Salt-induced changes in the photosynthetic apparatus and carbon metabolism of two tomato cultivars with varying salt tolerance

Salt-induced changes in the photosynthetic apparatus and carbon metabolism of two tomato cultivars with varying salt tolerance | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Salt-induced changes in the photosynthetic apparatus and carbon metabolism of two tomato cultivars with varying salt tolerance xuezhen li, yongchao Han, yundan Cong, longfei Wang, yujie Shi, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4600225/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Oct, 2025 Read the published version in Plant and Soil → Version 1 posted 6 You are reading this latest preprint version Abstract Background Soil salinization severely affects plant photosynthesis and reduces crop yield and quality. Therefore, we investigated the structure and function of photosystem I (PSI) and photosystem II (PSII) of tomato seedlings [Zhongshu No.4 (salt-sensitive) and Jinpeng No.3 (salt-tolerant)] after salt stress treatment were analyzed using rapid chlorophyll fluorescence kinetics and 820-nm transmission kinetics. Moreover, the activity and transcript level of enzymes related to Calvin cycle and sucrose metabolism were investigated. Results The structure and function of PSI and PSII were suppressed in both tomato varieties under salt stress as evidenced by Electron transfer chains are inhibited from transferring electrons, photosynthetic reaction centers are damaged, and energy flow distribution is disrupted. In addition, salt stress significantly inhibited the carbon assimilation efficiency of both tomato varieties as indicated by decrease in the activities of Rubisco (initial and total), RCA, PGK, FBPase, GAPDH, and FBA and transcript level and promoted sugar accumulation. Compared with salt-sensitive Zhongshu No.4, the photosynthetic apparatus and carbon metabolism of salt-resistant Jingpeng No.3 were much more tolerant to salt treatment. Conclusion Jingpeng No.3 had a higher electron transfer efficiency. The donor side and acceptor side of PSII, the integrity of the thylakoid, and the oxidized and redox state of PSI were less inhibited by salt stress. Meanwhile, the activation of photosynthetic protection mechanism increased the utilization of energy for photochemical reactions, decreased the excitation pressure of RC and led to a smoother energy flow. Improved carbon assimilation efficiency and sucrose metabolism efficiency. Therefore, Jinpeng No.3 has salt tolerance. tomato salt stress Chlorophyll a fluorescence rise kinetics 820 nm reflection Signal carbon metabolism Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 1 Introduction Salt stress in soil is one of the major abiotic stresses limiting global crop quality and yield formation (Kalaji et al., 2016 ). Approximately 7% of the world’s land area (approximately 1 billion hm 2 ) and 20% of irrigated farmland are threatened by soil salinization, particularly in semiarid and arid regions (Munns and Gilliham 2015 ). In China, saline soil area accounts for 41.88% (approximately 36 million hm 2 ) of the available land area in the country (Tounekti et al., 2011 ). Therefore, screening and breeding salt-tolerant crop varieties and exploring new plant strategies for salt tolerance are important for using and transforming saline soils for agricultural production. Plant photosynthesis is very sensitive to salt stress. When other phenotypic symptoms have not yet appeared and photosynthesis is partially or even completely inhibited by salt stress (Huang et al., 2019 ). PSI and PSII are important constituents of photosynthetic apparatus and sites of photosynthetic redox reaction in plants. The photosynthetic apparatus is disrupted under salt stress because of reception of light energy excess of its maximum utilization capacity and reduced regulation of excitation energy partitioning between PSI and PSII; this decreases photosynthetic efficiency and photoinhibition (Huang et al. 2019 ). It is generally accepted that PSII is the most sensitive and more prone to photoinhibition than PSI under adversity (including salt stress) (Yan et al., 2012 ; Yan et al., 2015 ). However, high-temperature stress is reported to cause PSI photoinhibition (Oukarroum et al., 2013 ). In wheat ( Triticum aestivum ) and cucumber ( Cucumis sativus ), PSI was observed to be more susceptible to inhibition under low-temperature stress than PSII, which exhibited only slight damage (Zhang et al., 2021 ; Zhu et al., 2018 ). Li et al. ( 2004 ) reported that PSI inhibition was the main factor limiting the recovery of photosynthesis after short-term cold stress under weak light. Salt stress resulted in the inhibition of PSI oxidation in Lonicera japonica , and the degree of inhibition was greater for PSI than for PSII (Yan et al., 2015 ). Therefore, it is necessary to investigate the mechanism of action of salt stress on the performance and structure of PSII and PSI. Rapid chlorophyll fluorescence induction kinetics (OJIP curve) enables rapid access to the primary photochemical reactions of PSII and state and function of the photosynthetic machineries (Liu et al., 2023 ). The quantitative analysis of the OJIP curve based on the biofilm energy flux theory (JIP-test) can be used to study the effects of environmental conditions on the reaction center and damaged sites of PSII (Brestic et al., 2012 ; Kalaji et al. 2016 ). In addition, the 820-nm light reflection signal (MR820) kinetics can detect changes in the oxidized and redox state of the plasma cyanin (PC) and PSI reaction center, which can provide insights into the response of PSI to adversity (Gao et al., 2022 ; Gao et al., 2014 ). Calvin cycle is a process in which chloroplasts use ATP and NADPH produced by photoreaction to fix CO 2 to from sugars (Peng et al., 2016 ). After plants are subjected to salt stress, inhibition of the activity of enzymes related to the photosynthetic carbon assimilation leads to NADPH accumulation; this also induces ROS production and feedback inhibition, affecting the transmission of photosynthetic electrons (El Sayed et al., 2019 ; Ruan 2014 ; Shu et al., 2014 ; Yan et al., 2021 ). Carbohydrate is the product of carbon fixation and transformation in photosynthesis and one of the important substances that regulate the ability of plants to adapt to adversity. Under salt stress, plant photosynthesis is inhibited; amount of sucrose transported to the roots and competitive sink organs is reduced; soluble sugar and starch are accumulated in the leaves, resulting in feedback inhibition of photosynthesis (Zhu et al., 2016 ). Additionally, salt stress leads to alterations in plant sugar metabolism. Sucrose synthase (SS), sucrose phosphate synthase (SPS), and acid converting enzyme (S-AI) are the key enzymes in the sugar metabolism process, which play a critical role in the interconversion of sucrose, glucose, and fructose in the cells (Cui et al., 2019 ). Salt-tolerant crop varieties can maintain salt tolerance under salt stress by increasing sucrose synthase activity and inhibiting sucrose degradation (Yang et al., 2020 ). However, the mechanisms by which the above physiological processes respond to salt stress are extremely complex and vary according to plant genotype, developmental stage, cellular history, and duration of stress (El Sayed et al., 2022; Huang et al. 2019 ). Tomato ( Solanum lycopersicum L.) is a moderately salt-tolerant plant. However, its growth is still susceptible to salt stress, which slows its growth and reduces its yield. The salt tolerance mechanism of tomato is complex and still not completely understood. Previous studies have extensively studied the agronomic traits, capacity to detoxify reactive oxygen species, ionic homeostasis, and osmotic regulation in tomato varieties with varying salt tolerance (Ali et al., 2021 ; Dogan et al., 2010 ). However, salt tolerance mechanisms in tomato related to the state and function of the photosynthetic apparatus, photosynthetic carbon assimilation, and sugar metabolism are relatively rarely reported. In the current study, we investigated the salt-tolerance mechanism related to photosynthetic machinery and sugar metabolism during the seedling stage of tomatoes. Two tomato varieties with varying salt tolerance [Zhongshu No.4 (salt-sensitive) and Jinpeng No.3 (salt-tolerant)] were subjected to salt stress, and the effects on the structure and function of PSI and PSII were analyzed using rapid chlorophyll fluorescence kinetics and 820-nm transmission kinetics after 5 and 15 days of salt-stress treatment. Moreover, the activity and transcript level of enzymes related to Calvin cycle and sucrose metabolism were investigated. Our study provided a theoretical basis for the screening and breeding of salt-tolerant tomato varieties and efficient exploitation and utilization of salinized soil. 2 Materials and methods 2.1 Plant material and salt-stress treatment Two tomato varieties, namely, Zhongshu No.4 (salt-sensitive; F; purchased from Shihezi Vegetable Research Institute, Xinjiang) and Jingpeng No.3 (salt-tolerant; T; purchased from Xi 'an Jinpeng Company), were used as the study material. The seedlings with uniform growth were selected at the three-leaf and one-heart-leaf stages and were planted in a black plastic bucket containing Hoagland nutrient solution. The nutrient solution was changed twice a week. Tomato seedlings were pre-cultured in the nutrient solution for 7 days and further subjected to salt treatment. The experiment included control (treated with 0 mM NaCl; FCK and TCK for Zhongshu No.4 and Jingpeng No.3, respectively) and salt treatment group (treated with 100 mM NaCl; FN and TN for Zhongshu No.4 and Jingpeng No.3, respectively). Each group contained 18 seedlings, and the treatment was repeated 3 times. Growth parameters, photosynthesis and photosynthetic product parameters, and gene transcript level were measured 5 and 15 days after the salt-stress treatments (labelled as S5 and S15, respectively.) 2.2 Determination of growth indicators After S5 and S15, plant height was determined from the top of root to the top of the main stem using a tape measure, and the diameter of the root at the top was determined using vernier calipers. The entire plants were washed with distilled water and cut at the stem base. The part above the stem base was considered aboveground part, and that below the stem base was considered belowground part. After wiping off water, fresh weights of the above- and belowground parts were measured. Next, the parts were heated at 105°C for 15 min and further at 75°C till constant weight was obtained, which was the dry weight of above- and belowground parts. 2.3 Effect of salt stress on the photosynthetic parameters in tomato seedlings After S5 and S15, the net photosynthetic rate (Pn), intercellular CO 2 concentration (Ci), stomatal conductance (Gs), and transpiration rate (Tr) of the third functional leaf of tomato seedlings under different treatments were measured using a portable photosynthesis system LI-6400 (Li-Cor, Lincoln, NE, USA). Photosynthetic photon flux density (PPFD) of 1000 µmol·m − 2 ·s − 1 and temperature of 25°C were set in the built-in leaf chamber with red and blue light source. CO 2 gas was supplied from an external buffer bottle, and its concentration was manually controlled to 400 µmol·mol − 1 . For plotting the Pn-PAR (photosynthesis-light response) curves, the CO 2 concentration and leaf chamber temperature were kept at 400 µmol·mol − 1 and 25°C, respectively, and PPFD gradients of 1600, 1400, 1200, 1000, 800, 600, 400, 300, 200, 100, 50, and 0 µmol·m − 2 ·s − 1 were set in the built-in leaf chamber with red and blue light source. The apparent photosynthetic quantum efficiency (AQY) and dark respiration rate (Rd) of the optical response were calculated using the modified rectangular hyperbola model. 2.4 Effect of salt stress on rapid chlorophyll fluorescence kinetics ( OJIP curves) and JIP-test in tomato seedlings Rapid chlorophyll fluorescence was determined using the plant efficiency analyzer Handy-PEA (Hansatech, Britain). OJIP curves, Fv/Fm, and PI abswere directly exported from the data. In the OJIP curve, the OKJIP phase exists: Fo is the minimum fluorescence at 0.02 ms (O phase); F K is the fluorescence at 0.3 ms (K phase); F J is the fluorescence at 2 ms (J phase); F I is fluorescence at 30 ms (I phase), and Fm is the maximum fluorescence (P phase). JIP-tests of OJIP curves were performed as described by Strasser et al. (2000) to obtain derived JIP-test parameters. Various parameters were calculated as follows. Probability that a captured exciton transfers electrons to other electron acceptors in the electron transport chain beyond Q A -: Ψo = ETo /TRo = 1 - V J ; quantum yield of absorbed energy for electron transfer: φEo = ETo/ABS = Ψo [1 - (Fo /Fm)]; quantum ratio for heat dissipation: φDo = 1 - φPo = Fo/Fm; quantum yield of captured energy that can be transferred to the end of the electron chain: φRo = REo /ETo = (Fm - F I )/(Fm - F J ); light energy absorbed electron transfer by unit active PSII centers: ABS/RC = Mo (1/V J )(1/φPo); energy captured for electron transfer by unit active PSII centers: TRo/RC = Mo (1/V J ); energy captured for electron transfer by unit active PSII centers: ETo /RC = Mo(1/V J )Ψo; energy dissipated thermally by unit active PSII centers: DIo/RC = (ABS/RC) - (TRo/RC); light energy absorbed per unit area: ABS/CSo ≈ Fm; light energy trapped per unit area: TRo/CSo = φPo(ABS/CSo); quantum yield of electron transfer per unit area: ETo/CSo = φEo(ABS/CSo); thermal dissipation per unit area: DIo/CSo = (ABS/CSo) - (TRo /CSo). Relative differences in variable fluorescence were calculated using double normalization Vt = (Ft - Fo)/(Fm - Fo) and ΔVt = Vt (Treatment) - Vt (control) (where Ft: fluorescence at time t; Fo: minimum fluorescence; and Fm: maximum fluorescence). To display the L-band, the OJIP curves between O and K phases under different treatments were normalized according to the following formulae: W O−K = (Ft - Fo)/(F K - Fo) and ΔW O−K = W O−K (treatment) - W O−K (control) to obtain the W O−J and ΔW O−J curves, respectively. W L is the relative variable fluorescence at 150 µs on the W O−K standard curve. To display the K-band, the OJIP curves between O and J phases were processed using the formulae W O−J = (Ft - Fo)/(F J - Fo) and ΔW O−J = W O−J (treatment) – W O−J (control) to obtain the W O−J and ΔW O−J curves, respectively. W K is the relative variable fluorescence at 300 µs on the W O−J standard curve. The active fraction of oxygen-evolving complex (OEC) centers were calculated as: [1 - (V K /V J )] treatment /[1 - (V K /V J )] control . 2.5 Effect of salt stress on modulated 820-nm reflection (MR 820 ) kinetics in tomato seedlings The kinetics of MR 820 (MR/MRo curves) were obtained using the Handy-PEA, as described by (Gao et al. 2022 ), where MRo is the value of the signal at the start of the photochemical irradiation (0.7 ms). The parameters of the redox states of the PSI electron carriers were calculated from the MR/MRo curves: the rapidly decreasing part of the MR/MRo curve [which indicates the oxidized states of plastocyanin (PC) and P700] and the rising part of the MR/MRo curve (which indicates the reduced states of PC + and P700 + ). The speed of oxidation of PC and P700 was calculated as Vox = ΔMR/Δt = (MR 2 ms –MR 0.7 ms )/(1.3 ms). The speed of re-reduction of PC + and P700 + was calculated as Vred = ΔMR/Δt = (MR 30 ms –MR 9 ms )/(21 ms) (where MR t ms refers to MR820 signal values at various time points; Vox refers to the speed of oxidation of PC and P700; Vred refers to the speed of re-reduction of PC + and P700 + ). 2.6 Effect of salt stress on activity of the key enzymes of Calvin cycle in tomato seedlings Rubisco activities (initial and total) were measured with reference to the method by Lilley and Walker ( 1974 ). The activity of Rubisco activating enzyme (RCA) was measured using an ELISA kit (TIANDZ, China). The activities of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), fructose-1,6-bisphosphatase (FBPase), fructose-1,6-bisphosphate aldolase (FBA), and 3-phosphoglycerate kinase (PGK) were determined using respective kits. 2.7 Effect of salt stress on sugar content and activities of enzymes related to sucrose metabolism in tomato seedlings Sugar content was determined as described by Buysse and Merckx ( 1993 ). In brief, 0.1 g dry leaf sample was added to 4 mL of 80% ethanol, and the mixture was heated in a water bath at 85°C for 30 min for continuous extraction with ethanol. Further, the mixture was centrifuged for 30 min at 12,000 g and 25°C, and supernatant was collected. The residue was extracted with 4 mL of 80% ethanol twice, and the supernatants were combined. The pigments in the extract were removed by the addition of activated carbon (0.1 g). Further, the volumes of ethanol extracts were made up to 50 mL with distilled water. This solution was used to determine the contents of soluble sugar, glucose, fructose, and sucrose. The enzymes were extracted according to the method by Hu et al. ( 2023 ). In brief, 1.0 g of the fresh leaves were ground in a pre-cooled mortar containing 10 mL of hydroxyethyl piperazine ethane sulfonic acid (HEPES) buffer (50 mM HEPES pH = 7.5, 1 mM EDTA, 10 mM MgCl 2 , 2.5 mM dithiothreitol, 10 mM vitamin C, and 5% insoluble polyvinyl pyrrolidone). The mixture was centrifuged for 20 min at 12,000 g and 4°C, and supernatant was collected. The activities of sucrose phosphate synthase (SPS), sucrose synthase (synthesis direction SS-II), sucrose synthase (catabolism direction SS-I), and acid converting enzyme (S-AI) were determined as described by Hubbard et al.(1989) and Lowell et al.(1989). 