Study on the intervention mechanism of ZhiLong HuoXue TongYu capsule on secondary brain injury after intracerebral hemorrhage based on oxidative stress

preprint OA: closed
Full text JSON View at publisher
Full text 141,494 characters · extracted from preprint-html · click to expand
Study on the intervention mechanism of ZhiLong HuoXue TongYu capsule on secondary brain injury after intracerebral hemorrhage based on oxidative stress | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Study on the intervention mechanism of ZhiLong HuoXue TongYu capsule on secondary brain injury after intracerebral hemorrhage based on oxidative stress lixia Wang, guijin Zhu, Gang Luo, Luyin Yang, Wei Ren, Raoqiong Wang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8172042/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 9 You are reading this latest preprint version Abstract Objective The purpose of this study is to investigate the mechanism of Zhilong Huoxue Tongyu (ZL) capsule on the treatment of intracerebral hemorrhage (ICH). Methods In this study, ICH model was established to assess the neuroprotective efficacy of ZL capsule. The ICH-induced neurological deficits were analyzed by behavioral studies including Zea-Longa score, Neurological Severity Score, Open filed test, Y-maze test, Morris water maze, Rotarod test and pathological staining such as HE staining and Nissl staining. Perls staining was used to measure iron deposition after ICH. Malondialdehyde (MDA), superoxide dismutase (SOD) and glutathione (GSH) assay kits were performed to measure the level of lipid peroxide after ICH. The levels of oxidative stress-related targets were verified by quantitative real-time PCR and western blot. Results This study demonstrated that ZL capsule treatment significantly reduced ICH-induced neurological deficits after ICH, improved the memory learning functions of rats and attenuated ICH‑Induced neuron damage in rats. After ICH, oxidative stress in brain tissue increased and ZL capsule could alleviate the pathological state of oxidative stress. The SOD and GSH activities were dramatically increased after the treatment of ZL capsule compared with the Ns group, while the content of MDA was markedly decreased after treatment with ZL capsule compared with Ns group. After ICH, the SLC40A1, SESN2 and GPX4 mRNA in brain tissue increased, and the NOX4 and TFR1 mRNA in brain tissue decreased after the treatment of ZL capsule. Proteomics analysis also confirmed these results. Conclusion Our data suggested that ZL capsule showed a neuroprotective function after ICH and alleviated ICH induced neurological deficits in rats. The possible mechanism may be that ZL capsule inhibits iron deposition and mitochondrial destabilization, lessening oxidative stress in brain tissue. The findings of this study offer a new perspective of how ZL capsule affects ICH at a molecular level and could be conducive to developing therapeutic drugs for ICH and traditional Chinese medicine. Zhilong Huoxue Tongyu capsule Intracerebral hemorrhage Oxidative stress Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Intracerebral hemorrhage (ICH) is a type of stroke which is devastatingly characterized by high mortality and disability rates in clinic ( 1 ). Data has evidenced that ICH has a high early case fatality which reaches 40% in some population-based studies ( 2 ). Many efforts have tried to find an effective therapy for the treatment of ICH, but little progress on the clinical breakthrough for patients has been made. Based on previous studies, brain injury induced by ICH includes primary brain injury and secondary brain injury (SBI), from which the former refers to physical disruption of parenchymal architecture caused by hematoma ( 3 ), and the SBI was related to deleterious byproducts of red blood cell lysis, which could lead to inflammation, oxidative stress and cell death et al. ( 4 , 5 ). Increasing studies have suggested the inhibition of SBI after ICH may be a critical target for exploring ICH therapy. Numerous evidences have shown that oxidative stress is related to many neurological disorders, including Alzheimer's disease (AD) ( 6 ), stroke ( 7 ) and etc. The overaccumulation of reactive oxygen species (ROS) and deficiency of antioxidant systems ( 8 ) after ICH contribute to the occurrence of oxidative stress. The reason why the brain is vulnerable to oxidative stress remains ambiguous, however, many reasons have been suspected to be related with the characteristic of brain, including high oxygen consumption of the brain for high energy needs, the neuronal membranes are rich in polyunsaturated fatty acids, the high abundance of Fe (II) in the brain and the mechanisms in the brain with low levels of antioxidants ( 7 , 9 ). As an important mediator of brain injury, ROS involves in the pathophysiology of many different brain diseases. The overgeneration of ROS after ICH leads to oxidative stress, and oxidative stress could interact with inflammation and cell death to exacerbate SBI after ICH ( 8 ). Many studies have indicated that the suppression of oxidative stress could alleviate brain injury after ICH ( 10 , 11 ) and patients with a favorable outcome six months after ICH have higher plasma levels of antioxidative enzymes than those with unfavorable outcomes( 12 ). Therefore, oxidative stress continues to remain a key therapeutic target for ICH. In recent years, many traditional Chinese medicines (TCMs) exhibit an important role in regulating oxidative stress ( 11 , 13 ). Zhilong Huoxue Tongyu (ZL) capsule is a patent traditional Chinese medicine which is consisted of five TCMs: Astragalus membranaceus (Fisch.) Bunge, Leech, Earthworm, Cinnamomum cassia Presl (Lauraceae) and Sargentodoxa cuneata (Oliv.) Rehd.et Wils.( 14 ). Previously, we discovered that ZL capsule has elicit neuroprotective effects after stroke. To be specific, ZL capsule could reduce the volume of intracranial hematoma in patients ( 15 ), and ameliorate ICH induced inflammatory brain injury via targeting the Nuclear factor kappa-β (NF-кβ) canonical signaling pathway in mouse ( 16 ). In addition, ZL capsule could alleviate ICH in a muti-target and multi-pathway manner ( 17 ). Therefore, in this study, we seek to investigate the further specific mechanism of ZL capsule in the treatment of ICH, focusing on the regulation of oxidative stress. Materials and methods Animals and grouping Before conducting this study, we estimated the number of rats required using error degrees of freedom ( 18 ). Finally, we chose ten rats per group as the experimental number. All 60 healthy male Sprague Dawley rats (weighing 250 ± 20 g) were purchased from Animal Centre of Kunming Medical University. And the animal study protocol was approved by the Animal Ethics Committee of Kunming Medical University (NO.20211111-002). Rats were maintained in a controlled humidity and temperature environment with alternative 12 h light/dark cycle. The animals were allowed free access to food and water. All experiments were performed in consistence with the Guide for the Care and Use of Laboratory Animal published by the United States National Institutes Health. The rats were randomly divided into 6 experimental groups, ( 1 ) Sham, ( 2 ) Ich (ICH model group), ( 3 ) Ns (Normal saline group), ( 4 ) Zll (Low dose of ZL capsule), ( 5 ) Zlm (Medium dose of ZL capsule) and ( 6 ) Zlh (High dose of ZL capsule) capsule group, with 10 rats in each group. The experimental process is shown in Fig. 1 . Establishment of ICH Model Regarding previous studies, an autologous blood injection in adult male rats was used to induce the ICH model in this study ( 19 , 20 ). Rats were anesthetized with an intraperitoneal (i.p.) injection of pentobarbital sodium (40 mg/kg) and secured on a stereotaxic apparatus (RWD Life Science Co., Ltd, Guangdong, China). Then, anterior fontanelle was raised by 1 mm, and a longitudinal incision with a length of 2 cm was taken to expose the scalp, and a hole was drilled (1.5 mm anterior and 3.0 mm lateral to bregma) and the needle of microsyringe was affixed to the stereotaxic frame with a depth of 6 mm. Next, 100 µl autologous blood collected from the tail was slowly injected into the right brain region in 5 min. The needle was kept in place for an additional 10–20 min at the end of the injection. Sham-operated rats were intracerebrally injected with needle without blood injection. Finally, the burr hole was sealed with bone wax, and the skin incision was disinfected and sutured. During the ICH surgical procedure, general state of rats was monitored. After waking up, the neurobehavioral scores of the ICH model rats were evaluated according to the Zea-Longa neurological deficits score (1–3 points) to confirm the establishment of the ICH model ( 21 ). Drug Administration Zhilong Huoxue Tongyu Capsule (ZL capsule) was provided by the Pharmacy Department of Affiliated Traditional Chinese Medicine Hospital of Southwest Medical University. The dosage was converted according to the body surface area of rats as 0.5 g/kg/day (Low dose), 1 g/kg/day (Medium dose) and 2 g/kg/day (High dose). The ZL capsule was administered orally for 21 days to the ZL capsule treatment group after modelling. The Ns, Sham and Ich groups were administered with the same dose of normal saline by oral gavage for 21 days. Behavioral studies The rats were assessed at 1, 3, 5, 7, 10, 14 and 21 days after ICH to evaluate the neurobehavioral outcomes according to the Zea-Longa score and Neurological Severity Score (NSS) ( 21 , 22 ). Zea-Longa score If the rats had no neurological defect, the score was 0. If the rats had dysfunction in stretching the left forelimb, the score was 1. If the rats walked in circles and cannot go straight, the score was 2. If the rats leaned to the opposite side when standing or crawling, the score was 3. If the rats were unconscious and unable to walk, the score was 4. Neurological severity score (NSS) The NSS evaluation included the motor (muscle status, abnormal movement), sensory (visual, tactile, proprioceptive), balance tests, and reflexes that were recorded on a scale of 0–18 (0, normal score; 18, maximal deficit score). Y-maze test Y-maze test was used to assess the distinctiveness, working memory and reference memory of rats. The Y-maze device was consisted of three arms including initial, wrong and food arms (Xinruan, Shanghai, China). The rats were fasted for 1 day to increase the rat’s desire to food. In the adaptation period, they were placed in the middle of the apparatus and allowed to move freely through the maze for approximately 10 minutes, which was adapted to 3 times in one day. During training period, the food (bait) was placed in food arm of the Y-maze. The door of the wrong arm was closed, and the rats were placed in the initial arm to find the food. And the training frequency was the same as previous described. Finally, in the formal test, the doors of the three arms of the Y-maze were simultaneously opened with no food, the rats were placed in the initial arm. The maze was cleaned between each rat using 75% ethyl alcohol. The arm entries of each rat were observed and recorded and the number of times the rats entered each arm within 5 minutes and the residence time in each arm were recorded to analyze the ability of spatial memory in rats ( 24 ). Morris water maze (MWW) Morris water maze (MWW) was employed to investigate the ability of spatial learning and memory after ICH in rats ( 25 , 26 ). The MWW test was consist of two parts: training period (1-5th day) and probe trial (6th day). During the training period, the rats were guided to locate a hidden and 1.5 cm submerged platform under the water in circular pool which was divided into four quadrants, and the platform was placed in the center of one quadrant. And the water temperature was maintained at 22 ± 1.5°C. The rats were trained to find the location of the platform and experienced four trials per day from different release positions in 90 s. If the rat failed to escape on the platform within 90 s, it was guided to locate on platform and stay on the platform for 10 s, and the tracking system was used to record and analyze the latency of finding the platform. During the probe trial, the platform was removed, rats were allowed to explore the pool and tracked at the same time within 90 s, and the number of platform area crossings was measured. Rotarod test Rotarod test was the classical behavioral test used to evaluate the locomotion and motor coordination of rats after neurological disorders ( 27 ). All the rats received adaptive training before the formal test. The rats were placed on the rotating rod to adapt to the movement on the rod. The rotation speed of the rod was set to 10 revolutions per minute (RPM). The rats were trained for 10 minutes per day for 3 consecutive days. During the formal test, the rod was set to accelerate from 0 RPM to 30 RPM within 3 minutes, and the time of duration on the rod was recorded. The test was performed three times one day, and the rats rested for at least 30 minutes to ensure the experimental results. Tissue harvest After behavioral studies, the rats were sacrificed for diverse experimental objectives. For the morphological detection, the rats in each group were sacrificed on 21th day with an intraperitoneal (i.p.) injection of pentobarbital sodium (40 mg/kg). The brain samples were obtained after intracardiac perfusion with 0.9% physiological saline followed by 4% paraformaldehyde, and the brains were put into 4% paraformaldehyde for more than 72 h. With paraffin embedded, the 4 µm-thick brain sections were prepared for morphological staining including Hematoxylin and Eosin staining (HE Staining), Nissl staining and Perls staining. For molecular biology analysis, rats in each group were anesthetized and sacrificed on 21th day after ICH. The tissues including cortex and hippocampus of the ipsilateral (right) hemisphere were collected and stored at -80°C for further detection. Hematoxylin and Eosin Staining (HE Staining) After 72 h fixation in 4% paraformaldehyde, the brain samples were dehydrated by gradient concentrations of ethanol, transparent by xylene, immersed in wax, and embedded in paraffin. Then paraffin-embedded brains were cut into 4 µm‐thick coronal sections. After being transferred to glass slides, the sections were stained with hematoxylin and eosin (HE) (Servicebio, G1005). Subsequently, the morphological changes in each group were observed under microscope (3D-histech (Pannoramic)). Nissl Staining After sectioned in 4 µm-thickness, the neuronal cells of the cortex section were visualized by a Nissl staining assay. The sections were dewaxed and stained by Nissl Staining Solution kit (Servicebio, G1430). Five sections were randomly selected from each rat, with four rats in each group, and the neurons including dark neurons and normal neurons in the cortex area was captured by 3D-histech. Three sections were randomly selected from each rat, with three rats in each group, and the neurons in the hippocampus areas including hippocampal cornu ammonis 1 (CA1), CA2, CA3, and dentate gyrus (DG) areas was captured the same as previously reported. Image J was used to count the number of total nerve cells and dark nerve cells. Eventually, the percentage of dark neuron cells was calculated to assess the injury of neuronal cells after ICH. Perls staining After sectioned in 4 µm-thickness, the deposition area of iron was carried out by a Perls staining kit ( 28 ). The sections were dewaxed and stained (Servicebio, G1420). Three animals per group were viewed and photographed under 3D-histech. Iron‐positive cell areas were calculated by four randomly‐selected microscopic fields at × 200 magnification around the modeling area. Image J was used to measure the area of iron deposition. Measurement of lipid peroxide levels In order to measure the level of lipid peroxide, malondialdehyde (MDA), superoxide dismutase (SOD) and glutathione (GSH) assay kits (Nanjing Jiancheng Bioengineering Institute, China) were carried out according to the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (qRT-PCR) The mRNA levels of oxidative stress related gene TFR1, GPX4, Sestrin2 and NOX4 were analyzed in each group after ICH modeling using qRT- PCR. The tissues collected from rats were used to extract total RNA by Trizol reagent. Reverse transcription to cDNA was performed using HiFi-MMLV cDNA Kit (Cwbio, CW0744M) to synthesize the cDNA template. PCR primers used for PCR amplification were obtained from Sangon Biotech (Chengdu, China). QRT-PCR was then performed in LightCycler 480 (Roche) using SYBR Green Kit (Cwbio, CW2601H). Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was used as an internal control to normalize the data, the RNA expression levels were calculated by the 2 −ΔΔCt (Quantitation-Comparative CT) method. The primers are presented as follows: 5ʹ-CAAGGCTGAGAATGGGAAGC-3′ (Forward Primer) and 5ʹ-GAAGACGCCAGTAGACTCCA-3′ (Reverse Primer) for GAPDH, 5ʹ- AGCTGCCACCTGAGAACATC − 3′ (Forward Primer) and 5ʹ- CGCACGCCCTTTATTCATGG − 3′ (Reverse Primer) for TFR1, 5ʹ- GGCTGTGGGATACTTCCTGA − 3′ (Forward Primer) and 5ʹ- TTCAATGGGTCTCTGCTTGG − 3′ (Reverse Primer) for Sestrin2, 5ʹ- CTACAAGAAGTCACAACACA − 3′ (Forward Primer) and 5ʹ- TCGTCCAGATACTCAGCATA − 3′ (Reverse Primer) for NOX4, 5ʹ- TTCCCCAGACCAGCAACAGC − 3′ (Forward Primer) and 5ʹ- GCCAGGATTCGTAAACCACA − 3′ (Reverse Primer) for GPX4, 5ʹ- CCCCATAATCTCCGTCAGCC − 3′ (Forward Primer) and 5ʹ- TGAAGGTTCGTTAGTGCCCC − 3′ (Reverse Primer) for SLC40A1. Western blot analysis To testify the protein expression of GPX4, Sestrin2 and NOX4 after ICH, the tissues stored at -80°C were used. The protein was extracted from each group using RIPA lysis buffer (Beyotime, P0013C) containing PMSF. Then the protein concentration of the tissues was quantified using BCA assay kit (Beyotime, P0012S). Afterward, protein (42 µg) was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis at 80 V for 30 min and then at 120 V for 1 h. Further, the samples were transferred to polyvinylidene fluoride membranes (Millipore, IPVH00010) at 400 mA for 20 min. After being locked in 5% BSA for 2 h, the membranes were then incubated with GPX4 primary antibody (1:5000; Abcam (ab125066), rabbit), Sestrin2 primary antibody (1:5000; Abcam (ab178518), rabbit) and NOX4 primary antibody (1:5000; Abcam (ab133303), rabbit) overnight at 4°C. GAPDH (1:5000, Beyotime, (AF1186), rabbit) was selected as an internal control. The membranes were rinsed in TBST and incubated with secondary antibody (1:5000; goat anti-rabbit IgG; ZSGB-BIO, (bs-40295G-HRP)) for 2 h at room temperature. Finally, after being rinsed in TBST, the membranes were developed with the ECL (Beyotime, P0018AS) luminescence solution. The quantitative analysis was carried out by ImageJ software. Statistical Analysis Experimental data were analyzed using SPSS 24.0 software and presented as mean ± standard deviation (SD). Data comparisons among groups were analyzed using one-way ANOVA. p < 0.05 was statistically significant. Results ZL Capsule Attenuated Neurological Deficits in Rats After ICH ZL capsule has shown a therapeutic effect on stroke in clinic, however, the specific mechanism of ZL capsule on ICH still leaves unknown. The neuroprotection effect of ZL capsule was assessed by neurological scores and ethological examinations including Zea-Longa score, NSS, Open filed test, Y-maze test, Morris water maze and Rotarod test. As shown in Fig. 2 , Zea-Longa score was significantly increased in Ich group and Ns group after ICH compared with the Sham group ( p < 0.05, Fig. 2 A), indicating the successful modeling of ICH. As expected, the NSS in Ich group and Ns group was obviously increased after ICH compared with the Sham group, while it significantly decreased in ZL capsule groups as compared with the Ns group ( p < 0.05, Fig. 2 B). In the open field test, the frequency of standing and grooming was distinctly decreased in Ich and Ns rats compared with Sham animals, and as excepted, the ZL capsule rats showed more frequency of standing and grooming compared with Ns rats ( p < 0.05, Fig. 2 G, H). Additionally, the total distance reduced in Ich and Ns rats compared with Sham animals, and the ZL capsule rats showed a greater total distance in open filed test compared with Ns rats ( p < 0.05, Fig. 2 I). In the Y-maze test, compared with Sham group, the duration of food arm was lower, the duration of wrong arm was higher in Ich group and Ns group, while ZL capsule rats showed longer duration in food arm and lower duration in wrong arm compared with Ns rats ( p < 0.05, Fig. 2 C). In the Morris water maze, after 5 days of spatial learning and 1 day of spatial memory exploration test, the ZL capsule rats performed better in learning and memory function than that of rats in Ich group and Ns group ( p < 0.05, Fig. 2 D, J), and the ZL capsule rats have crossed the platform with more times and less total distance ( p < 0.05, Fig. 2 E, F). In the rotarod test, the rats in Ich group and Ns group have demonstrated a shorter duration on the rotarod compared with Sham group, while the ZL capsule rats exhibited a longer duration on the rotarod compared with Ns group ( p < 0.05, Fig. 2 K). All above tests indicated that the treatment of ZL capsule contributed the recovery of neurological deficits in rats after ICH. ZL capsule Improved ICH‑Induced Neuron Damage in rats 21 days after ICH, HE staining was performed to assess the tissue injury in each group. Morphology of the brain tissues after ICH was examined by HE staining, as shown in Fig. 3 , the tissue in Sham group showed normal structure and no swelling or necrosis cells were observed. In Ich group and Ns group, tissue was loose and grid shaped, and displayed obvious red blood cells infiltration, severe cellular swelling and death. The administration of ZL capsule reversed above damages, especially in Zlh group (Fig. 3 A). Nissl staining was used to evaluate the damage of neuron after ICH in rats, as expected, the section showed discernible Nissl bodies, nucleus and cytoplasm in Sham group, and neurons was arranged tightly. However, in Ich group and Ns group, the sections displayed with significantly damage, swelling, nuclear deformation and Nissl bodies reduction, and the number of dead cell was dramatically increased. Also, it was found that the treatment of ZL capsule could improve neuronal damage and neurological deficits compared with the ICH modeling rats in Ich group and Ns group (Fig. 4 ). Compared with the ICH modeling rats, the total cortical neurons after the treatment of ZL capsule showed no difference (Fig. 3 B). It also indicated the safety and low neuronal toxicity of ZL capsule. What’s more, the treatment group showed fewer dark neurons compared with the ICH modeling groups, especially in Zlh group (Fig. 3 C). As for hippocampus, the neuroprotective function is closely related to the dose of ZL capsule. Zlh group rats showed fewer dark neurons in different hippocampal subdivisions CA1, CA3 and DG (Fig. 3 E). Moreover, Zlm and Zll rats showed fewer dark neurons in CA2 region, but there was no statistical difference among three treatment groups (Fig. 3 E). The ICH modeling groups retained fewer total neurons in CA1 compared with Sham group. Zlh group showed no statistical difference compared with ICH modeling groups (Fig. 3 D), indicating the safety of ZL capsule. Compared with Sham group, the total neurons in DG showed no statistical difference in ICH modeling groups, and the treatment of ZL capsule had no effect on total neurons (Fig. 3 D). ZL capsule Alleviates oxidative stress after ICH in rats It has been recognized that oxidative stress is a main inducer of second brain injury after ICH. Regarding previous studies, the inhibition of oxidative stress shows cerebral protection after ICH. The iron deposition and lipid peroxidation were assessed by Perls staining and oxidative stress markers such as MDA assay kit, SOD assay kit and GSH assay kit to analyze the expression level of oxidative stress after ICH in rats. Compared with Sham groups, the sections in Ich group and Ns group showed a large blue iron deposition area after ICH. However, the treatment of ZL capsule after ICH decreased the area of iron deposition compared with Ns group ( p < 0.05, Fig. 5 A, B). In the detection of lipid peroxidation, the expression of the SOD and GSH were reduced and the level of MDA were increased in Ich group and Ns group after ICH compared with Sham group ( p < 0.05, Fig. 5 C, D, E). However, the administration of ZL capsule decreased the level of MDA and improved the expression of SOD and GSH by comparison with Ns group ( p < 0.05, Fig. 5 C, D, E). ZL capsule Ameliorates ICH‑Induced oxidative stress via inhibiting iron deposition and mitochondrial destabilization To validate the inhibition of ZL capsule on oxidative stress, the expression level of key targets in oxidative stress pathway was measured. As shown in Fig. 6 , the mRNA expression level of transferrin receptor 1 protein (TFR1) and SLC40A1 (Ferroportin1, FPN1), the markers of which were related to the iron metabolism ( 29 , 30 ), has shown that the expression of TFR1 markedly increased and the expression of SLC40A1 significantly decreased compared with Sham group after ICH ( p < 0.05, Fig. 6 A, B), and the treatment of ZL capsule decreased the expression of TFR1 and increased the expression of SLC40A1 ( P < 0.05, Fig. 6 A, B) compared with Ns group after ICH. Moreover, the mRNA expression level of Glutathione Peroxidase 4 (GPX4), the key genes related to lipid peroxidation, were significantly decreased after ICH compared with Sham group ( p < 0.05, Fig. 6 C), and this effect was blocked by the treatment of ZL capsule ( p < 0.05, Fig. 6 C) compared with Ns group after ICH. Being consistent with the result of PCR, the western blot protein level of GPX4 decreased after ICH compared with Sham group ( p < 0.05, Fig. 7 B, C), and the treatment of ZL capsule increased the GPX4 protein expression ( p < 0.05, Fig. 7 B, C) compared with Ns group after ICH. In order to further verify the mechanism of ZL capsule on oxidative stress inhibition, we investigated the expression level of Sestrin2 (SESN2) and NADPH oxidase 4 (NOX4)after ICH. As shown in Fig. 6 , the mRNA expression level of NOX4 was significantly increased after ICH compared with Sham group ( p < 0.05, Fig. 6 E), and this effect was blocked by the treatment of ZL capsule ( p < 0.05, Fig. 6 E) compared with Ns group after ICH. The mRNA expression level of Sestrin2 was significantly decreased after ICH compared with Sham group ( p < 0.05, Fig. 6 D), and this effect was blocked by the treatment of ZL capsule ( p < 0.05, Fig. 6 D) compared with Ns group after ICH. Moreover, similar to the tendency of PCR, the western blot result of NOX4 was increased dramatically after ICH compared with Sham group ( p < 0.05, Fig. 7 A, C), Sestrin2 was decreased significantly after ICH compared with Sham group ( p < 0.05, Fig. 7 D, C), and these effects were blocked by ZL capsule treatment ( p < 0.05, Fig. 7 A, D, C) compared with Ns group after ICH. Taken together, our data suggested that the treatment of ZL capsule could alleviate ICH-induced brain injury via suppressing oxidative stress and iron metabolism. Discussion Our study explored the effect and mechanisms of ZL capsule on ICH-induced oxidative stress. We discovered that the treatment of ZL capsule after ICH could attenuate neurological deficits in rats, and improve ICH‑induced neuron damage. Further experiments revealed that ZL capsule could inhibit iron metabolism and suppressing oxidative stress via muti-targets and muti-pathways. These results suggested that ZL capsule could be a potential drug for the treatment of ICH. Accumulating evidence showed that SBI played an important role in the progression after ICH. The biochemical, cellular and physiological changes like inflammation, neurotoxicity, blood brain barrier, mitochondrial dysfunction, oxidative stress and cell death contribute to the SBI and eventually lead to irreversible neuronal injury ( 31 – 33 ). Due to its high unsaturated lipid enrichment and iron content and modest antioxidant defence, the brain is susceptible to damage from oxidative stress ( 34 ) after ICH. And oxidative stress could be triggered by ICH and participate the following pathophysiology of ICH. It is meaningful to figure out the specific role of oxidative stress after ICH. As the energy producer of cell, mitochondria not only serve as the main producers of ROS, but also contribute to their harmful amplification ( 35 ). As pivotal organelles governing cellular metabolism and redox homeostasis, mitochondria could regulate ROS levels according to cellular demands via its precise mechanisms ( 36 ). Under normal circumstances, the dynamic balance between ROS generation and elimination is a key event in the regulation of to ensure the function of cell. However, after ICH, the mitochondrion was stimulated by various stimuli, such as hemin, the morphology, location and dynamics of mitochondrion were destroyed due to ICH, eventually leading to the sustained oxidative stress and following SBI ( 37 ). Consequently, to figure out the role of mitochondrion after ICH is meaningful for the development of ICH drugs. Traditional Chinese medicine has a long history with unique advantages in stroke treatment. Chinese herb prescription has shown neuroprotective effect through various pathways. In our experiment, to clarify the protection of ZL capsule on memory function after ICH, Morris water maze and Y-maze test were carried out. Our data suggested that ZL capsule could improve the spatial memory after ICH. The hippocampus played a key role in the centre of a network supporting memory function, especially memory for places and events ( 38 – 40 ). Place cells, neurons in the hippocampus with spatial receptive fields are typically pyramidal neurons from the CA1 and CA3 regions of the hippocampus ( 40 – 42 ). The injury of hippocampus is associated with memory dysfunction after ICH in rats. The Nissl staining results suggested the treatment of ZL capsule after ICH could survive more total neurons in CA1 region, and decrease the dark neurons in CA1, CA2, CA3 and DG regions, particularly in CA1, CA3 and DG regions of Zlh group. This may explain the potential mechanism of ZL capsule in improving learning and memory after ICH in rats. Open filed test was also carried out to assess the anxiety state of rats through observing the grooming and standing behavior and total distance of rats. Mood and emotional disturbances are frequent symptoms in stroke patients ( 43 ), to improve post stroke anxiety remains a clinically important issue. Anxiety-related neural circuits span a wide range of brain structures, including subcortical white matter and the limbic system ( 44 ). To further analyze the