocytes, are poorly understood. In this study, we found that while STa did not affect monocyte viability or function, LT induced cell death, reduced monocyte phagocytic and intracellular killing activity and inhibited ROS production by monocytes. Moreover, LT stimulated the release of IL-1β and TNF-α, and the chemokines CCL-3 and CXCL-8.\u003c/p\u003e \u003cp\u003eUnder healthy conditions, the body maintains a steady number of monocytes through cell proliferation, differentiation, survival, and cell death\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. This balance can be disturbed by pathogens, some of which have been shown to increase the death of monocytes\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. In this study, we showed that LT increased monocyte death. These findings are consistent with previous studies showing that LT can induce apoptosis in lymphocytes\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Further experiments are necessary to evaluate the cytotoxicity of STa and LT on other innate immune cells.\u003c/p\u003e \u003cp\u003eThe generation of ROS by monocytes is a critical antimicrobial mechanism to control pathogens\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e and serves as a major signaling molecule in various physiological pathways\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. However, excessive oxidative stress can lead to tissue damage and development of diseases\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. While previous studies have shown that LT can induce apoptosis in intestinal epithelial cells by increasing ROS production\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e, our findings indicate that neither LT nor STa significantly alter ROS production by monocytes. These results are consistent with those observed in porcine neutrophils, as published in our previous study\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Since LT induced cAMP production in both intestinal epithelial cells\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e, neutrophils\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e and monocytes, this suggests that LT may activate similar signaling pathways in both immune and non-immune cells, but with differing outcomes depending on the cell type. Interestingly, we found that pretreatment with LT inhibited ROS production induced by PMA and β-glucans, which are well-known inducers of ROS in porcine monocytes\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. However, our previous results showed that LT did not affect the ROS production induced by PMA in neutrophils\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. This suggests that LT causes different outcomes in different immune cells, even when similar signaling pathways are activated. Although LT did not induce ROS production in monocytes, our results show that an LT deletion mutant ETEC strain significantly increased ROS production by these cells. Oxidative damage in the intestine of piglets has been observed in previous studies following ETEC infection\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Additionally, we found that LT can inhibit ETEC-induced ROS production, suggesting that LT secretion by ETEC may be an effective strategy to counteract ROS-mediated elimination by monocytes. Further experiments could be designed to determine whether the presence of LT might enhance ETEC survival \u003cem\u003ein vivo\u003c/em\u003e. In fact, it has been reported that many bacterial pathogens can utilize virulence factors, such as catalases of enterohemorrhagic \u003cem\u003eEscherichia coli\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/em\u003e\u003c/sup\u003e and staphyloxanthin of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/em\u003e\u003c/sup\u003e, to resist elimination by immune cells.