2.8 Effect of salt stress on the transcript levels of key genes related to Calvin cycle and sucrose metabolism in tomato seedlings The primers were synthesized by Xinjiang Youkang Company (detailed sequences given in Table 1 ). RNA was extracted from fresh tomato leaves using Trizol method. Nucleic acid detector was used to determine its concentration. RNA was reverse transcribed to cDNA, which was used as a template for qPCR. qPCR was performed using iCycler iQ Multicolor Real-Time PCR detection System (Bio-Rad) and SYBR qPCR Mix (EnzyArtisan., China). The reaction mix (20 µL) contained 10 µL SYBR Mix, 1 µL template, 1 µL forward and reverse primers each, and 7 µL deionized water. The gene transcript levels were calculated using the 2 −ΔΔCt method (Livak and Schmittgen 2001 ). Table 1 Design of primers for qRT-PCR gene Forward Primer Reverse Primer Actin ( NM_001323002.1 ) TGACTACGAGCAGGAACTTGAAACC AACGGAACCTCTCAGCACCAATG RCA ( XM_010327541.3 ) TTGGACGGATTCTACATCGC CTCCCCAAACACCCAAAATAAG RbcL ( XM_012015910.1 ) CTGTATGGACCGATGGACTTAC AAGGTCTAAAGGGTAAGCTACATAAG RbcS ( NM_001308943.1 ) CAAGAGGCGAAGAAGGCGTACC TGAAGCTGATGCACTGGACTTGAC PGK ( XM_004243920.3 ) GAAGAGCGTTGGAGACCTTAG AGTGTTTGATGGTAGGGATGG FBA ( NM_001321372.1 ) CTGTATGGACCGATGGACTTAC AAGGTCTAAAGGGTAAGCTACATAAG GAPDH ( NM_001247874.2 ) ACTCTGGTATATGTGTTACTC AGGGAAGCAAGATTACTAAA FBPase ( NM_001328673.1 ) AATTTCCATCTCTTCCCCACC TCGGTTTCTTGATCTGTGCTG SS ( NM_001247726.2 ) GGTACGCCAAGAATCCACGACTAAG CTTCTTCATCTCTGCCTGCTCTTCC SPS ( NM_001246991.2 ) TGGTCTACGCAAGGCTGTCATAATG CTGCTACATTCCTCGTCTGCTTGG S-AI ( NM_001246913.2 ) AGTTGCACAGGCTGACGTTGAAG AAGACCACCTTGAACCGTTGAACC Note: actin : Actin gene; RCA : Rubisco activase gene; RbcL : Rubisco large subunit gene; RbcS : Rubisco small subunit gene; PGK : 3-phosphoglycerate kinase gene; FBA : Fructose-1,6-bisphosphate aldolase gen; GAPDH : glyceraldehyde-3-phosphate dehydrogenase gene; FBPase : fructose-1,6-bisphosphatase gene; SS : sucrose synthase gene; SPS : sucrose phosphate synthase; S-AI : acid converting enzyme gene 2.9 Statistical analysis Statistical differences between treatments were analyzed by one-way analysis of variance (ANOVA) followed by post-hoc multiple comparison analysis using SPSS v. 19.0. Results were expressed as mean ± standard error (SE) (at least n = 3). Differences were considered significant at P < 0.05. The graphs were plotted using origin 2021b. 3 Results 3.1 Difference in the growth of tomato varieties with varying salt tolerance Salt-stress treatment significantly inhibited the seedling growth of both tomato varieties (Table 2 ). The FN samples (salt-sensitive Zhongshu No.4 exposed to 100 mM NaCl) were more severely inhibited than the TN samples (salt-tolerant Jingpeng No.3 exposed to 100 mM NaCl). The FN samples exhibited higher magnitude of decline in the dry weights and fresh weights of above ground and belowground parts, plant height, and stem diameter (except on S15) than the TN samples. Table 2 Effects of salt stress on Plant Height (cm), Stem diameter (mm), Shoot FW (g), and Root FW (g), Shoot DW (g) and Root DW (g) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE, and bars with different letters above the columns of figures indicate significant differences among the treatments at P < 0.05 (Duncan’s range test) on a given day of treatment. Time(d) Treatment Plant Height(cm) Stem Diameter(mm) Shoot FW(g) Root FW(g) Shoot DW(g) Root DW(g) 5D FCK 11.4 ± 0.90b 4.05 ± 0.34a 7.87 ± 0.71a 1.76 ± 0.18a 0.85 ± 0.07ab 0.15 ± 0.02a FN 10.2 ± 0.84b 3.34 ± 0.15b 5.74 ± 1.05b 1.08 ± 0.06b 0.71 ± 0.07c 0.09 ± 0.01c TCK 12.9 ± 0.89a 4.20 ± 0.27a 8.33 ± 0.79a 1.96 ± 0.19a 0.91 ± 0.05a 0.16 ± 0.01a TN 11.1 ± 0.74b 3.59 ± 0.10b 6.49 ± 0.36b 1.29 ± 0.18b 0.80 ± 0.12bc 0.12 ± 0.03b 15D FCK 21.9 ± 1.43a 8.11 ± 0.97a 15.91 ± 0.92b 5.68 ± 0.69b 2.23 ± 0.23a 0.87 ± 0.10a FN 12.9 ± 0.74c 6.35 ± 0.29b 10.39 ± 0.72d 3.29 ± 0.23c 1.54 ± 0.23b 0.57 ± 0.10b TCK 23.2 ± 2.28a 8.62 ± 0.84a 18.52 ± 0.88a 7.07 ± 1.08a 2.34 ± 0.18a 0.93 ± 0.10a TN 16.2 ± 0.89b 6.15 ± 0.15b 13.14 ± 1.44c 3.92 ± 0.69c 1.86 ± 0.18b 0.68 ± 0.05b 3.2 Difference in the photosynthetic parameters of tomato varieties with varying salt tolerance in response to salt stress No significant differences were observed in terms of Pn, Gs, Ci, and Tr between the two varieties under control conditions (Fig. 1 ). The Pn, Gs Ci, and Tr values of both tomato varieties exhibited reduction in different degrees under salt stress. The Pn, Gs Ci, and Tr were significantly decreased in the FN samples after S5, and the decrease in Pn, Ci, and Gs values was higher after S15 than after S5. The TN samples exhibited no significant changes in Pn after S5 and in Tr after S15. The decrease in Pn, Gs Ci, and Tr after S5 and S15 was lower in the TN samples than in the FN samples. No significant differences in AQY and Rd was observed between both varieties under control conditions (except for AQY on S15). Salt stress significantly reduced the AQY of Zhongshu No.4 after S5 and S15; however, that of Jingpeng No.3 significantly decreased only after S15. Meanwhile, the Rd of both varieties significantly increased during the whole treatment period. The amplitude of AQY and Rd was significantly higher in Zhongshu No.4 than in Jinpeng No.3 during salt-stress treatment (except for AQY on S15). This indicated that salt stress reduced the photosynthetic capacity of both tomato varieties; however, the photosynthetic capacity of salt-tolerant variety was less affected (Fig. 2 ). 3.3 Difference in the rapid chlorophyll fluorescence of tomato varieties with varying salt tolerance in response to salt stress 3.3.1 Effects of salt stress on OJIP curves and relative variable fluorescence curves The OJIP curves exhibited different degrees of deformation during the whole period of salt-stress treatment compared with the control (Fig. 3 A - B), indicating increased O-phase and J-phase, reduced amplitude of P-phase and I-P-phase, flattening of the curve. Jingpeng No.3 exhibited less OJIP deformation than Zhongshu No.4. In the ΔVt curves of both tomato varieties, the ΔV J values were significantly increased during the whole period of salt-stress treatment compared with the control, and they were > 0. The ΔV I of the FN samples after S15 was significantly higher than that of the FCK samples, and it was > 0. The amplitude of ΔV J and ΔV I was higher in the FN samples than in the TN samples (Fig. 3 C - D). It suggested that electron transfer on the PSII receptor side of both tomato varieties was inhibited under salt stress, with large accumulation of Q A − (primary quinone receptor Q A reduced form), but it occurred by a lesser extent in the salt-tolerant variety. The appearance of the L-band and increase of ΔW L value are indicators of the decrease of energy connectivity between PSII unit grouping or antenna and PSII reaction center (RC) caused by the thylakoids in chloroplasts. The appearance of the K-band and an increase in ΔW K values are specific markers of the damage to the oxygen-evolving complex (OEC) of the PSII donor side or inactivation of the OEC center (Wu et al., 2022 ). The OEC activity of PSII was significantly reduced; W L , ΔW L , W K , and ΔW K values were significantly increased, and ΔW L and ΔW K were both > 0 in both tomato varieties under salt-stress treatment (Fig. 4 – 5 ). Among them, the increases in the W L , ΔW L , W K , and ΔW K values during the whole period of salt-stress treatment were higher in Zhongshu No.4 than in Jinpeng No.3. It indicated that the OEC, and acceptor side and donor side of PSII of both tomato varieties were damaged under salt stress, resulting in the inactivation of OEC center and decreased grouping or energy connectivity of PSII units. The damage on the donor and acceptor sides of PSII under salt stress was less in the salt-tolerant variety. 3.3.2 Effect of salt stress on JIP-test parameters The maximum photochemical efficiency (Fv/Fm) is an important parameter reflecting the light energy conversion efficiency of PSII active center, and photosynthetic performance index (PI abs) refers to the performance index based on absorbed light energy. Compared with the FCK and TCK samples, Fv/Fm and PI abs in the leaves of both tomato varieties significantly decreased in the FN and TN samples (Fig. 6 ). Salt stress affected PI abs more severely compared to Fv/Fm, indicating that it was more sensitive to salt stress than Fv/Fm. After S5 and S15, Fv/Fm was reduced by 7.4% and 7.0% in Zhongshu No. 4 and by 4.0% and 6.0% in Jinpeng No.3; PI abs was reduced by 31.1% and 23.1% in Zhongshu No. 4 and by 28.2% and 13.6% in Jinpeng No.3, respectively. Among both varieties, the magnitude of decline in Fv/Fm and PI abs after S15 was significantly higher in Zhongshu No.4 than in Jinpeng No.3. During the whole period of salt-stress treatment, the quantum yield for electron transfer (φEo), probability of electron transfer to the electron acceptors downstream of Q A - (ψo), and quantum yield of captured energy that can be transferred to the end of the electron chain (φRo) were significantly reduced; however, quantum ratios of heat dissipation (φDo), J-phase relatively variable fluorescence (V J ), and I-phase relatively variable fluorescence (V I ) were significantly increased in both varieties. The magnitude of decline in φEo after S5 and S15 and that in φRo and ψo after S15 was significantly higher in Zhongshu No.4 than in Jingpeng No.3. This indicated that salt stress decreased electron transfer ability on the side of PSII and the opening degree of active PSII reaction center (Fig. 7 ). However, salt-tolerant tomato variety exhibited less closure of active PSII reaction centers under salt stress. 3.3.3 Effect of salt stress on light energy parameters Figure 8 A - B show the absorbed energy, trapped energy, heat dissipation energy, and energy for transfer by the active unit reaction center (RC) after control and salt-stress treatments (ABS/RC, TRo/RC, DIo/Rc, and ETo/RC, respectively). Figure 8 C - D show absorbed energy, captured energy, dissipated energy, and energy used for transfer per unit area (CSo) (ABS/CSo, TRo/CSo, DIo/CSo, and ETo/CSo, respectively). No significant differences were observed in other specific activity parameters between both tomato varieties under control conditions except that DIo/RC and ABS/RC were significantly higher in Zhongshu No. 4 than in Jinpeng No. 3 after S5 (Fig. 8 A - B). During the whole period of salt-stress treatment, ABS/RC, TRo/RC, and DIo/RC significantly increased, and ETo/RC significantly decreased after S15 in both varieties. Among them, the magnitude of increase in TRo/RC and ETo/RC after S5 and S15 and that in ABS/RC after S15 was higher, and the decrease in DIo/RC after S5 was lower in Zhongshu No.4 than in Jingpeng No.3. In addition, ABS/CSo, TRo/CSo, and ETo/CSo were significantly decreased and DIo/CSo was significantly increased in both tomato varieties after S5 and S15. The magnitude of increase in ABS/CSo, TRo/RC, DIo/CSo, and ETo/CSo after S5 and S15 was higher in Zhongshu No.4 than in Jingpeng No.3. These results indicated that the energy share for electron transfer in the leaves of both tomato varieties is reduced under salt stress, inhibiting electron transfer and increasing energy share for heat dissipation. The energy share for heat dissipation in the salt-resistant tomato variety increased to a greater extent than that in the salt-sensitive variety. 3.3.4 The kinetics of 820-nm light reflection ( MR 820 ) and response of its parameters to salt stress The MR 820 kinetics (MR/MRo curves) reflect the state of redox activity of PSI. In the MR/MRo curve, the descending phase (fast-phase) represents the oxidized states of PC and P700 and can be quantified as ∆MRfast/MRo, whereas the rising stage (slow-phase) represents the reduced state in the reaction centers of PC + and P700 + and can be quantified as ΔMRslow/MRo. Figure 9 A-B shows the MR/MRo curves of both varieties under salt stress. The MR/MRo curves of both tomato varieties were deformed after S5 and S15 compared with the control. This indicated that fast phase increased and slow phase decreased, particularly after S15. This indicated that salt stress affected the redox ability of PSI in both varieties.Zhongshu No.4 exhibited significant reduction in ∆MRfast/MRo, ∆MRslow/MRo, Vred, and Vox after S5 and S15 (Fig. 9 C–F). In the salt-tolerant Jinpeng No.3, ∆MRslow/MRo was significantly reduced after S5 and ∆MRslow/MRo, ∆MRslow/MRo, Vred, and Vox were reduced after S5 and S15. Zhongshu No.4 exhibited a higher magnitude of decline in Vred and Vox than Jinpeng No. 3 after S5. 3.4 Effect of salt stress on the activities of key enzymes and transcript levels of genes involved in Calvin cycle Activities of Rubisco (initial and total), RCA, PGK, FBPase, GAPDH, and FBA reduced under salt stress in both varieties (Fig. 10 A - B). After S5 and S15, the FN samples exhibited 29.8% and 44.7%, 32.9% and 23.4%, 26.6% and 52.1%, 40.0% and 64.0%, 47.8% and 65.3%, 40.8% and 126.5%, and 28.2% and 5.8% decrease and TN samples exhibited 19.3% and 9.0%, 29.8% and 19.3%, 17.4% and 50.7%, 9.5% and 47.9%, 25.3% and 47.6%, 39.2% and 51.6%, and 18.0% and 32.1% decrease compared with their respective controls, respectively. The decreases in the enzyme activities were proportional to the duration of stress and were greater in Zhongshu No.4 than in Jingpeng No.3. The transcript level of RbcL, RbcS, RCA, PGK, GAPDH, FBPase, and FBA genes exhibited the same trend as that of enzyme activities. Salt stress had a greater influence on the transcript level of key genes in Calvin cycle of Zhongshu No.4; thus, the enzyme activity greatly decreased. 3.5 Effects of salt stress on sugar metabolism of tomato varieties with varying salt tolerance 3.5.1 Sugar content No significant differences were observed in the contents of glucose, sucrose, fructose, and soluble sugar in both tomato seedlings under control conditions (Fig. 11 ). The sugar contents of both tomato varieties gradually increased as the duration of salt-stress treatment increased. They increased more in Jingpeng No.3 than in Zhongshu No.4 during the whole period of salt treatment. 3.5.2 Activity of the key enzymes of sucrose metabolism and gene expression Salt-stress treatment significantly decreased S-AI and SS-I activities and significantly increased SPS and SS-II activities in both cultivars (Fig. 12 ). The activities of SPS and SS-II in Zhongshu No.4 increased by 25.5% and 19.8% after S5 and 32.9% and 31.7% after S15, respectively, whereas the S-AI and SS-I activities decreased by 20.3% and 24.1% after S5 and 18.9% and 39.4% after S15, respectively. The activities of SPS and SS-II in Jingpeng No.3 increased by 50.2% and 26.3% after 5 days and 40.0% and 41.1% after S15, whereas the S-AI and SS-I activities decreased by 17.8% and 27.6% after S5 and 14.2% and 41.0% after S15, respectively. At the same time, SPS genes were upregulated, and S-AI and SS genes were downregulated in both tomato varieties. The magnitude of increase in the SPS activity and gene expression level and SS-II activity was less in Zhongshu No.4 than in Jingpeng No.3 under salt stress. The magnitude of decrease in the activities and gene expression levels of S-AI and SS-I was more in Zhongshu No.4 than in Jingpeng No.3 under salt stress. These results suggested that the high salt-tolerance of Jingpeng No.3 seedlings is because of the promotion of sucrose synthesis and reduction of the irreversible breakdown of sucrose. 4 Discussion Biomass is a comprehensive reflection of plant growth status and the survival ability of plants under adversity. Photosynthesis is a process of energy production in higher plants. It is one of the plant physiological processes most sensitive to abiotic stresses. Its assessment can reflect the resistance of plants to adversity (Li et al., 2017 ). Decreased photosynthetic capacity due to salt stress is related to stomatal and non-stomatal limitation. This study revealed that salt-stress treatment significantly inhibited the growth and decreased Pn of two tomato varieties with varying salt tolerance; however, the extent of inhibition was less in salt-tolerant tomato variety (Table 2 ). This is consistent with the findings of Li in Lycium barbarum (Li et al., 2022 ). Salt stress decreased Gs, Ci, AQY, Fv/Fm, and PI abs and increased Rd in both tomato varieties. The highest decrease was observed in Pn and PI abs, particularly in Zhongshu No.4. Many studies suggested that PI abs is a more sensitive indicator than Fv/Fm. PI abs is a comprehensive indicator of impaired photosynthetic apparatus and photochemical efficiency under adversity. These results indicated that the growth suppression and Pn reduction in both tomato varieties under salt stress are attributed to stomatal and non-stomatal limitations, and the degree of inhibition is closely related to the salt tolerance of varieties. Activities of donor and acceptor sides are important factors affecting PSII activity in plants; therefore, increasing the primary photochemistry of PSII and protecting the photosynthetic apparatus are helpful in improving salt tolerance in plants. The different phases (O-J, J-I, and I-P) on the OJIP curve reflect three reduction processes of the electrons in the whole electron transport chain. The increase of the O phase indicates that the PSII reaction centers are destroyed or inactivated. The rise in the J phase and increase in V J indicates that the transfer of Q A to the secondary electron acceptor (Q B ) of the PSII is blocked (Guo et al., 2020 ). The rise in the I phase and V I represents the decrease in the ability of the PQ pools to accept electrons. The decrease of IP amplitude indicates electron flux from PQH2 to the final electron acceptor, as well as reduced final electron acceptor pools in PSI (Zhu et al. 2018 ). The appearance of L-band with increased W L and ΔW L > 0 indicates that the integrity of the thylakoid in chloroplasts is disrupted, resulting in increased dispersion between PSII complexes. The appearance of the K-band with increased Wk and ΔW K > 0 reflects the degree of dissociation of the OEC, and damage of the PSII leads to the decreased number of electrons flowing from the PSII donor side. The appearance of K-band in plants after exposure to heat or drought stress is reported to be a marker of OEC damage (Guo and Tan 2015 ). In this study, the OJIP curves of both varieties markedly increased J phase and V J and V I values and decreased IP amplitude under salt stress. Additionally, the emergence of L-band and K-band was observed, accompanied by an increase in W L and W K values and ΔW K > 0 and ΔW L > 0. This indicated that the donor and receptor sides of PSII were the target of salt stress injury. Salt stress resulted in OEC damage in PSII; dispersion between PSII complexes increased, and electron transport capacity and PQ storage capacity of the PSII receptor side decreased. This lead to the partial closure of PSII RCs and decreased PSII activity. Our results are consistent with those of Çiçek and Dabrowski on chickpea and ryegrass (Çiçek et al., 2018 ; Dąbrowski et al., 2016 ). At the same time, the Ψo, φEo, and φRo significantly decreased in both varieties under salt stress, which further indicated that the opening degree of active PSII reaction center and electron transfer from PSII receptor to lateral PSI were blocked by salt stress. Additionally, the decrease of φRo indicated that the blockage of electron transfer from Q B to PSI receptor was more serious than that from Q A − to Q B . These results are consistent with the study on cucumber (Wu et al. 2022 ) and on passion fruit (Gaudio Gomes et al., 2012 ). In the present study, the increase of V J , W L and W K and the decrease of OEC activity, Ψo, φEo and φRo values were higher in Zhongshu No.4 than in Jinpeng No.3. It indicated that salt-tolerant tomato varieties could maintain higher OEC activity and PSII receptor side electron transport capacity, which may be related to higher increase in φDo (Zushi and Matsuzoe 2017 ). Increasing the capacity of PSII to absorb and dissipate energy and maintaining the activity of PSII reaction centers are some strategies used by plants to improve their tolerance under adversity (Zaghdoudi et al., 2011 ). In this study, salt stress reduced TRo/CSo and ETo/CSo but increased DIo/CSo in both tomato cultivars. This indicated that the PSII reaction active center initiates the protection mechanism of the photosynthetic apparatus under salt stress. On the one hand, it protects against excessive accumulation of light energy by reducing PSII absorption of light energy. On the other hand, it reduces the accumulation of excess excitation energy by promoting heat dissipation (Goussi et al., 2018 ). In addition, salt stress increased the TRo/RC, ABS/RC, and DIo/RC values of both tomato varieties. This may be attributed to the compensatory reaction after the reduction in the number of active reaction centers per unit leaf area due to salt stress, and the improved efficiency of the remaining active reaction centers facilitates better consumption