protective effect of ZL, we statistically analyzed the dark neurons in the cortical area through Nissl staining. In Nissl staining, more neurons survived in cortical regions after the treatment of ZL capsule, and the therapeutic effect has a dose dependent manner. What’ more, there was no significant difference in the total neurons in cortical regions, which further indicated the safety of ZL capsule. In this experiment, we also found the treatment of ZL capsule alleviated brain injuries after ICH via relating oxidative stress pathways. In our previous study, the main chemicals in ZL capsule including quercetin, crocetin and kaempferol were identified to be active ingredients for the treatment of ICH ( 45 ). And these active ingredients have a common function, namely, antioxidation ( 46 – 48 ). Moreover, previously we also discovered that the pathways of ZL capsule for the treatment of ICH included Ferroptosis, chemical carcinogenesis - reactive oxygen species and so on ( 45 ). Therefore, ZL capsule may play a therapeutic role in ICH by regulating oxidative stress after ICH. In our study, we tested the level of GSH, MDA and SOD, which are the markers of oxidative stress. After ICH, the excessive accumulation of Fe could facilitate the production of ROS and contribute to the oxidative stress via Fenton and Harber-Weiss reactions( 49 ). SLC40A1 could transport iron from the intracellular space to the extracellular space and TFR1 could transport iron from the extracellular space to the intracellular space. And we also measured the area of ironic deposition to evaluate the oxidative stress. Our data suggested that ZL capsule could decrease the area of ironic deposition and promote the iron absorption and following oxidative stress. As a multifunctional antioxidant enzyme, GPX4 is intricately linked to cellular antioxidant defense. And the upregulating of GPX4 after brain injury could provide neuroprotection and prevent further deterioration( 50 ). Our results have confirmed that the treatment of ZL capsule could attenuate oxidative stress. After ICH, the mitochondrial destabilization contributes to the oxidative stress and subsequent SBI. Therefore, it is meaningful to regulate the oxidative stress for the treatment of ICH. Mitochondria are the major sources of cellular ROS ( 51 ). And NOX4 locates on mitochondria, which are closely related to ROS production and oxidative stress ( 52 ). Regulating the mitochondrial dynamics is a potential therapeutic method for the treatment of ICH. Sestrins are a family of highly conserved stress-inducible proteins that maintain homeostasis. Sestrin2 is an important member of the family and has been implicated in oxidative stress ( 53 ). It has found that the loss of Sestrin2 contributes to the generation of ROS via triggering NOX4 ( 54 ). All these results have shown that ZL capsule could decrease the expression of oxidative stress. To further determine the specific pathways of oxidative stress, we also discovered that the treatment of ZL capsule could decrease the expression of NOX4, increase the expression of Sestrin2 after ICH. The results indicated ZL capsule might attenuate brain injury via regulating NOX4 and Sestrin2. Moreover, based on the findings of our previous study ( 45 ), we detected the level of TP53, a predicted target involved in ICH. And the results suggested that ZL capsule could inhibit the expression level of TP53 in rats after ICH. Recent research reveals that Sestrin2 is the downstream factor of TP53 ( 55 , 56 ). Thus, further research is needed to identify the role of TP53/Sestrin2/NOX4 pathway on oxidative stress for the treatment of ICH. Conclusions Collectively, these results have revealed that ZL capsule has shown neuroprotective effect via improving rats’ memory function and ameliorating ICH‑induced neuron damage via muti-targets and muti-pathways. And the specific pathway was related with impressing the expression of oxidative stress via regulating the pathway of Sestrin2/NOX4 pathway. Mitochondria have played an important role in the progress of SBI after ICH. Sestrin2 and NOX4 are also intricately linked to mitochondria. Further effect was needed to explain the relationship between SBI and mitochondrial dynamics. Abbreviations ZL Zhilong Huoxue Tongyu ICH Intracerebral hemorrhage MDA Malondialdehyde SOD Superoxide dismutase GSH Glutathione NOX4 NADPH oxidase 4 AD Alzheimer's disease SBI Secondary brain injury ROS Reactive oxygen species TCMs Traditional Chinese medicines NF-кβ Nuclear factor kappa-β NSS Neurological Severity Score MWW Morris water maze RPM Revolutions per minute qRT-PCR Quantitative real-time polymerase chain reaction TFR1 Transferrin receptor 1 protein SLC40A1 Ferroportin1, FPN1 GPX4 Glutathione Peroxidase 4 Declarations Acknowledgements We thank Prof. Sijin Yang at the Affiliated Traditional Chinese Medicine Hospital of Southwest Medical University for the fruitful discussions and kind help. Authors’ contributions Wang lixia and Xu houping designed the study. Wang lixia and Ren wei have drafted the work or substantively revised it.Wang lixia, Zhu guijin, Yang luyin, and Luo gang completed the animal study and analyzed the data. Wang lixia, Luo gang and Wang raoqiong contributed to the interpretation of data. Wang lixia, Zhu guijin, Luo gang, Yang luyin, Wang raoqiong, Ren wei and Xu houping read and approved the final manuscript. Funding This work was funded by Sichuan Administration of traditional Chinese Medicine (Grant No. 2022C007 and 2023ZD004); the Luzhou Science and Technology Program (Grant No. 2024JYJ020); the Project of Southwest Medical University (Grant No. 2022YFS0613-C4); Innovation Team and Talents Cultivation Program of National Administration of Traditional Chinese Medicine (Grant No. ZYYCXTD-C-202207). Availability of data and materials All data generated or analyzed during this study are included in this published article. Ethics approval and consent to participate And the animal study protocol was approved by the Animal Ethics Committee of Kunming Medical University (NO.20211111-002). All animal experiments were performed in accordance with a guide to animal ethics. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Footnotes Publisher’s Note References Magid-Bernstein J, Girard R, Polster S, Srinath A, Romanos S, Awad IA et al (2022) Cerebral Hemorrhage: Pathophysiology, Treatment, and Future Directions. Circ Res 130(8):1204–1229 Pinho J, Costa AS, Araújo JM, Amorim JM, Ferreira C (2019) Intracerebral hemorrhage outcome: A comprehensive update. J Neurol Sci 398:54–66 Qureshi AI, Suri MFK, Ostrow PT, Kim SH, Ali Z, Shatla AA et al (2003) Apoptosis as a form of cell death in intracerebral hemorrhage. Neurosurgery. ;52(5) Wei Y, Song X, Gao Y, Gao Y, Li Y, Gu L (2022) Iron toxicity in intracerebral hemorrhage: Physiopathological and therapeutic implications. Brain Res Bull 178:144–154 Ren H, Han R, Chen X, Liu X, Wan J, Wang L et al (2020) Potential therapeutic targets for intracerebral hemorrhage-associated inflammation: An update. J Cereb Blood Flow Metabolism: Official J Int Soc Cereb Blood Flow Metabolism 40(9):1752–1768 Rummel NG, Butterfield DA (2022) Altered Metabolism in Alzheimer Disease Brain: Role of Oxidative Stress. Antioxid Redox Signal 36(16–18):1289–1305 Briyal S, Ranjan AK, Gulati A (2023) Oxidative stress: A target to treat Alzheimer's disease and stroke. Neurochem Int 165:105509 Zhang Y, Khan S, Liu Y, Wu G, Yong VW, Xue M (2022) Oxidative Stress Following Intracerebral Hemorrhage: From Molecular Mechanisms to Therapeutic Targets. Front Immunol 13:847246 Patel M (2016) Targeting Oxidative Stress in Central Nervous System Disorders. Trends Pharmacol Sci 37(9):768–778 Zhao J, Chen C, Ge L, Jiang Z, Hu Z, Yin L (2024) TAK1 inhibition mitigates intracerebral hemorrhage-induced brain injury through reduction of oxidative stress and neuronal pyroptosis via the NRF2 signaling pathway. Front Immunol 15:1386780 Duan C, Wang H, Jiao D, Geng Y, Wu Q, Yan H et al (2022) Curcumin Restrains Oxidative Stress of After Intracerebral Hemorrhage in Rat by Activating the Nrf2/HO-1 Pathway. Front Pharmacol 13:889226 Masomi-Bornwasser J, Kurz E, Frenz C, Schmitt J, Wesp DMA, König J et al (2021) The Influence of Oxidative Stress on Neurological Outcomes in Spontaneous Intracerebral Hemorrhage. Biomolecules. ;11(11) Wei N, Wei Y, Li B, Pang L (2017) Baicalein Promotes Neuronal and Behavioral Recovery After Intracerebral Hemorrhage Via Suppressing Apoptosis, Oxidative Stress and Neuroinflammation. Neurochem Res 42(5):1345–1353 Liang P, Mao L, Ma Y, Ren W, Yang S (2021) A systematic review on Zhilong Huoxue Tongyu capsule in treating cardiovascular and cerebrovascular diseases: Pharmacological actions, molecular mechanisms and clinical outcomes. J Ethnopharmacol 277:114234 Liang P, Mao L, Ma Y, Ren W, Yang S (2021) A systematic review on Zhilong Huoxue Tongyu capsule in treating cardiovascular and cerebrovascular diseases: Pharmacological actions, molecular mechanisms and clinical outcomes. J Ethnopharmacol 277:114234 Mazhar M, Yang G, Mao L, Liang P, Tan R, Wang L et al (2022) Zhilong Huoxue Tongyu Capsules Ameliorate Early Brain Inflammatory Injury Induced by Intracerebral Hemorrhage Inhibition of Canonical NFкβ Signalling Pathway. Front Pharmacol 13:850060 Wang L, Ren W, Wang L, Mao L, Mazhar M, Zhou C et al (2022) Exploring the Ferroptosis Mechanism of Zhilong Huoxue Tongyu Capsule for the Treatment of Intracerebral Hemorrhage Based on Network Pharmacology and Validation. Evidence-based Complementary and Alternative Medicine: ECAM. ;2022:5033135 Dell RB, Holleran S, Ramakrishnan R (2002) Sample size determination. ILAR J 43(4):207–213 Wang Z, Zhou F, Dou Y, Tian X, Liu C, Li H et al (2018) Melatonin Alleviates Intracerebral Hemorrhage-Induced Secondary Brain Injury in Rats via Suppressing Apoptosis, Inflammation, Oxidative Stress, DNA Damage, and Mitochondria Injury. Translational Stroke Res 9(1):74–91 Yang GY, Betz AL, Chenevert TL, Brunberg JA, Hoff JT (1994) Experimental intracerebral hemorrhage: relationship between brain edema, blood flow, and blood-brain barrier permeability in rats. J Neurosurg. ;81(1) Liu X-H, Bi H-Y, Cao J, Ren S, Yue S-W (2019) Early constraint-induced movement therapy affects behavior and neuronal plasticity in ischemia-injured rat brains. Neural regeneration Res 14(5):775–782 Xiong L-L, Xue L-L, Du R-L, Zhou H-L, Tan Y-X, Ma Z et al (2020) Vi4-miR-185-5p-Igfbp3 Network Protects the Brain From Neonatal Hypoxic Ischemic Injury via Promoting Neuron Survival and Suppressing the Cell Apoptosis. Front Cell Dev Biol 8:529544 Ma Z, Wang F, Xue L-L, Niu Y-J, Hu Y, Su Z-Y et al (2020) bFGF promotes neurological recovery from neonatal hypoxic-ischemic encephalopathy by IL-1β signaling pathway-mediated axon regeneration. Brain Behav 10(8):e01696 Hu F, Li T, Gong H, Chen Z, Jin Y, Xu G et al (2017) Bisphenol A Impairs Synaptic Plasticity by Both Pre- and Postsynaptic Mechanisms. Adv Sci (Weinh) 4(8):1600493 Khuman J, Meehan WP, Zhu X, Qiu J, Hoffmann U, Zhang J et al (2011) Tumor necrosis factor alpha and Fas receptor contribute to cognitive deficits independent of cell death after concussive traumatic brain injury in mice. J Cereb Blood Flow Metabolism: Official J Int Soc Cereb Blood Flow Metabolism 31(2):778–789 Yang B, Xia ZA, Zhong B, Xiong X, Sheng C, Wang Y et al (2017) Distinct Hippocampal Expression Profiles of Long Non-coding RNAs in an Alzheimer's Disease Model. Mol Neurobiol 54(7):4833–4846 Gowayed MA, El-Sayed NS, Matar NA, Afify EA, El-Ganainy SO (2022) The α7 nAChR allosteric modulator PNU-120596 amends neuroinflammatory and motor consequences of parkinsonism in rats: Role of JAK2/NF-κB/GSk3β/ TNF-α pathway. Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie. ;148:112776 Xie B-S, Wang Y-Q, Lin Y, Mao Q, Feng J-F, Gao G-Y et al (2019) Inhibition of ferroptosis attenuates tissue damage and improves long-term outcomes after traumatic brain injury in mice. CNS Neurosci Ther 25(4):465–475 Zhao Y, Liu Y, Xu Y, Li K, Zhou L, Qiao H et al (2022) The Role of Ferroptosis in Blood-Brain Barrier Injury. Cell Mol Neurobiol Feng H, Schorpp K, Jin J, Yozwiak CE, Hoffstrom BG, Decker AM et al (2020) Transferrin Receptor Is a Specific Ferroptosis Marker. Cell Rep. ;30(10) Tschoe C, Bushnell CD, Duncan PW, Alexander-Miller MA, Wolfe SQ (2020) Neuroinflammation after Intracerebral Hemorrhage and Potential Therapeutic Targets. J stroke 22(1):29–46 Duan X, Wen Z, Shen H, Shen M, Chen G (2016) Intracerebral Hemorrhage, Oxidative Stress, and Antioxidant Therapy. Oxid Med Cell Longev 2016:1203285 Khatri N, Thakur M, Pareek V, Kumar S, Sharma S, Datusalia AK (2018) Oxidative Stress: Major Threat in Traumatic Brain Injury. CNS Neurol Disord Drug Targets 17(9):689–695 Cobley JN, Fiorello ML, Bailey DM (2018) 13 reasons why the brain is susceptible to oxidative stress. Redox Biol 15:490–503 Cong J, Li JY, Zou W (2024) Mechanism and treatment of intracerebral hemorrhage focus on mitochondrial permeability transition pore. Front Mol Neurosci 17:1423132 Cadenas S (2018) ROS and redox signaling in myocardial ischemia-reperfusion injury and cardioprotection. Free Radic Biol Med 117:76–89 Li Y, Liu H, Tian C, An N, Song K, Wei Y et al (2022) Targeting the multifaceted roles of mitochondria in intracerebral hemorrhage and therapeutic prospects. Biomed Pharmacother 148:112749 Rosenbaum RS, Priselac S, Köhler S, Black SE, Gao F, Nadel L et al (2000) Remote spatial memory in an amnesic person with extensive bilateral hippocampal lesions. Nat Neurosci 3(10):1044–1048 Scoville WB, Milner B (1957) Loss of recent memory after bilateral hippocampal lesions. J Neurol Neurosurg Psychiatry 20(1):11–21 Ólafsdóttir HF, Bush D, Barry C (2018) The Role of Hippocampal Replay in Memory and Planning. Curr Biol 28(1):R37–r50 O'Keefe J, Dostrovsky J (1971) The hippocampus as a spatial map. Preliminary evidence from unit activity in the freely-moving rat. Brain Res 34(1):171–175 Ekstrom AD, Kahana MJ, Caplan JB, Fields TA, Isham EA, Newman EL et al (2003) Cellular networks underlying human spatial navigation. Nature 425(6954):184–188 Hackett ML, Köhler S, O'Brien JT, Mead GE (2014) Neuropsychiatric outcomes of stroke. Lancet Neurol 13(5):525–534 Xiao M, Huang G, Feng L, Luan X, Wang Q, Ren W et al (2020) Impact of sleep quality on post-stroke anxiety in stroke patients. Brain Behav 10(12):e01716 Wang L, Ren W, Wang L, Mao L, Mazhar M, Zhou C et al (2022) Exploring the Ferroptosis Mechanism of Zhilong Huoxue Tongyu Capsule for the Treatment of Intracerebral Hemorrhage Based on Network Pharmacology and In Vivo Validation. Evid Based Complement Alternat Med 2022:5033135 Galho AR, Cordeiro MF, Ribeiro SA, Marques MS, Antunes MF, Luz DC et al (2016) Protective role of free and quercetin-loaded nanoemulsion against damage induced by intracerebral haemorrhage in rats. Nanotechnology 27(17):175101 Cerdá-Bernad D, Costa L, Serra AT, Bronze MR, Valero-Cases E, Pérez-Llamas F et al (2022) Saffron against Neuro-Cognitive Disorders: An Overview of Its Main Bioactive Compounds, Their Metabolic Fate and Potential Mechanisms of Neurological Protection. Nutrients. ;14(24) Imran M, Rauf A, Shah ZA, Saeed F, Imran A, Arshad MU et al (2019) Chemo-preventive and therapeutic effect of the dietary flavonoid kaempferol: A comprehensive review. Phytother Res 33(2):263–275 Taheri P Crosstalk of nitro-oxidative stress and iron in plant immunity. Free Radic Biol Med. 191:137–149 