Antioxidant and Anticancer Effects of Alchemilla vulgaris Extract on Medullary Thyroid Carcinoma Cells

Antioxidant and Anticancer Effects of Alchemilla vulgaris Extract on Medullary Thyroid Carcinoma Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF correspondence Antioxidant and Anticancer Effects of Alchemilla vulgaris Extract on Medullary Thyroid Carcinoma Cells Merve Dolunay UYANIK, Gonul Zisan ONCEL, Sakir AKGUN This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7646704/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract This study examined the antioxidant and anticancer properties of the ethyl acetate extract of Alchemilla vulgaris L. ( A. vulgaris ) against medullary thyroid carcinoma (MTC-TT) cells. Antioxidant activity was measured through assays of total antioxidant capacity, phenolic content, and reducing power. Cytotoxicity, apoptosis, proliferation, and migration were evaluated using MTT, TUNEL, colony formation, and wound-healing assays. Gene expression of CDKN1A, BAX, BCL-2, MMP2 , and MMP9 was analyzed by RT-PCR. The extract showed strong antioxidant potential with high phenolic levels and notable reducing activity. Treatment of MTC-TT cells led to reduced viability in a time- and dose-dependent manner, with increased apoptosis, BAX induction, BCL-2 repression, and elevation of CDKN1A expression over time. Colony formation was significantly decreased, and wound healing assays confirmed reduced migration, which was consistent with transient downregulation of MMP2 and MMP9 . Selectivity was evident, as IC₅₀ values were substantially higher in WI-38 normal fibroblasts compared to tumor cells. These findings suggest that A. vulgaris ethyl acetate extract exerts anticancer activity by influencing apoptosis, cell growth, and migration. Its phenolic richness and robust antioxidant profile highlight the extract as a promising nutraceutical candidate for further in vivo research in aggressive and treatment-resistant cancers such as MTC. A. vulgaris antioxidant medullary thyroid carcinoma apoptosis antiproliferative migration Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The International Agency for Research on Cancer (IARC) reported that in 2022, approximately 20 million new cancer cases and 9.7 million cancer deaths occurred worldwide, confirming cancer as a persistent global health problem. Thyroid cancer, the most frequent endocrine malignancy, has shown a marked increase in incidence over recent decades, with distinct variations across regions [ 1 , 2 ]. Hazard and co-workers identified medullary thyroid carcinoma (MTC) as a separate pathological type in 1959 [ 3 ]. This uncommon but aggressive cancer originates from parafollicular C cells that produce calcitonin and accounts for about 5% of thyroid cancers [ 4 ]. It is characterized by a high tendency to spread to cervical and regional lymph nodes, and distant organ involvement is also common, factors that largely account for its unfavorable prognosis [ 5 ]. Management of localized medullary thyroid carcinoma generally requires total thyroidectomy in combination with central compartment dissection and, in many cases, lateral neck node dissection [ 6 , 7 ]. Because parafollicular C cells cannot uptake radioactive iodine, radioiodine therapy is not effective in MTC, and traditional chemotherapeutic regimens show only modest benefit while being associated with substantial toxicity [ 8 ]. Evidence indicates that plant-derived secondary metabolites interact with a wide range of molecular targets. Their antineoplastic activity involves several processes, including the mitigation of oxidative stress [ 9 , 10 ], modulating cellular signaling pathways [ 11 , 12 ], and remodeling of the tumor microenvironment [ 13 – 15 ]. The use of A. vulgaris in folk medicine, particularly for gynecological ailments, is well documented [ 16 ]. The plant is rich in polyphenols and has been reported to exert anti-inflammatory [ 17 ], antioxidant [ 18 ], antiviral [ 19 ], and wound-healing [ 20 ] activities. Native to Europe and Central Asia, the species also grows abundantly in the highlands of Turkey [ 21 ]. Its extracts, depending on the solvent used, contain diverse bioactive compounds such as flavonoids, flavonol glycosides, phenolic acids, and ellagitannins [ 21 , 22 ], these compounds not only mitigate oxidative stress and suppress inflammation [ 23 , 24 ], but also display cytotoxic, antiproliferative, anti-invasive, and apoptosis-inducing properties in various cancer cell lines, including breast, colon, ovarian, cervical, melanoma, and neuroblastoma [ 21 , 25 – 28 ]. In addition to their antioxidant effects, the polyphenolic constituents of A. vulgaris may exhibit context-dependent pro-oxidant activity in cancer cells with enhanced metabolic activity, thereby promoting cell death through oxidative stress–mediated mechanisms [ 29 , 30 ]. Although the antioxidant properties of A. vulgaris are well documented, little is known about its activity in tumor types with limited therapeutic options, such as medullary thyroid carcinoma. Exploring these effects could provide valuable insights into its