of the energy in the electron transport chain (Daniel Bordenave et al., 2019 ). Jingpeng No.3 could maintain higher activity of photosynthetic system center under salt stress, and the distribution of energy flow was more reasonable than that in Zhongshu No.4. Apart from PSII, PSI also is a site affected by abiotic stress. The decrease in PSI activity under adversity can be attributed to PSI damage, which led to the inability of PSI to efficiently promote electron transfer to the acceptor side and inhibited the oxidation of PSI. In addition, it may be attributed to the blockage of electron transfer from PSII to PSI, which inhibited PSI reduction (Wu et al. 2022 ). The descending (fast phase) and ascending (slow phase) parts of the MR/MRo curves represent the oxidative and reductive processes of PC and P700, respectively (Guo et al. 2020 ). In this study, the oxidation (decreased ΔMRfast/MR O ) and re-reduction (decreased ΔMRfast/MR O ) processes of PSI in Zhongshu No.4 was significantly inhibited after S5. However, only the re-reduction process of PSI in Jingpeng No.3 was significantly inhibited after S5. As the duration of stress increased, the redox process of PSI was significantly inhibited in both tomato varieties (Figs. 10 A - D). However, the degree of inhibition of PSI redox process and rate was higher in Zhongshu No.4 than in Jingpeng No.3. This indicated that the decrease in PSI activity of Zhongshu No.4 under salt stress can be attributed to PSI damage and blocked electron flow from the PSII receptor side to PSI. However, the decrease in PSI activity of Jinpeng No.3 after S5 was mainly due to the blocking of electron flow from PSII receptor to PSI, whereas the decrease of PSI activity after S5 was due to the damage to PSI and blocking of electron flow transfer from PSII to PSI. The degree of PSI damage and inhibition of electron flow between two photosystems was higher in Zhongshu No.4 than in Jingpeng No.3. Photosynthetic light reactions provide the reducing power for carbon assimilation, and the efficiency of CO 2 fixation is closely related to the activity of key enzymes involved at various stages of Calvin cycle. Rubisco is a key enzyme in plant photosynthesis, which controls the fixation efficiency of inorganic carbon and is also a key hub for the conversion of inorganic carbon into organic carbon. Rubisco is catalytically active only in the activated state of RCA activation (Scafaro et al., 2012 ). Initial activity of Rubisco is used to reflect the activity of Rubisco enzyme in the active state, whereas total Rubisco activity is used to reflect the activity potential of Rubisco (Zhao et al., 2022 ). RbcL is the large subunit of Rubisco and is the main catalytic site. The small subunit RbcS can produce enough Rubisco content to maintain the photosynthetic carbon assimilation capacity of plants. Abiotic stress affects the expression of RbcS and RbcL, thereby regulating adaptation of plants to stress (Pinheiro and Chaves 2011 ). Our study revealed that salt stress significantly reduced the initial and total activities of Rubisco; RCA activity; and transcript levels of RbcL , RbcS , and RCA in tomato seedlings with varying salt tolerance. However, the decrease was greater in Zhongshu No.4 (Fig. 11 ). It indicated that salt stress inhibited the assimilation efficiency of CO 2 by affecting the activity of Rubisco, thus reducing the utilization of assimilation force (NADPH and ATP). Studies have reported that GAPDH and PGK are involved in the regeneration phase of RuBP and play a central role in the Calvin cycle, with activity and transcript levels directly affecting the Calvin cycle (Guan et al., 2022 ; Rius et al., 2006 ). FBA and FBPase are involved in RuBP regeneration (Ding et al., 2016 ). (Tamoi et al., 2006 ) reported that increased FBPase activity in transgenic tobacco expressing FBPase gene led to the improvement of photosynthesis and biomass. FBA is involved in glycolysis, cytoplasmic gluconeogenesis, and carbon dioxide fixation, and its expression affects RuBP regeneration (El Sayed et al. 2019 ). In our study, the activities and gene transcript levels of GAPDH, PGK, SBPase, FBPase, and FBA were significantly downregulated in both tomato varieties after S5 and S15. Among them, the activities and gene transcript levels of key enzymes involved in the CO 2 fixation and RuBP regeneration stages were decreased to larger extent in Zhongshu No.4. This demonstrated that salt stress decreased the carboxylation efficiency of CO 2 and operation efficiency of the Calvin cycle in tomato seedlings with varying salt tolerance, and the salt-tolerant variety could maintain a higher rate of carbon fixation efficiency. The products of photosynthetic carbon assimilation are mainly sugars, including monosaccharides (mainly glucose and fructose), oligosaccharides (mainly sucrose), and polysaccharides (mainly starch). Sucrose and starch are the most common products. Different types of sugars are converted into each other to satisfy the needs of plant growth and development and environmental adaptation. Carbohydrates not only provide energy and solute for osmosis adjustment but also act as regulatory messengers in many metabolic processes involved in the expression of various genes (Naya et al., 2007 ). The main form of carbohydrate transport in plants and major component of soluble sugars is sucrose, which is used as an osmotic substance to maintain cellular homeostasis under stress conditions (Lastdrager et al., 2014 ). Various key enzymes in sugar metabolism regulate the synthesis, decomposition, and transformation of sucrose. Among them, SS can reversibly decompose sucrose into fructose and UDP-glucose and can also synthesize sucrose under appropriate pH (Lastdrager et al. 2014 ). SPS is the most important enzyme for the synthesis of sucrose from fructose-6-phosphate and UDP-G (Maloney et al., 2015 ). S-AI irreversibly converts sucrose (transported to the liquid cell membrane) into fructose and glucose (Ruan et al., 2010 ). In our study, the accumulation of sucrose in Jingpeng No.3 was caused by the increased activity and transcript level of SPS and increased activity of SS-II. Jingpeng No.3 may increase sucrose synthesis at the metabolic and gene expression levels, leading to increased energy conservation and osmotically regulated cellular metabolism. This conclusion was also reported by (Wu et al., 2021 ), (Wang et al., 2013 ), and (Nemati et al., 2018 ) in cucumber, peach, and wheat, respectively. Plants with salt-tolerant genotypes subjected to salt stress exhibited significantly high content of soluble sugars, including glucose, fructose, and sucrose, compared with salt-sensitive varieties. Thus, the large increase in fructose, glucose, and soluble sugar contents in Jingpeng No.3 may trigger osmoregulation and regulation of intracellular osmotic pressure at the cellular level as strategies for resisting salt stress. Studies have reported that photosynthetic carbon assimilation influences carbohydrate accumulation in plants (Wu et al. 2021 ). Interestingly, in our study, salt stress decreased photosynthetic carbon assimilation capacity of both tomato varieties but not carbohydrate accumulation. As an osmotic regulator, carbohydrates can maintain cell osmotic homeostasis, which may be an adaptive self-protection response of plants. However, the specific mechanism should be further explored. 5 Conclusion In summary, salt stress inhibited PSII and PSI activities and carbon metabolism in the leaves of two tomato varieties mainly via impairing the donor and acceptor sides of PSII and reaction centers of the two photosystems. It reduced photochemical efficiency of PSII and electron transfer rate of PSI, inhibiting the assimilation and operational efficiency of Calvin cycle and the interconversion of sugars. It ultimately resulted in plant growth inhibition and reduced Pn. The photosynthetic apparatus and carbon metabolism of salt-tolerant Jingpeng No.3 were much more tolerant to salt treatment than salt-sensitive Zhongshu No.4. Jingpeng No.3 could still protect the functions of the photosynthetic reaction center of PSI and PSII to a certain extent under salt stress and maintain high photochemical reaction efficiency, energy utilization efficiency, carbon assimilation efficiency, and sucrose metabolism, thereby reducing the degree of inhibition of growth and photosynthetic capacity under salt stress. Declarations Funding This research was funded by the earmarked fund for XJARS (XJARS-07), the Major Science and Technology Special Projects of Xinjiang Uygur Autonomous Region (NO. 2022A02005-2), and the National Natural Science Foundation of China (Grant NO. 31860550) Competing interests The authors have no relevant fnancial or non-fnancial interests to disclose. The data that support the findings of this study are available from the corresponding author upon reasonable request. Author Contributions This work was carried out in collaboration between all the authors. Huiying Liu and Huifang Liu defined the research theme and designed the experiment. Xuezhen Li and Yongchao Han performed the experiments and wrote the manuscript. Yundan Cong and Longfei Wang analyzed the data, and interpreted the results, and prepared the figures. Yujie Shi modified the manuscript. All authors reviewed and approved the manuscript. Data availability Data will be made available on request. References Ali, A.A.M., Romdhane, W.B., Tarroum, M., Al-Dakhil, M., Al-Doss, A., Alsadon, A.A., et al., (2021). Analysis of salinity tolerance in tomato introgression lines based on morpho-physiological and molecular traits. Plants (Basel). 10.https://doi.org/10.3390/plants10122594 Brestic, M., Zivcak, M., Kalaji, H.M., Carpentier, R., Allakhverdiev, S.I., (2012). Photosystem II thermostability in situ: environmentally induced acclimation and genotype-specific reactions in Triticum aestivum L. Plant Physiol Biochem. 57, 93-105.https://doi.org/10.1016/j.plaphy.2012.05.012 Buysse, J., Merckx, R., (1993). An improved colorimetric method to quantify sugar content of plant tissue. J. Exp. Bot. 44, 1627-1629.https://doi.org/10.1093/jxb/44.10.1627 Çiçek, N., Oukarroum, A., Strasser, R.J., Schansker, G., (2018). Salt stress effects on the photosynthetic electron transport chain in two chickpea lines differing in their salt stress tolerance. Photosynth Res. 136, 291-301.https://doi.org/10.1007/s11120-017-0463-y Cui, G., Zhang, Y., Zhang, W., Lang, D., Zhang, X., Li, Z., et al., (2019). Response of carbon and nitrogen metabolism and secondary metabolites to drought stress and salt stress in plants. J Plant Biol. 62, 387-399.https://doi.org/10.1007/s12374-019-0257-1 Dąbrowski, P., Baczewska, A.H., Pawluśkiewicz, B., Paunov, M., Alexantrov, V., Goltsev, V., et al., (2016). Prompt chlorophyll a fluorescence as a rapid tool for diagnostic changes in PSII structure inhibited by salt stress in Perennial ryegrass . J. Photochem. Photobiol. B. 157, 22-31.https://doi.org/10.1016/j.jphotobiol.2016.02.001 Daniel Bordenave, C., Rocco, R., Javier Maiale, S., Campestre, M.P., Adolfo Ruiz, O., Alberto Rodriguez, A., et al., (2019). Chlorophyll a fluorescence analysis reveals divergent photosystem II responses to saline, alkaline and saline-alkaline stresses in the two Lotus japonicus model ecotypes MG20 and Gifu-129. Acta Physiol. Plant. 41.https://doi.org/10.1007/s11738-019-2956-0 Ding, F., Wang, M., Zhang, S., Ai, X., (2016). Changes in SBPase activity influence photosynthetic capacity, growth, and tolerance to chilling stress in transgenic tomato plants. Sci. Rep. 6, 32741.https://doi.org/10.1038/srep32741 Dogan, M., Tipirdamaz, R., Demir, Y., (2010). Salt resistance of tomato species grown in sand culture. Plant Soil Environ. 56, 499-507.https://doi.org/10.17221/24/2010-pse El Sayed, A.I., El-Hamahmy, M.A.M., Rafudeen, M.S., Ebrahim, M.K.H., (2019). Exogenous spermidine enhances expression of Calvin cycle genes and photosynthetic efficiency in sweet sorghum seedlings under salt stress. Biol. Plant. 63, 511-518.https://doi.org/10.32615/bp.2019.046 ElSayed, A.I., Mohamed, A.H., Rafudeen, M.S., Omar, A.A., Awad, M.F., Mansour, E., (2022). Polyamines mitigate the destructive impacts of salinity stress by enhancing photosynthetic capacity, antioxidant defense system and upregulation of calvin cycle-related genes in rapeseed ( Brassica napus L.). Saudi J. Biol. Sci. 29, 3675-3686.https://doi.org/10.1016/j.sjbs.2022.02.053 Gao, D., Ran, C., Zhang, Y., Wang, X., Lu, S., Geng, Y., et al., (2022). Effect of different concentrations of foliar iron fertilizer on chlorophyll fluorescence characteristics of iron-deficient rice seedlings under saline sodic conditions. Plant Physiol Biochem. 185, 112-122.https://doi.org/10.1016/j.plaphy.2022.05.021 Gao, J., Li, P., Ma, F., Goltsev, V., (2014). Photosynthetic performance during leaf expansion in Malus micromalus probed by chlorophyll a fluorescence and modulated 820nm reflection. J. Photochem. Photobiol. B. 137, 144-150.https://doi.org/10.1016/j.jphotobiol.2013.12.005 Gaudio Gomes, M.T., da Luz, A.C., dos Santos, M.R., Pimentel Batitucci, M.d.C., Silva, D.M., Falqueto, A.R., (2012). Drought tolerance of passion fruit plants assessed by the OJIP chlorophyll a fluorescence transient. Sci. Hortic. 142, 49-56.https://doi.org/10.1016/j.scienta.2012.04.026 Goussi, R., Manaa, A., Derbali, W., Cantamessa, S., Abdelly, C., Barbato, R., (2018). Comparative analysis of salt stress, duration and intensity, on the chloroplast ultrastructure and photosynthetic apparatus in Thellungiella salsuginea . J. Photochem. Photobiol. B. 183, 275-287.https://doi.org/10.1016/j.jphotobiol.2018.04.047 Guan, B., Jiang, Y.T., Lin, D.L., Lin, W.H., Xue, H.W., (2022). Phosphatidic acid suppresses autophagy through competitive inhibition by binding GAPC (glyceraldehyde-3-phosphate dehydrogenase) and PGK (phosphoglycerate kinase) proteins. Autophagy. 18, 2656-2670.https://doi.org/10.1080/15548627.2022.2046449 Guo, Y., Lu, Y., Goltsev, V., Strasser, R.J., Kalaji, H.M., Wang, H., et al., (2020). Comparative effect of tenuazonic acid, diuron, bentazone, dibromothymoquinone and methyl viologen on the kinetics of Chl a fluorescence rise OJIP and the MR(820) signal. Plant Physiol Biochem. 156, 39-48.https://doi.org/10.1016/j.plaphy.2020.08.044 Guo, Y., Tan, J., (2015). Recent advances in the application of chlorophyll a fluorescence from photosystem II. Photochem Photobiol. 91, 1-14.https://doi.org/10.1111/php.12362 Hu, W., Gao, M., Du, K., Liu, Y., Xu, B., Wang, Y., Zhou, Z., & Zhao, W. (2023). Combined effect of elevated temperature and drought stress on carbohydrate metabolism of cotton ( Gossypium hirsutum L.) subtending leaves. Physiol Plant. 175(1), e13866. https://doi.org/10.1111/ppl.13866 Huang, L.Y., Li, Z.Z., Liu, Q., Pu, G.B., Zhang, Y.Q., Li, J., (2019). Research on the adaptive mechanism of photosynthetic apparatus under salt stress: New directions to increase crop yield in saline soils. Ann. Appl. Biol. 175, 1-17.https://doi.org/10.1111/aab.12510 Hubbard, N.L., Huber, S.C., Pharr, D.M., (1989). Sucrose Phosphate Synthase and Acid Invertase as Determinants of Sucrose Concentration in Developing Muskmelon ( Cucumis melo L.) Fruits. Plant Physiol. 91, 1527-1534.https://doi.org/10.1104/pp.91.4.1527 Kalaji, H.M., Jajoo, A., Oukarroum, A., Brestic, M., Zivcak, M., Samborska, I.A., et al., (2016). Chlorophyll a fluorescence as a tool to monitor physiological status of plants under abiotic stress conditions. Acta Physiol. Plant. 38.https://doi.org/10.1007/s11738-016-2113-y Lastdrager, J., Hanson, J., Smeekens, S., (2014). Sugar signals and the control of plant growth and development. J Exp Bot. 65, 799-807.https://doi.org/10.1093/jxb/ert474 Li, H., Chang, J., Chen, H., Wang, Z., Gu, X., Wei, C., et al., (2017). Exogenous Melatonin Confers Salt Stress Tolerance to Watermelon by Improving Photosynthesis and Redox Homeostasis. Front Plant Sci. 8, 295.https://doi.org/10.3389/fpls.2017.00295 Li, W., Rao, S., Du, C., Liu, L., Dai, G., Chen, J., (2022). Strategies used by two goji species, Lycium ruthenicum and Lycium barbarum , to defend against salt stress. Sci. Hortic. 306, 111430.https://doi.org/https://doi.org/10.1016/j.scienta.2022.111430 Li, X.G., Wang, X.M., Meng, Q.W., Zou, Q., (2004). Factors limiting photosynthetic recovery in sweet pepper leaves after short-term chilling stress under low irradiance. Photosynthetica. 42, 257-262.https://doi.org/10.1023/B:PHOT.0000040598.48732.af Lilley, R.M., Walker, D.A., (1974). An improved spectrophotometric assay for ribulosebisphosphate carboxylase. Biochim Biophys Acta. 358, 226-229.https://doi.org/10.1016/0005-2744(74)90274-5 Liu, Y., Gong, C., Pei, W., Fan, K., Shen, W., (2023). Chlorophyll a fluorescence as a tool to monitor physiological status in the leaves of Artemisia ordosica under root cutting conditions. Front Plant Sci. 14, 1308209.https://doi.org/10.3389/fpls.2023.1308209 Livak, K.J., Schmittgen, T.D., (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2 -ΔΔT method. Methods. 25, 402-408.https://doi.org/10.1006/meth.2001.1262 Lowell, C.A., Tomlinson, P.T., Koch, K.E., (1989). Sucrose-metabolizing enzymes in transport tissues and adjacent sink structures in developing citrus fruit. Plant Physiol. 90, 1394-1402.https://doi.org/10.1104/pp.90.4.1394 Maloney, V.J., Park, J.Y., Unda, F., Mansfield, S.D., (2015). Sucrose phosphate synthase and sucrose phosphate phosphatase interact in planta and promote plant growth and biomass accumulation. J Exp Bot. 66, 4383-4394.https://doi.org/10.1093/jxb/erv101 Munns, R., Gilliham, M., (2015). Salinity tolerance of crops - what is the cost? New Phytol. 208, 668-673.https://doi.org/10.1111/nph.13519 Naya, L., Ladrera, R., Ramos, J., González, E. M., Arrese-Igor, C., Minchin, F. R., & Becana, M. (2007). The response of carbon metabolism and antioxidant defenses of alfalfa nodules to drought stress and to the subsequent recovery of plants. Plant Physiol. 144(2), 1104–1114. https://doi.org/10.1104/pp.107.099648 Nemati, F., Ghanati, F., Gavlighi, H.A., Sharifi, M., (2018). Comparison of sucrose metabolism in wheat seedlings during drought stress and subsequent recovery. Biol. Plant. 62, 595-599.https://doi.org/10.1007/s10535-018-0792-5 Oukarroum, A., Goltsev, V., Strasser, R.J., (2013). Temperature effects on pea plants probed by simultaneous measurements of the kinetics of prompt fluorescence, delayed fluorescence and modulated 820 nm reflection. PLoS One. 8, e59433.https://doi.org/10.1371/journal.pone.0059433 Peng, J., Liu, J., Zhang, L., Luo, J., Dong, H., Ma, Y., et al., (2016). Effects of soil salinity on sucrose metabolism in Cotton Leaves. PLoS One. 11, e0156241.https://doi.org/10.1371/journal.pone.0156241 Pinheiro, C., Chaves, M.M., (2011). Photosynthesis and drought: can we make metabolic connections from available data? J Exp Bot. 62, 869-882.https://doi.org/10.1093/jxb/erq340 Rius, S.P., Casati, P., Iglesias, A.A., Gomez-Casati, D.F., (2006). Characterization of an Arabidopsis thaliana mutant lacking a cytosolic non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase. Plant Mol Biol. 61, 945-957.https://doi.org/10.1007/s11103-006-0060-5 Ruan, Y.L., (2014). Sucrose metabolism: gateway to diverse carbon use and sugar signaling. Annu. Rev. Plant Biol. 65, 33-67.https://doi.org/10.1146/annurev-arplant-050213-040251 Ruan, Y.L., Jin, Y., Yang, Y.J., Li, G.J., Boyer, J.S., (2010). Sugar input, metabolism, and signaling mediated by invertase: roles in development, yield potential, and response to drought and heat. Mol Plant. 