Zhang W, Liu Y, Liao Y, Zhu C, Zou Z (2024) GPX4, ferroptosis, and diseases. Biomed Pharmacother 174:116512 Gurung P, Lukens JR, Kanneganti TD (2015) Mitochondria: diversity in the regulation of the NLRP3 inflammasome. Trends Mol Med 21(3):193–201 Zhang T, Han H, Zhou Y, Liu Z, Ma T, Cao X (2022) MicroRNA-454 modulates the oxidative stress and neuronal apoptosis after cerebral ischemia/reperfusion injury via targeting NADPH oxidase 4 (NOX4). J Biochem Mol Toxicol 36(10):e23153 Li Y, Wu J, Yu S, Zhu J, Zhou Y, Wang P et al (2020) Sestrin2 promotes angiogenesis to alleviate brain injury by activating Nrf2 through regulating the interaction between p62 and Keap1 following photothrombotic stroke in rats. Brain Res 1745:146948 Hwang CY, Han YH, Lee SM, Cho SM, Yu DY, Kwon KS (2020) Sestrin2 Attenuates Cellular Senescence by Inhibiting NADPH Oxidase 4 Expression. Ann Geriatr Med Res 24(4):297–304 Ala M (2022) Sestrin2 in cancer: a foe or a friend? Biomark Res 10(1):29 Gao A, Li F, Zhou Q, Chen L (2020) Sestrin2 as a potential therapeutic target for cardiovascular diseases. Pharmacol Res 159:104990 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 09 Feb, 2026 Reviews received at journal 30 Jan, 2026 Reviews received at journal 15 Jan, 2026 Reviewers agreed at journal 14 Jan, 2026 Reviewers agreed at journal 06 Jan, 2026 Reviewers invited by journal 06 Jan, 2026 Editor assigned by journal 29 Dec, 2025 Submission checks completed at journal 21 Nov, 2025 First submitted to journal 21 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8172042","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":571083520,"identity":"2def0496-2b49-40f4-a892-9c692d1d268c","order_by":0,"name":"lixia Wang","email":"","orcid":"","institution":"Guizhou Provincial People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"lixia","middleName":"","lastName":"Wang","suffix":""},{"id":571083521,"identity":"72fc959d-326a-4ea4-9e6d-d60053e2752a","order_by":1,"name":"guijin Zhu","email":"","orcid":"","institution":"Central Hospital of Zibo","correspondingAuthor":false,"prefix":"","firstName":"guijin","middleName":"","lastName":"Zhu","suffix":""},{"id":571083524,"identity":"56391f58-ea9d-45ef-b714-3e8d00f4e45f","order_by":2,"name":"Gang Luo","email":"","orcid":"","institution":"Affiliated Hospital of Southwest Medical University","correspondingAuthor":false,"prefix":"","firstName":"Gang","middleName":"","lastName":"Luo","suffix":""},{"id":571083525,"identity":"c169e550-11e4-4faa-b3fe-33e1e5799cff","order_by":3,"name":"Luyin Yang","email":"","orcid":"","institution":"Affiliated Hospital of Southwest Medical University","correspondingAuthor":false,"prefix":"","firstName":"Luyin","middleName":"","lastName":"Yang","suffix":""},{"id":571083526,"identity":"5710c478-89e6-4e06-9d8e-5b638c81f177","order_by":4,"name":"Wei Ren","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIiWNgGAWjYNACAwk5fmbmA1BeAlFaLIwl29lgSonSwlCRuOE8jwFxWszbe49JfCiQSNxwmOfzZ96cwwz87DkGDD934NYic+ZcmuQMAwnjmYd5t0nzbjvMINnzxoCx9wxuLRISOWa3eQwkZPuAWphzgVoMbuQYMDO24dEi/8bs9h8DCcaGwzyPP4O02BPUIsFjdhsYyIoTDvMwSINtkSCkhSfH/GcP0C+SzWxm0n+3pfNInHlWcLAXnxb2M8YGP/7UyfHzH378ceY2azn+9uSND37i0YIBeEDEARI0jIJRMApGwSjAAgAw8ExGiq7EFwAAAABJRU5ErkJggg==","orcid":"","institution":"Affiliated Hospital of Southwest Medical University","correspondingAuthor":true,"prefix":"","firstName":"Wei","middleName":"","lastName":"Ren","suffix":""},{"id":571083527,"identity":"ddf5f8c4-2c3e-46fa-9242-574a22ee606a","order_by":5,"name":"Raoqiong Wang","email":"","orcid":"","institution":"Affiliated Hospital of Southwest Medical University","correspondingAuthor":false,"prefix":"","firstName":"Raoqiong","middleName":"","lastName":"Wang","suffix":""},{"id":571083530,"identity":"9fd4656a-975a-4e4b-bbcf-6582bf933536","order_by":6,"name":"Houping Xu","email":"","orcid":"","institution":"Affiliated Hospital of Southwest Medical University","correspondingAuthor":false,"prefix":"","firstName":"Houping","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2025-11-21 10:05:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8172042/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8172042/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":99799058,"identity":"54cb736b-9405-489a-8bcc-f0553ff176d6","added_by":"auto","created_at":"2026-01-08 13:49:11","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3624983,"visible":true,"origin":"","legend":"","description":"","filename":"StudyontheinterventionmechanismofZhiLongHuoXueTongYucapsuleonsecondarybraininjuryafterintracerebralhemorrhagebasedonoxidativestress.docx","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/1465a9e0e1d8b9d5452a92f7.docx"},{"id":99784518,"identity":"1b1713a6-1295-4ad7-9c42-6a0acc2d7e4d","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8778,"visible":true,"origin":"","legend":"","description":"","filename":"3e937d6ba2124d49b0bee132df070cc8.json","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/8283753bc2b9ebc90f20bb4c.json"},{"id":99799388,"identity":"09c99ef5-7ad0-4743-be7a-b517c54bad7d","added_by":"auto","created_at":"2026-01-08 13:49:30","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":148358,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/a12c6c4beaed5572cdd098df.png"},{"id":99784522,"identity":"e492376d-0105-46f1-8920-738bef758c45","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":867050,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/c808462adbbddbd989506c56.png"},{"id":99799021,"identity":"c3dc747a-4eb9-4341-a2d4-1804488d4beb","added_by":"auto","created_at":"2026-01-08 13:49:09","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9392716,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/d70c8d64455a8a6a11276aa0.png"},{"id":99784546,"identity":"80c73d95-82f6-4e3f-b186-5aabff9f4806","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":27589996,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/4a429f546d4606321059e371.png"},{"id":99799030,"identity":"2ee32add-b53a-4285-ba07-81835e57a4dd","added_by":"auto","created_at":"2026-01-08 13:49:10","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5851179,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/9507ee10c7f4b05ecc90912d.png"},{"id":99784526,"identity":"68af3974-e0e8-4333-a0f3-204ff441f9f7","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":359021,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/9e861c3619703a96ff019579.png"},{"id":99798711,"identity":"7a14add8-3eb9-41ea-85d5-5b6175712306","added_by":"auto","created_at":"2026-01-08 13:48:50","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":260910,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/ca06bb21097f04fa0a974791.png"},{"id":99799082,"identity":"dc30713b-386a-49f9-8cc0-17a642461cf0","added_by":"auto","created_at":"2026-01-08 13:49:13","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":139068,"visible":true,"origin":"","legend":"","description":"","filename":"3e937d6ba2124d49b0bee132df070cc81enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/7990210dc63d15aef3afe46a.xml"},{"id":99799381,"identity":"3080a9b1-ceb5-41ca-acb9-cf6da6390e57","added_by":"auto","created_at":"2026-01-08 13:49:30","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":148358,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/8465a890bf1bb22b918ba6b1.png"},{"id":99784523,"identity":"6f8fdd0f-3442-4720-b794-a1db7c13bf00","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1004463,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/292fb660ca5ae1f4f4fc6a38.jpeg"},{"id":99784534,"identity":"7fb60d89-d789-4a2c-a423-919a19857bda","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1186408,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/673bd9e6d11f1d673bc5dd01.jpeg"},{"id":99784540,"identity":"0a3aea1f-608d-4fc3-a5d6-7b2c2a159c29","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1483635,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/f3ca913829b8d379e7f19974.jpeg"},{"id":99799246,"identity":"2fb5471e-9ea3-45b6-97c0-21241e012cf9","added_by":"auto","created_at":"2026-01-08 13:49:22","extension":"jpeg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":941905,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/8f62863813ee96829a14397d.jpeg"},{"id":99799433,"identity":"fd026e27-a8c3-4028-996c-7bb715fa7555","added_by":"auto","created_at":"2026-01-08 13:49:34","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":116872,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/a747ebdf3d96e2f872e4a065.png"},{"id":99799028,"identity":"8207ae81-75da-48f0-a136-b42bba1b2b0a","added_by":"auto","created_at":"2026-01-08 13:49:09","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":168272,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/9f134325eefa560ba592e90c.png"},{"id":99784537,"identity":"bbe38a0e-6fa8-4925-a178-0feb70e14a83","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65099,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/423328db6e48393358427aeb.png"},{"id":99799002,"identity":"abf0855e-8787-420c-9d9d-ff97e0a64f8d","added_by":"auto","created_at":"2026-01-08 13:49:08","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":211240,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/434ab7c262608c24fc5dd126.png"},{"id":99799022,"identity":"e9dae0b2-c36b-4574-8803-9d03ac0fdc0f","added_by":"auto","created_at":"2026-01-08 13:49:09","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":345283,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/84699bd3fa63196c2ebbc6ff.png"},{"id":99784541,"identity":"e07b2d20-a5af-4ae9-a3b2-ea42f89f0e3f","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":469570,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/7f00cc48c160406bdb1adf49.png"},{"id":99799032,"identity":"089b5ff9-5b04-42f0-984c-eacc87c2f4f6","added_by":"auto","created_at":"2026-01-08 13:49:10","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":230058,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/785aa2bd918d18895de6bdc4.png"},{"id":99799310,"identity":"709a4b48-bcb7-493c-8e3d-25653cd9245a","added_by":"auto","created_at":"2026-01-08 13:49:27","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":34378,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/7ca40ae4aa0e543677407fb8.png"},{"id":99799222,"identity":"d88b91ab-4e56-4828-a3f0-de6d367b35f3","added_by":"auto","created_at":"2026-01-08 13:49:22","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":41867,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/f5f37ae773854bd12a850aa4.png"},{"id":99799128,"identity":"4e9b0348-7cbb-490a-8638-f13fe0db63cb","added_by":"auto","created_at":"2026-01-08 13:49:15","extension":"xml","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":137345,"visible":true,"origin":"","legend":"","description":"","filename":"3e937d6ba2124d49b0bee132df070cc81structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/93e3ac5c49efd62d78adde8d.xml"},{"id":99784545,"identity":"df0b059e-cb99-4037-a674-d836216b22ae","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"html","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":152430,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/50ddccb515e0ff1043ef6692.html"},{"id":99799461,"identity":"4d8a950a-9a24-46d2-a9d9-60024574a7fa","added_by":"auto","created_at":"2026-01-08 13:49:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":148358,"visible":true,"origin":"","legend":"\u003cp\u003eThe experimental process and schematic diagram to summarize our new findings.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/e9325aed60b5f20efd6659f5.png"},{"id":99784513,"identity":"740dea12-4910-4128-bf15-23a90da938b4","added_by":"auto","created_at":"2026-01-08 11:15:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":515504,"visible":true,"origin":"","legend":"\u003cp\u003eNeurological scores and ethological examinations including Zea-Longa score, NSS, Open filed test, Y-maze test, Morris water maze and Rotarod test. The results showed that rats were neurological impaired and had poor memory learning function after ICH modeling. And the treatment of ZL capsule could improve the spatial learning and memory functions of rats, with the 2 g/kg/day (High dose) group having a more pronounced effect. (A) The Zea-Longa score and (B) NSS of each group after modeling in 1d, 3d, 5d, 7d, 10d, 14d, 21d were shown (n=10). (* Indicates Sham group compared with the Ich group and Ns group \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; # indicates Ns group compared with the Zll group \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; @ indicates Ns group compared with the Zlm group \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; \u0026amp; indicates Ns group compared with the Zlh group \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05. @ indicates Ns group compared with the Zlm group \u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05) (C) The duration in three arms of Y-maze test in each group. (D) The latency to target and (E) target crossing in day 6 of Morris water maze test. (F) Total distance traveled and (J) trajectory diagram in last day of training of Morris water maze test. (G) Number of grooming, (H) number of standing and (I) total distance of Open filed test were shown. (K) The duration of Rotarod test in each group. Experimental values were expressed as means ± standard deviation (SD) (n=10). *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003e p \u003c/em\u003e\u0026lt; 0.01 and ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001 compared with the Ns group.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/77916c0c9eed6749ba5e552b.png"},{"id":99799584,"identity":"8cb119ef-fbe1-490a-93aa-072a5bb51563","added_by":"auto","created_at":"2026-01-08 13:49:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":736245,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of ZL capsule on brain injury in ICH model rats. HE staining and Nissl staining were carried out to estimate the brain injury after gavage treatment for 21 days. The brain injury was alleviated and total surviving neurons increased in cortex and hippocampus. (A) Representative images of HE staining of brain slices in the rats of different groups. Bar = 50 μm. (B) Quantitative histogram of relative statistics of cortical total surviving neuron in different groups (n =4). (C) Quantitative histogram of relative statistics of cortical dark neuron statistics in different groups (n =4). (D) Quantitative histogram of relative statistics of hippocampal total neuron statistics in different groups (n =3). (E) Quantitative histogram of hippocampal dark neuron statistics in different groups (n =3). Experimental values were expressed as means ± SD. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003e p \u003c/em\u003e\u0026lt; 0.01 and ***\u003cem\u003e p \u003c/em\u003e\u0026lt; 0.001 compared with the Ich group and Ns group.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/6bf6df0d25280a230d521f10.png"},{"id":99784515,"identity":"bb18e099-39f4-456f-87e4-5b64bed62697","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":476913,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative images of Nissl staining of the cortex and hippocampus in the rats of different groups.