underlying mechanisms and contribute to the identification of nutraceutical candidates with potential clinical relevance. On this basis, the current study aimed to assess the in vitro antioxidant capacity of the ethyl acetate extract of A. vulgaris and to investigate its cytotoxic, antiproliferative, pro-apoptotic, and anti-migratory effects in MTC-TT cells. Material and Methods Ethical Statement Ethical approval for this research was obtained from the Kafkas University Faculty of Medicine Ethics Committee on 27 March 2024 (Approval number: 2024/401). Chemicals Reagents of analytical grade were used throughout the study. For antioxidant assays, thiocyanate, Folin–Ciocalteu reagent, sodium carbonate, ferricyanide, trichloroacetic acid, and ferric chloride were obtained from Sigma-Aldrich (St. Louis, MO, USA). For cell culture, RPMI-1640 medium (Thermo Fisher Gibco, Cat. No. 21875-034), fetal bovine serum (Capricorn Scientific, Cat. No. FBS-11A), and penicillin–streptomycin (Thermo Fisher Gibco, Cat. No. 15140-122) were used. The MTT kit (Beyotime Biotechnology, Cat. No: ST1537) and doxorubicin (Sigma-Aldrich, Cat. No: D9542) were applied in the relevant assays. Plant material and extraction Aerial parts of Alchemilla vulgaris were obtained from a commercial source (Kayalar Spice Seed Food Company, Ankara, Turkey; registration no: TR-06-K-009592). The plant material was ground, then extracted with ethyl acetate using a Soxhlet apparatus at 50 °C for 48 h. The solvent was removed under reduced pressure, and the crude extract was lyophilized (5 mmHg). A stock solution (100 mg/mL) was prepared in DMSO, filtered through 0.22 µm syringe filters, and kept at −20 °C until required. Determination of Total Antioxidant Activity (TAA) of the Extract TAA was evaluated by the thiocyanate method using a linoleic acid emulsion, according to Mitsuda et al. [31]. Extract solutions (1–10 mg/mL) were prepared in KH₂PO₄ buffer (0.2 M, pH 7.0) with linoleic acid and incubated at 37 °C. Every 12 h, ethanol, ammonium thiocyanate, and FeCl₂ were added. The absorbance at 500 nm was recorded, where lower values corresponded to more potent antioxidant activity. Ascorbic acid and trolox were used as reference antioxidants. Determination of Total Phenolic Compound Content (TPC) The phenolic content of the extract was quantified with the Folin–Ciocalteu method [32]. Briefly, 0.25 mg of dried extract was dissolved in 0.25 mL ethyl acetate and reacted with 1.25 mL Folin–Ciocalteu reagent. After 5 min of incubation at 30 °C, 2 mL of 7.5% Na₂CO₃ was added, and the mixture was kept at 30 °C for 90 min. Absorbance was measured at 765 nm. Results were obtained from a standard curve of gallic acid (0–200 µg/mL) and reported as mg gallic acid equivalents (GAE) per g of extract. Determination of the Reducing Power of the Extract (RP) Reducing power was analyzed using the potassium ferricyanide method [33]. In this assay, 0.5 mg of extract in 0.5 mL ethyl acetate was mixed with phosphate buffer (0.02 M, pH 6.6) and 1% K₃[Fe(CN)₆], and incubated at 50 °C for 30 min. After treatment with 10% trichloroacetic acid and centrifugation at 3000 rpm for 10 min, the supernatant was combined with distilled water and 0.1% FeCl₃. The absorbance at 700 nm was recorded, where higher values corresponded to greater reducing potential. Cell Lines and Cell Culture MTC-TT cells (ATCC CRL-1803) and WI-38 fibroblasts (ATCC CCL-75) were obtained from the American Type Culture Collection (Manassas, VA, USA). They were grown in RPMI-1640 medium with 10% fetal bovine serum and 1% penicillin–streptomycin at 37 °C in a CO₂ incubator (5% CO₂, humidified). MTT Cell Viability Assay The MTT assay (Beyotime, Cat. No: ST1537) was applied to measure viability in MTC-TT and WI-38 cells. Cells were seeded in 96-well plates (7 × 10³/well) and cultured for 24 h before treatment with the extract (5–50 µg/mL for MTC-TT; 10–100 µg/mL for WI-38) for 24, 48, or 72 h. MTT reagent was added for four hours, after which the formazan crystals were dissolved with SDS–HCl. Absorbance readings were taken at 570 nm, using 690 nm as a reference. Cell viability (%) was calculated against untreated control values. IC₅₀ values were obtained using nonlinear regression with GraphPad Prism 8.0.2, and the selectivity index (SI) was expressed as the ratio of IC₅₀ normal to IC₅₀ cancer. TUNEL Assay Apoptosis was evaluated with the Elabscience® One-step TUNEL In Situ Green Apoptosis Kit (Cat. No: E-CK-A321, Elabscience). MTC-TT cells (1 × 10⁴/well) were treated with the IC₅₀ dose of the extract for 48 and 72 h. Groups included untreated control, DNase I-treated positive control, enzyme-free control, and extract-treated cells. After fixation in 4% paraformaldehyde, TUNEL labeling was performed following the kit protocol. Nuclei were counterstained with DAPI, and fluorescence was observed using an EVOS™ FL Color Imaging System under transmitted light, DAPI, and GFP channels. Apoptotic cells were counted in random fields based on green fluorescence. Colony Formation Assay For the colony formation assay, 1 × 10³ MTC-TT cells were seeded in 6-well plates. Three conditions