3, 942-955.https://doi.org/10.1093/mp/ssq044 Scafaro, A.P., Yamori, W., Carmo-Silva, A.E., Salvucci, M.E., von Caemmerer, S., Atwell, B.J., (2012). Rubisco activity is associated with photosynthetic thermotolerance in a wild rice ( Oryza meridionalis ). Physiol Plant. 146, 99-109.https://doi.org/10.1111/j.1399-3054.2012.01597.x Shu, S., Chen, L., Lu, W., Sun, J., Guo, S., Yuan, Y., et al., (2014). Effects of exogenous spermidine on photosynthetic capacity and expression of Calvin cycle genes in salt-stressed cucumber seedlings. J Plant Res. 127, 763-773.https://doi.org/10.1007/s10265-014-0653-z Tamoi, M., Nagaoka, M., Miyagawa, Y., Shigeoka, S., (2006). Contribution of fructose-1,6-bisphosphatase and sedoheptulose-1,7-bisphosphatase to the photosynthetic rate and carbon flow in the Calvin cycle in transgenic plants. Plant Cell Physiol. 47, 380-390.https://doi.org/10.1093/pcp/pcj004 Tounekti, T., Vadel, A.M., Oñate, M., Khemira, H., Munné-Bosch, S., (2011). Salt-induced oxidative stress in rosemary plants: Damage or protection? Environ. Exp. Bot. 71, 298-305.https://doi.org/10.1016/j.envexpbot.2010.12.016 Wang, K., Shao, X., Gong, Y., Zhu, Y., Wang, H., Zhang, X., et al., (2013). The metabolism of soluble carbohydrates related to chilling injury in peach fruit exposed to cold stress. Postharvest Biol. Technol. 86, 53-61.https://doi.org/10.1016/j.postharvbio.2013.06.020 Wu, P., Ma, Y., Ahammed, G.J., Hao, B., Chen, J., Wan, W., et al., (2022). Insights into melatonin-induced photosynthetic electron transport under low-temperature stress in cucumber. Front Plant Sci. 13, 1029854.https://doi.org/10.3389/fpls.2022.1029854 Wu, P., Xiao, C., Cui, J., Hao, B., Zhang, W., Yang, Z., et al., (2021). Nitric Oxide and Its Interaction with Hydrogen Peroxide Enhance Plant Tolerance to Low Temperatures by Improving the Efficiency of the Calvin Cycle and the Ascorbate-Glutathione Cycle in Cucumber Seedlings. J. Plant Growth Regul. 40, 2390-2408.https://doi.org/10.1007/s00344-020-10242-w Yan, F., Zhang, J., Li, W., Ding, Y., Zhong, Q., Xu, X., et al., (2021). Exogenous melatonin alleviates salt stress by improving leaf photosynthesis in rice seedlings. Plant Physiol Biochem. 163, 367-375.https://doi.org/10.1016/j.plaphy.2021.03.058 Yan, K., Chen, P., Shao, H., Zhao, S., Zhang, L., Zhang, L., et al., (2012). Responses of Photosynthesis and Photosystem II to Higher Temperature and Salt Stress in Sorghum . J Agron Crop Sci. 198, 218-226.https://doi.org/10.1111/j.1439-037X.2011.00498.x Yan, K., Wu, C., Zhang, L., Chen, X., (2015). Contrasting photosynthesis and photoinhibition in tetraploid and its autodiploid honeysuckle ( Lonicera japonica Thunb.) under salt stress. Front Plant Sci. 6, 227.https://doi.org/10.3389/fpls.2015.00227 Yang, Z., Li, J.-L., Liu, L.-N., Xie, Q., Sui, N., (2020). Photosynthetic regulation under salt stress and salt-tolerance mechanism of sweet sorghum. Front Plant Sci. 10.https://doi.org/10.3389/fpls.2019.01722 Zaghdoudi, M., Msilini, N., Govindachary, S., Lachaâl, M., Ouerghi, Z., Carpentier, R., (2011). Inhibition of photosystems I and II activities in salt stress-exposed Fenugreek ( Trigonella foenum graecum ). J. Photochem. Photobiol. B. 105, 14-20.https://doi.org/10.1016/j.jphotobiol.2011.06.005 Zhang, X., Feng, Y., Jing, T., Liu, X., Ai, X., Bi, H., (2021). Melatonin Promotes the Chilling Tolerance of Cucumber Seedlings by Regulating Antioxidant System and Relieving Photoinhibition. Front Plant Sci. 12, 789617.https://doi.org/10.3389/fpls.2021.789617 Zhao, H., Zhang, Z., Zhang, Y., Bai, L., Hu, X., Li, X., et al., (2022). Melatonin reduces photoinhibition in cucumber during chilling by regulating the Calvin-Benson Cycle. Sci. Hortic. 299, 111007.https://doi.org/https://doi.org/10.1016/j.scienta.2022.111007 Zhu, X., Liu, S., Sun, L., Song, F., Liu, F., Li, X., (2018). Cold tolerance of photosynthetic electron transport system is enhanced in wheat plants grown under elevated CO 2 . Front Plant Sci. 9, 933.https://doi.org/10.3389/fpls.2018.00933 Zhu, Y., Guo, J., Feng, R., Jia, J., Han, W., Gong, H., (2016). The regulatory role of silicon on carbohydrate metabolism in Cucumis sativus L. under salt stress. Plant Soil. 406, 231-249.https://doi.org/10.1007/s11104-016-2877-2 Zushi, K., Matsuzoe, N., (2017). Using of chlorophyll a fluorescence OJIP transients for sensing salt stress in the leaves and fruits of tomato. Sci. Hortic. 219, 216-221.https://doi.org/https://doi.org/10.1016/j.scienta.2017.03.016 Supplementary Files SupplementaryMaterial.xlsx Cite Share Download PDF Status: Published Journal Publication published 01 Oct, 2025 Read the published version in Plant and Soil → Version 1 posted Editorial decision: Major revisions 26 Sep, 2024 Reviewers agreed at journal 23 Jun, 2024 Reviewers invited by journal 19 Jun, 2024 Editor invited by journal 19 Jun, 2024 Editor assigned by journal 19 Jun, 2024 First submitted to journal 18 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4600225","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":316593271,"identity":"e4304886-a274-4826-a25c-e2ee547f96a5","order_by":0,"name":"xuezhen li","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"xuezhen","middleName":"","lastName":"li","suffix":""},{"id":316593272,"identity":"59662d4f-c029-481e-9229-916a945421ce","order_by":1,"name":"yongchao Han","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"yongchao","middleName":"","lastName":"Han","suffix":""},{"id":316593273,"identity":"48ab75fb-8fe5-46ff-99c7-21bb8ac9908c","order_by":2,"name":"yundan Cong","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"yundan","middleName":"","lastName":"Cong","suffix":""},{"id":316593274,"identity":"db89436a-f94f-49bd-8954-874496ad34d6","order_by":3,"name":"longfei Wang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"longfei","middleName":"","lastName":"Wang","suffix":""},{"id":316593275,"identity":"b41d051a-9b43-4428-b97d-efb1defa6b6a","order_by":4,"name":"yujie Shi","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"yujie","middleName":"","lastName":"Shi","suffix":""},{"id":316593276,"identity":"5d5e9b00-8371-4fba-b1d0-fe8394bed88a","order_by":5,"name":"huiying liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAz0lEQVRIiWNgGAWjYBACAwbmhgMMDAlyDOyMDQxARIwWRrAWYwZmUrQAqYTEBmYgRZQWc4nExsM8FWnp/c3MbRI/dzDI84sdwK/FckZiw2GeMzm5Mw4ztkn2nmEwnDk7gYDDbgC18LZV5DYAtUjwtjEkGNwmUku6PMiWvyRoyUkwAGqRJs6WMw8bDs45k2a48TBjs7VsmwQRfjmefPjDm4pkebnj7Q9vvm2zkeeXJqCFQQChgEWCgUGCgHIQ4D8AZzJ/IEL9KBgFo2AUjEAAAH/ISV1riMAVAAAAAElFTkSuQmCC","orcid":"","institution":"Shihezi University","correspondingAuthor":true,"prefix":"","firstName":"huiying","middleName":"","lastName":"liu","suffix":""},{"id":316593277,"identity":"9384a699-7aeb-4dd7-918d-d3447d1b1676","order_by":6,"name":"huifang Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"huifang","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-06-18 13:10:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4600225/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4600225/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11104-025-07810-y","type":"published","date":"2025-10-01T15:56:57+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":59946928,"identity":"430de72f-8370-4684-830a-3fe8754b9a4d","added_by":"auto","created_at":"2024-07-09 16:15:34","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":143998,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salt stress on net photosynthetic rate (Pn, A), tomatal conductance(Gs, B), intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration (Ci, C), and transpiration rate (Tr , D) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE (standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/c751ec02898fa4221d39e671.jpg"},{"id":59946925,"identity":"12d5ef40-0875-48ad-ab66-fc65008a3f7a","added_by":"auto","created_at":"2024-07-09 16:15:34","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":79484,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salt stress on apparent photosynthetic quantum efficiency (AQY, A) and dark respiration rate (Rd, B) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE(standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/dcdbc395c8d3715d101269a8.jpg"},{"id":59947515,"identity":"f7fb28a0-efa8-440c-941e-c2e523254453","added_by":"auto","created_at":"2024-07-09 16:23:34","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":106950,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salt stress on Chl a fiuorescence (a.u) (A,B) and relative differences in variable fluorescence (C,D) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE(standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/30a8bb456218982a5f543eb4.jpg"},{"id":59946926,"identity":"37f9692d-85eb-4601-ad9a-8a5efc85eff9","added_by":"auto","created_at":"2024-07-09 16:15:34","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":111890,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salt stress on ΔW\u003csub\u003eO-K \u003c/sub\u003e(A,B) and W\u003csub\u003eL\u003c/sub\u003e (C,D) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE(standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/6bc720550627826d9be2e6e5.jpg"},{"id":59946939,"identity":"24d25f44-cdb2-4385-9019-d3379fb7138f","added_by":"auto","created_at":"2024-07-09 16:15:34","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":112524,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salt stress on ΔW\u003csub\u003eO-J \u003c/sub\u003e(A,B), W\u003csub\u003eK \u003c/sub\u003e(C), and OEC centers (D) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE(standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/b4ce3efb7323b0988f8e68a5.jpg"},{"id":59946929,"identity":"2d42aeec-3095-4b94-b0d3-e4c3f75d3b77","added_by":"auto","created_at":"2024-07-09 16:15:34","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":89367,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salt stress on maximum photochemical efficiency (Fv/Fm, A) and photosynthetic performance index (PI abs, B) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE (standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/0f2bd077dfb65415b6ddd8d1.jpg"},{"id":59946930,"identity":"462c3213-a6b5-49ad-bd19-f2863d897b2a","added_by":"auto","created_at":"2024-07-09 16:15:34","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":92632,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salt stress on JIP-test parameters (A,B) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE (standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment\u003c/p\u003e","description":"","filename":"7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/e8dcd0b9f92e78f262087e97.jpg"},{"id":59948076,"identity":"86212949-3c66-433c-bc55-59a623b2573a","added_by":"auto","created_at":"2024-07-09 16:31:34","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":134403,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salt stress on light energy parameters by the active unit reaction center (RC)(A,B) and per unit area (CSo) (C,D) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE(standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment\u003c/p\u003e","description":"","filename":"8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/34a5495ef28cb3af3e3c84d0.jpg"},{"id":59947516,"identity":"9b5f8ad2-d08a-4223-a664-3da178acbe46","added_by":"auto","created_at":"2024-07-09 16:23:34","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":101340,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salt stress on MR/MR\u003csub\u003eO \u003c/sub\u003e(A,B), ΔMRfast/MR\u003csub\u003eO\u003c/sub\u003e (C), ΔMRslow/MR\u003csub\u003eO \u003c/sub\u003e(D), Vox (E), and Vred (F) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE (standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment\u003c/p\u003e","description":"","filename":"9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/b2ef6b8668fd110113c29161.jpg"},{"id":59946938,"identity":"53311175-f8eb-4394-8db9-cbf52c6f22a3","added_by":"auto","created_at":"2024-07-09 16:15:34","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":283218,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Effects of salt stress on activities and transcript levels of Rubisco (initialand total)(A,B,C,D), RCA(E,F) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE(standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eB\u003c/strong\u003e Effects of salt stress on activities and transcript levels of PGK(A, B), FBPase (C,D), GAPDH(E,F), and FBA (G,H) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE (standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment\u003c/p\u003e","description":"","filename":"10.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/acc9d38cade30548c8db83ae.jpg"},{"id":59946936,"identity":"ca85455c-9ef6-49ea-8b5a-a37985ece8c4","added_by":"auto","created_at":"2024-07-09 16:15:34","extension":"jpg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":111063,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salt stress on Glucose content (A), Sucrose content (B), Fructose content (C), and Soluble sugar content (D) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE (standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment\u003c/p\u003e","description":"","filename":"11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/7ac0fe733e482ce30671750a.jpg"},{"id":59946941,"identity":"cb6aee2a-fed3-4d60-816a-770716c46d51","added_by":"auto","created_at":"2024-07-09 16:15:35","extension":"jpg","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":73933,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of salt stress on activities and transcript levels of SPS (A,B), S-AI (C,D), SS-I (E,F), and SS-II (G) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means ± SE (standard error), and bars with different letters above the columns of figures indicate significant differences among the treatments at P \u0026lt; 0.05 (Duncan’s range test) on a given day of treatment\u003c/p\u003e","description":"","filename":"12.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/6ef4a65b4de138862b9453ac.jpg"},{"id":92883736,"identity":"7380a9d4-d28a-4349-a101-08f6419255da","added_by":"auto","created_at":"2025-10-06 16:08:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2956721,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/a64f0aaa-2979-4135-bd89-7c5851a3a3cf.pdf"},{"id":59946940,"identity":"517fe101-1850-4220-a0c7-2e610d55178b","added_by":"auto","created_at":"2024-07-09 16:15:34","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":93673,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4600225/v1/54105776a0b693468ac5addd.xlsx"}],"financialInterests":"","formattedTitle":"Salt-induced changes in the photosynthetic apparatus and carbon metabolism of two tomato cultivars with varying salt tolerance","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eSalt stress in soil is one of the major abiotic stresses limiting global crop quality and yield formation (Kalaji et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Approximately 7% of the world\u0026rsquo;s land area (approximately 1\u0026nbsp;billion hm\u003csup\u003e2\u003c/sup\u003e) and 20% of irrigated farmland are threatened by soil salinization, particularly in semiarid and arid regions (Munns and Gilliham \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In China, saline soil area accounts for 41.88% (approximately 36\u0026nbsp;million hm\u003csup\u003e2\u003c/sup\u003e) of the available land area in the country (Tounekti et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Therefore, screening and breeding salt-tolerant crop varieties and exploring new plant strategies for salt tolerance are important for using and transforming saline soils for agricultural production.\u003c/p\u003e \u003cp\u003ePlant photosynthesis is very sensitive to salt stress. When other phenotypic symptoms have not yet appeared and photosynthesis is partially or even completely inhibited by salt stress (Huang et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). PSI and PSII are important constituents of photosynthetic apparatus and sites of photosynthetic redox reaction in plants. The photosynthetic apparatus is disrupted under salt stress because of reception of light energy excess of its maximum utilization capacity and reduced regulation of excitation energy partitioning between PSI and PSII; this decreases photosynthetic efficiency and photoinhibition (Huang et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). It is generally accepted that PSII is the most sensitive and more prone to photoinhibition than PSI under adversity (including salt stress) (Yan et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Yan et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). However, high-temperature stress is reported to cause PSI photoinhibition (Oukarroum et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). In wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e) and cucumber (\u003cem\u003eCucumis sativus\u003c/em\u003e), PSI was observed to be more susceptible to inhibition under low-temperature stress than PSII, which exhibited only slight damage (Zhang et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zhu et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Li et al. (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) reported that PSI inhibition was the main factor limiting the recovery of photosynthesis after short-term cold stress under weak light. Salt stress resulted in the inhibition of PSI oxidation in \u003cem\u003eLonicera japonica\u003c/em\u003e, and the degree of inhibition was greater for PSI than for PSII (Yan et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Therefore, it is necessary to investigate the mechanism of action of salt stress on the performance and structure of PSII and PSI. Rapid chlorophyll fluorescence induction kinetics (OJIP curve) enables rapid access to the primary photochemical reactions of PSII and state and function of the photosynthetic machineries (Liu et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The quantitative analysis of the OJIP curve based on the biofilm energy flux theory (JIP-test) can be used to study the effects of environmental conditions on the reaction center and damaged sites of PSII (Brestic et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Kalaji et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In addition, the 820-nm light reflection signal (MR820) kinetics can detect changes in the oxidized and redox state of the plasma cyanin (PC) and PSI reaction center, which can provide insights into the response of PSI to adversity (Gao et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Gao et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCalvin cycle is a process in which chloroplasts use ATP and NADPH produced by photoreaction to fix CO\u003csub\u003e2\u003c/sub\u003e to from sugars (Peng et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). After plants are subjected to salt stress, inhibition of the activity of enzymes related to the photosynthetic carbon assimilation leads to NADPH accumulation; this also induces ROS production and feedback inhibition, affecting the transmission of photosynthetic electrons (El Sayed et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ruan \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Shu et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Yan et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Carbohydrate is the product of carbon fixation and transformation in photosynthesis and one of the important substances that regulate the ability of plants to adapt to adversity. Under salt stress, plant photosynthesis is inhibited; amount of sucrose transported to the roots and competitive sink organs is reduced; soluble sugar and starch are accumulated in the leaves, resulting in feedback inhibition of photosynthesis (Zhu et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Additionally, salt stress leads to alterations in plant sugar metabolism. Sucrose synthase (SS), sucrose phosphate synthase (SPS), and acid converting enzyme (S-AI) are the key enzymes in the sugar metabolism process, which play a critical role in the interconversion of sucrose, glucose, and fructose in the cells (Cui et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Salt-tolerant crop varieties can maintain salt tolerance under salt stress by increasing sucrose synthase activity and inhibiting sucrose degradation (Yang et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, the mechanisms by which the above physiological processes respond to salt stress are extremely complex and vary according to plant genotype, developmental stage, cellular history, and duration of stress (El Sayed et al., 2022; Huang et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e L.) is a moderately salt-tolerant plant. However, its growth is still susceptible to salt stress, which slows its growth and reduces its yield. The salt tolerance mechanism of tomato is complex and still not completely understood. Previous studies have extensively studied the agronomic traits, capacity to detoxify reactive oxygen species, ionic homeostasis, and osmotic regulation in tomato varieties with varying salt tolerance (Ali et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Dogan et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). However, salt tolerance mechanisms in tomato related to the state and function of the photosynthetic apparatus, photosynthetic carbon assimilation, and sugar metabolism are relatively rarely reported.