\u003c/p\u003e \u003cp\u003eMonocytes are professional phagocytes, and phagocytosis is a key innate immune mechanism involved in antibacterial immunity\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Our results revealed that LT treatment inhibited the ability of monocytes to phagocytose \u003cem\u003eE. coli\u003c/em\u003e. This finding on phagocytosis of monocytes is consistent with our previous study showing that LT decreases uptake of \u003cem\u003eE. coli\u003c/em\u003e by neutrophils\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Virulence factors of other pathogens, like \u003cem\u003eStaphylococcus aureus\u003c/em\u003e and enterohaemorrhagic \u003cem\u003eEscherichia coli\u003c/em\u003e, are also known to impair phagocytosis\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Our results also showed that pretreatment of LT inhibited the ability of monocytes to kill intracellular ETEC, which might be connected to the LT-induced inhibition of ROS production by monocytes. Interestingly, our results contrast with a previous study using murine macrophages, showing that LT pretreatment reduced the number of live ETEC taken up by these cells\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. We hypothesize that this discrepancy might be due to cell- or species-specific differences or technical differences between both studies. Further experiments are needed to explore how LT enhances the survival of intracellular ETEC upon their phagocytosis by monocytes.\u003c/p\u003e \u003cp\u003eA key function of monocytes is their capacity to produce cytokines and chemokines in response to different stimuli\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. These molecules attract and activate various immune cells, playing a central role in the immune defense against pathogens. In this study, porcine monocytes exhibited increased secretion of IL-1β, IL-6, and TNF-α after stimulation with LT for 4 and 24 h. Similar trends have also been observed for IL-1β production in mice dendritic cells\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Furthermore, previous studies have shown increased production of IL-1β, IL-6, and TNF-α in human and mice macrophages in response to stimulation with the B subunit of LT\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. This suggests that further research should investigate whether the B subunit alone is sufficient to induce cytokine production in monocytes. IL-1β, IL-6, and TNF-α are pro-inflammatory cytokines that can lead to the activation of innate and adaptive immune cells. Furthermore, these pro-inflammatory factors play a crucial role in the differentiation of monocytes towards macrophages or dendritic cells\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. Further experiments might be conducted to better characterize the impact of LT on this differentiation process. Our results also showed that LT treatment significantly increased the expression and production of CCL-3 and CXCL-8. CCL-3 and CXCL-8 are chemokines that attract macrophages and neutrophils separately, which can enhance inflammation at the infection site to eliminate ETEC. Increased production of CXCL-8 induced by B subunit of LT has also been observed in human and mice macrophages\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. Therefore, further research should investigate whether the B subunit is responsible for the CXCL-8 production in monocytes stimulated by LT. CCL-2, known as monocyte chemoattractant protein-1, can bind to CCR2 and mediate the recruitment of monocytes\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. In this study, we found that LT treatment decreased the expression of CCL-2 in monocytes, However, the effect of LT on CCL-2 secretion was not statistically significant.