were used: untreated control, 1% DMSO control, and extract at IC₅₀ for 24, 48, or 72 h. Plates were incubated for 12 days, with medium refreshed every 2–3 days. Colonies were fixed with 4% formaldehyde and stained using 1% crystal violet. Colonies of 50 cells or more were counted under a microscope, and ImageJ v1.53a (NIH, Bethesda, MD, USA) was used for quantification. Wound Healing Assay Cell migration was assessed using a wound-healing assay. Confluent monolayers of MTC-TT cells were wounded using a sterile 10 µL pipette tip, and detached cells were gently removed by washing with PBS. Treatments were applied at IC₅₀ concentrations of the extract, while control wells received only culture medium. Images were taken at 0, 24, 48, and 72 h from predefined positions using constant magnification. Wound closure was calculated relative to the initial wound size using ImageJ software and expressed as percentage closure. Gene Expression Analysis For gene expression analysis, MTC-TT cells (1.5 × 10⁵/well) were treated with the extract (IC₅₀) for 48 or 72 h. RNA was isolated using TRI Reagent™ (MRC, Cat. No. TR118), and the concentration and purity were checked using a NanoDrop™ spectrophotometer (Thermo Fisher Scientific, USA). cDNA was prepared with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA). Real-time PCR was performed on a StepOnePlus instrument (Applied Biosystems) using SYBR Green Master Mix (Enzo Life Sciences, USA). Target genes included CDKN1A (p21), BAX, BCL-2, MMP2 , and MMP9 , with β -actin as the reference. Primer details are listed in Table 1. Expression levels were determined by the 2−ΔΔCt approach. Statistical Analyses All experiments were repeated three times. Data are reported as mean values with standard deviations (SD). One-way ANOVA with Duncan’s post hoc test was used for TAA, TPC, and RP analyses. MTT, colony formation, and wound healing results were analyzed with two-way ANOVA and Tukey’s post hoc test. Student’s t-test was applied for gene expression analysis. Differences with p < 0.05, p < 0.01, and p < 0.001 were considered statistically significant. Results and Discussion In-vitro Antioxidant Capacity of Alchemilla Vulgaris Ethyl Acetate Extract Across the tested concentration range (1–10 mg/mL), AVEA exhibited an apparent dose-dependent increase in total antioxidant activity (TAA, ferric–thiocyanate method; 60 h, 500 nm), reducing power (RP; 700 nm), and total phenolic content (TPC). Specifically, TAA inhibition rose from 75.8% at 1 mg/mL to 85.3% at 10 mg/mL, while the corresponding absorbance decreased from 0.844 ± 0.006 to 0.513 ± 0.003 (lower absorbance reflecting higher inhibition in this assay). RP increased from 0.066 ± 0.006 to 1.298 ± 0.003, and TPC increased from 16.81 ± 0.053 to 26.49 ± 0.050 mg GAE/g lyophilizate (Table 2). The positive controls behaved as expected (e.g., Trolox 1 mg/mL: 82.1% inhibition). The parallel rise in TPC with both TAA and RP indicates that phenolic enrichment accounts for much of the antioxidant capacity observed in AVEA, aligning with prior reports that link phenolic abundance to stronger radical-scavenging and electron-donating properties in A. vulgaris and related botanicals [21, 26, 34, 35]. Polyphenols can quench radicals through hydrogen/electron donation, and may, to a limited extent, modulate redox-sensitive signaling pathways (e.g., NF-κB, Nrf2) [36, 37]. Consistent with solvent-polarity effects, ethyl acetate extraction frequently yields fractions enriched in mid-polarity phenolics that track with higher RP and TAA metrics [21, 26]. These findings confirm a significant dose–response relationship in the antioxidant properties of the ethyl acetate extract of A. vulgaris, indicating that phenolic compounds play a significant role in this activity (Table 2). In vitro Anticancer Properties of A. vulgaris Extract Effect on Cell Viability MTT assay results demonstrated a pronounced dose- and time-dependent reduction in cell viability in the medullary thyroid carcinoma cell line (MTC-TT) following treatment with the ethyl acetate extract of A. vulgaris (AVEA) (Figure 1). The IC₅₀ values were calculated as 43.6 µg/mL at 24 h, 40.9 µg/mL at 48 h, and 18.9 µg/mL at 72 h ( p < 0.005). In contrast, cytotoxicity was less pronounced in the non-malignant WI-38 fibroblast line, with IC₅₀ values of 78.3, 74.9, and 72.3 µg/mL at the corresponding time points (Figure 2). The resulting selectivity indices (SI; WI-38/MTC-TT) of 1.80, 1.83, and 3.83 indicate that the extract preferentially targets tumor cells, particularly after 72 h of exposure. These findings are consistent with previous reports showing that A. vulgaris extracts prepared with different solvents exert cytotoxic effects across a range of cancer cell types. For example, the ethyl acetate fraction exhibited the lowest IC₅₀ value (18.7 µg/mL) in PC-3 prostate cancer cells, highlighting its tumor-selective profile [21]. Similarly, in breast (MDA-MB-231), bladder (T24), and lung (A549) cancer cells, treatment with 1 mg/mL extract for 72 h reduced viability by 75%, 62.9%, and 45.5%, respectively, underscoring the role of phenolic compounds