\u003c/p\u003e \u003cp\u003eIn the current study, we investigated the salt-tolerance mechanism related to photosynthetic machinery and sugar metabolism during the seedling stage of tomatoes. Two tomato varieties with varying salt tolerance [Zhongshu No.4 (salt-sensitive) and Jinpeng No.3 (salt-tolerant)] were subjected to salt stress, and the effects on the structure and function of PSI and PSII were analyzed using rapid chlorophyll fluorescence kinetics and 820-nm transmission kinetics after 5 and 15 days of salt-stress treatment. Moreover, the activity and transcript level of enzymes related to Calvin cycle and sucrose metabolism were investigated. Our study provided a theoretical basis for the screening and breeding of salt-tolerant tomato varieties and efficient exploitation and utilization of salinized soil.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Plant material and salt-stress treatment\u003c/h2\u003e \u003cp\u003eTwo tomato varieties, namely, Zhongshu No.4 (salt-sensitive; F; purchased from Shihezi Vegetable Research Institute, Xinjiang) and Jingpeng No.3 (salt-tolerant; T; purchased from Xi 'an Jinpeng Company), were used as the study material. The seedlings with uniform growth were selected at the three-leaf and one-heart-leaf stages and were planted in a black plastic bucket containing Hoagland nutrient solution. The nutrient solution was changed twice a week. Tomato seedlings were pre-cultured in the nutrient solution for 7 days and further subjected to salt treatment. The experiment included control (treated with 0 mM NaCl; FCK and TCK for Zhongshu No.4 and Jingpeng No.3, respectively) and salt treatment group (treated with 100 mM NaCl; FN and TN for Zhongshu No.4 and Jingpeng No.3, respectively). Each group contained 18 seedlings, and the treatment was repeated 3 times. Growth parameters, photosynthesis and photosynthetic product parameters, and gene transcript level were measured 5 and 15 days after the salt-stress treatments (labelled as S5 and S15, respectively.)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Determination of growth indicators\u003c/h2\u003e \u003cp\u003eAfter S5 and S15, plant height was determined from the top of root to the top of the main stem using a tape measure, and the diameter of the root at the top was determined using vernier calipers. The entire plants were washed with distilled water and cut at the stem base. The part above the stem base was considered aboveground part, and that below the stem base was considered belowground part. After wiping off water, fresh weights of the above- and belowground parts were measured. Next, the parts were heated at 105\u0026deg;C for 15 min and further at 75\u0026deg;C till constant weight was obtained, which was the dry weight of above- and belowground parts.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Effect of salt stress on the photosynthetic parameters in tomato seedlings\u003c/h2\u003e \u003cp\u003eAfter S5 and S15, the net photosynthetic rate (Pn), intercellular CO\u003csub\u003e2\u003c/sub\u003e concentration (Ci), stomatal conductance (Gs), and transpiration rate (Tr) of the third functional leaf of tomato seedlings under different treatments were measured using a portable photosynthesis system LI-6400 (Li-Cor, Lincoln, NE, USA). Photosynthetic photon flux density (PPFD) of 1000 \u0026micro;mol\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and temperature of 25\u0026deg;C were set in the built-in leaf chamber with red and blue light source. CO\u003csub\u003e2\u003c/sub\u003e gas was supplied from an external buffer bottle, and its concentration was manually controlled to 400 \u0026micro;mol\u0026middot;mol\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFor plotting the Pn-PAR (photosynthesis-light response) curves, the CO\u003csub\u003e2\u003c/sub\u003e concentration and leaf chamber temperature were kept at 400 \u0026micro;mol\u0026middot;mol\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 25\u0026deg;C, respectively, and PPFD gradients of 1600, 1400, 1200, 1000, 800, 600, 400, 300, 200, 100, 50, and 0 \u0026micro;mol\u0026middot;m\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u0026middot;s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e were set in the built-in leaf chamber with red and blue light source. The apparent photosynthetic quantum efficiency (AQY) and dark respiration rate (Rd) of the optical response were calculated using the modified rectangular hyperbola model.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.4 Effect of salt stress on rapid chlorophyll fluorescence kinetics (\u003c/b\u003eOJIP curves) \u003cb\u003eand JIP-test in tomato seedlings\u003c/b\u003e\u003c/p\u003e \u003cp\u003eRapid chlorophyll fluorescence was determined using the plant efficiency analyzer Handy-PEA (Hansatech, Britain). OJIP curves, Fv/Fm, and PI abswere directly exported from the data. In the OJIP curve, the OKJIP phase exists: Fo is the minimum fluorescence at 0.02 ms (O phase); F\u003csub\u003eK\u003c/sub\u003e is the fluorescence at 0.3 ms (K phase); F\u003csub\u003eJ\u003c/sub\u003e is the fluorescence at 2 ms (J phase); F\u003csub\u003eI\u003c/sub\u003e is fluorescence at 30 ms (I phase), and Fm is the maximum fluorescence (P phase). JIP-tests of OJIP curves were performed as described by Strasser et al. (2000) to obtain derived JIP-test parameters. Various parameters were calculated as follows. Probability that a captured exciton transfers electrons to other electron acceptors in the electron transport chain beyond Q\u003csub\u003eA\u003c/sub\u003e-: Ψo\u0026thinsp;=\u0026thinsp;ETo /TRo\u0026thinsp;=\u0026thinsp;1 - V\u003csub\u003eJ\u003c/sub\u003e; quantum yield of absorbed energy for electron transfer: φEo\u0026thinsp;=\u0026thinsp;ETo/ABS\u0026thinsp;=\u0026thinsp;Ψo [1 - (Fo /Fm)]; quantum ratio for heat dissipation: φDo\u0026thinsp;=\u0026thinsp;1 - φPo\u0026thinsp;=\u0026thinsp;Fo/Fm; quantum yield of captured energy that can be transferred to the end of the electron chain: φRo\u0026thinsp;=\u0026thinsp;REo /ETo = (Fm - F\u003csub\u003eI\u003c/sub\u003e)/(Fm - F\u003csub\u003eJ\u003c/sub\u003e); light energy absorbed electron transfer by unit active PSII centers: ABS/RC\u0026thinsp;=\u0026thinsp;Mo (1/V\u003csub\u003eJ\u003c/sub\u003e )(1/φPo); energy captured for electron transfer by unit active PSII centers: TRo/RC\u0026thinsp;=\u0026thinsp;Mo (1/V\u003csub\u003eJ\u003c/sub\u003e ); energy captured for electron transfer by unit active PSII centers: ETo /RC\u0026thinsp;=\u0026thinsp;Mo(1/V\u003csub\u003eJ\u003c/sub\u003e)Ψo; energy dissipated thermally by unit active PSII centers: DIo/RC = (ABS/RC) - (TRo/RC); light energy absorbed per unit area: ABS/CSo\u0026thinsp;\u0026asymp;\u0026thinsp;Fm; light energy trapped per unit area: TRo/CSo\u0026thinsp;=\u0026thinsp;φPo(ABS/CSo); quantum yield of electron transfer per unit area: ETo/CSo\u0026thinsp;=\u0026thinsp;φEo(ABS/CSo); thermal dissipation per unit area: DIo/CSo = (ABS/CSo) - (TRo /CSo).\u003c/p\u003e \u003cp\u003eRelative differences in variable fluorescence were calculated using double normalization Vt = (Ft - Fo)/(Fm - Fo) and ΔVt\u0026thinsp;=\u0026thinsp;Vt\u003csub\u003e(Treatment)\u003c/sub\u003e - Vt \u003csub\u003e(control)\u003c/sub\u003e (where Ft: fluorescence at time t; Fo: minimum fluorescence; and Fm: maximum fluorescence). To display the L-band, the OJIP curves between O and K phases under different treatments were normalized according to the following formulae: W\u003csub\u003eO\u0026minus;K\u003c/sub\u003e = (Ft - Fo)/(F\u003csub\u003eK\u003c/sub\u003e - Fo) and ΔW\u003csub\u003eO\u0026minus;K\u003c/sub\u003e = W\u003csub\u003eO\u0026minus;K (treatment)\u003c/sub\u003e - W\u003csub\u003eO\u0026minus;K (control)\u003c/sub\u003e to obtain the W\u003csub\u003eO\u0026minus;J\u003c/sub\u003e and ΔW\u003csub\u003eO\u0026minus;J\u003c/sub\u003e curves, respectively. W\u003csub\u003eL\u003c/sub\u003e is the relative variable fluorescence at 150 \u0026micro;s on the W\u003csub\u003eO\u0026minus;K\u003c/sub\u003e standard curve. To display the K-band, the OJIP curves between O and J phases were processed using the formulae W\u003csub\u003eO\u0026minus;J\u003c/sub\u003e = (Ft - Fo)/(F\u003csub\u003eJ\u003c/sub\u003e - Fo) and ΔW\u003csub\u003eO\u0026minus;J\u003c/sub\u003e = W\u003csub\u003eO\u0026minus;J (treatment)\u003c/sub\u003e \u0026ndash; W\u003csub\u003eO\u0026minus;J (control)\u003c/sub\u003e to obtain the W\u003csub\u003eO\u0026minus;J\u003c/sub\u003e and ΔW\u003csub\u003eO\u0026minus;J\u003c/sub\u003e curves, respectively. W\u003csub\u003eK\u003c/sub\u003e is the relative variable fluorescence at 300 \u0026micro;s on the W\u003csub\u003eO\u0026minus;J\u003c/sub\u003e standard curve. The active fraction of oxygen-evolving complex (OEC) centers were calculated as: [1 - (V\u003csub\u003eK\u003c/sub\u003e/V\u003csub\u003eJ\u003c/sub\u003e)]\u003csub\u003etreatment\u003c/sub\u003e/[1 - (V\u003csub\u003eK\u003c/sub\u003e/V\u003csub\u003eJ\u003c/sub\u003e)]\u003csub\u003econtrol\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.5 Effect of salt stress on modulated 820-nm reflection\u003c/b\u003e (MR\u003csub\u003e820\u003c/sub\u003e) \u003cb\u003ekinetics in tomato seedlings\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eThe kinetics of MR\u003csub\u003e820\u003c/sub\u003e (MR/MRo curves) were obtained using the Handy-PEA, as described by (Gao et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), where MRo is the value of the signal at the start of the photochemical irradiation (0.7 ms). The parameters of the redox states of the PSI electron carriers were calculated from the MR/MRo curves: the rapidly decreasing part of the MR/MRo curve [which indicates the oxidized states of plastocyanin (PC) and P700] and the rising part of the MR/MRo curve (which indicates the reduced states of PC\u003csup\u003e+\u003c/sup\u003e and P700\u003csup\u003e+\u003c/sup\u003e). The speed of oxidation of PC and P700 was calculated as Vox\u0026thinsp;=\u0026thinsp;ΔMR/Δt = (MR\u003csub\u003e2 ms\u003c/sub\u003e \u0026ndash;MR\u003csub\u003e0.7 ms\u003c/sub\u003e)/(1.3 ms). The speed of re-reduction of PC\u003csup\u003e+\u003c/sup\u003e and P700\u003csup\u003e+\u003c/sup\u003e was calculated as Vred\u0026thinsp;=\u0026thinsp;ΔMR/Δt = (MR\u003csub\u003e30 ms\u003c/sub\u003e \u0026ndash;MR\u003csub\u003e9 ms\u003c/sub\u003e)/(21 ms) (where MR\u003csub\u003et ms\u003c/sub\u003e refers to MR820 signal values at various time points; Vox refers to the speed of oxidation of PC and P700; Vred refers to the speed of re-reduction of PC\u003csup\u003e+\u003c/sup\u003e and P700\u003csup\u003e+\u003c/sup\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.6 Effect of salt stress on activity of the key enzymes of Calvin cycle in tomato seedlings\u003c/b\u003e \u003c/p\u003e \u003cp\u003eRubisco activities (initial and total) were measured with reference to the method by Lilley and Walker (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1974\u003c/span\u003e). The activity of Rubisco activating enzyme (RCA) was measured using an ELISA kit (TIANDZ, China). The activities of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), fructose-1,6-bisphosphatase (FBPase), fructose-1,6-bisphosphate aldolase (FBA), and 3-phosphoglycerate kinase (PGK) were determined using respective kits.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.7 Effect of salt stress on sugar content and activities of enzymes related to sucrose metabolism in tomato seedlings\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSugar content was determined as described by Buysse and Merckx (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1993\u003c/span\u003e). In brief, 0.1 g dry leaf sample was added to 4 mL of 80% ethanol, and the mixture was heated in a water bath at 85\u0026deg;C for 30 min for continuous extraction with ethanol. Further, the mixture was centrifuged for 30 min at 12,000 g and 25\u0026deg;C, and supernatant was collected. The residue was extracted with 4 mL of 80% ethanol twice, and the supernatants were combined. The pigments in the extract were removed by the addition of activated carbon (0.1 g). Further, the volumes of ethanol extracts were made up to 50 mL with distilled water. This solution was used to determine the contents of soluble sugar, glucose, fructose, and sucrose.\u003c/p\u003e \u003cp\u003eThe enzymes were extracted according to the method by Hu et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In brief, 1.0 g of the fresh leaves were ground in a pre-cooled mortar containing 10 mL of hydroxyethyl piperazine ethane sulfonic acid (HEPES) buffer (50 mM HEPES pH\u0026thinsp;=\u0026thinsp;7.5, 1 mM EDTA, 10 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 2.5 mM dithiothreitol, 10 mM vitamin C, and 5% insoluble polyvinyl pyrrolidone). The mixture was centrifuged for 20 min at 12,000 g and 4\u0026deg;C, and supernatant was collected. The activities of sucrose phosphate synthase (SPS), sucrose synthase (synthesis direction SS-II), sucrose synthase (catabolism direction SS-I), and acid converting enzyme (S-AI) were determined as described by Hubbard et al.(1989) and Lowell et al.(1989).\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.8 Effect of salt stress on the transcript levels of key genes related to Calvin cycle and sucrose metabolism in tomato seedlings\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe primers were synthesized by Xinjiang Youkang Company (detailed sequences given in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). RNA was extracted from fresh tomato leaves using Trizol method. Nucleic acid detector was used to determine its concentration. RNA was reverse transcribed to cDNA, which was used as a template for qPCR. qPCR was performed using iCycler iQ Multicolor Real-Time PCR detection System (Bio-Rad) and SYBR qPCR Mix (EnzyArtisan., China). The reaction mix (20 \u0026micro;L) contained 10 \u0026micro;L SYBR Mix, 1 \u0026micro;L template, 1 \u0026micro;L forward and reverse primers each, and 7 \u0026micro;L deionized water. The gene transcript levels were calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method (Livak and Schmittgen \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDesign of primers for qRT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003egene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eActin\u003c/em\u003e (\u003cem\u003eNM_001323002.1\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGACTACGAGCAGGAACTTGAAACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACGGAACCTCTCAGCACCAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRCA\u003c/em\u003e (\u003cem\u003eXM_010327541.3\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGGACGGATTCTACATCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCCCCAAACACCCAAAATAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRbcL\u003c/em\u003e (\u003cem\u003eXM_012015910.1\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGTATGGACCGATGGACTTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGGTCTAAAGGGTAAGCTACATAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRbcS\u003c/em\u003e (\u003cem\u003eNM_001308943.1\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAGAGGCGAAGAAGGCGTACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAAGCTGATGCACTGGACTTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePGK\u003c/em\u003e (\u003cem\u003eXM_004243920.3\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAAGAGCGTTGGAGACCTTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTGTTTGATGGTAGGGATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFBA\u003c/em\u003e (\u003cem\u003eNM_001321372.1\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGTATGGACCGATGGACTTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGGTCTAAAGGGTAAGCTACATAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e (\u003cem\u003eNM_001247874.2\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTCTGGTATATGTGTTACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGGAAGCAAGATTACTAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFBPase\u003c/em\u003e (\u003cem\u003eNM_001328673.1\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATTTCCATCTCTTCCCCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGGTTTCTTGATCTGTGCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSS\u003c/em\u003e (\u003cem\u003eNM_001247726.2\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTACGCCAAGAATCCACGACTAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCTTCATCTCTGCCTGCTCTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSPS\u003c/em\u003e (\u003cem\u003eNM_001246991.2\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGTCTACGCAAGGCTGTCATAATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGCTACATTCCTCGTCTGCTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eS-AI\u003c/em\u003e (\u003cem\u003eNM_001246913.2\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTTGCACAGGCTGACGTTGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGACCACCTTGAACCGTTGAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003eNote: \u003cem\u003eactin\u003c/em\u003e: Actin gene; \u003cem\u003eRCA\u003c/em\u003e: Rubisco activase gene; \u003cem\u003eRbcL\u003c/em\u003e: Rubisco large subunit gene; \u003cem\u003eRbcS\u003c/em\u003e: Rubisco small subunit gene; \u003cem\u003ePGK\u003c/em\u003e: 3-phosphoglycerate kinase gene; \u003cem\u003eFBA\u003c/em\u003e: Fructose-1,6-bisphosphate aldolase gen; \u003cem\u003eGAPDH\u003c/em\u003e: glyceraldehyde-3-phosphate dehydrogenase gene; \u003cem\u003eFBPase\u003c/em\u003e: fructose-1,6-bisphosphatase gene; \u003cem\u003eSS\u003c/em\u003e: sucrose synthase gene; \u003cem\u003eSPS\u003c/em\u003e: sucrose phosphate synthase; \u003cem\u003eS-AI\u003c/em\u003e: acid converting enzyme gene\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Statistical analysis\u003c/h2\u003e \u003cp\u003eStatistical differences between treatments were analyzed by one-way analysis of variance (ANOVA) followed by post-hoc multiple comparison analysis using SPSS v. 19.0. Results were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SE) (at least n\u0026thinsp;=\u0026thinsp;3). Differences were considered significant at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05. The graphs were plotted using origin 2021b.