\u003c/p\u003e","description":"","filename":"image4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/fa8fa363fb7527e7b663bf79.jpeg"},{"id":99784521,"identity":"d2cb0533-5baa-4441-a051-d1640b90fbf6","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":578590,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of ZL capsule on oxidative stress in ICH model rats. (A) Representative images of Perls staining of brain slices in the rats of different groups. Bar = 50 μm. (B) Quantitative histogram of relative statistics of the area of iron deposition in different groups. (C) Quantitative histogram of relative statistics of the expression of SOD. (D) Quantitative histogram of relative statistics of the expression of MDA. (E) Quantitative histogram of relative statistics of the expression of GSH. Experimental values were expressed as means ± SD (n = 3). *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003e p \u003c/em\u003e\u0026lt; 0.01 and ***\u003cem\u003e p \u003c/em\u003e\u0026lt; 0.001 compared with the Ns group.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/a6e6b64dc67bee0ee704ff17.png"},{"id":99799116,"identity":"f50f6228-8edb-4843-a8b1-f0a8d3238e8d","added_by":"auto","created_at":"2026-01-08 13:49:14","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":129647,"visible":true,"origin":"","legend":"\u003cp\u003eAnti-oxidative stress effect of ZL capsule in ICH model rats. Quantitative histogram of relative statistics of the mRNA expression of (A) TFR1, (B) SLC40A1, (C) GPX4,(D) Sestrin2 and (E) NOX4 in the perihematoma brain tissues of rats. Experimental values were expressed as means ± SD (n = 3). *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003e p \u003c/em\u003e\u0026lt; 0.01 and ***\u003cem\u003e p \u003c/em\u003e\u0026lt; 0.001 compared with the Ns group.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/2a8191b45cb1b2503f9af53a.png"},{"id":99784519,"identity":"7f21b815-5cae-4817-8614-11ac72c7b93f","added_by":"auto","created_at":"2026-01-08 11:15:56","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":168272,"visible":true,"origin":"","legend":"\u003cp\u003eAnti-oxidative stress effect of ZL capsule in ICH model rats. Quantitative histogram of relative statistics of the protein expression of (A) NOX4, (B) GPX4 and (D) Sestrin2 in the perihematoma brain tissues of rats. (C) Western blot for GPX4, NOX4, and Sestrin2 protein level in perihematomal area. Experimental values were expressed as means ± SD (n = 3). *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003e p \u003c/em\u003e\u0026lt; 0.01 and ***\u003cem\u003e p \u003c/em\u003e\u0026lt; 0.001 compared with the Ns group.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/15cf9a5f5f425559c875d68c.png"},{"id":100356436,"identity":"29d1c36c-1da1-4dfb-8a95-96ac46b3a814","added_by":"auto","created_at":"2026-01-16 07:09:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3492985,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8172042/v1/078f0e51-2cdd-4da7-a256-5505acc37511.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Study on the intervention mechanism of ZhiLong HuoXue TongYu capsule on secondary brain injury after intracerebral hemorrhage based on oxidative stress","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIntracerebral hemorrhage (ICH) is a type of stroke which is devastatingly characterized by high mortality and disability rates in clinic (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Data has evidenced that ICH has a high early case fatality which reaches 40% in some population-based studies (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Many efforts have tried to find an effective therapy for the treatment of ICH, but little progress on the clinical breakthrough for patients has been made. Based on previous studies, brain injury induced by ICH includes primary brain injury and secondary brain injury (SBI), from which the former refers to physical disruption of parenchymal architecture caused by hematoma (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e), and the SBI was related to deleterious byproducts of red blood cell lysis, which could lead to inflammation, oxidative stress and cell death et al. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Increasing studies have suggested the inhibition of SBI after ICH may be a critical target for exploring ICH therapy.\u003c/p\u003e \u003cp\u003eNumerous evidences have shown that oxidative stress is related to many neurological disorders, including Alzheimer's disease (AD) (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e), stroke (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e) and etc. The overaccumulation of reactive oxygen species (ROS) and deficiency of antioxidant systems (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e) after ICH contribute to the occurrence of oxidative stress. The reason why the brain is vulnerable to oxidative stress remains ambiguous, however, many reasons have been suspected to be related with the characteristic of brain, including high oxygen consumption of the brain for high energy needs, the neuronal membranes are rich in polyunsaturated fatty acids, the high abundance of Fe (II) in the brain and the mechanisms in the brain with low levels of antioxidants (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). As an important mediator of brain injury, ROS involves in the pathophysiology of many different brain diseases. The overgeneration of ROS after ICH leads to oxidative stress, and oxidative stress could interact with inflammation and cell death to exacerbate SBI after ICH (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Many studies have indicated that the suppression of oxidative stress could alleviate brain injury after ICH (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e) and patients with a favorable outcome six months after ICH have higher plasma levels of antioxidative enzymes than those with unfavorable outcomes(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Therefore, oxidative stress continues to remain a key therapeutic target for ICH.\u003c/p\u003e \u003cp\u003eIn recent years, many traditional Chinese medicines (TCMs) exhibit an important role in regulating oxidative stress (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Zhilong Huoxue Tongyu (ZL) capsule is a patent traditional Chinese medicine which is consisted of five TCMs: Astragalus membranaceus (Fisch.) Bunge, Leech, Earthworm, Cinnamomum cassia Presl (Lauraceae) and Sargentodoxa cuneata (Oliv.) Rehd.et Wils.(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Previously, we discovered that ZL capsule has elicit neuroprotective effects after stroke. To be specific, ZL capsule could reduce the volume of intracranial hematoma in patients (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e), and ameliorate ICH induced inflammatory brain injury via targeting the Nuclear factor kappa-β (NF-кβ) canonical signaling pathway in mouse (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). In addition, ZL capsule could alleviate ICH in a muti-target and multi-pathway manner (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Therefore, in this study, we seek to investigate the further specific mechanism of ZL capsule in the treatment of ICH, focusing on the regulation of oxidative stress.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals and grouping\u003c/h2\u003e \u003cp\u003eBefore conducting this study, we estimated the number of rats required using error degrees of freedom (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Finally, we chose ten rats per group as the experimental number. All 60 healthy male Sprague Dawley rats (weighing 250\u0026thinsp;\u0026plusmn;\u0026thinsp;20 g) were purchased from Animal Centre of Kunming Medical University. And the animal study protocol was approved by the Animal Ethics Committee of Kunming Medical University (NO.20211111-002). Rats were maintained in a controlled humidity and temperature environment with alternative 12 h light/dark cycle. The animals were allowed free access to food and water. All experiments were performed in consistence with the Guide for the Care and Use of Laboratory Animal published by the United States National Institutes Health. The rats were randomly divided into 6 experimental groups, (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) Sham, (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) Ich (ICH model group), (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) Ns (Normal saline group), (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) Zll (Low dose of ZL capsule), (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e) Zlm (Medium dose of ZL capsule) and (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e) Zlh (High dose of ZL capsule) capsule group, with 10 rats in each group. The experimental process is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEstablishment of ICH Model\u003c/h3\u003e\n\u003cp\u003eRegarding previous studies, an autologous blood injection in adult male rats was used to induce the ICH model in this study (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Rats were anesthetized with an intraperitoneal (i.p.) injection of pentobarbital sodium (40 mg/kg) and secured on a stereotaxic apparatus (RWD Life Science Co., Ltd, Guangdong, China). Then, anterior fontanelle was raised by 1 mm, and a longitudinal incision with a length of 2 cm was taken to expose the scalp, and a hole was drilled (1.5 mm anterior and 3.0 mm lateral to bregma) and the needle of microsyringe was affixed to the stereotaxic frame with a depth of 6 mm. Next, 100 \u0026micro;l autologous blood collected from the tail was slowly injected into the right brain region in 5 min. The needle was kept in place for an additional 10\u0026ndash;20 min at the end of the injection. Sham-operated rats were intracerebrally injected with needle without blood injection. Finally, the burr hole was sealed with bone wax, and the skin incision was disinfected and sutured. During the ICH surgical procedure, general state of rats was monitored. After waking up, the neurobehavioral scores of the ICH model rats were evaluated according to the Zea-Longa neurological deficits score (1\u0026ndash;3 points) to confirm the establishment of the ICH model (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eDrug Administration\u003c/h3\u003e\n\u003cp\u003eZhilong Huoxue Tongyu Capsule (ZL capsule) was provided by the Pharmacy Department of Affiliated Traditional Chinese Medicine Hospital of Southwest Medical University. The dosage was converted according to the body surface area of rats as 0.5 g/kg/day (Low dose), 1 g/kg/day (Medium dose) and 2 g/kg/day (High dose). The ZL capsule was administered orally for 21 days to the ZL capsule treatment group after modelling. The Ns, Sham and Ich groups were administered with the same dose of normal saline by oral gavage for 21 days.\u003c/p\u003e\n\u003ch3\u003eBehavioral studies\u003c/h3\u003e\n\u003cp\u003eThe rats were assessed at 1, 3, 5, 7, 10, 14 and 21 days after ICH to evaluate the neurobehavioral outcomes according to the Zea-Longa score and Neurological Severity Score (NSS) (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eZea-Longa score\u003c/h3\u003e\n\u003cp\u003eIf the rats had no neurological defect, the score was 0. If the rats had dysfunction in stretching the left forelimb, the score was 1. If the rats walked in circles and cannot go straight, the score was 2. If the rats leaned to the opposite side when standing or crawling, the score was 3. If the rats were unconscious and unable to walk, the score was 4.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eNeurological severity score (NSS)\u003c/h2\u003e \u003cp\u003eThe NSS evaluation included the motor (muscle status, abnormal movement), sensory (visual, tactile, proprioceptive), balance tests, and reflexes that were recorded on a scale of 0\u0026ndash;18 (0, normal score; 18, maximal deficit score).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eY-maze test\u003c/h3\u003e\n\u003cp\u003eY-maze test was used to assess the distinctiveness, working memory and reference memory of rats. The Y-maze device was consisted of three arms including initial, wrong and food arms (Xinruan, Shanghai, China). The rats were fasted for 1 day to increase the rat\u0026rsquo;s desire to food. In the adaptation period, they were placed in the middle of the apparatus and allowed to move freely through the maze for approximately 10 minutes, which was adapted to 3 times in one day. During training period, the food (bait) was placed in food arm of the Y-maze. The door of the wrong arm was closed, and the rats were placed in the initial arm to find the food. And the training frequency was the same as previous described. Finally, in the formal test, the doors of the three arms of the Y-maze were simultaneously opened with no food, the rats were placed in the initial arm. The maze was cleaned between each rat using 75% ethyl alcohol. The arm entries of each rat were observed and recorded and the number of times the rats entered each arm within 5 minutes and the residence time in each arm were recorded to analyze the ability of spatial memory in rats (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eMorris water maze (MWW)\u003c/h2\u003e \u003cp\u003eMorris water maze (MWW) was employed to investigate the ability of spatial learning and memory after ICH in rats (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). The MWW test was consist of two parts: training period (1-5th day) and probe trial (6th day). During the training period, the rats were guided to locate a hidden and 1.5 cm submerged platform under the water in circular pool which was divided into four quadrants, and the platform was placed in the center of one quadrant. And the water temperature was maintained at 22\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5\u0026deg;C. The rats were trained to find the location of the platform and experienced four trials per day from different release positions in 90 s. If the rat failed to escape on the platform within 90 s, it was guided to locate on platform and stay on the platform for 10 s, and the tracking system was used to record and analyze the latency of finding the platform. During the probe trial, the platform was removed, rats were allowed to explore the pool and tracked at the same time within 90 s, and the number of platform area crossings was measured.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eRotarod test\u003c/h2\u003e \u003cp\u003eRotarod test was the classical behavioral test used to evaluate the locomotion and motor coordination of rats after neurological disorders (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). All the rats received adaptive training before the formal test. The rats were placed on the rotating rod to adapt to the movement on the rod. The rotation speed of the rod was set to 10 revolutions per minute (RPM). The rats were trained for 10 minutes per day for 3 consecutive days. During the formal test, the rod was set to accelerate from 0 RPM to 30 RPM within 3 minutes, and the time of duration on the rod was recorded. The test was performed three times one day, and the rats rested for at least 30 minutes to ensure the experimental results.