in mediating cytotoxicity [35]. Ethanol extracts of A. vulgaris also induced dose-dependent cytotoxicity in A549 and HCT116 cells with IC₅₀ values of approximately 36 µg/mL [26], nd high tumor selectivity was observed in 4T1 and human breast cancer cells after 72 h of treatment [27]. In addition, investigations on melanoma have demonstrated that the extract produces a pronounced loss of viability in highly invasive B16F10 cells. In contrast, the effect is more limited in the less aggressive B16F1 subline, suggesting that cellular invasiveness may influence sensitivity to treatment [28]. Consistently, the ethyl acetate fraction exhibited potent cytotoxic activity in SH-SY5Y neuroblastoma cells, with an IC₅₀ value of 12.29 µg/mL [38]. In contrast, the methanol/water extract displayed only moderate effects in PC-3, MCF-7, and Caco-2 cells (IC₅₀: 88.6–110.5 µg/mL), yet demonstrated notable selectivity toward PC-3 cells, as indicated by a high SI value of 6.7 [25]. Furthermore, the extract's dose-dependent bidirectional effects were demonstrated by noting that viability was maintained at high concentrations in healthy human lymphocytes, while significant decreases were observed at low concentrations [39]. The time-dependent increase in cytotoxicity and SI values observed in our study may be linked to the so-called “antioxidant paradox.” In cancer cells, elevated metabolic activity and increased intracellular Fe²⁺/Fe³⁺ and Cu²⁺ ion levels facilitate redox cycling of flavonoids. Catechol-type structures in the B ring of flavonoids can reduce these metal ions, which subsequently react with intracellular H₂O₂ to generate highly reactive hydroxyl radicals. This pro-oxidant effect may trigger oxidative stress–related cell death pathways, including apoptosis, necrosis, or ferroptosis [29]. Thus, the phenolic richness of A. vulgaris ethyl acetate extract likely contributes not only to its antioxidant potential but also to its pro-oxidant cytotoxic effects, selectively enhancing its activity against cancer cells. Apoptotic Effect To investigate whether the reduction in cell viability was associated with apoptosis, TUNEL staining was performed at 48 and 72 h (Figures 3 and 4). In MTC-TT cells treated with the IC₅₀ dose of the ethyl acetate extract, the total cell number at 48 h was 225.0 ± 10.0 (n = 3), with 13.0 ± 4.0 apoptotic cells, corresponding to an apoptotic index of 5.8%. At 72 h, the total cell number declined to 53.0 ± 6.0, while the number of apoptotic cells increased to 16.0 ± 4.0, yielding an apoptotic rate of 30.2% ( p = 0.0029). These findings indicate a time-dependent increase in apoptosis, confirming the pro-apoptotic activity of the extract. Consistent with these morphological data, gene expression analysis revealed a marked upregulation of the pro-apoptotic BAX gene and downregulation of the anti-apoptotic BCL-2 gene (Figure 5). After 48 h of treatment, BAX expression increased 2.01 ± 0.06-fold ( p < 0.0001), whereas BCL-2 expression decreased to 0.22 ± 0.004-fold ( p < 0.0001) relative to the control. At 72 h, BAX expression further increased (2.65 ± 0.09-fold, p < 0.0001), while BCL-2 expression remained strongly suppressed (0.24 ± 0.03-fold, p < 0.0001). These results are consistent with previous studies that have reported apoptosis induction by A. vulgaris extracts in various tumor models. For example, ethanol extracts induced both early and late apoptosis in lung cancer cells after 72 hours [26]. In melanoma, a stronger apoptotic response was observed in the highly invasive B16F10 line than in the less aggressive B16F1 line, although caspase activation remained limited [28]. Similarly, in 4T1 breast cancer cells, exposure to the extract induced early apoptosis in the majority of cells, accompanied by only mild caspase activation [27]. In PC-3 prostate cancer cells, increased apoptosis correlated with elevated BAX and reduced BCL-2 expression [25]. Comparable findings were also obtained in MTC-TT cells treated with ferulic acid, which upregulated BAX while downregulating BCL-2 [40], and with boric acid, which was shown to modulate Bcl-2 family members toward a pro-apoptotic profile [41]. The observed increase in BAX/BCL-2 ratio enhances mitochondrial outer membrane permeability, promoting cytochrome c release and activation of the intrinsic apoptotic cascade. This is consistent with the well-documented role of polyphenolic compounds in shifting the BAX/BCL-2 balance toward apoptosis, thereby contributing to the antitumor activity of the extract. Antiproliferative effect Visual evidence from colony formation assays after treatment of MTC-TT cells with A. vulgaris ethyl acetate extract at IC₅₀ doses for 24, 48, and 72 hours is presented in Figure 6. The untreated control and solvent (1% DMSO) groups showed stable proliferation over time, with average colony counts of 222.0 ± 3.0 and 207.0 ± 5.0 at 24 h, 266.0 ± 3.0 and 239.0 ± 5.0 at 48 h, and 287.0 ± 3.0 and 248.0 ± 5.0 at 72 h, respectively. In contrast, extract-treated cells exhibited markedly reduced colony formation, with counts of 106,0 ± 15,0, 106,0 ± 15,0, and 78,0 ± 5,0 at 24, 48, and 72 