\u003c/p\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eIn conclusion, while STa did not affect monocyte viability or function, LT increased the release of inflammatory mediators by monocytes, which may contribute to the clearance of ETEC infections. However, ETEC-derived LT also induced monocyte cell death and dampened several effector functions of monocytes. Specifically, LT inhibited ROS production induced by PMA, β-glucan, and ETEC, reduced the uptake of \u003cem\u003eE. coli\u003c/em\u003e, and enhanced the survival of phagocytosed \u003cem\u003eE. coli\u003c/em\u003e. These effects likely provide an advantage for ETEC to evade monocyte immune responses and establish infection.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eJ.M.\u003c/strong\u003e designed and carried out the experiments, performed data analysis and drafted the manuscript.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eH.V.d.W.\u003c/strong\u003e assisted in ELISA\u0026nbsp;and\u0026nbsp;flow cytometry. \u003cstrong\u003eM.D.\u003c/strong\u003e assisted in purifying LT and flow cytometry. \u003cstrong\u003eL.H.\u003c/strong\u003e assisted in flow cytometry and RT-qPCR.\u003cstrong\u003e\u0026nbsp;E.C.\u003c/strong\u003e supervised the project and provided critical feedback. \u003cstrong\u003eB.D.\u003c/strong\u003e conceived the presented idea, designed the experiments, supervised the project, provided critical feedback and drafted the manuscript. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJ.M. is supported by a PhD grant from the China Scholarship Council (grant number 201906350196). M.D. is supported by the Flemish fund for scientific research (FWO-SB; 3S036319). This research is supported by grants from the Special Research Fund of Ghent University (BOF/STA/202009/021; BOF/BAS/2015/0029/01).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request. Source data are provided with this paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKhalil, IA, Troeger, T \u0026amp; Blacker, BF (2018) \u003cem\u003eEscherichia coli\u003c/em\u003e diarrhoea. \u003cem\u003eLancet Infect Dis\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e:1305-1305. Doi: 10.1016/S1473-3099(18)30664-9\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Neal, CJ, Jobling, MG, Holmes, RK \u0026amp; Hol, WG (2005) Structural basis for the activation of cholera toxin by human ARF6-GTP. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e309\u003c/strong\u003e:1093-1096. Doi: 10.1126/science.1113398\u003c/li\u003e\n\u003cli\u003eWeiglmeier, PR, Rosch, P \u0026amp; Berkner, H (2010) Cure and curse: \u003cem\u003eE. coli \u003c/em\u003eheat-stable enterotoxin and its receptor guanylyl cyclase C. \u003cem\u003eToxins (Basel)\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e:2213-2229. Doi: 10.3390/toxins2092213\u003c/li\u003e\n\u003cli\u003eWang, HX, Zhong, ZF, Luo, Y, Cox, E \u0026amp; Devriendt, B (2019) Heat-Stable Enterotoxins of Enterotoxigenic \u003cem\u003eEscherichia coli \u003c/em\u003eand Their Impact on Host Immunity. \u003cem\u003eToxins\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e. Doi: 10.3390/toxins11010024\u003c/li\u003e\n\u003cli\u003eMotyka, NI, Stewart, SR, Hollifield, IE, Kyllo, TR, Mansfield, JA, Norton, EB, Clements, JD \u0026amp; Bitoun, JP (2021) Elevated Extracellular cGMP Produced after Exposure to Enterotoxigenic \u003cem\u003eEscherichia coli \u003c/em\u003eHeat-Stable Toxin Induces Epithelial IL-33 Release and Alters Intestinal Immunity. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e89\u003c/strong\u003e. Doi: 10.1128/IAI.00707-20\u003c/li\u003e\n\u003cli\u003eMotyka, NI, Stewart, SR, Porretta, CP, Hollifield, IE, Bauer, DL \u0026amp; Bitoun, JP (2022) Enterotoxigenic \u003cem\u003eEscherichia coli \u003c/em\u003eEnterotoxins Regulate Epithelial to Immune Relay of IL-33 and IL-1Ra Cytokines. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e90\u003c/strong\u003e. Doi: 10.1128/iai.00637-21\u003c/li\u003e\n\u003cli\u003eKnapp, MPA, Johnson, TA, Ritter, MK, Rainer, RO, Fiester, SE, Grier, JT, Connell, TD \u0026amp; Arce, S (2021) Immunomodulatory regulation by heat-labile enterotoxins and potential therapeutic applications. \u003cem\u003eExpert Rev Vaccines\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e:975-987. Doi: 10.1080/14760584.2021.1945449\u003c/li\u003e\n\u003cli\u003eLee, CH, Masso-Welch, P, Hajishengallis, G \u0026amp; Connell, TD (2011) TLR2-dependent modulation of dendritic cells by LT-IIa-B, a novel mucosal adjuvant derived from a type II heat-labile enterotoxin. \u003cem\u003eJ Leukocyte Biol\u003c/em\u003e \u003cstrong\u003e90\u003c/strong\u003e:911-921. Doi: 10.1189/jlb.0511236\u003c/li\u003e\n\u003cli\u003eLiang, S, Hosur, KB, Nawar, HF, Russell, MW, Connell, TD \u0026amp; Hajishengallis, G (2009) In vivo and in vitro adjuvant activities of the B subunit of Type IIb heat-labile enterotoxin (LT-IIb-B) from \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eVaccine\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e:4302-4308. Doi: 10.1016/j.vaccine.2009.05.027\u003c/li\u003e\n\u003cli\u003eBrereton, CF, Sutton, CE, Ross, PJ, Iwakura, Y, Pizza, M, Rappuoli, R, Lavelle, EC \u0026amp; Mills, KHG (2011) Heat-Labile Enterotoxin Promotes Protective Th17 Responses against Infection by Driving Innate IL-1 and IL-23 Production. \u003cem\u003eJ Immunol\u003c/em\u003e \u003cstrong\u003e186\u003c/strong\u003e:5896-5906. Doi: 10.4049/jimmunol.1003789\u003c/li\u003e\n\u003cli\u003eHajishengallis, G, Nawar, H, Tapping, RI, Russell, MW \u0026amp; Connell, TD (2004) The type II heat-labile enterotoxins LT-IIa and LT-IIb and their respective B pentamers differentially induce and regulate cytokine production in human monocytic cells. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e72\u003c/strong\u003e:6351-6358. Doi: 10.1128/Iai.72.11.6351-6358.2004\u003c/li\u003e\n\u003cli\u003eLee, CH, Nawar, HF, Mandell, L, Liang, S, Hajishengallis, G \u0026amp; Connell, TD (2010) Enhanced antigen uptake by dendritic cells induced by the B pentamer of the type II heat-labile enterotoxin LT-IIa requires engagement of TLR2. \u003cem\u003eVaccine\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e:3696-3705. Doi: 10.1016/j.vaccine.2010.03.016\u003c/li\u003e\n\u003cli\u003eNawar, HF, Greene, CJ, Lee, CH, Mandell, LM, Hajishengallis, G \u0026amp; Connell, TD (2011) LT-IIc, a new member of the type II heat-labile enterotoxin family, exhibits potent immunomodulatory properties that are different from those induced by LT-IIa or LT-IIb. \u003cem\u003eVaccine\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e:721-727. Doi: 10.1016/j.vaccine.2010.11.020\u003c/li\u003e\n\u003cli\u003eHollifield, IE, Motyka, NI, Fernando, KA \u0026amp; Bitoun, JP (2023) Heat-Labile Enterotoxin Decreases Macrophage Phagocytosis of Enterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eMicroorganisms\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e. Doi: 10.3390/microorganisms11082121\u003c/li\u003e\n\u003cli\u003eLi, DY \u0026amp; Wu, MH (2021) Pattern recognition receptors in health and diseases. \u003cem\u003eSignal Transduct Tar\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e. Doi: 10.1038/s41392-021-00687-0\u003c/li\u003e\n\u003cli\u003eGuilliams, M, Mildner, A \u0026amp; Yona, S (2018) Developmental and Functional Heterogeneity of Monocytes. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e:595-613. Doi: 10.1016/j.immuni.2018.10.005\u003c/li\u003e\n\u003cli\u003eJakubzick, CV, Randolph, GJ \u0026amp; Henson, PM (2017) Monocyte differentiation and antigen-presenting functions. \u003cem\u003eNat Rev Immunol\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e:349-362. Doi: 10.1038/nri.2017.28\u003c/li\u003e\n\u003cli\u003eMa, JL, Hermans, L, Dierick, M, van der Weken, H, Cox, E \u0026amp; Devriendt, B (2024) Enterotoxigenic \u003cem\u003eEscherichia coli \u003c/em\u003eheat labile enterotoxin affects neutrophil effector functions via cAMP/PKA/ERK signaling. \u003cem\u003eGut Microbes\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e. Doi: 10.1080/19490976.2024.2399215\u003c/li\u003e\n\u003cli\u003eHermans, L, De Pelsmaeker, S, Denaeghel, S, Cox, E, Favoreel, HW \u0026amp; Devriendt, B (2021) beta-Glucan-Induced IL-10 Secretion by Monocytes Triggers Porcine NK Cell Cytotoxicity. \u003cem\u003eFront Immunol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e:634402. Doi: 10.3389/fimmu.2021.634402\u003c/li\u003e\n\u003cli\u003eLoos, M, Geens, M, Schauvliege, S, Gasthuys, F, van der Meulen, J, Dubreuil, JD, Goddeeris, BM, Niewold, T \u0026amp; Cox, E (2012) Role of Heat-Stable Enterotoxins in the Induction of Early Immune Responses in Piglets after Infection with Enterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003ePlos One\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e. Doi: 10.1371/journal.pone.0041041\u003c/li\u003e\n\u003cli\u003eDierick, M, Van der Weken, H, Rybarczyk, J, Vanrompay, D, Devriendt, B \u0026amp; Cox, E (2020) Porcine and Bovine Forms of Lactoferrin Inhibit Growth of Porcine Enterotoxigenic Escherichia coli and Degrade Its Virulence Factors. \u003cem\u003eAppl Environ Microbiol\u003c/em\u003e \u003cstrong\u003e86\u003c/strong\u003e. Doi: 10.1128/AEM.00524-20\u003c/li\u003e\n\u003cli\u003eVon der Hardt, K, Kandler, MA, Fink, L, Schoof, E, Dotsch, J, Brandenstein, O, Bohle, RM \u0026amp; Rascher, W (2004) High frequency oscillatory ventilation suppresses inflammatory response in lung tissue and microdissected alveolar macrophages in surfactant depleted piglets. \u003cem\u003ePediatr Res\u003c/em\u003e \u003cstrong\u003e55\u003c/strong\u003e:339-346. Doi: 10.1203/01.Pdr.0000106802.55721.8a\u003c/li\u003e\n\u003cli\u003eMelkebeek, V, Verdonck, F, Goddeeris, BM \u0026amp; Cox, E (2007) Comparison of immune responses in parenteral FaeG DNA primed pigs boosted orally with F4 protein or reimmunized with the DNA vaccine. \u003cem\u003eVet Immunol Immunop\u003c/em\u003e \u003cstrong\u003e116\u003c/strong\u003e:199-214. Doi: 10.1016/j.vetimm.2007.01.021\u003c/li\u003e\n\u003cli\u003eLaforge, M, Campillo-Gimenez, L, Monceaux, V, Cumont, MC, Hurtrel, B, Corbeil, J, Zaunders, J, Elbim, C \u0026amp; Estaquier, J (2011) HIV/SIV Infection Primes Monocytes and Dendritic Cells for Apoptosis. \u003cem\u003ePlos Pathog\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e. Doi: 10.1371/journal.ppat.1002087\u003c/li\u003e\n\u003cli\u003eMelehani, JH, James, DBA, DuMont, AL, Torres, VJ \u0026amp; Duncan, JA (2015) \u003cem\u003eStaphylococcus aureus \u003c/em\u003eLeukocidin A/B (LukAB) Kills Human Monocytes via Host NLRP3 and ASC when Extracellular, but Not Intracellular. \u003cem\u003ePlos Pathog\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e. Doi: 10.1371/journal.ppat.1004970\u003c/li\u003e\n\u003cli\u003eHumphreys, D, Singh, V \u0026amp; Koronakis, V (2016) Inhibition of WAVE Regulatory Complex Activation by a Bacterial Virulence Effector Counteracts Pathogen Phagocytosis. \u003cem\u003eCell Rep\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e:697-707. Doi: 10.1016/j.celrep.2016.09.039\u003c/li\u003e\n\u003cli\u003eItoh, S, Hamada, E, Kamoshida, G, Yokoyama, R, Takii, T, Onozaki, K \u0026amp; Tsuji, T (2010) Staphylococcal superantigen-like protein 10 (SSL10) binds to human immunoglobulin G (IgG) and inhibits complement activation via the classical pathway. \u003cem\u003eMol Immunol\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e:932-938. Doi: 10.1016/j.molimm.2009.09.027\u003c/li\u003e\n\u003cli\u003eSonck, E, Stuyven, E, Goddeeris, B \u0026amp; Cox, E (2010) The effect of beta-glucans on porcine leukocytes. \u003cem\u003eVet Immunol