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Difference in the growth of tomato varieties with varying salt tolerance\u003c/h2\u003e \u003cp\u003eSalt-stress treatment significantly inhibited the seedling growth of both tomato varieties (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The FN samples (salt-sensitive Zhongshu No.4 exposed to 100 mM NaCl) were more severely inhibited than the TN samples (salt-tolerant Jingpeng No.3 exposed to 100 mM NaCl). The FN samples exhibited higher magnitude of decline in the dry weights and fresh weights of above ground and belowground parts, plant height, and stem diameter (except on S15) than the TN samples.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of salt stress on Plant Height (cm), Stem diameter (mm), Shoot FW (g), and Root FW (g), Shoot DW (g) and Root DW (g) of different tomato seedlings. FCK, Zhongshu No.4 tomato seedlings grew in nutrient solution without NaCl; FN, Zhongshu No.4 tomato seedlings grew in nutrient solution with 100 mM NaCl; TCK, Jingpeng No.3 tomato seedlings grew in nutrient solution without NaCl; TN, Jingpeng No.3 tomato seedlings grew in nutrient solution with 100 mM NaCl. The results shown are the means\u0026thinsp;\u0026plusmn;\u0026thinsp;SE, and bars with different letters above the columns of figures indicate significant differences among the treatments at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 (Duncan\u0026rsquo;s range test) on a given day of treatment.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTime(d)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePlant Height(cm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eStem Diameter(mm)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eShoot FW(g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRoot FW(g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eShoot DW(g)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eRoot DW(g)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e5D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.90b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.71a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.76\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07ab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.84b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.74\u0026thinsp;\u0026plusmn;\u0026thinsp;1.05b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.09\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01c\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.89a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.79a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.96\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.74b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12bc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e15D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.9\u0026thinsp;\u0026plusmn;\u0026thinsp;1.43a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.97a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e15.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.92b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e5.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.87\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.74c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72d\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23.2\u0026thinsp;\u0026plusmn;\u0026thinsp;2.28a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.84a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e18.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.88a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.07\u0026thinsp;\u0026plusmn;\u0026thinsp;1.08a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.89b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.14\u0026thinsp;\u0026plusmn;\u0026thinsp;1.44c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.69c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.86\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.2 Difference in the photosynthetic parameters of tomato varieties with varying salt tolerance in response to salt stress\u003c/b\u003e \u003c/p\u003e \u003cp\u003eNo significant differences were observed in terms of Pn, Gs, Ci, and Tr between the two varieties under control conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The Pn, Gs Ci, and Tr values of both tomato varieties exhibited reduction in different degrees under salt stress. The Pn, Gs Ci, and Tr were significantly decreased in the FN samples after S5, and the decrease in Pn, Ci, and Gs values was higher after S15 than after S5. The TN samples exhibited no significant changes in Pn after S5 and in Tr after S15. The decrease in Pn, Gs Ci, and Tr after S5 and S15 was lower in the TN samples than in the FN samples.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNo significant differences in AQY and Rd was observed between both varieties under control conditions (except for AQY on S15). Salt stress significantly reduced the AQY of Zhongshu No.4 after S5 and S15; however, that of Jingpeng No.3 significantly decreased only after S15. Meanwhile, the Rd of both varieties significantly increased during the whole treatment period. The amplitude of AQY and Rd was significantly higher in Zhongshu No.4 than in Jinpeng No.3 during salt-stress treatment (except for AQY on S15). This indicated that salt stress reduced the photosynthetic capacity of both tomato varieties; however, the photosynthetic capacity of salt-tolerant variety was less affected (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.3 Difference in the rapid chlorophyll fluorescence of tomato varieties with varying salt tolerance in response to salt stress\u003c/b\u003e \u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e3.3.1 Effects of salt stress on OJIP curves and relative variable fluorescence curves\u003c/h2\u003e \u003cp\u003eThe OJIP curves exhibited different degrees of deformation during the whole period of salt-stress treatment compared with the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA - B), indicating increased O-phase and J-phase, reduced amplitude of P-phase and I-P-phase, flattening of the curve. Jingpeng No.3 exhibited less OJIP deformation than Zhongshu No.4. In the ΔVt curves of both tomato varieties, the ΔV\u003csub\u003eJ\u003c/sub\u003e values were significantly increased during the whole period of salt-stress treatment compared with the control, and they were \u0026gt;\u0026thinsp;0. The ΔV\u003csub\u003eI\u003c/sub\u003e of the FN samples after S15 was significantly higher than that of the FCK samples, and it was \u0026gt;\u0026thinsp;0. The amplitude of ΔV\u003csub\u003eJ\u003c/sub\u003e and ΔV\u003csub\u003eI\u003c/sub\u003e was higher in the FN samples than in the TN samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC - D). It suggested that electron transfer on the PSII receptor side of both tomato varieties was inhibited under salt stress, with large accumulation of Q\u003csub\u003eA\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e (primary quinone receptor Q\u003csub\u003eA\u003c/sub\u003e reduced form), but it occurred by a lesser extent in the salt-tolerant variety.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe appearance of the L-band and increase of ΔW\u003csub\u003eL\u003c/sub\u003e value are indicators of the decrease of energy connectivity between PSII unit grouping or antenna and PSII reaction center (RC) caused by the thylakoids in chloroplasts. The appearance of the K-band and an increase in ΔW\u003csub\u003eK\u003c/sub\u003e values are specific markers of the damage to the oxygen-evolving complex (OEC) of the PSII donor side or inactivation of the OEC center (Wu et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The OEC activity of PSII was significantly reduced; W\u003csub\u003eL\u003c/sub\u003e, ΔW\u003csub\u003eL\u003c/sub\u003e, W\u003csub\u003eK\u003c/sub\u003e, and ΔW\u003csub\u003eK\u003c/sub\u003e values were significantly increased, and ΔW\u003csub\u003eL\u003c/sub\u003e and ΔW\u003csub\u003eK\u003c/sub\u003e were both \u0026gt;\u0026thinsp;0 in both tomato varieties under salt-stress treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Among them, the increases in the W\u003csub\u003eL\u003c/sub\u003e, ΔW\u003csub\u003eL\u003c/sub\u003e, W\u003csub\u003eK\u003c/sub\u003e, and ΔW\u003csub\u003eK\u003c/sub\u003e values during the whole period of salt-stress treatment were higher in Zhongshu No.4 than in Jinpeng No.3. It indicated that the OEC, and acceptor side and donor side of PSII of both tomato varieties were damaged under salt stress, resulting in the inactivation of OEC center and decreased grouping or energy connectivity of PSII units. The damage on the donor and acceptor sides of PSII under salt stress was less in the salt-tolerant variety.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e3.3.2 Effect of salt stress on JIP-test parameters\u003c/h2\u003e \u003cp\u003eThe maximum photochemical efficiency (Fv/Fm) is an important parameter reflecting the light energy conversion efficiency of PSII active center, and photosynthetic performance index (PI abs) refers to the performance index based on absorbed light energy. Compared with the FCK and TCK samples, Fv/Fm and PI abs in the leaves of both tomato varieties significantly decreased in the FN and TN samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Salt stress affected PI abs more severely compared to Fv/Fm, indicating that it was more sensitive to salt stress than Fv/Fm. After S5 and S15, Fv/Fm was reduced by 7.4% and 7.0% in Zhongshu No. 4 and by 4.0% and 6.0% in Jinpeng No.3; PI abs was reduced by 31.1% and 23.1% in Zhongshu No. 4 and by 28.2% and 13.6% in Jinpeng No.3, respectively. Among both varieties, the magnitude of decline in Fv/Fm and PI abs after S15 was significantly higher in Zhongshu No.4 than in Jinpeng No.3.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eDuring the whole period of salt-stress treatment, the quantum yield for electron transfer (φEo), probability of electron transfer to the electron acceptors downstream of Q\u003csub\u003eA\u003c/sub\u003e- (ψo), and quantum yield of captured energy that can be transferred to the end of the electron chain (φRo) were significantly reduced; however, quantum ratios of heat dissipation (φDo), J-phase relatively variable fluorescence (V\u003csub\u003eJ\u003c/sub\u003e), and I-phase relatively variable fluorescence (V\u003csub\u003eI\u003c/sub\u003e) were significantly increased in both varieties. The magnitude of decline in φEo after S5 and S15 and that in φRo and ψo after S15 was significantly higher in Zhongshu No.4 than in Jingpeng No.3. This indicated that salt stress decreased electron transfer ability on the side of PSII and the opening degree of active PSII reaction center (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). However, salt-tolerant tomato variety exhibited less closure of active PSII reaction centers under salt stress.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e3.3.3 Effect of salt stress on light energy parameters\u003c/h2\u003e \u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA - B show the absorbed energy, trapped energy, heat dissipation energy, and energy for transfer by the active unit reaction center (RC) after control and salt-stress treatments (ABS/RC, TRo/RC, DIo/Rc, and ETo/RC, respectively). Figure\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC - D show absorbed energy, captured energy, dissipated energy, and energy used for transfer per unit area (CSo) (ABS/CSo, TRo/CSo, DIo/CSo, and ETo/CSo, respectively). No significant differences were observed in other specific activity parameters between both tomato varieties under control conditions except that DIo/RC and ABS/RC were significantly higher in Zhongshu No. 4 than in Jinpeng No. 3 after S5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA - B). During the whole period of salt-stress treatment, ABS/RC, TRo/RC, and DIo/RC significantly increased, and ETo/RC significantly decreased after S15 in both varieties. Among them, the magnitude of increase in TRo/RC and ETo/RC after S5 and S15 and that in ABS/RC after S15 was higher, and the decrease in DIo/RC after S5 was lower in Zhongshu No.4 than in Jingpeng No.3. In addition, ABS/CSo, TRo/CSo, and ETo/CSo were significantly decreased and DIo/CSo was significantly increased in both tomato varieties after S5 and S15. The magnitude of increase in ABS/CSo, TRo/RC, DIo/CSo, and ETo/CSo after S5 and S15 was higher in Zhongshu No.4 than in Jingpeng No.3. These results indicated that the energy share for electron transfer in the leaves of both tomato varieties is reduced under salt stress, inhibiting electron transfer and increasing energy share for heat dissipation. The energy share for heat dissipation in the salt-resistant tomato variety increased to a greater extent than that in the salt-sensitive variety.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e\u003cb\u003e3.3.4 The kinetics of\u003c/b\u003e 820-nm light reflection (\u003cb\u003eMR\u003c/b\u003e\u003csub\u003e\u003cb\u003e820\u003c/b\u003e\u003c/sub\u003e\u003cb\u003e) and response of its parameters to salt stress\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eThe MR\u003csub\u003e820\u003c/sub\u003e kinetics (MR/MRo curves) reflect the state of redox activity of PSI. In the MR/MRo curve, the descending phase (fast-phase) represents the oxidized states of PC and P700 and can be quantified as ∆MRfast/MRo, whereas the rising stage (slow-phase) represents the reduced state in the reaction centers of PC\u003csup\u003e+\u003c/sup\u003e and P700\u003csup\u003e+\u003c/sup\u003e and can be quantified as ΔMRslow/MRo. Figure\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA-B shows the MR/MRo curves of both varieties under salt stress. The MR/MRo curves of both tomato varieties were deformed after S5 and S15 compared with the control. This indicated that fast phase increased and slow phase decreased, particularly after S15. This indicated that salt stress affected the redox ability of PSI in both varieties.Zhongshu No.4 exhibited significant reduction in ∆MRfast/MRo, ∆MRslow/MRo, Vred, and Vox after S5 and S15 (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC\u0026ndash;F). In the salt-tolerant Jinpeng No.3, ∆MRslow/MRo was significantly reduced after S5 and ∆MRslow/MRo, ∆MRslow/MRo, Vred, and Vox were reduced after S5 and S15. Zhongshu No.4 exhibited a higher magnitude of decline in Vred and Vox than Jinpeng No. 3 after S5.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.4 Effect of salt stress on the activities of key enzymes and transcript levels of genes involved in Calvin cycle\u003c/b\u003e \u003c/p\u003e \u003cp\u003eActivities of Rubisco (initial and total), RCA, PGK, FBPase, GAPDH, and FBA reduced under salt stress in both varieties (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e10\u003c/span\u003eA - B). After S5 and S15, the FN samples exhibited 29.8% and 44.7%, 32.9% and 23.4%, 26.6% and 52.1%, 40.0% and 64.0%, 47.8% and 65.3%, 40.8% and 126.5%, and 28.2% and 5.8% decrease and TN samples exhibited 19.3% and 9.0%, 29.8% and 19.3%, 17.4% and 50.7%, 9.5% and 47.9%, 25.3% and 47.6%, 39.2% and 51.6%, and 18.0% and 32.1% decrease compared with their respective controls, respectively. The decreases in the enzyme activities were proportional to the duration of stress and were greater in Zhongshu No.4 than in Jingpeng No.3. The transcript level of RbcL, RbcS, RCA, PGK, GAPDH, FBPase, and FBA genes exhibited the same trend as that of enzyme activities. Salt stress had a greater influence on the transcript level of key genes in Calvin cycle of Zhongshu No.4; thus, the enzyme activity greatly decreased.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Effects of salt stress on sugar metabolism of tomato varieties with varying salt tolerance\u003c/h2\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e3.5.1 Sugar content\u003c/h2\u003e \u003cp\u003eNo significant differences were observed in the contents of glucose, sucrose, fructose, and soluble sugar in both tomato seedlings under control conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e11\u003c/span\u003e). The sugar contents of both tomato varieties gradually increased as the duration of salt-stress treatment increased. They increased more in Jingpeng No.3 than in Zhongshu No.4 during the whole period of salt treatment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section3\"\u003e \u003ch2\u003e3.5.2 Activity of the key enzymes of sucrose metabolism and gene expression\u003c/h2\u003e \u003cp\u003eSalt-stress treatment significantly decreased S-AI and SS-I activities and significantly increased SPS and SS-II activities in both cultivars (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e12\u003c/span\u003e). The activities of SPS and SS-II in Zhongshu No.4 increased by 25.5% and 19.8% after S5 and 32.9% and 31.7% after S15, respectively, whereas the S-AI and SS-I activities decreased by 20.3% and 24.1% after S5 and 18.9% and 39.4% after S15, respectively. The activities of SPS and SS-II in Jingpeng No.3 increased by 50.2% and 26.3% after 5 days and 40.0% and 41.1% after S15, whereas the S-AI and SS-I activities decreased by 17.8% and 27.6% after S5 and 14.2% and 41.0% after S15, respectively. At the same time, \u003cem\u003eSPS\u003c/em\u003e genes were upregulated, and \u003cem\u003eS-AI\u003c/em\u003e and \u003cem\u003eSS\u003c/em\u003e genes were downregulated in both tomato varieties. The magnitude of increase in the SPS activity and gene expression level and SS-II activity was less in Zhongshu No.4 than in Jingpeng No.3 under salt stress. The magnitude of decrease in the activities and gene expression levels of S-AI and SS-I was more in Zhongshu No.4 than in Jingpeng No.3 under salt stress. These results suggested that the high salt-tolerance of Jingpeng No.3 seedlings is because of the promotion of sucrose synthesis and reduction of the irreversible breakdown of sucrose.