h, corresponding to 51%, 45%, and 31% inhibition, respectively (p < 0.001). These findings clearly indicate that A. vulgaris ethyl acetate extract exerts a time-dependent suppression of proliferative capacity in MTC-TT cells. At the molecular level, the expression of CDKN1A (p21) exhibited a dual-phase expression profile. A marked suppression was observed at 48 hours (0.4974 ± 0.01084-fold, p < 0.0001), whereas by 72 hours transcript levels had risen substantially, reaching 4.251 ± 0.1171-fold compared with the control (p < 0.0001) (Figure 5). The late-phase increase in p21 is consistent with prior studies showing that various phytochemicals suppress cell cycle progression through p53-independent or partially p53-dependent induction of p21 [42, 43]. The late-phase increase in p21 is consistent with prior studies showing that various phytochemicals suppress cell cycle progression through p53-independent or partially p53-dependent induction of p21[42, 43]. In MTC models, elevated CDK5 activity has also been linked to increased p21 at both mRNA and protein levels (Pozo et al., 2015), suggesting that our results align with previously described regulatory mechanisms [44]. The transient reduction at 48 h may reflect early stress-induced suppression of p21 transcription, proteasome-mediated degradation, or functional relocalization of p21 as reported for other plant-derived compounds [45, 46]. Such dynamic regulation indicates that the antiproliferative effect of the extract involves time-dependent molecular switching, where transient loss of p21 is compensated by a strong late-phase induction, ultimately reinforcing growth inhibition. These results are consistent with previous reports on different tumor models, where cell division was suppressed in A549 lung carcinoma [26], proliferation was inhibited through G1-phase cell cycle arrest in PC-3 prostate carcinoma [25], colony-forming capacity was reduced by approximately 20% in 4T1 breast carcinoma [27], and colony viability was significantly decreased in SH-SY5Y neuroblastoma cells [38]. Overall, the evidence suggests that the ethyl acetate extract of A. vulgaris exhibits notable antiproliferative activity, which appears to be mediated, at least in part, by the regulation of the p21 pathway. Anti-migratory Effect The wound-healing assay performed in MTC-TT cells demonstrated that treatment with the ethyl acetate extract of A. vulgaris at IC₅₀ concentrations led to a marked inhibition of migration (Figure 7). Pixel-based quantification of wound closure revealed closure rates of 54.83% ± 1.36 at 24 h, 55.67% ± 3.93 at 48 h, and 58.30% ± 2.79 at 72 h compared with controls ( p < 0.0001). In contrast to the control and solvent groups, the wound area did not close significantly over the 24–72 h period, underscoring the inhibitory effect of the extract on cell motility. Expression profiling demonstrated that the anti-migratory effect of the extract was accompanied by marked alterations in invasion-related genes, as shown in Figure 5. At 48 h, MMP2 transcript levels decreased to 0.01920 ± 0.006306-fold ( p = 0.0382), while MMP9 expression was reduced to 0.1825 ± 0.004424-fold ( p < 0.0001) compared with controls. Following this early suppression, both genes displayed a compensatory increase at 72 h, with MMP2 rising to 1.311 ± 0.07614-fold ( p < 0.0001) and MMP9 to 1.449 ± 0.1039-fold ( p = 0.0002). These results suggest that the inhibitory effect of A. vulgaris ethyl acetate extract on cell migration is closely associated with the transient downregulation of MMP2 and MMP9 . At the same time, the subsequent upregulation at later time points suggests the activation of adaptive responses that may restore invasive potential. Our results are consistent with previous studies showing reduced migration in 4T1 breast carcinoma cells [27] and significant anti-migratory effects of A. vulgaris extract in SH-SY5Y neuroblastoma cells [38]. The observed transient inhibition of MMP2 and MMP9 at 48 h corresponds to earlier studies, which have shown that the invasive capacity of medullary thyroid carcinoma cells can be reduced through the regulation of these enzymes [40, 47]. The subsequent increase at 72 h may be explained by compensatory cellular mechanisms activated under prolonged stress, as MMP transcription is known to be dynamically regulated via NF-κB and AP-1 signaling [48, 49]. Moreover, alterations in cell–cell and cell–matrix interactions during extended incubation could contribute to the reactivation of MMP expression. Similar time-dependent bidirectional effects of plant-derived compounds on MMP regulation have also been described [50]. Taken together, these data indicate that the ethyl acetate extract of A. vulgaris suppresses migration in MTC-TT cells, likely through early downregulation of MMP2 and MMP9 . However, the subsequent upregulation of gene expression at later stages highlights adaptive mechanisms that may enable tumor cells to restore their invasive capacity partially, emphasizing the need to evaluate long-term treatment effects. Conclusion This study demonstrates that the ethyl acetate extract of Alchemilla vulgaris