Immunopathol\u003c/em\u003e \u003cstrong\u003e135\u003c/strong\u003e:199-207. Doi: 10.1016/j.vetimm.2009.11.014\u003c/li\u003e\n\u003cli\u003eJohnson, AM, Kaushik, RS, Francis, DH, Fleckenstein, JM \u0026amp; Hardwidge, PR (2009) Heat-Labile Enterotoxin Promotes \u003cem\u003eEscherichia coli \u003c/em\u003eAdherence to Intestinal Epithelial Cells. \u003cem\u003eJ Bacteriol\u003c/em\u003e \u003cstrong\u003e191\u003c/strong\u003e:178-186. Doi: 10.1128/Jb.00822-08\u003c/li\u003e\n\u003cli\u003eAllen, KP, Randolph, MM \u0026amp; Fleckenstein, JM (2006) Importance of heat-labile enterotoxin in colonization of the adult mouse small intestine by human enterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e strains. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e:869-875. Doi: 10.1128/Iai.74.2.869-875.2006\u003c/li\u003e\n\u003cli\u003eDubreuil, JD, Isaacson, RE \u0026amp; Schifferli, DM (2016) Animal Enterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eEcoSal Plus\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e. Doi: 10.1128/ecosalplus.ESP-0006-2016\u003c/li\u003e\n\u003cli\u003eTamayo, E, Postigo, J, Del Giudice, G, Rappuoli, R, Benito, A, Yagita, H, Merino, R \u0026amp; Merino, J (2009) Involvement of the intrinsic and extrinsic cell-death pathways in the induction of apoptosis of mature lymphocytes by the heat-labile enterotoxin. \u003cem\u003eEur J Immunol\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e:439-446. Doi: 10.1002/eji.200838993\u003c/li\u003e\n\u003cli\u003eTamayo, E, Merino, R, Gonz\u0026aacute;lez-Rojas, J, Marquina, R, Santiuste, I, Amado, JA, Rappuoli, R, Del Giudice, G \u0026amp; Merino, J (2005) The heat-labile enterotoxin induces apoptosis of immature lymphocytes via a glucocorticoid-dependent pathway. \u003cem\u003eEur J Immunol\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e:3505-3515. Doi: 10.1002/eji.200526326\u003c/li\u003e\n\u003cli\u003eNovais, FO, Nguyen, BT, Beiting, DP, Carvalho, LP, Glennie, ND, Passos, S, Carvalho, EM \u0026amp; Scott, P (2014) Human classical monocytes control the intracellular stage of Leishmania braziliensis by reactive oxygen species. \u003cem\u003eJ Infect Dis\u003c/em\u003e \u003cstrong\u003e209\u003c/strong\u003e:1288-1296. Doi: 10.1093/infdis/jiu013\u003c/li\u003e\n\u003cli\u003ePizzolla, A, Hultqvist, M, Nilson, B, Grimm, MJ, Eneljung, T, Jonsson, IM, Verdrengh, M, Kelkka, T, Gjertsson, I, Segal, BH \u0026amp; Holmdahl, R (2012) Reactive oxygen species produced by the NADPH oxidase 2 complex in monocytes protect mice from bacterial infections. \u003cem\u003eJ Immunol\u003c/em\u003e \u003cstrong\u003e188\u003c/strong\u003e:5003-5011. Doi: 10.4049/jimmunol.1103430\u003c/li\u003e\n\u003cli\u003eGilardini Montani, MS, Santarelli, R, Granato, M, Gonnella, R, Torrisi, MR, Faggioni, A \u0026amp; Cirone, M (2019) EBV reduces autophagy, intracellular ROS and mitochondria to impair monocyte survival and differentiation. \u003cem\u003eAutophagy\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e:652-667. Doi: 10.1080/15548627.2018.1536530\u003c/li\u003e\n\u003cli\u003eHan, CY, Umemoto, T, Omer, M, Den Hartigh, LJ, Chiba, T, LeBoeuf, R, Buller, CL, Sweet, IR, Pennathur, S, Abel, ED \u0026amp; Chait, A (2012) NADPH oxidase-derived reactive oxygen species increases expression of monocyte chemotactic factor genes in cultured adipocytes. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e287\u003c/strong\u003e:10379-10393. Doi: 10.1074/jbc.M111.304998\u003c/li\u003e\n\u003cli\u003eDegasperi, GR, Denis, RG, Morari, J, Solon, C, Geloneze, B, Stabe, C, Pareja, JC, Vercesi, AE \u0026amp; Velloso, LA (2009) Reactive oxygen species production is increased in the peripheral blood monocytes of obese patients. \u003cem\u003eMetabolism\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e:1087-1095. Doi: 10.1016/j.metabol.2009.04.002\u003c/li\u003e\n\u003cli\u003eJacinto, TA, Meireles, GS, Dias, AT, Aires, R, Porto, ML, Gava, AL, Vasquez, EC, Pereira, TMC, Campagnaro, BP \u0026amp; Meyrelles, SS (2018) Increased ROS production and DNA damage in monocytes are biomarkers of aging and atherosclerosis. \u003cem\u003eBiol Res\u003c/em\u003e \u003cstrong\u003e51\u003c/strong\u003e:33. Doi: 10.1186/s40659-018-0182-7\u003c/li\u003e\n\u003cli\u003eLu, X, Li, C, Li, C, Li, P, Fu, E, Xie, Y \u0026amp; Jin, F (2017) Heat-Labile Enterotoxin-Induced PERK-CHOP Pathway Activation Causes Intestinal Epithelial Cell Apoptosis. \u003cem\u003eFront Cell Infect Microbiol\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e:244. Doi: 10.3389/fcimb.2017.00244\u003c/li\u003e\n\u003cli\u003eWang, HX, Garcia, RS, Cox, E \u0026amp; Devriendt, B (2020) Porcine Enterotoxigenic Strains Differ in Their Capacity To Secrete Enterotoxins through Varying YghG Levels. \u003cem\u003eAppl Environ Microb\u003c/em\u003e \u003cstrong\u003e86\u003c/strong\u003e. Doi: 10.1128/AEM.00523-20\u003c/li\u003e\n\u003cli\u003eDonne, E, Pasmans, F, Boyen, F, Van Immerseel, F, Adriaensen, C, Hernalsteens, JP, Ducatelle, R \u0026amp; Haesebrouck, F (2005) Survival of Salmonella serovar Typhimurium inside porcine monocytes is associated with complement binding and suppression of the production of reactive oxygen species. \u003cem\u003eVet Microbiol\u003c/em\u003e \u003cstrong\u003e107\u003c/strong\u003e:205-214. Doi: 10.1016/j.vetmic.2005.01.027\u003c/li\u003e\n\u003cli\u003eJin, S, Xu, H, Yang, C \u0026amp; O, K (2024) Regulation of oxidative stress in the intestine of piglets after enterotoxigenic \u003cem\u003eEscherichia coli \u003c/em\u003e(ETEC) infection. \u003cem\u003eBiochim Biophys Acta Mol Cell Res\u003c/em\u003e \u003cstrong\u003e1871\u003c/strong\u003e:119711. Doi: 10.1016/j.bbamcr.2024.119711\u003c/li\u003e\n\u003cli\u003eWan, B, Zhang, Q, Ni, J, Li, S, Wen, D, Li, J, Xiao, H, He, P, Ou, HY, Tao, J, Teng, Q, Lu, J, Wu, W \u0026amp; Yao, YF (2017) Type VI secretion system contributes to Enterohemorrhagic \u003cem\u003eEscherichia coli \u003c/em\u003evirulence by secreting catalase against host reactive oxygen species (ROS). \u003cem\u003ePlos Pathog\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e:e1006246. Doi: 10.1371/journal.ppat.1006246\u003c/li\u003e\n\u003cli\u003eClauditz, A, Resch, A, Wieland, KP, Peschel, A \u0026amp; Gotz, F (2006) Staphyloxanthin plays a role in the fitness of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e and its ability to cope with oxidative stress. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e:4950-4953. Doi: 10.1128/IAI.00204-06\u003c/li\u003e\n\u003cli\u003eDale, DC, Boxer, L \u0026amp; Liles, WC (2008) The phagocytes: neutrophils and monocytes. \u003cem\u003eBlood\u003c/em\u003e \u003cstrong\u003e112\u003c/strong\u003e:935-945. Doi: 10.1182/blood-2007-12-077917\u003c/li\u003e\n\u003cli\u003eSerbina, NV, Jia, T, Hohl, TM \u0026amp; Pamer, EG (2008) Monocyte-mediated defense against microbial pathogens. \u003cem\u003eAnnu Rev Immunol\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e:421-452. Doi: 10.1146/annurev.immunol.26.021607.090326\u003c/li\u003e\n\u003cli\u003eZimmermann, HW, Bruns, T, Weston, CJ, Curbishley, SM, Liaskou, E, Li, KK, Resheq, YJ, Badenhorst, PW \u0026amp; Adams, DH (2016) Bidirectional transendothelial migration of monocytes across hepatic sinusoidal endothelium shapes monocyte differentiation and regulates the balance between immunity and tolerance in liver. \u003cem\u003eHepatology\u003c/em\u003e \u003cstrong\u003e63\u003c/strong\u003e:233-246. Doi: 10.1002/hep.28285\u003c/li\u003e\n\u003cli\u003eBrereton, CF, Sutton, CE, Ross, PJ, Iwakura, Y, Pizza, M, Rappuoli, R, Lavelle, EC \u0026amp; Mills, KHG (2011) \u003cem\u003eEscherichia coli\u003c/em\u003e Heat-Labile Enterotoxin Promotes Protective