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eTissue harvest\u003c/h2\u003e \u003cp\u003eAfter behavioral studies, the rats were sacrificed for diverse experimental objectives. For the morphological detection, the rats in each group were sacrificed on 21th day with an intraperitoneal (i.p.) injection of pentobarbital sodium (40 mg/kg). The brain samples were obtained after intracardiac perfusion with 0.9% physiological saline followed by 4% paraformaldehyde, and the brains were put into 4% paraformaldehyde for more than 72 h. With paraffin embedded, the 4 \u0026micro;m-thick brain sections were prepared for morphological staining including Hematoxylin and Eosin staining (HE Staining), Nissl staining and Perls staining. For molecular biology analysis, rats in each group were anesthetized and sacrificed on 21th day after ICH. The tissues including cortex and hippocampus of the ipsilateral (right) hemisphere were collected and stored at -80\u0026deg;C for further detection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin and Eosin Staining (HE Staining)\u003c/h2\u003e \u003cp\u003eAfter 72 h fixation in 4% paraformaldehyde, the brain samples were dehydrated by gradient concentrations of ethanol, transparent by xylene, immersed in wax, and embedded in paraffin. Then paraffin-embedded brains were cut into 4 \u0026micro;m‐thick coronal sections. After being transferred to glass slides, the sections were stained with hematoxylin and eosin (HE) (Servicebio, G1005). Subsequently, the morphological changes in each group were observed under microscope (3D-histech (Pannoramic)).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eNissl Staining\u003c/h2\u003e \u003cp\u003eAfter sectioned in 4 \u0026micro;m-thickness, the neuronal cells of the cortex section were visualized by a Nissl staining assay. The sections were dewaxed and stained by Nissl Staining Solution kit (Servicebio, G1430). Five sections were randomly selected from each rat, with four rats in each group, and the neurons including dark neurons and normal neurons in the cortex area was captured by 3D-histech. Three sections were randomly selected from each rat, with three rats in each group, and the neurons in the hippocampus areas including hippocampal cornu ammonis 1 (CA1), CA2, CA3, and dentate gyrus (DG) areas was captured the same as previously reported. Image J was used to count the number of total nerve cells and dark nerve cells. Eventually, the percentage of dark neuron cells was calculated to assess the injury of neuronal cells after ICH.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003ePerls staining\u003c/h2\u003e \u003cp\u003eAfter sectioned in 4 \u0026micro;m-thickness, the deposition area of iron was carried out by a Perls staining kit (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). The sections were dewaxed and stained (Servicebio, G1420). Three animals per group were viewed and photographed under 3D-histech. Iron‐positive cell areas were calculated by four randomly‐selected microscopic fields at \u0026times; 200 magnification around the modeling area. Image J was used to measure the area of iron deposition.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of lipid peroxide levels\u003c/h2\u003e \u003cp\u003eIn order to measure the level of lipid peroxide, malondialdehyde (MDA), superoxide dismutase (SOD) and glutathione (GSH) assay kits (Nanjing Jiancheng Bioengineering Institute, China) were carried out according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time polymerase chain reaction (qRT-PCR)\u003c/h2\u003e \u003cp\u003eThe mRNA levels of oxidative stress related gene TFR1, GPX4, Sestrin2 and NOX4 were analyzed in each group after ICH modeling using qRT- PCR. The tissues collected from rats were used to extract total RNA by Trizol reagent. Reverse transcription to cDNA was performed using HiFi-MMLV cDNA Kit (Cwbio, CW0744M) to synthesize the cDNA template. PCR primers used for PCR amplification were obtained from Sangon Biotech (Chengdu, China). QRT-PCR was then performed in LightCycler 480 (Roche) using SYBR Green Kit (Cwbio, CW2601H). Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was used as an internal control to normalize the data, the RNA expression levels were calculated by the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e (Quantitation-Comparative CT) method. The primers are presented as follows: 5ʹ-CAAGGCTGAGAATGGGAAGC-3\u0026prime; (Forward Primer) and 5ʹ-GAAGACGCCAGTAGACTCCA-3\u0026prime; (Reverse Primer) for GAPDH, 5ʹ- AGCTGCCACCTGAGAACATC \u0026minus;\u0026thinsp;3\u0026prime; (Forward Primer) and 5ʹ- CGCACGCCCTTTATTCATGG \u0026minus;\u0026thinsp;3\u0026prime; (Reverse Primer) for TFR1, 5ʹ- GGCTGTGGGATACTTCCTGA \u0026minus;\u0026thinsp;3\u0026prime; (Forward Primer) and 5ʹ- TTCAATGGGTCTCTGCTTGG \u0026minus;\u0026thinsp;3\u0026prime; (Reverse Primer) for Sestrin2, 5ʹ- CTACAAGAAGTCACAACACA \u0026minus;\u0026thinsp;3\u0026prime; (Forward Primer) and 5ʹ- TCGTCCAGATACTCAGCATA \u0026minus;\u0026thinsp;3\u0026prime; (Reverse Primer) for NOX4, 5ʹ- TTCCCCAGACCAGCAACAGC \u0026minus;\u0026thinsp;3\u0026prime; (Forward Primer) and 5ʹ- GCCAGGATTCGTAAACCACA \u0026minus;\u0026thinsp;3\u0026prime; (Reverse Primer) for GPX4, 5ʹ- CCCCATAATCTCCGTCAGCC \u0026minus;\u0026thinsp;3\u0026prime; (Forward Primer) and 5ʹ- TGAAGGTTCGTTAGTGCCCC \u0026minus;\u0026thinsp;3\u0026prime; (Reverse Primer) for SLC40A1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eTo testify the protein expression of GPX4, Sestrin2 and NOX4 after ICH, the tissues stored at -80\u0026deg;C were used. The protein was extracted from each group using RIPA lysis buffer (Beyotime, P0013C) containing PMSF. Then the protein concentration of the tissues was quantified using BCA assay kit (Beyotime, P0012S). Afterward, protein (42 \u0026micro;g) was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis at 80 V for 30 min and then at 120 V for 1 h. Further, the samples were transferred to polyvinylidene fluoride membranes (Millipore, IPVH00010) at 400 mA for 20 min. After being locked in 5% BSA for 2 h, the membranes were then incubated with GPX4 primary antibody (1:5000; Abcam (ab125066), rabbit), Sestrin2 primary antibody (1:5000; Abcam (ab178518), rabbit) and NOX4 primary antibody (1:5000; Abcam (ab133303), rabbit) overnight at 4\u0026deg;C. GAPDH (1:5000, Beyotime, (AF1186), rabbit) was selected as an internal control. The membranes were rinsed in TBST and incubated with secondary antibody (1:5000; goat anti-rabbit IgG; ZSGB-BIO, (bs-40295G-HRP)) for 2 h at room temperature. Finally, after being rinsed in TBST, the membranes were developed with the ECL (Beyotime, P0018AS) luminescence solution. The quantitative analysis was carried out by ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eExperimental data were analyzed using SPSS 24.0 software and presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Data comparisons among groups were analyzed using one-way ANOVA. \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eZL Capsule Attenuated Neurological Deficits in Rats After ICH\u003c/h2\u003e \u003cp\u003eZL capsule has shown a therapeutic effect on stroke in clinic, however, the specific mechanism of ZL capsule on ICH still leaves unknown. The neuroprotection effect of ZL capsule was assessed by neurological scores and ethological examinations including Zea-Longa score, NSS, Open filed test, Y-maze test, Morris water maze and Rotarod test. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Zea-Longa score was significantly increased in Ich group and Ns group after ICH compared with the Sham group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), indicating the successful modeling of ICH. As expected, the NSS in Ich group and Ns group was obviously increased after ICH compared with the Sham group, while it significantly decreased in ZL capsule groups as compared with the Ns group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). In the open field test, the frequency of standing and grooming was distinctly decreased in Ich and Ns rats compared with Sham animals, and as excepted, the ZL capsule rats showed more frequency of standing and grooming compared with Ns rats (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG, H). Additionally, the total distance reduced in Ich and Ns rats compared with Sham animals, and the ZL capsule rats showed a greater total distance in open filed test compared with Ns rats (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). In the Y-maze test, compared with Sham group, the duration of food arm was lower, the duration of wrong arm was higher in Ich group and Ns group, while ZL capsule rats showed longer duration in food arm and lower duration in wrong arm compared with Ns rats (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). In the Morris water maze, after 5 days of spatial learning and 1 day of spatial memory exploration test, the ZL capsule rats performed better in learning and memory function than that of rats in Ich group and Ns group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, J), and the ZL capsule rats have crossed the platform with more times and less total distance (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, F). In the rotarod test, the rats in Ich group and Ns group have demonstrated a shorter duration on the rotarod compared with Sham group, while the ZL capsule rats exhibited a longer duration on the rotarod compared with Ns group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eK). All above tests indicated that the treatment of ZL capsule contributed the recovery of neurological deficits in rats after ICH.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eZL capsule Improved ICH‑Induced Neuron Damage in rats\u003c/h2\u003e \u003cp\u003e21 days after ICH, HE staining was performed to assess the tissue injury in each group. Morphology of the brain tissues after ICH was examined by HE staining, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, the tissue in Sham group showed normal structure and no swelling or necrosis cells were observed. In Ich group and Ns group, tissue was loose and grid shaped, and displayed obvious red blood cells infiltration, severe cellular swelling and death. The administration of ZL capsule reversed above damages, especially in Zlh group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eNissl staining was used to evaluate the damage of neuron after ICH in rats, as expected, the section showed discernible Nissl bodies, nucleus and cytoplasm in Sham group, and neurons was arranged tightly. However, in Ich group and Ns group, the sections displayed with significantly damage, swelling, nuclear deformation and Nissl bodies reduction, and the number of dead cell was dramatically increased. Also, it was found that the treatment of ZL capsule could improve neuronal damage and neurological deficits compared with the ICH modeling rats in Ich group and Ns group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Compared with the ICH modeling rats, the total cortical neurons after the treatment of ZL capsule showed no difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). It also indicated the safety and low neuronal toxicity of ZL capsule. What\u0026rsquo;s more, the treatment group showed fewer dark neurons compared with the ICH modeling groups, especially in Zlh group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). As for hippocampus, the neuroprotective function is closely related to the dose of ZL capsule. Zlh group rats showed fewer dark neurons in different hippocampal subdivisions CA1, CA3 and DG (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Moreover, Zlm and Zll rats showed fewer dark neurons in CA2 region, but there was no statistical difference among three treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). The ICH modeling groups retained fewer total neurons in CA1 compared with Sham group. Zlh group showed no statistical difference compared with ICH modeling groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), indicating the safety of ZL capsule. Compared with Sham group, the total neurons in DG showed no statistical difference in ICH modeling groups, and the treatment of ZL capsule had no effect on total neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eZL capsule Alleviates oxidative stress after ICH in rats\u003c/h2\u003e \u003cp\u003eIt has been recognized that oxidative stress is a main inducer of second brain injury after ICH. Regarding previous studies, the inhibition of oxidative stress shows cerebral protection after ICH. The iron deposition and lipid peroxidation were assessed by Perls staining and oxidative stress markers such as MDA assay kit, SOD assay kit and GSH assay kit to analyze the expression level of oxidative stress after ICH in rats. Compared with Sham groups, the sections in Ich group and Ns group showed a large blue iron deposition area after ICH. However, the treatment of ZL capsule after ICH decreased the area of iron deposition compared with Ns group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B). In the detection of lipid peroxidation, the expression of the SOD and GSH were reduced and the level of MDA were increased in Ich group and Ns group after ICH compared with Sham group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D, E). However, the administration of ZL capsule decreased the level of MDA and improved the expression of SOD and GSH by comparison with Ns group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D, E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eZL capsule Ameliorates ICH‑Induced oxidative stress via inhibiting iron deposition and mitochondrial destabilization\u003c/h2\u003e \u003cp\u003eTo validate the inhibition of ZL capsule on oxidative stress, the expression level of key targets in oxidative stress pathway was measured. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, the mRNA expression level of transferrin receptor 1 protein (TFR1) and SLC40A1 (Ferroportin1, FPN1), the markers of which were related to the iron metabolism (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e), has shown that the expression of TFR1 markedly increased and the expression of SLC40A1 significantly decreased compared with Sham group after ICH (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B), and the treatment of ZL capsule decreased the expression of TFR1 and increased the expression of SLC40A1 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B) compared with Ns group after ICH. Moreover, the mRNA expression level of Glutathione Peroxidase 4 (GPX4), the key genes related to lipid peroxidation, were significantly decreased after ICH compared with Sham group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC), and this effect was blocked by the treatment of ZL capsule (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC) compared with Ns group after ICH. Being consistent with the result of PCR, the western blot protein level of GPX4 decreased after ICH compared with Sham group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB, C), and the treatment of ZL capsule increased the GPX4 protein expression (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB, C) compared with Ns group after ICH.\u003c/p\u003e \u003cp\u003eIn order to further verify the mechanism of ZL capsule on oxidative stress inhibition, we investigated the expression level of Sestrin2 (SESN2) and NADPH oxidase 4 (NOX4)after ICH. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, the mRNA expression level of NOX4 was significantly increased after ICH compared with Sham group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE), and this effect was blocked by the treatment of ZL capsule (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE) compared with Ns group after ICH. The mRNA expression level of Sestrin2 was significantly decreased after ICH compared with Sham group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD), and this effect was blocked by the treatment of ZL capsule (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD) compared with Ns group after ICH. Moreover, similar to the tendency of PCR, the western blot result of NOX4 was increased dramatically after ICH compared with Sham group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, C), Sestrin2 was decreased significantly after ICH compared with Sham group (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, C), and these effects were blocked by ZL capsule treatment (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, D, C) compared with Ns group after ICH. Taken together, our data suggested that the treatment of ZL capsule could alleviate ICH-induced brain injury via suppressing oxidative stress and iron metabolism.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study explored the effect and mechanisms of ZL capsule on ICH-induced oxidative stress. We discovered that the treatment of ZL capsule after ICH could attenuate neurological deficits in rats, and improve ICH‑induced neuron damage. Further experiments revealed that ZL capsule could inhibit iron metabolism and suppressing oxidative stress via muti-targets and muti-pathways. These results suggested that ZL capsule could be a potential drug for the treatment of ICH.\u003c/p\u003e \u003cp\u003eAccumulating evidence showed that SBI played an important role in the progression after ICH. The biochemical, cellular and physiological changes like inflammation, neurotoxicity, blood brain barrier, mitochondrial dysfunction, oxidative stress and cell death contribute to the SBI and eventually lead to irreversible neuronal injury (\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). Due to its high unsaturated lipid enrichment and iron content and modest antioxidant defence, the brain is susceptible to damage from oxidative stress (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e) after ICH. And oxidative stress could be triggered by ICH and participate the following pathophysiology of ICH. It is meaningful to figure out the specific role of oxidative stress after ICH.\u003c/p\u003e \u003cp\u003eAs the energy producer of cell, mitochondria not only serve as the main producers of ROS, but also contribute to their harmful amplification (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). As pivotal organelles governing cellular metabolism and redox homeostasis, mitochondria could regulate ROS levels according to cellular demands via its precise mechanisms (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). Under normal circumstances, the dynamic balance between ROS generation and elimination is a key event in the regulation of to ensure the function of cell. However, after ICH, the mitochondrion was stimulated by various stimuli, such as hemin, the morphology, location and dynamics of mitochondrion were destroyed due to ICH, eventually leading to the sustained oxidative stress and following SBI (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Consequently, to figure out the role of mitochondrion after ICH is meaningful for the development of ICH drugs.\u003c/p\u003e \u003cp\u003eTraditional Chinese medicine has a long history with unique advantages in stroke treatment. Chinese herb prescription has shown neuroprotective effect through various pathways. In our experiment, to clarify the protection of ZL capsule on memory function after ICH, Morris water maze and Y-maze test were carried out. Our data suggested that ZL capsule could improve the spatial memory after ICH. The hippocampus played a key role in the centre of a network supporting memory function, especially memory for places and events (\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Place cells, neurons in the hippocampus with spatial receptive fields are typically pyramidal neurons from the CA1 and CA3 regions of the hippocampus (\u003cspan additionalcitationids=\"CR41\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). The injury of hippocampus is associated with memory dysfunction after ICH in rats. The Nissl staining results suggested the treatment of ZL capsule after ICH could survive more total neurons in CA1 region, and decrease the dark neurons in CA1, CA2, CA3 and DG regions, particularly in CA1, CA3 and DG regions of Zlh group. This may explain the potential mechanism of ZL capsule in improving learning and memory after ICH in rats. Open filed test was also carried out to assess the anxiety state of rats through observing the grooming and standing behavior and total distance of rats. Mood and emotional disturbances are frequent symptoms in stroke patients (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e), to improve post stroke anxiety remains a clinically important issue. Anxiety-related neural circuits span a wide range of brain structures, including subcortical white matter and the limbic system (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). To further analyze the protective effect of ZL, we statistically analyzed the dark neurons in the cortical area through Nissl staining. In Nissl staining, more neurons survived in cortical regions after the treatment of ZL capsule, and the therapeutic effect has a dose dependent manner. What\u0026rsquo; more, there was no significant difference in the total neurons in cortical regions, which further indicated the safety of ZL capsule.\u003c/p\u003e \u003cp\u003eIn this experiment, we also found the treatment of ZL capsule alleviated brain injuries after ICH via relating oxidative stress pathways. In our previous study, the main chemicals in ZL capsule including quercetin, crocetin and kaempferol were identified to be active ingredients for the treatment of ICH (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). And these active ingredients have a common function, namely, antioxidation (\u003cspan additionalcitationids=\"CR47\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). Moreover, previously we also discovered that the pathways of ZL capsule for the treatment of ICH included Ferroptosis, chemical carcinogenesis - reactive oxygen species and so on (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). Therefore, ZL capsule may play a therapeutic role in ICH by regulating oxidative stress after ICH.\u003c/p\u003e \u003cp\u003eIn our study, we tested the level of GSH, MDA and SOD, which are the markers of oxidative stress. After ICH, the excessive accumulation of Fe could facilitate the production of ROS and contribute to the oxidative stress via Fenton and Harber-Weiss reactions(\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). SLC40A1 could transport iron from the intracellular space to the extracellular space and TFR1 could transport iron from the extracellular space to the intracellular space. And we also measured the area of ironic deposition to evaluate the oxidative stress. Our data suggested that ZL capsule could decrease the area of ironic deposition and promote the iron absorption and following oxidative stress. As a multifunctional antioxidant enzyme, GPX4 is intricately linked to cellular antioxidant defense. And the upregulating of GPX4 after brain injury could provide neuroprotection and prevent further deterioration(\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). Our results have confirmed that the treatment of ZL capsule could attenuate oxidative stress.\u003c/p\u003e \u003cp\u003eAfter ICH, the mitochondrial destabilization contributes to the oxidative stress and subsequent SBI. Therefore, it is meaningful to regulate the oxidative stress for the treatment of ICH. Mitochondria are the major sources of cellular ROS (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). And NOX4 locates on mitochondria, which are closely related to ROS production and oxidative stress (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e). Regulating the mitochondrial dynamics is a potential therapeutic method for the treatment of ICH. Sestrins are a family of highly conserved stress-inducible proteins that maintain homeostasis. Sestrin2 is an important member of the family and has been implicated in oxidative stress (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e). It has found that the loss of Sestrin2 contributes to the generation of ROS via triggering NOX4 (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e). All these results have shown that ZL capsule could decrease the expression of oxidative stress. To further determine the specific pathways of oxidative stress, we also discovered that the treatment of ZL capsule could decrease the expression of NOX4, increase the expression of Sestrin2 after ICH. The results indicated ZL capsule might attenuate brain injury via regulating NOX4 and Sestrin2. Moreover, based on the findings of our previous study (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e), we detected the level of TP53, a predicted target involved in ICH. And the results suggested that ZL capsule could inhibit the expression level of TP53 in rats after ICH. Recent research reveals that Sestrin2 is the downstream factor of TP53 (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). Thus, further research is needed to identify the role of TP53/Sestrin2/NOX4 pathway on oxidative stress for the treatment of ICH.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eCollectively, these results have revealed that ZL capsule has shown neuroprotective effect via improving rats\u0026rsquo; memory function and ameliorating ICH‑induced neuron damage via muti-targets and muti-pathways. And the specific pathway was related with impressing the expression of oxidative stress via regulating the pathway of Sestrin2/NOX4 pathway. Mitochondria have played an important role in the progress of SBI after ICH. Sestrin2 and NOX4 are also intricately linked to mitochondria. Further effect was needed to explain the relationship between SBI and mitochondrial dynamics.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eZL Zhilong Huoxue Tongyu\u003c/p\u003e \u003cp\u003eICH Intracerebral hemorrhage\u003c/p\u003e \u003cp\u003eMDA Malondialdehyde\u003c/p\u003e \u003cp\u003eSOD Superoxide dismutase\u003c/p\u003e \u003cp\u003eGSH Glutathione\u003c/p\u003e \u003cp\u003eNOX4 NADPH oxidase 4\u003c/p\u003e \u003cp\u003eAD Alzheimer's disease\u003c/p\u003e \u003cp\u003eSBI Secondary brain injury\u003c/p\u003e \u003cp\u003eROS Reactive oxygen species\u003c/p\u003e \u003cp\u003eTCMs Traditional Chinese medicines\u003c/p\u003e \u003cp\u003eNF-кβ Nuclear factor kappa-β\u003c/p\u003e \u003cp\u003eNSS Neurological Severity Score\u003c/p\u003e \u003cp\u003eMWW Morris water maze\u003c/p\u003e \u003cp\u003eRPM Revolutions per minute\u003c/p\u003e \u003cp\u003eqRT-PCR Quantitative real-time polymerase chain reaction\u003c/p\u003e \u003cp\u003eTFR1 Transferrin receptor 1 protein\u003c/p\u003e \u003cp\u003eSLC40A1 Ferroportin1, FPN1\u003c/p\u003e \u003cp\u003eGPX4 Glutathione Peroxidase 4\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Prof. Sijin Yang at the Affiliated Traditional Chinese Medicine Hospital of Southwest Medical University for the fruitful discussions and kind help.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWang lixia and Xu houping designed the study. Wang lixia and Ren wei have drafted the work or substantively revised it.Wang lixia, Zhu guijin, Yang luyin, and Luo gang completed the animal study and analyzed the data. Wang lixia, Luo gang and Wang raoqiong contributed to the interpretation of data. Wang lixia, Zhu guijin, Luo gang, Yang luyin, Wang raoqiong, Ren wei and Xu houping read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was funded by Sichuan Administration of traditional Chinese Medicine (Grant No. 2022C007 and 2023ZD004); the Luzhou Science and Technology Program (Grant No. 2024JYJ020); the Project of Southwest Medical University (Grant No. 2022YFS0613-C4); Innovation Team and Talents Cultivation Program of National Administration of Traditional Chinese Medicine (Grant No. ZYYCXTD-C-202207).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnd the animal study protocol was approved by the Animal Ethics Committee of Kunming Medical University (NO.20211111-002). All animal experiments were performed in accordance with a guide to animal ethics.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFootnotes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePublisher\u0026rsquo;s Note\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMagid-Bernstein J, Girard R, Polster S, Srinath A, Romanos S, Awad IA et al (2022) Cerebral Hemorrhage: Pathophysiology, Treatment, and Future Directions. Circ Res 130(8):1204\u0026ndash;1229\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePinho J, Costa AS, Ara\u0026uacute;jo JM, Amorim JM, Ferreira C (2019) Intracerebral hemorrhage outcome: A comprehensive update. J Neurol Sci 398:54\u0026ndash;66\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQureshi AI, Suri MFK, Ostrow PT, Kim SH, Ali Z, Shatla AA et al (2003) Apoptosis as a form of cell death in intracerebral hemorrhage. Neurosurgery. ;52(5)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei Y, Song X, Gao Y, Gao Y, Li Y, Gu L (2022) Iron toxicity in intracerebral hemorrhage: Physiopathological and therapeutic implications. Brain Res Bull 178:144\u0026ndash;154\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen H, Han R, Chen X, Liu X, Wan J, Wang L et al (2020) Potential therapeutic targets for intracerebral hemorrhage-associated inflammation: An update. J Cereb Blood Flow Metabolism: Official J Int Soc Cereb Blood Flow Metabolism 40(9):1752\u0026ndash;1768\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRummel NG, Butterfield DA (2022) Altered Metabolism in Alzheimer Disease Brain: Role of Oxidative Stress. Antioxid Redox Signal 36(16\u0026ndash;18):1289\u0026ndash;1305\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBriyal S, Ranjan AK, Gulati A (2023) Oxidative stress: A target to treat Alzheimer's disease and stroke. Neurochem Int 165:105509\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Khan S, Liu Y, Wu G, Yong VW, Xue M (2022) Oxidative Stress Following Intracerebral Hemorrhage: From Molecular Mechanisms to Therapeutic Targets. Front Immunol 13:847246\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatel M (2016) Targeting Oxidative Stress in Central Nervous System Disorders. Trends Pharmacol Sci 37(9):768\u0026ndash;778\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao J, Chen C, Ge L, Jiang Z, Hu Z, Yin L (2024) TAK1 inhibition mitigates intracerebral hemorrhage-induced brain injury through reduction of oxidative stress and neuronal pyroptosis via the NRF2 signaling pathway. Front Immunol 15:1386780\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuan C, Wang H, Jiao D, Geng Y, Wu Q, Yan H et al (2022) Curcumin Restrains Oxidative Stress of After Intracerebral Hemorrhage in Rat by Activating the Nrf2/HO-1 Pathway. Front Pharmacol 13:889226\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMasomi-Bornwasser J, Kurz E, Frenz C, Schmitt J, Wesp DMA, K\u0026ouml;nig J et al (2021) The Influence of Oxidative Stress on Neurological Outcomes in Spontaneous Intracerebral Hemorrhage. Biomolecules. ;11(11)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei N, Wei