exerts significant antitumor activity against medullary thyroid carcinoma (MTC-TT) cells. The extract showed strong antioxidant capacity attributable to its high phenolic content and induced selective cytotoxicity in tumor cells while sparing normal fibroblasts. Treatment activated the intrinsic apoptotic pathway by modulating BAX and BCL-2 , suppressed clonogenic proliferation in association with the time-dependent regulation of CDKN1A , and inhibited cell migration through transient downregulation of MMP2 and MMP9 expression. When considered as a whole, these findings indicate that the anticancer activity of A. vulgaris is mediated by multiple, interconnected molecular pathways. Given its low toxicity toward normal cells and broad spectrum of biological effects, the extract may represent a promising candidate for further development as a nutraceutical or adjuvant therapeutic option in aggressive and treatment-resistant thyroid cancers. Limitations This study has several limitations that should be considered when interpreting the findings. First, all experiments were conducted in vitro and restricted to a single medullary thyroid carcinoma cell line (MTC-TT); therefore, the results cannot be directly extrapolated to in vivo systems or to other thyroid cancer subtypes. Second, the extract tested is a complex phytochemical mixture, and the individual bioactive compounds responsible for the observed effects were not identified, which highlights the need for future studies involving fractionation and characterization of active constituents. Third, the analysis of molecular mechanisms was limited to mRNA expression; protein-level validation and functional assays were not performed, which would have provided more substantial evidence for the biological relevance of the implicated pathways. Fourth, the assessment of temporal dynamics was restricted to selected time points, which may not fully capture intermediate changes, particularly in the expression of CDKN1A and MMP2/9 . Finally, although the preliminary selectivity data obtained in WI-38 fibroblasts are encouraging, validation using additional non-malignant cell models is required to confirm tumor-specific effects and to strengthen the translational potential of the findings. Declarations Conflict of Interest The authors declare no conflict of interest. Funding This study was supported by the Scientific Research Projects Coordination Unit of Kafkas University under project number 2024-TS-54. Author Contribution Project management: GZO. Literature review: GZO, MDU. Data analysis: all authors.Experimental studies: MDU. Article writing and editing: all authors. Acknowledgement All Authors would like to thank the Scientific Research Projects Coordination Unit of Kafkas University for their work on the 2024-TS-54 Project. References Bray, F., et al., Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians, 2018. 68 (6): p. 394-424. Bray, F., et al., Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians, 2024. 74 (3): p. 229-263. Hazard, J.B., W.A. HAWK, and G. CRILE JR, Medullary (solid) carcinoma of the thyroid—a clinicopathologic entity. The Journal of Clinical Endocrinology & Metabolism, 1959. 19 (1): p. 152-161. Sahakian, N., F. Castinetti, and P. Romanet, Molecular basis and natural history of medullary thyroid cancer: it is (almost) all in the RET. Cancers, 2023. 15 (19): p. 4865. Torino, F., et al., Medullary thyroid cancer: a promising model for targeted therapy. Current molecular medicine, 2010. 10 (7): p. 608-625. Ceolin, L., et al., Medullary thyroid carcinoma beyond surgery: advances, challenges, and perspectives. Endocrine-related cancer, 2019. 26 (9): p. R499-R518. Wells Jr, S.A., et al., Revised American Thyroid Association guidelines for the management of medullary thyroid carcinoma: the American Thyroid Association Guidelines Task Force on medullary thyroid carcinoma. Thyroid, 2015. 25 (6): p. 567-610. Maxwell, J.E., et al., Medical management of metastatic medullary thyroid cancer. Cancer, 2014. 120 (21): p. 3287-3301. Weng, C.-J. and G.-C. Yen, Flavonoids, a ubiquitous dietary phenolic subclass, exert extensive in vitro anti-invasive and in vivo anti-metastatic activities. Cancer and Metastasis Reviews, 2012. 31 (1): p. 323-351. Wagner, K.-H. and I. Elmadfa, Biological relevance of terpenoids: Overview focusing on mono-, di-and tetraterpenes. Annals of Nutrition and metabolism, 2003. 47 (3-4): p. 95-106. Lu, J.-J., et al., Alkaloids isolated from natural herbs as the anticancer agents. Evidence‐Based Complementary and Alternative Medicine, 2012. 2012 (1): p. 485042. Pan, M.-H., C.-S. Lai, and C.-T. Ho, Anti-inflammatory activity of natural dietary flavonoids. Food & function, 2010. 1 (1): p. 15-31. Atanasov, A.G., et al., Discovery and resupply of pharmacologically active plant-derived natural products: A review. Biotechnology advances, 2015. 33 (8): p. 1582-1614. Cragg, G.M. and J.M. Pezzuto, Natural products as a vital source for the discovery of cancer chemotherapeutic and chemopreventive agents. Medical Principles and Practice, 2016. 25 (Suppl. 