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eBiomass is a comprehensive reflection of plant growth status and the survival ability of plants under adversity. Photosynthesis is a process of energy production in higher plants. It is one of the plant physiological processes most sensitive to abiotic stresses. Its assessment can reflect the resistance of plants to adversity (Li et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Decreased photosynthetic capacity due to salt stress is related to stomatal and non-stomatal limitation. This study revealed that salt-stress treatment significantly inhibited the growth and decreased Pn of two tomato varieties with varying salt tolerance; however, the extent of inhibition was less in salt-tolerant tomato variety (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). This is consistent with the findings of Li in \u003cem\u003eLycium barbarum\u003c/em\u003e (Li et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Salt stress decreased Gs, Ci, AQY, Fv/Fm, and PI abs and increased Rd in both tomato varieties. The highest decrease was observed in Pn and PI abs, particularly in Zhongshu No.4. Many studies suggested that PI abs is a more sensitive indicator than Fv/Fm. PI abs is a comprehensive indicator of impaired photosynthetic apparatus and photochemical efficiency under adversity. These results indicated that the growth suppression and Pn reduction in both tomato varieties under salt stress are attributed to stomatal and non-stomatal limitations, and the degree of inhibition is closely related to the salt tolerance of varieties.\u003c/p\u003e \u003cp\u003eActivities of donor and acceptor sides are important factors affecting PSII activity in plants; therefore, increasing the primary photochemistry of PSII and protecting the photosynthetic apparatus are helpful in improving salt tolerance in plants. The different phases (O-J, J-I, and I-P) on the OJIP curve reflect three reduction processes of the electrons in the whole electron transport chain. The increase of the O phase indicates that the PSII reaction centers are destroyed or inactivated. The rise in the J phase and increase in V\u003csub\u003eJ\u003c/sub\u003e indicates that the transfer of Q\u003csub\u003eA\u003c/sub\u003e to the secondary electron acceptor (Q\u003csub\u003eB\u003c/sub\u003e) of the PSII is blocked (Guo et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The rise in the I phase and V\u003csub\u003eI\u003c/sub\u003e represents the decrease in the ability of the PQ pools to accept electrons. The decrease of IP amplitude indicates electron flux from PQH2 to the final electron acceptor, as well as reduced final electron acceptor pools in PSI (Zhu et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The appearance of L-band with increased W\u003csub\u003eL\u003c/sub\u003e and ΔW\u003csub\u003eL\u003c/sub\u003e \u0026gt; 0 indicates that the integrity of the thylakoid in chloroplasts is disrupted, resulting in increased dispersion between PSII complexes. The appearance of the K-band with increased Wk and ΔW\u003csub\u003eK\u003c/sub\u003e \u0026gt; 0 reflects the degree of dissociation of the OEC, and damage of the PSII leads to the decreased number of electrons flowing from the PSII donor side. The appearance of K-band in plants after exposure to heat or drought stress is reported to be a marker of OEC damage (Guo and Tan \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In this study, the OJIP curves of both varieties markedly increased J phase and V\u003csub\u003eJ\u003c/sub\u003e and V\u003csub\u003eI\u003c/sub\u003e values and decreased IP amplitude under salt stress. Additionally, the emergence of L-band and K-band was observed, accompanied by an increase in W\u003csub\u003eL\u003c/sub\u003e and W\u003csub\u003eK\u003c/sub\u003e values and ΔW\u003csub\u003eK\u003c/sub\u003e \u0026gt; 0 and ΔW\u003csub\u003eL\u003c/sub\u003e \u0026gt; 0. This indicated that the donor and receptor sides of PSII were the target of salt stress injury. Salt stress resulted in OEC damage in PSII; dispersion between PSII complexes increased, and electron transport capacity and PQ storage capacity of the PSII receptor side decreased. This lead to the partial closure of PSII RCs and decreased PSII activity. Our results are consistent with those of \u0026Ccedil;i\u0026ccedil;ek and Dabrowski on chickpea and ryegrass (\u0026Ccedil;i\u0026ccedil;ek et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Dąbrowski et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). At the same time, the Ψo, φEo, and φRo significantly decreased in both varieties under salt stress, which further indicated that the opening degree of active PSII reaction center and electron transfer from PSII receptor to lateral PSI were blocked by salt stress. Additionally, the decrease of φRo indicated that the blockage of electron transfer from Q\u003csub\u003eB\u003c/sub\u003e to PSI receptor was more serious than that from Q\u003csub\u003eA\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e to Q\u003csub\u003eB\u003c/sub\u003e. These results are consistent with the study on cucumber (Wu et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and on passion fruit (Gaudio Gomes et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). In the present study, the increase of V\u003csub\u003eJ\u003c/sub\u003e, W\u003csub\u003eL\u003c/sub\u003e and W\u003csub\u003eK\u003c/sub\u003e and the decrease of OEC activity, Ψo, φEo and φRo values were higher in Zhongshu No.4 than in Jinpeng No.3. It indicated that salt-tolerant tomato varieties could maintain higher OEC activity and PSII receptor side electron transport capacity, which may be related to higher increase in φDo (Zushi and Matsuzoe \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIncreasing the capacity of PSII to absorb and dissipate energy and maintaining the activity of PSII reaction centers are some strategies used by plants to improve their tolerance under adversity (Zaghdoudi et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). In this study, salt stress reduced TRo/CSo and ETo/CSo but increased DIo/CSo in both tomato cultivars. This indicated that the PSII reaction active center initiates the protection mechanism of the photosynthetic apparatus under salt stress. On the one hand, it protects against excessive accumulation of light energy by reducing PSII absorption of light energy. On the other hand, it reduces the accumulation of excess excitation energy by promoting heat dissipation (Goussi et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In addition, salt stress increased the TRo/RC, ABS/RC, and DIo/RC values of both tomato varieties. This may be attributed to the compensatory reaction after the reduction in the number of active reaction centers per unit leaf area due to salt stress, and the improved efficiency of the remaining active reaction centers facilitates better consumption of the energy in the electron transport chain (Daniel Bordenave et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Jingpeng No.3 could maintain higher activity of photosynthetic system center under salt stress, and the distribution of energy flow was more reasonable than that in Zhongshu No.4.\u003c/p\u003e \u003cp\u003eApart from PSII, PSI also is a site affected by abiotic stress. The decrease in PSI activity under adversity can be attributed to PSI damage, which led to the inability of PSI to efficiently promote electron transfer to the acceptor side and inhibited the oxidation of PSI. In addition, it may be attributed to the blockage of electron transfer from PSII to PSI, which inhibited PSI reduction (Wu et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The descending (fast phase) and ascending (slow phase) parts of the MR/MRo curves represent the oxidative and reductive processes of PC and P700, respectively (Guo et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In this study, the oxidation (decreased ΔMRfast/MR\u003csub\u003eO\u003c/sub\u003e) and re-reduction (decreased ΔMRfast/MR\u003csub\u003eO\u003c/sub\u003e) processes of PSI in Zhongshu No.4 was significantly inhibited after S5. However, only the re-reduction process of PSI in Jingpeng No.3 was significantly inhibited after S5. As the duration of stress increased, the redox process of PSI was significantly inhibited in both tomato varieties (Figs.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e10\u003c/span\u003eA - D). However, the degree of inhibition of PSI redox process and rate was higher in Zhongshu No.4 than in Jingpeng No.3. This indicated that the decrease in PSI activity of Zhongshu No.4 under salt stress can be attributed to PSI damage and blocked electron flow from the PSII receptor side to PSI. However, the decrease in PSI activity of Jinpeng No.3 after S5 was mainly due to the blocking of electron flow from PSII receptor to PSI, whereas the decrease of PSI activity after S5 was due to the damage to PSI and blocking of electron flow transfer from PSII to PSI. The degree of PSI damage and inhibition of electron flow between two photosystems was higher in Zhongshu No.4 than in Jingpeng No.3.\u003c/p\u003e \u003cp\u003ePhotosynthetic light reactions provide the reducing power for carbon assimilation, and the efficiency of CO\u003csub\u003e2\u003c/sub\u003e fixation is closely related to the activity of key enzymes involved at various stages of Calvin cycle. Rubisco is a key enzyme in plant photosynthesis, which controls the fixation efficiency of inorganic carbon and is also a key hub for the conversion of inorganic carbon into organic carbon. Rubisco is catalytically active only in the activated state of RCA activation (Scafaro et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Initial activity of Rubisco is used to reflect the activity of Rubisco enzyme in the active state, whereas total Rubisco activity is used to reflect the activity potential of Rubisco (Zhao et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). RbcL is the large subunit of Rubisco and is the main catalytic site. The small subunit RbcS can produce enough Rubisco content to maintain the photosynthetic carbon assimilation capacity of plants. Abiotic stress affects the expression of RbcS and RbcL, thereby regulating adaptation of plants to stress (Pinheiro and Chaves \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Our study revealed that salt stress significantly reduced the initial and total activities of Rubisco; RCA activity; and transcript levels of \u003cem\u003eRbcL\u003c/em\u003e, \u003cem\u003eRbcS\u003c/em\u003e, and \u003cem\u003eRCA\u003c/em\u003e in tomato seedlings with varying salt tolerance. However, the decrease was greater in Zhongshu No.4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e11\u003c/span\u003e). It indicated that salt stress inhibited the assimilation efficiency of CO\u003csub\u003e2\u003c/sub\u003e by affecting the activity of Rubisco, thus reducing the utilization of assimilation force (NADPH and ATP). Studies have reported that GAPDH and PGK are involved in the regeneration phase of RuBP and play a central role in the Calvin cycle, with activity and transcript levels directly affecting the Calvin cycle (Guan et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Rius et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). FBA and FBPase are involved in RuBP regeneration (Ding et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). (Tamoi et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2006\u003c/span\u003e) reported that increased FBPase activity in transgenic tobacco expressing FBPase gene led to the improvement of photosynthesis and biomass. FBA is involved in glycolysis, cytoplasmic gluconeogenesis, and carbon dioxide fixation, and its expression affects RuBP regeneration (El Sayed et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In our study, the activities and gene transcript levels of GAPDH, PGK, SBPase, FBPase, and FBA were significantly downregulated in both tomato varieties after S5 and S15. Among them, the activities and gene transcript levels of key enzymes involved in the CO\u003csub\u003e2\u003c/sub\u003e fixation and RuBP regeneration stages were decreased to larger extent in Zhongshu No.4. This demonstrated that salt stress decreased the carboxylation efficiency of CO\u003csub\u003e2\u003c/sub\u003e and operation efficiency of the Calvin cycle in tomato seedlings with varying salt tolerance, and the salt-tolerant variety could maintain a higher rate of carbon fixation efficiency.\u003c/p\u003e \u003cp\u003eThe products of photosynthetic carbon assimilation are mainly sugars, including monosaccharides (mainly glucose and fructose), oligosaccharides (mainly sucrose), and polysaccharides (mainly starch). Sucrose and starch are the most common products. Different types of sugars are converted into each other to satisfy the needs of plant growth and development and environmental adaptation. Carbohydrates not only provide energy and solute for osmosis adjustment but also act as regulatory messengers in many metabolic processes involved in the expression of various genes (Naya et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The main form of carbohydrate transport in plants and major component of soluble sugars is sucrose, which is used as an osmotic substance to maintain cellular homeostasis under stress conditions (Lastdrager et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Various key enzymes in sugar metabolism regulate the synthesis, decomposition, and transformation of sucrose. Among them, SS can reversibly decompose sucrose into fructose and UDP-glucose and can also synthesize sucrose under appropriate pH (Lastdrager et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). SPS is the most important enzyme for the synthesis of sucrose from fructose-6-phosphate and UDP-G (Maloney et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). S-AI irreversibly converts sucrose (transported to the liquid cell membrane) into fructose and glucose (Ruan et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). In our study, the accumulation of sucrose in Jingpeng No.3 was caused by the increased activity and transcript level of SPS and increased activity of SS-II. Jingpeng No.3 may increase sucrose synthesis at the metabolic and gene expression levels, leading to increased energy conservation and osmotically regulated cellular metabolism. This conclusion was also reported by (Wu et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), (Wang et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), and (Nemati et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) in cucumber, peach, and wheat, respectively. Plants with salt-tolerant genotypes subjected to salt stress exhibited significantly high content of soluble sugars, including glucose, fructose, and sucrose, compared with salt-sensitive varieties. Thus, the large increase in fructose, glucose, and soluble sugar contents in Jingpeng No.3 may trigger osmoregulation and regulation of intracellular osmotic pressure at the cellular level as strategies for resisting salt stress. Studies have reported that photosynthetic carbon assimilation influences carbohydrate accumulation in plants (Wu et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Interestingly, in our study, salt stress decreased photosynthetic carbon assimilation capacity of both tomato varieties but not carbohydrate accumulation. As an osmotic regulator, carbohydrates can maintain cell osmotic homeostasis, which may be an adaptive self-protection response of plants. However, the specific mechanism should be further explored.\u003c/p\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eIn summary, salt stress inhibited PSII and PSI activities and carbon metabolism in the leaves of two tomato varieties mainly via impairing the donor and acceptor sides of PSII and reaction centers of the two photosystems. It reduced photochemical efficiency of PSII and electron transfer rate of PSI, inhibiting the assimilation and operational efficiency of Calvin cycle and the interconversion of sugars. It ultimately resulted in plant growth inhibition and reduced Pn. The photosynthetic apparatus and carbon metabolism of salt-tolerant Jingpeng No.3 were much more tolerant to salt treatment than salt-sensitive Zhongshu No.4. Jingpeng No.3 could still protect the functions of the photosynthetic reaction center of PSI and PSII to a certain extent under salt stress and maintain high photochemical reaction efficiency, energy utilization efficiency, carbon assimilation efficiency, and sucrose metabolism, thereby reducing the degree of inhibition of growth and photosynthetic capacity under salt stress.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by the earmarked fund for XJARS (XJARS-07), the Major Science and Technology Special Projects of Xinjiang Uygur Autonomous Region (NO. 2022A02005-2), and the National Natural Science Foundation of China (Grant NO. 31860550)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant fnancial or non-fnancial interests to disclose. The data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003eAuthor Contributions\u003c/p\u003e\n\u003cp\u003eThis work was carried out in collaboration between all the authors. Huiying Liu and\u0026nbsp;Huifang Liu\u0026nbsp;defined the research theme and designed the experiment. Xuezhen Li and Yongchao Han performed the experiments and wrote the manuscript. Yundan Cong and Longfei Wang analyzed the data, and interpreted the results, and prepared the figures. Yujie Shi modified the manuscript. All authors reviewed and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be made available on request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAli, A.A.M., Romdhane, W.B., Tarroum, M., Al-Dakhil, M., Al-Doss, A., Alsadon, A.A., et al., (2021). Analysis of salinity tolerance in tomato introgression lines based on morpho-physiological and molecular traits. Plants (Basel). 10.https://doi.org/10.3390/plants10122594\u003c/li\u003e\n\u003cli\u003eBrestic, M., Zivcak, M., Kalaji, H.M., Carpentier, R., Allakhverdiev, S.I., (2012). Photosystem II thermostability in situ: environmentally induced acclimation and genotype-specific reactions in \u003cem\u003eTriticum aestivum\u003c/em\u003e L. Plant Physiol Biochem. 57, 93-105.https://doi.org/10.1016/j.plaphy.2012.05.012\u003c/li\u003e\n\u003cli\u003eBuysse, J., Merckx, R., (1993). An improved colorimetric method to quantify sugar content of plant tissue. J. Exp. Bot. 44, 1627-1629.https://doi.org/10.1093/jxb/44.10.1627\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;i\u0026ccedil;ek, N., Oukarroum, A., Strasser, R.J., Schansker, G., (2018). Salt stress effects on the photosynthetic electron transport chain in two chickpea lines differing in their salt stress tolerance. Photosynth Res. 136, 291-301.https://doi.org/10.1007/s11120-017-0463-y\u003c/li\u003e\n\u003cli\u003eCui, G., Zhang, Y., Zhang, W., Lang, D., Zhang, X., Li, Z., et al., (2019). Response of carbon and nitrogen metabolism and secondary metabolites to drought stress and salt stress in plants. J Plant Biol. 62, 387-399.https://doi.org/10.1007/s12374-019-0257-1\u003c/li\u003e\n\u003cli\u003eDąbrowski, P., Baczewska, A.H., Pawluśkiewicz, B., Paunov, M., Alexantrov, V., Goltsev, V., et al., (2016). Prompt chlorophyll a fluorescence as a rapid tool for diagnostic changes in PSII structure inhibited by salt stress in \u003cem\u003ePerennial ryegrass\u003c/em\u003e. J. Photochem. Photobiol. B. 157, 22-31.https://doi.org/10.1016/j.jphotobiol.2016.02.001\u003c/li\u003e\n\u003cli\u003eDaniel Bordenave, C., Rocco, R., Javier Maiale, S., Campestre, M.P., Adolfo Ruiz, O., Alberto Rodriguez, A., et al., (2019). Chlorophyll \u003cem\u003ea\u003c/em\u003e fluorescence analysis reveals divergent photosystem II responses to saline, alkaline and saline-alkaline stresses in the two\u003cem\u003e Lotus japonicus\u003c/em\u003e model ecotypes MG20 and Gifu-129. Acta Physiol. Plant. 