Th17 Responses against Infection by Driving Innate IL-1 and IL-23 Production. \u003cem\u003eJ Immunol\u003c/em\u003e \u003cstrong\u003e186\u003c/strong\u003e:5896-5906. Doi: 10.4049/jimmunol.1003789\u003c/li\u003e\n\u003cli\u003eHajishengallis, G, Tapping, RI, Martin, MH, Nawar, H, Lyle, EA, Russell, MW \u0026amp; Connell, TD (2005) Toll-like receptor 2 mediates cellular activation by the B subunits of type II heat-labile enterotoxins. \u003cem\u003eInfect Immun\u003c/em\u003e \u003cstrong\u003e73\u003c/strong\u003e:1343-1349. Doi: 10.1128/Iai.73.3.1343-1349.2005\u003c/li\u003e\n\u003cli\u003eOrozco, SL, Canny, SP \u0026amp; Hamerman, JA (2021) Signals governing monocyte differentiation during inflammation. \u003cem\u003eCurr Opin Immunol\u003c/em\u003e \u003cstrong\u003e73\u003c/strong\u003e:16-24. Doi: 10.1016/j.coi.2021.07.007\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"heat labile enterotoxin, heat stable enterotoxin, monocytes, immune evasion, pig","lastPublishedDoi":"10.21203/rs.3.rs-5896206/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5896206/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEnterotoxigenic \u003cem\u003eEscherichia coli\u003c/em\u003e (ETEC) is a common cause of diarrhea in human and animals, including pigs. Enterotoxins are important virulence factors for ETEC. Although a lot is known on the mechanism of enterotoxin-induced diarrhea, less is known about their effects on innate immune cells like monocytes. Monocytes can differentiate into macrophages and dendritic cells and play a pivotal role as a bridge between the innate and adaptive immune system. Understanding the interaction between ETEC enterotoxins and monocytes can help in the development of more effective preventive and therapeutic strategies to combat this disease. In this study, we aimed to investigate the effects of the heat labile enterotoxin (LT) and the heat stable enterotoxin a (STa) produced by ETEC on porcine monocytes. Our results show that STa did not affect the cell viability and effector functions of monocytes. LT, on the other hand, decreased the cell viability of monocytes. While LT did not alter the production of reactive oxygen species (ROS) production by monocytes, it significantly reduced ROS production induced by phorbol 12-myristate 13-acetate (PMA). In addition, LT decreased the phagocytosis of \u003cem\u003eE. coli\u003c/em\u003e by monocytes and enhanced the survival of intracellular ETEC. Furthermore, LT triggered the production of cytokines IL-1β, IL-6 and TNF-α as well as chemokines CCL-3 and CXCL-8. Together, our results show that in contrast to STa, LT can cause cell death in monocytes and disrupt their immune effector functions, potentially acting as an immune evasion strategy to establish infection.\u003c/p\u003e","manuscriptTitle":"Enterotoxigenic Escherichia coli heat labile enterotoxin induces cell death and disrupts effector functions of porcine monocytes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-10 07:54:00","doi":"10.21203/rs.3.rs-5896206/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e57832de-383b-4ffe-bc40-57547d5eb8b2","owner":[],"postedDate":"February 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-07-07T16:11:56+00:00","versionOfRecord":{"articleIdentity":"rs-5896206","link":"https://doi.org/10.1186/s13567-025-01540-w","journal":{"identity":"veterinary-research","isVorOnly":false,"title":"Veterinary Research"},"publishedOn":"2025-07-06 15:58:08","publishedOnDateReadable":"July 6th, 2025"},"versionCreatedAt":"2025-02-10 07:54:00","video":"","vorDoi":"10.1186/s13567-025-01540-w","vorDoiUrl":"https://doi.org/10.1186/s13567-025-01540-w","workflowStages":[]},"version":"v1","identity":"rs-5896206","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5896206","identity":"rs-5896206","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}