2): p. 41-59. Cháirez-Ramírez, M.H., K.G. de la Cruz-López, and A. García-Carrancá, Polyphenols as antitumor agents targeting key players in cancer-driving signaling pathways. Frontiers in pharmacology, 2021. 12 : p. 710304. Ghedira, K., P. Goetz, and R. Jeune, Alchemilla vulgaris L.: Alchémille (Rosaceae). Phytotherapie-Heidelberg, 2012. 10 (4): p. 263. Mukhopadhyay, N., et al., Natural product-driven dual COX-LOX inhibitors: Overview of recent studies on the development of novel anti-inflammatory agents. Heliyon, 2023. 9 (3). Boroja, T., et al., The biological activities of roots and aerial parts of Alchemilla vulgaris L. South african journal of botany, 2018. 116 : p. 175-184. Filippova, E., Antiviral activity of Lady’s mantle (Alchemilla vulgaris L.) extracts against orthopoxviruses. Bulletin of Experimental Biology and Medicine, 2017. 163 (3): p. 374-377. Choi, J., et al., Effect of herbal mixture composed of Alchemilla vulgaris and Mimosa on wound healing process. Biomedicine & Pharmacotherapy, 2018. 106 : p. 326-332. Vlaisavljević, S., et al., Alchemilla vulgaris agg.(Lady's mantle) from central Balkan: antioxidant, anticancer and enzyme inhibition properties. RSC advances, 2019. 9 (64): p. 37474-37483. Neagu, E., et al., Assessment of acetylcholinesterase and tyrosinase inhibitory and antioxidant activity of Alchemilla vulgaris and Filipendula ulmaria extracts. Journal of the Taiwan Institute of Chemical Engineers, 2015. 52 : p. 1-6. Arbeláez, L.F.G., et al., Cardioprotection and natural polyphenols: An update of clinical and experimental studies. Food & function, 2018. 9 (12): p. 6129-6145. Ebrahimi, R., et al., Exploring the links between polyphenols, Nrf2, and diabetes: A review. Biomedicine & Pharmacotherapy, 2025. 186 : p. 118020. Ibrahim, O.H., et al., Phytochemical characterization, antimicrobial activity and in vitro antiproliferative potential of Alchemilla vulgaris Auct root extract against prostate (PC-3), breast (MCF-7) and colorectal adenocarcinoma (Caco-2) cancer cell lines. Plants, 2022. 11 (16): p. 2140. Jelača, S., et al., Beyond traditional use of Alchemilla vulgaris: genoprotective and antitumor activity in vitro. Molecules, 2022. 27 (23): p. 8113. Jelača, S., et al., Dual role of Alchemilla vulgaris L. extract in breast cancer regression: reestablishment of effective immune response. Pharmaceuticals, 2024. 17 (3): p. 286. Jelača, S., et al., Antimelanoma Effects of Alchemilla vulgaris: A Comprehensive In Vitro and In Vivo Study. Diseases, 2024. 12 (6): p. 125. Farhan, M. and A. Rizvi, Understanding the prooxidant action of plant polyphenols in the cellular microenvironment of malignant cells: Role of copper and therapeutic implications. Frontiers in Pharmacology, 2022. 13 : p. 929853. León-González, A.J., C. Auger, and V.B. Schini-Kerth, Pro-oxidant activity of polyphenols and its implication on cancer chemoprevention and chemotherapy. Biochemical pharmacology, 2015. 98 (3): p. 371-380. Mistuda, H., K. Yuasumoto, and K. Iwami, Antioxidation action of indole compounds during the autoxidation of linoleic acid. 1996. Slinkard, K. and V.L. Singleton, Total phenol analysis: automation and comparison with manual methods. American journal of enology and viticulture, 1977. 28 (1): p. 49-55. Yen, G.-C. and H.-Y. Chen, Antioxidant activity of various tea extracts in relation to their antimutagenicity. Journal of agricultural and food chemistry, 1995. 43 (1): p. 27-32. Trouillas, P., et al., Antioxidant, anti-inflammatory and antiproliferative properties of sixteen water plant extracts used in the Limousin countryside as herbal teas. Food chemistry, 2003. 80 (3): p. 399-407. Bilušić, T., I. Šola, and V. Čikeš Čulić, Identification of Flavonoids, Antioxidant and Antiproliferative Activity of Aqueous Infusions of Calendula officinalis L., Chelidonium majus L., Teucrium chamaedrys L. and Alchemilla vulgaris L. Food technology and biotechnology, 2024. 62 (1): p. 49-58. Granado-Serrano, A.B., et al., Epicatechin induces NF-κB, activator protein-1 (AP-1) and nuclear transcription factor erythroid 2p45-related factor-2 (Nrf2) via phosphatidylinositol-3-kinase/protein kinase B (PI3K/AKT) and extracellular regulated kinase (ERK) signalling in HepG2 cells. British Journal of Nutrition, 2010. 103 (2): p. 168-179. Pandey, K.B. and S.I. Rizvi, Plant polyphenols as dietary antioxidants in human health and disease. Oxidative medicine and cellular longevity, 2009. 2 (5): p. 270-278. Moqidem, Y., Evaluation of the Anticancer Potential of Alchemilla vulgaris Extract Against Human Neuroblastoma Cells. 2021. Al-Osaj, S.L., K.W. Al-Sammarraei, and L. Al-Osaj, Cytotoxic evaluation of Alchemilla vulgaris extract in normal blood lymphocytes. World J. Pharmaceut. Res, 2016. 5 (4): p. 237-252. Dodurga, Y., et al., Anti-proliferative and anti-invasive effects of ferulic acid in TT medullary thyroid cancer cells interacting with URG4/URGCP. Tumor Biology, 2016. 37 (2): p. 1933-1940. Yıldırım, O., et al., In vitro effects of boric acid on cell cycle, apoptosis, and miRNAs in medullary thyroid cancer cells. Biological Trace Element Research, 2025. 