41.https://doi.org/10.1007/s11738-019-2956-0\u003c/li\u003e\n\u003cli\u003eDing, F., Wang, M., Zhang, S., Ai, X., (2016). Changes in SBPase activity influence photosynthetic capacity, growth, and tolerance to chilling stress in transgenic tomato plants. Sci. Rep. 6, 32741.https://doi.org/10.1038/srep32741\u003c/li\u003e\n\u003cli\u003eDogan, M., Tipirdamaz, R., Demir, Y., (2010). Salt resistance of tomato species grown in sand culture. Plant Soil Environ. 56, 499-507.https://doi.org/10.17221/24/2010-pse\u003c/li\u003e\n\u003cli\u003eEl Sayed, A.I., El-Hamahmy, M.A.M., Rafudeen, M.S., Ebrahim, M.K.H., (2019). Exogenous spermidine enhances expression of Calvin cycle genes and photosynthetic efficiency in sweet sorghum seedlings under salt stress. Biol. Plant. 63, 511-518.https://doi.org/10.32615/bp.2019.046\u003c/li\u003e\n\u003cli\u003eElSayed, A.I., Mohamed, A.H., Rafudeen, M.S., Omar, A.A., Awad, M.F., Mansour, E., (2022). Polyamines mitigate the destructive impacts of salinity stress by enhancing photosynthetic capacity, antioxidant defense system and upregulation of calvin cycle-related genes in rapeseed (\u003cem\u003eBrassica napus\u003c/em\u003e L.). Saudi J. Biol. Sci. 29, 3675-3686.https://doi.org/10.1016/j.sjbs.2022.02.053\u003c/li\u003e\n\u003cli\u003eGao, D., Ran, C., Zhang, Y., Wang, X., Lu, S., Geng, Y., et al., (2022). Effect of different concentrations of foliar iron fertilizer on chlorophyll fluorescence characteristics of iron-deficient rice seedlings under saline sodic conditions. Plant Physiol Biochem. 185, 112-122.https://doi.org/10.1016/j.plaphy.2022.05.021\u003c/li\u003e\n\u003cli\u003eGao, J., Li, P., Ma, F., Goltsev, V., (2014). Photosynthetic performance during leaf expansion in \u003cem\u003eMalus micromalus\u003c/em\u003e probed by chlorophyll a fluorescence and modulated 820nm reflection. J. Photochem. Photobiol. B. 137, 144-150.https://doi.org/10.1016/j.jphotobiol.2013.12.005\u003c/li\u003e\n\u003cli\u003eGaudio Gomes, M.T., da Luz, A.C., dos Santos, M.R., Pimentel Batitucci, M.d.C., Silva, D.M., Falqueto, A.R., (2012). Drought tolerance of passion fruit plants assessed by the OJIP chlorophyll \u003cem\u003ea\u003c/em\u003e fluorescence transient. Sci. Hortic. 142, 49-56.https://doi.org/10.1016/j.scienta.2012.04.026\u003c/li\u003e\n\u003cli\u003eGoussi, R., Manaa, A., Derbali, W., Cantamessa, S., Abdelly, C., Barbato, R., (2018). Comparative analysis of salt stress, duration and intensity, on the chloroplast ultrastructure and photosynthetic apparatus in \u003cem\u003eThellungiella salsuginea\u003c/em\u003e. J. Photochem. Photobiol. B. 183, 275-287.https://doi.org/10.1016/j.jphotobiol.2018.04.047\u003c/li\u003e\n\u003cli\u003eGuan, B., Jiang, Y.T., Lin, D.L., Lin, W.H., Xue, H.W., (2022). Phosphatidic acid suppresses autophagy through competitive inhibition by binding GAPC (glyceraldehyde-3-phosphate dehydrogenase) and PGK (phosphoglycerate kinase) proteins. Autophagy. 18, 2656-2670.https://doi.org/10.1080/15548627.2022.2046449\u003c/li\u003e\n\u003cli\u003eGuo, Y., Lu, Y., Goltsev, V., Strasser, R.J., Kalaji, H.M., Wang, H., et al., (2020). Comparative effect of tenuazonic acid, diuron, bentazone, dibromothymoquinone and methyl viologen on the kinetics of Chl a fluorescence rise OJIP and the MR(820) signal. Plant Physiol Biochem. 156, 39-48.https://doi.org/10.1016/j.plaphy.2020.08.044\u003c/li\u003e\n\u003cli\u003eGuo, Y., Tan, J., (2015). Recent advances in the application of chlorophyll a fluorescence from photosystem II. Photochem Photobiol. 91, 1-14.https://doi.org/10.1111/php.12362\u003c/li\u003e\n\u003cli\u003eHu, W., Gao, M., Du, K., Liu, Y., Xu, B., Wang, Y., Zhou, Z., \u0026amp; Zhao, W. (2023). Combined effect of elevated temperature and drought stress on carbohydrate metabolism of cotton (\u003cem\u003eGossypium hirsutum\u003c/em\u003e L.) subtending leaves. Physiol Plant. 175(1), e13866. https://doi.org/10.1111/ppl.13866\u003c/li\u003e\n\u003cli\u003eHuang, L.Y., Li, Z.Z., Liu, Q., Pu, G.B., Zhang, Y.Q., Li, J., (2019). Research on the adaptive mechanism of photosynthetic apparatus under salt stress: New directions to increase crop yield in saline soils. Ann. Appl. Biol. 175, 1-17.https://doi.org/10.1111/aab.12510\u003c/li\u003e\n\u003cli\u003eHubbard, N.L., Huber, S.C., Pharr, D.M., (1989). Sucrose Phosphate Synthase and Acid Invertase as Determinants of Sucrose Concentration in Developing Muskmelon (\u003cem\u003eCucumis melo\u003c/em\u003e L.) Fruits. Plant Physiol. 91, 1527-1534.https://doi.org/10.1104/pp.91.4.1527\u003c/li\u003e\n\u003cli\u003eKalaji, H.M., Jajoo, A., Oukarroum, A., Brestic, M., Zivcak, M., Samborska, I.A., et al., (2016). Chlorophyll \u003cem\u003ea\u003c/em\u003e fluorescence as a tool to monitor physiological status of plants under abiotic stress conditions. Acta Physiol. Plant. 38.https://doi.org/10.1007/s11738-016-2113-y\u003c/li\u003e\n\u003cli\u003eLastdrager, J., Hanson, J., Smeekens, S., (2014). Sugar signals and the control of plant growth and development. J Exp Bot. 65, 799-807.https://doi.org/10.1093/jxb/ert474\u003c/li\u003e\n\u003cli\u003eLi, H., Chang, J., Chen, H., Wang, Z., Gu, X., Wei, C., et al., (2017). Exogenous Melatonin Confers Salt Stress Tolerance to Watermelon by Improving Photosynthesis and Redox Homeostasis. Front Plant Sci. 8, 295.https://doi.org/10.3389/fpls.2017.00295\u003c/li\u003e\n\u003cli\u003eLi, W., Rao, S., Du, C., Liu, L., Dai, G., Chen, J., (2022). Strategies used by two goji species, \u003cem\u003eLycium ruthenicum\u003c/em\u003e and \u003cem\u003eLycium barbarum\u003c/em\u003e, to defend against salt stress. Sci. Hortic. 306, 111430.https://doi.org/https://doi.org/10.1016/j.scienta.2022.111430\u003c/li\u003e\n\u003cli\u003eLi, X.G., Wang, X.M., Meng, Q.W., Zou, Q., (2004). Factors limiting photosynthetic recovery in sweet pepper leaves after short-term chilling stress under low irradiance. Photosynthetica. 42, 257-262.https://doi.org/10.1023/B:PHOT.0000040598.48732.af\u003c/li\u003e\n\u003cli\u003eLilley, R.M., Walker, D.A., (1974). An improved spectrophotometric assay for ribulosebisphosphate carboxylase. Biochim Biophys Acta. 358, 226-229.https://doi.org/10.1016/0005-2744(74)90274-5\u003c/li\u003e\n\u003cli\u003eLiu, Y., Gong, C., Pei, W., Fan, K., Shen, W., (2023). Chlorophyll a fluorescence as a tool to monitor physiological status in the leaves of \u003cem\u003eArtemisia ordosica\u003c/em\u003e under root cutting conditions. Front Plant Sci. 14, 1308209.https://doi.org/10.3389/fpls.2023.1308209\u003c/li\u003e\n\u003cli\u003eLivak, K.J., Schmittgen, T.D., (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2\u003csup\u003e-\u0026Delta;\u0026Delta;T\u003c/sup\u003e method. Methods. 25, 402-408.https://doi.org/10.1006/meth.2001.1262\u003c/li\u003e\n\u003cli\u003eLowell, C.A., Tomlinson, P.T., Koch, K.E., (1989). Sucrose-metabolizing enzymes in transport tissues and adjacent sink structures in developing citrus fruit. Plant Physiol. 90, 1394-1402.https://doi.org/10.1104/pp.90.4.1394\u003c/li\u003e\n\u003cli\u003eMaloney, V.J., Park, J.Y., Unda, F., Mansfield, S.D., (2015). Sucrose phosphate synthase and sucrose phosphate phosphatase interact in planta and promote plant growth and biomass accumulation. J Exp Bot. 66, 4383-4394.https://doi.org/10.1093/jxb/erv101\u003c/li\u003e\n\u003cli\u003eMunns, R., Gilliham, M., (2015). Salinity tolerance of crops - what is the cost? New Phytol. 208, 668-673.https://doi.org/10.1111/nph.13519\u003c/li\u003e\n\u003cli\u003eNaya, L., Ladrera, R., Ramos, J., Gonz\u0026aacute;lez, E. M., Arrese-Igor, C., Minchin, F. R., \u0026amp; Becana, M. (2007). The response of carbon metabolism and antioxidant defenses of alfalfa nodules to drought stress and to the subsequent recovery of plants. Plant Physiol. 144(2), 1104\u0026ndash;1114. https://doi.org/10.1104/pp.107.099648\u003c/li\u003e\n\u003cli\u003eNemati, F., Ghanati, F., Gavlighi, H.A., Sharifi, M., (2018). Comparison of sucrose metabolism in wheat seedlings during drought stress and subsequent recovery. Biol. Plant. 62, 595-599.https://doi.org/10.1007/s10535-018-0792-5\u003c/li\u003e\n\u003cli\u003eOukarroum, A., Goltsev, V., Strasser, R.J., (2013). Temperature effects on pea plants probed by simultaneous measurements of the kinetics of prompt fluorescence, delayed fluorescence and modulated 820 nm reflection. PLoS One. 8, e59433.https://doi.org/10.1371/journal.pone.0059433\u003c/li\u003e\n\u003cli\u003ePeng, J., Liu, J., Zhang, L., Luo, J., Dong, H., Ma, Y., et al., (2016). Effects of soil salinity on sucrose metabolism in Cotton Leaves. PLoS One. 11, e0156241.https://doi.org/10.1371/journal.pone.0156241\u003c/li\u003e\n\u003cli\u003ePinheiro, C., Chaves, M.M., (2011). Photosynthesis and drought: can we make metabolic connections from available data? J Exp Bot. 62, 869-882.https://doi.org/10.1093/jxb/erq340\u003c/li\u003e\n\u003cli\u003eRius, S.P., Casati, P., Iglesias, A.A., Gomez-Casati, D.F., (2006). Characterization of an \u003cem\u003eArabidopsis thaliana\u003c/em\u003e mutant lacking a cytosolic non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase. Plant Mol Biol. 61, 945-957.https://doi.org/10.1007/s11103-006-0060-5\u003c/li\u003e\n\u003cli\u003eRuan, Y.L., (2014). Sucrose metabolism: gateway to diverse carbon use and sugar signaling. Annu. Rev. Plant Biol. 65, 33-67.https://doi.org/10.1146/annurev-arplant-050213-040251\u003c/li\u003e\n\u003cli\u003eRuan, Y.L., Jin, Y., Yang, Y.J., Li, G.J., Boyer, J.S., (2010). Sugar input, metabolism, and signaling mediated by invertase: roles in development, yield potential, and response to drought and heat. Mol Plant. 3, 942-955.https://doi.org/10.1093/mp/ssq044\u003c/li\u003e\n\u003cli\u003eScafaro, A.P., Yamori, W., Carmo-Silva, A.E., Salvucci, M.E., von Caemmerer, S., Atwell, B.J., (2012). Rubisco activity is associated with photosynthetic thermotolerance in a wild rice (\u003cem\u003eOryza meridionalis\u003c/em\u003e). Physiol Plant. 146, 99-109.https://doi.org/10.1111/j.1399-3054.2012.01597.x\u003c/li\u003e\n\u003cli\u003eShu, S., Chen, L., Lu, W., Sun, J., Guo, S., Yuan, Y., et al., (2014). Effects of exogenous spermidine on photosynthetic capacity and expression of Calvin cycle genes in salt-stressed cucumber seedlings. J Plant Res. 127, 763-773.https://doi.org/10.1007/s10265-014-0653-z\u003c/li\u003e\n\u003cli\u003eTamoi, M., Nagaoka, M., Miyagawa, Y., Shigeoka, S., (2006). Contribution of fructose-1,6-bisphosphatase and sedoheptulose-1,7-bisphosphatase to the photosynthetic rate and carbon flow in the Calvin cycle in transgenic plants. Plant Cell Physiol. 47, 380-390.https://doi.org/10.1093/pcp/pcj004\u003c/li\u003e\n\u003cli\u003eTounekti, T., Vadel, A.M., O\u0026ntilde;ate, M., Khemira, H., Munn\u0026eacute;-Bosch, S., (2011). Salt-induced oxidative stress in rosemary plants: Damage or protection? Environ. Exp. Bot. 71, 298-305.https://doi.org/10.1016/j.envexpbot.2010.12.016\u003c/li\u003e\n\u003cli\u003eWang, K., Shao, X., Gong, Y., Zhu, Y., Wang, H., Zhang, X., et al., (2013). The metabolism of soluble carbohydrates related to chilling injury in peach fruit exposed to cold stress. Postharvest Biol. Technol. 86, 53-61.https://doi.org/10.1016/j.postharvbio.2013.06.020\u003c/li\u003e\n\u003cli\u003eWu, P., Ma, Y., Ahammed, G.J., Hao, B., Chen, J., Wan, W., et al., (2022). Insights into melatonin-induced photosynthetic electron transport under low-temperature stress in cucumber. Front Plant Sci. 13, 1029854.https://doi.org/10.3389/fpls.2022.1029854\u003c/li\u003e\n\u003cli\u003eWu, P., Xiao, C., Cui, J., Hao, B., Zhang, W., Yang, Z., et al., (2021). Nitric Oxide and Its Interaction with Hydrogen Peroxide Enhance Plant Tolerance to Low Temperatures by Improving the Efficiency of the Calvin Cycle and the Ascorbate-Glutathione Cycle in Cucumber Seedlings. J. Plant Growth Regul. 40, 2390-2408.https://doi.org/10.1007/s00344-020-10242-w\u003c/li\u003e\n\u003cli\u003eYan, F., Zhang, J., Li, W., Ding, Y., Zhong, Q., Xu, X., et al., (2021). Exogenous melatonin alleviates salt stress by improving leaf photosynthesis in rice seedlings. Plant Physiol Biochem. 163, 367-375.https://doi.org/10.1016/j.plaphy.2021.03.058\u003c/li\u003e\n\u003cli\u003eYan, K., Chen, P., Shao, H., Zhao, S., Zhang, L., Zhang, L., et al., (2012). Responses of Photosynthesis and Photosystem II to Higher Temperature and Salt Stress in\u003cem\u003e Sorghum\u003c/em\u003e. J Agron Crop Sci. 198, 218-226.https://doi.org/10.1111/j.1439-037X.2011.00498.x\u003c/li\u003e\n\u003cli\u003eYan, K., Wu, C., Zhang, L., Chen, X., (2015). Contrasting photosynthesis and photoinhibition in tetraploid and its autodiploid honeysuckle (\u003cem\u003eLonicera japonica \u003c/em\u003eThunb.) under salt stress. Front Plant Sci. 6, 227.https://doi.org/10.3389/fpls.2015.00227\u003c/li\u003e\n\u003cli\u003eYang, Z., Li, J.-L., Liu, L.-N., Xie, Q., Sui, N., (2020). Photosynthetic regulation under salt stress and salt-tolerance mechanism of sweet sorghum. Front Plant Sci. 10.https://doi.org/10.3389/fpls.2019.01722\u003c/li\u003e\n\u003cli\u003eZaghdoudi, M., Msilini, N., Govindachary, S., Lacha\u0026acirc;l, M., Ouerghi, Z., Carpentier, R., (2011). Inhibition of photosystems I and II activities in salt stress-exposed Fenugreek (\u003cem\u003eTrigonella foenum graecum\u003c/em\u003e). J. Photochem. Photobiol. B. 105, 14-20.https://doi.org/10.1016/j.jphotobiol.2011.06.005\u003c/li\u003e\n\u003cli\u003eZhang, X., Feng, Y., Jing, T., Liu, X., Ai, X., Bi, H., (2021). Melatonin Promotes the Chilling Tolerance of Cucumber Seedlings by Regulating Antioxidant System and Relieving Photoinhibition. Front Plant Sci. 12, 789617.https://doi.org/10.3389/fpls.2021.789617\u003c/li\u003e\n\u003cli\u003eZhao, H., Zhang, Z., Zhang, Y., Bai, L., Hu, X., Li, X., et al., (2022). Melatonin reduces photoinhibition in cucumber during chilling by regulating the Calvin-Benson Cycle. Sci. Hortic. 299, 111007.https://doi.org/https://doi.org/10.1016/j.scienta.2022.111007\u003c/li\u003e\n\u003cli\u003eZhu, X., Liu, S., Sun, L., Song, F., Liu, F., Li, X., (2018). Cold tolerance of photosynthetic electron transport system is enhanced in wheat plants grown under elevated CO\u003csub\u003e2\u003c/sub\u003e. Front Plant Sci. 9, 933.https://doi.org/10.3389/fpls.2018.00933\u003c/li\u003e\n\u003cli\u003eZhu, Y., Guo, J., Feng, R., Jia, J., Han, W., Gong, H., (2016). The regulatory role of silicon on carbohydrate metabolism in \u003cem\u003eCucumis sativus\u003c/em\u003e L. under salt stress. Plant Soil. 406, 231-249.https://doi.org/10.1007/s11104-016-2877-2\u003c/li\u003e\n\u003cli\u003eZushi, K., Matsuzoe, N., (2017). Using of chlorophyll a fluorescence OJIP transients for sensing salt stress in the leaves and fruits of tomato. Sci. Hortic. 219, 216-221.https://doi.org/https://doi.org/10.1016/j.scienta.2017.03.016\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"plant-and-soil","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"plso","sideBox":"Learn more about [Plant and Soil](https://www.springer.com/journal/11104)","snPcode":"11104","submissionUrl":"https://submission.nature.com/new-submission/11104/3","title":"Plant and Soil","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"tomato, salt stress, Chlorophyll a fluorescence rise kinetics, 820 nm reflection Signal, carbon metabolism","lastPublishedDoi":"10.21203/rs.3.rs-4600225/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4600225/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eSoil salinization severely affects plant photosynthesis and reduces crop yield and quality. Therefore, we investigated the structure and function of photosystem I (PSI) and photosystem II (PSII) of tomato seedlings [Zhongshu No.4 (salt-sensitive) and Jinpeng No.3 (salt-tolerant)] after salt stress treatment were analyzed using rapid chlorophyll fluorescence kinetics and 820-nm transmission kinetics. Moreover, the activity and transcript level of enzymes related to Calvin cycle and sucrose metabolism were investigated.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe structure and function of PSI and PSII were suppressed in both tomato varieties under salt stress as evidenced by Electron transfer chains are inhibited from transferring electrons, photosynthetic reaction centers are damaged, and energy flow distribution is disrupted. In addition, salt stress significantly inhibited the carbon assimilation efficiency of both tomato varieties as indicated by decrease in the activities of Rubisco (initial and total), RCA, PGK, FBPase, GAPDH, and FBA and transcript level and promoted sugar accumulation. Compared with salt-sensitive Zhongshu No.4, the photosynthetic apparatus and carbon metabolism of salt-resistant Jingpeng No.3 were much more tolerant to salt treatment.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eJingpeng No.3 had a higher electron transfer efficiency. The donor side and acceptor side of PSII, the integrity of the thylakoid, and the oxidized and redox state of PSI were less inhibited by salt stress. Meanwhile, the activation of photosynthetic protection mechanism increased the utilization of energy for photochemical reactions, decreased the excitation pressure of RC and led to a smoother energy flow. Improved carbon assimilation efficiency and sucrose metabolism efficiency. Therefore, Jinpeng No.3 has salt tolerance.\u003c/p\u003e","manuscriptTitle":"Salt-induced changes in the photosynthetic apparatus and carbon metabolism of two tomato cultivars with varying salt tolerance","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-09 16:15:29","doi":"10.21203/rs.3.rs-4600225/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revisions","date":"2024-09-26T04:30:01+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-06-23T13:16:26+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-19T22:26:40+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"Plant and Soil","date":"2024-06-19T21:26:05+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-19T13:12:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant and Soil","date":"2024-06-18T09:09:31+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"plant-and-soil","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"plso","sideBox":"Learn more about [Plant and Soil](https://www.springer.com/journal/11104)","snPcode":"11104","submissionUrl":"https://submission.nature.com/new-submission/11104/3","title":"Plant and Soil","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6f7f1150-5a3a-45c7-b981-3b711b1c6e31","owner":[],"postedDate":"July 9th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-10-06T16:01:26+00:00","versionOfRecord":{"articleIdentity":"rs-4600225","link":"https://doi.org/10.1007/s11104-025-07810-y","journal":{"identity":"plant-and-soil","isVorOnly":false,"title":"Plant and Soil"},"publishedOn":"2025-10-01 15:56:57","publishedOnDateReadable":"October 1st, 2025"},"versionCreatedAt":"2024-07-09 16:15:29","video":"","vorDoi":"10.1007/s11104-025-07810-y","vorDoiUrl":"https://doi.org/10.1007/s11104-025-07810-y","workflowStages":[]},"version":"v1","identity":"rs-4600225","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4600225","identity":"rs-4600225","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}