Y, Li B, Pang L (2017) Baicalein Promotes Neuronal and Behavioral Recovery After Intracerebral Hemorrhage Via Suppressing Apoptosis, Oxidative Stress and Neuroinflammation. Neurochem Res 42(5):1345\u0026ndash;1353\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang P, Mao L, Ma Y, Ren W, Yang S (2021) A systematic review on Zhilong Huoxue Tongyu capsule in treating cardiovascular and cerebrovascular diseases: Pharmacological actions, molecular mechanisms and clinical outcomes. J Ethnopharmacol 277:114234\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang P, Mao L, Ma Y, Ren W, Yang S (2021) A systematic review on Zhilong Huoxue Tongyu capsule in treating cardiovascular and cerebrovascular diseases: Pharmacological actions, molecular mechanisms and clinical outcomes. J Ethnopharmacol 277:114234\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMazhar M, Yang G, Mao L, Liang P, Tan R, Wang L et al (2022) Zhilong Huoxue Tongyu Capsules Ameliorate Early Brain Inflammatory Injury Induced by Intracerebral Hemorrhage Inhibition of Canonical NFкβ Signalling Pathway. Front Pharmacol 13:850060\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Ren W, Wang L, Mao L, Mazhar M, Zhou C et al (2022) Exploring the Ferroptosis Mechanism of Zhilong Huoxue Tongyu Capsule for the Treatment of Intracerebral Hemorrhage Based on Network Pharmacology and Validation. Evidence-based Complementary and Alternative Medicine: ECAM. ;2022:5033135\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDell RB, Holleran S, Ramakrishnan R (2002) Sample size determination. ILAR J 43(4):207\u0026ndash;213\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Zhou F, Dou Y, Tian X, Liu C, Li H et al (2018) Melatonin Alleviates Intracerebral Hemorrhage-Induced Secondary Brain Injury in Rats via Suppressing Apoptosis, Inflammation, Oxidative Stress, DNA Damage, and Mitochondria Injury. Translational Stroke Res 9(1):74\u0026ndash;91\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang GY, Betz AL, Chenevert TL, Brunberg JA, Hoff JT (1994) Experimental intracerebral hemorrhage: relationship between brain edema, blood flow, and blood-brain barrier permeability in rats. J Neurosurg. ;81(1)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X-H, Bi H-Y, Cao J, Ren S, Yue S-W (2019) Early constraint-induced movement therapy affects behavior and neuronal plasticity in ischemia-injured rat brains. Neural regeneration Res 14(5):775\u0026ndash;782\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiong L-L, Xue L-L, Du R-L, Zhou H-L, Tan Y-X, Ma Z et al (2020) Vi4-miR-185-5p-Igfbp3 Network Protects the Brain From Neonatal Hypoxic Ischemic Injury via Promoting Neuron Survival and Suppressing the Cell Apoptosis. Front Cell Dev Biol 8:529544\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa Z, Wang F, Xue L-L, Niu Y-J, Hu Y, Su Z-Y et al (2020) bFGF promotes neurological recovery from neonatal hypoxic-ischemic encephalopathy by IL-1β signaling pathway-mediated axon regeneration. Brain Behav 10(8):e01696\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu F, Li T, Gong H, Chen Z, Jin Y, Xu G et al (2017) Bisphenol A Impairs Synaptic Plasticity by Both Pre- and Postsynaptic Mechanisms. Adv Sci (Weinh) 4(8):1600493\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhuman J, Meehan WP, Zhu X, Qiu J, Hoffmann U, Zhang J et al (2011) Tumor necrosis factor alpha and Fas receptor contribute to cognitive deficits independent of cell death after concussive traumatic brain injury in mice. J Cereb Blood Flow Metabolism: Official J Int Soc Cereb Blood Flow Metabolism 31(2):778\u0026ndash;789\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang B, Xia ZA, Zhong B, Xiong X, Sheng C, Wang Y et al (2017) Distinct Hippocampal Expression Profiles of Long Non-coding RNAs in an Alzheimer's Disease Model. Mol Neurobiol 54(7):4833\u0026ndash;4846\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGowayed MA, El-Sayed NS, Matar NA, Afify EA, El-Ganainy SO (2022) The α7 nAChR allosteric modulator PNU-120596 amends neuroinflammatory and motor consequences of parkinsonism in rats: Role of JAK2/NF-κB/GSk3β/ TNF-α pathway. Biomedicine \u0026amp; Pharmacotherapy\u0026thinsp;=\u0026thinsp;Biomedecine \u0026amp; Pharmacotherapie. ;148:112776\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie B-S, Wang Y-Q, Lin Y, Mao Q, Feng J-F, Gao G-Y et al (2019) Inhibition of ferroptosis attenuates tissue damage and improves long-term outcomes after traumatic brain injury in mice. CNS Neurosci Ther 25(4):465\u0026ndash;475\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Y, Liu Y, Xu Y, Li K, Zhou L, Qiao H et al (2022) The Role of Ferroptosis in Blood-Brain Barrier Injury. Cell Mol Neurobiol\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng H, Schorpp K, Jin J, Yozwiak CE, Hoffstrom BG, Decker AM et al (2020) Transferrin Receptor Is a Specific Ferroptosis Marker. Cell Rep. ;30(10)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTschoe C, Bushnell CD, Duncan PW, Alexander-Miller MA, Wolfe SQ (2020) Neuroinflammation after Intracerebral Hemorrhage and Potential Therapeutic Targets. J stroke 22(1):29\u0026ndash;46\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuan X, Wen Z, Shen H, Shen M, Chen G (2016) Intracerebral Hemorrhage, Oxidative Stress, and Antioxidant Therapy. Oxid Med Cell Longev 2016:1203285\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhatri N, Thakur M, Pareek V, Kumar S, Sharma S, Datusalia AK (2018) Oxidative Stress: Major Threat in Traumatic Brain Injury. CNS Neurol Disord Drug Targets 17(9):689\u0026ndash;695\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCobley JN, Fiorello ML, Bailey DM (2018) 13 reasons why the brain is susceptible to oxidative stress. Redox Biol 15:490\u0026ndash;503\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCong J, Li JY, Zou W (2024) Mechanism and treatment of intracerebral hemorrhage focus on mitochondrial permeability transition pore. Front Mol Neurosci 17:1423132\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCadenas S (2018) ROS and redox signaling in myocardial ischemia-reperfusion injury and cardioprotection. Free Radic Biol Med 117:76\u0026ndash;89\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Liu H, Tian C, An N, Song K, Wei Y et al (2022) Targeting the multifaceted roles of mitochondria in intracerebral hemorrhage and therapeutic prospects. Biomed Pharmacother 148:112749\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosenbaum RS, Priselac S, K\u0026ouml;hler S, Black SE, Gao F, Nadel L et al (2000) Remote spatial memory in an amnesic person with extensive bilateral hippocampal lesions. Nat Neurosci 3(10):1044\u0026ndash;1048\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScoville WB, Milner B (1957) Loss of recent memory after bilateral hippocampal lesions. J Neurol Neurosurg Psychiatry 20(1):11\u0026ndash;21\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026Oacute;lafsd\u0026oacute;ttir HF, Bush D, Barry C (2018) The Role of Hippocampal Replay in Memory and Planning. Curr Biol 28(1):R37\u0026ndash;r50\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'Keefe J, Dostrovsky J (1971) The hippocampus as a spatial map. Preliminary evidence from unit activity in the freely-moving rat. Brain Res 34(1):171\u0026ndash;175\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEkstrom AD, Kahana MJ, Caplan JB, Fields TA, Isham EA, Newman EL et al (2003) Cellular networks underlying human spatial navigation. Nature 425(6954):184\u0026ndash;188\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHackett ML, K\u0026ouml;hler S, O'Brien JT, Mead GE (2014) Neuropsychiatric outcomes of stroke. Lancet Neurol 13(5):525\u0026ndash;534\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao M, Huang G, Feng L, Luan X, Wang Q, Ren W et al (2020) Impact of sleep quality on post-stroke anxiety in stroke patients. Brain Behav 10(12):e01716\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Ren W, Wang L, Mao L, Mazhar M, Zhou C et al (2022) Exploring the Ferroptosis Mechanism of Zhilong Huoxue Tongyu Capsule for the Treatment of Intracerebral Hemorrhage Based on Network Pharmacology and In Vivo Validation. Evid Based Complement Alternat Med 2022:5033135\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalho AR, Cordeiro MF, Ribeiro SA, Marques MS, Antunes MF, Luz DC et al (2016) Protective role of free and quercetin-loaded nanoemulsion against damage induced by intracerebral haemorrhage in rats. Nanotechnology 27(17):175101\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCerd\u0026aacute;-Bernad D, Costa L, Serra AT, Bronze MR, Valero-Cases E, P\u0026eacute;rez-Llamas F et al (2022) Saffron against Neuro-Cognitive Disorders: An Overview of Its Main Bioactive Compounds, Their Metabolic Fate and Potential Mechanisms of Neurological Protection. Nutrients. ;14(24)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eImran M, Rauf A, Shah ZA, Saeed F, Imran A, Arshad MU et al (2019) Chemo-preventive and therapeutic effect of the dietary flavonoid kaempferol: A comprehensive review. Phytother Res 33(2):263\u0026ndash;275\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaheri P Crosstalk of nitro-oxidative stress and iron in plant immunity. Free Radic Biol Med. 191:137\u0026ndash;149\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang W, Liu Y, Liao Y, Zhu C, Zou Z (2024) GPX4, ferroptosis, and diseases. Biomed Pharmacother 174:116512\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGurung P, Lukens JR, Kanneganti TD (2015) Mitochondria: diversity in the regulation of the NLRP3 inflammasome. Trends Mol Med 21(3):193\u0026ndash;201\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang T, Han H, Zhou Y, Liu Z, Ma T, Cao X (2022) MicroRNA-454 modulates the oxidative stress and neuronal apoptosis after cerebral ischemia/reperfusion injury via targeting NADPH oxidase 4 (NOX4). J Biochem Mol Toxicol 36(10):e23153\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Wu J, Yu S, Zhu J, Zhou Y, Wang P et al (2020) Sestrin2 promotes angiogenesis to alleviate brain injury by activating Nrf2 through regulating the interaction between p62 and Keap1 following photothrombotic stroke in rats. Brain Res 1745:146948\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHwang CY, Han YH, Lee SM, Cho SM, Yu DY, Kwon KS (2020) Sestrin2 Attenuates Cellular Senescence by Inhibiting NADPH Oxidase 4 Expression. Ann Geriatr Med Res 24(4):297\u0026ndash;304\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAla M (2022) Sestrin2 in cancer: a foe or a friend? Biomark Res 10(1):29\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao A, Li F, Zhou Q, Chen L (2020) Sestrin2 as a potential therapeutic target for cardiovascular diseases. Pharmacol Res 159:104990\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroimmune-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jnip","sideBox":"Learn more about [Journal of Neuroimmune Pharmacology](http://link.springer.com/journal/11481)","snPcode":"11481","submissionUrl":"https://submission.nature.com/new-submission/11481/3","title":"Journal of Neuroimmune Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Zhilong Huoxue Tongyu capsule, Intracerebral hemorrhage, Oxidative stress","lastPublishedDoi":"10.21203/rs.3.rs-8172042/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8172042/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eThe purpose of this study is to investigate the mechanism of Zhilong Huoxue Tongyu (ZL) capsule on the treatment of intracerebral hemorrhage (ICH).\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eIn this study, ICH model was established to assess the neuroprotective efficacy of ZL capsule. The ICH-induced neurological deficits were analyzed by behavioral studies including Zea-Longa score, Neurological Severity Score, Open filed test, Y-maze test, Morris water maze, Rotarod test and pathological staining such as HE staining and Nissl staining. Perls staining was used to measure iron deposition after ICH. Malondialdehyde (MDA), superoxide dismutase (SOD) and glutathione (GSH) assay kits were performed to measure the level of lipid peroxide after ICH. The levels of oxidative stress-related targets were verified by quantitative real-time PCR and western blot.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThis study demonstrated that ZL capsule treatment significantly reduced ICH-induced neurological deficits after ICH, improved the memory learning functions of rats and attenuated ICH‑Induced neuron damage in rats. After ICH, oxidative stress in brain tissue increased and ZL capsule could alleviate the pathological state of oxidative stress. The SOD and GSH activities were dramatically increased after the treatment of ZL capsule compared with the Ns group, while the content of MDA was markedly decreased after treatment with ZL capsule compared with Ns group. After ICH, the SLC40A1, SESN2 and GPX4 mRNA in brain tissue increased, and the NOX4 and TFR1 mRNA in brain tissue decreased after the treatment of ZL capsule. Proteomics analysis also confirmed these results.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOur data suggested that ZL capsule showed a neuroprotective function after ICH and alleviated ICH induced neurological deficits in rats. The possible mechanism may be that ZL capsule inhibits iron deposition and mitochondrial destabilization, lessening oxidative stress in brain tissue. The findings of this study offer a new perspective of how ZL capsule affects ICH at a molecular level and could be conducive to developing therapeutic drugs for ICH and traditional Chinese medicine.\u003c/p\u003e","manuscriptTitle":"Study on the intervention mechanism of ZhiLong HuoXue TongYu capsule on secondary brain injury after intracerebral hemorrhage based on oxidative stress","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-08 11:15:51","doi":"10.21203/rs.3.rs-8172042/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-09T20:38:37+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-30T12:21:30+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-15T06:57:47+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"242134614989977727429265440603605923567","date":"2026-01-14T14:52:56+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"288103916673345762237239575062051825867","date":"2026-01-06T23:55:50+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-06T20:52:10+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-29T20:36:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-21T20:27:54+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Neuroimmune Pharmacology","date":"2025-11-21T09:34:10+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroimmune-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jnip","sideBox":"Learn more about [Journal of Neuroimmune Pharmacology](http://link.springer.com/journal/11481)","snPcode":"11481","submissionUrl":"https://submission.nature.com/new-submission/11481/3","title":"Journal of Neuroimmune Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"364b4eda-99b7-488b-80d7-04d37678ecdc","owner":[],"postedDate":"January 8th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-05-06T18:24:04+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-08 11:15:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8172042","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8172042","identity":"rs-8172042","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00