203 (2): p. 799-809. Laka, K. and Z. Mbita, P53-Related anticancer activities of Drimia calcarata bulb extracts against lung cancer. Frontiers in Molecular Biosciences, 2022. 9 : p. 876213. Rajabi, L., et al., Aqueous and ethanolic extracts of Moringa oleifera leaves induce selective cytotoxicity in Raji and Jurkat cell lines by activating the P21 pathway independent of P53. Molecular Biology Reports, 2025. 52 (1): p. 102. Pozo, K., et al., Differential expression of cell cycle regulators in CDK5-dependent medullary thyroid carcinoma tumorigenesis. Oncotarget, 2015. 6 (14): p. 12080. Jung, Y.-S., Y. Qian, and X. Chen, Examination of the expanding pathways for the regulation of p21 expression and activity. Cellular signalling, 2010. 22 (7): p. 1003-1012. Gartel, A.L. and A.L. Tyner, The role of the cyclin-dependent kinase inhibitor p21 in apoptosis. Molecular cancer therapeutics, 2002. 1 (8): p. 639-649. Vázquez-Lorente, H., et al., Matrix Metalloproteinases 2 and 9 and Their Tissue Inhibitors in the Diagnostics of Medullary Thyroid Carcinoma. Applied Immunohistochemistry & Molecular Morphology, 2023. 31 (2): p. 121-127. Page-McCaw, A., A.J. Ewald, and Z. Werb, Matrix metalloproteinases and the regulation of tissue remodelling. Nature reviews Molecular cell biology, 2007. 8 (3): p. 221-233. Kessenbrock, K., V. Plaks, and Z. Werb, Matrix metalloproteinases: regulators of the tumor microenvironment. Cell, 2010. 141 (1): p. 52-67. Overall, C.M. and O. Kleifeld, Validating matrix metalloproteinases as drug targets and anti-targets for cancer therapy. Nature Reviews Cancer, 2006. 6 (3): p. 227-239. Tables Table 1. Primer sequences used for quantitative real-time PCR analysis of target genes associated with cell cycle regulation, apoptosis, and invasion. Genes analyzed included CDKN1A (cyclin-dependent kinase inhibitor 1A, also known as p21), BAX (BCL2-associated X, an apoptosis regulator), BCL-2 (B-cell lymphoma 2), MMP-2 (matrix metalloproteinase 2), and MMP-9 (matrix metalloproteinase 9). ACTB (β-actin) was employed as the endogenous housekeeping control for normalization of gene expression levels. Genes Primer Sequences (5′→3′) CDKN1A (p21) F: GACTGTGATGCGCTAATGGC R: CGTGGGAAGGTAGAGCTTGG BAX F: AGAGGATGATTGCCGCCGT R: CAACCACCCTGGTCTTGGATC BCL-2 F: TTGGCCCCCGTTGCTT R: CGGTTATCGTACCCCGTTCTC MMP2 F: TCTCCTGACATTGACCTTGGC R: CAAGGTGCTGGCTGAGTAGATC MMP9 F: CCTTGTGCTCTTCCCTGGAG R: GGCCCCAGAGATTTCGACTC ACTB (β-actin) F: TCCTGTGGCATCCACGAAACT R: GAAGCATTGCGGTGGACGAT F: forward primer; R: reverse primer. Table 2. Total antioxidant activity (TAA; ferric–thiocyanate method, read at 500 nm at 60 h), reducing power (RP; 700 nm), and total phenolic content (TPC; mg gallic acid equivalents per g lyophilizate, mg GAE/g) of A. vulgaris ethyl acetate extract (AVEA). Samples Dose (mg/mL) TAA (Absorbance at 60 h, 500 nm) TAA (%) Inhibition RP (700 nm, Absorbance) TPC (mg GAE/g lyophilizate) AVEA 1.0 0.844 ± 0.006ᵉ 75.8 0.066 ± 0.006ᵃ 16.81 ± 0.053ᵃ 5.0 0.696 ± 0.004ᵈ 80.1 0.373 ± 0.005ᵇ 22.50 ± 0.075ᵇ 7.5 0.596 ± 0.005ᶜ 82.8 0.947 ± 0.005ᶜ 23.55 ± 0.115ᶜ 10.0 0.513 ± 0.003ᵇ 85.3 1.298 ± 0.003ᵈ 26.49 ± 0.050ᵈ Ascorbic acid 1.0 0.691 ± 0.002ᶠ 38.4 — — Trolox 1.0 0.279 ± 0.002ᵃ 82.1 — — Control (DMSO) — 3.499 ± 0.003ᵍ — — — Control (water) — 1.563 ± 0.003ᵍ — — — Values are mean ± SD (n = 3 independent experiments, each with 3 technical replicates). One-way ANOVA + Dunnett’s test vs. vehicle control (DMSO, final ≤ 0.5% v/v) for TAA; water control used for RP and TPC. Different letters within a column indicate significant differences. (p < 0.05). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7646704","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"correspondence","associatedPublications":[],"authors":[{"id":524592363,"identity":"88c805eb-c704-436c-bd99-a709ff1e428b","order_by":0,"name":"Merve Dolunay UYANIK","email":"","orcid":"","institution":"Kafkas University","correspondingAuthor":false,"prefix":"","firstName":"Merve","middleName":"Dolunay","lastName":"UYANIK","suffix":""},{"id":524592364,"identity":"e39c5911-b9a1-4a9c-ae5f-6c2d1d293bfa","order_by":1,"name":"Gonul Zisan ONCEL","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2UlEQVRIiWNgGAWjYDACZhiDnfkAkJSQIUELM1sCSAsPKdbxGIAowlrk29kffi6ouCPPz8zz+dWNGgseBvbDRzfg08LYzGMsPePMM8OZzbzbrHOOAR3Gk5Z2A69zmHkYpHnbDicYHObdZpzDBtQiwWOGVwsbM/vj3yAt9od5nhnn/CNCCw8zgxnEFmYe5se5bURokWDmMbPmOXPYcMZhNjPm3D4JHjZCfpHvP/74Nk/FYXn+9ubHn3O+1cnxsx8+hlcLir8kwCSxykGA+QMpqkfBKBgFo2DkAACOBTwWUaOLDAAAAABJRU5ErkJggg==","orcid":"","institution":"Kafkas University","correspondingAuthor":true,"prefix":"","firstName":"Gonul","middleName":"Zisan","lastName":"ONCEL","suffix":""},{"id":524592365,"identity":"3b95aeb0-aa76-40c6-bf97-4bda75889ad5","order_by":2,"name":"Sakir AKGUN","email":"","orcid":"","institution":"Kafkas University","correspondingAuthor":false,"prefix":"","firstName":"Sakir","middleName":"","lastName":"AKGUN","suffix":""}],"badges":[],"createdAt":"2025-09-18 07:53:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7646704/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7646704/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92866701,"identity":"6923a20c-2e49-4605-90d5-538d20324b7b","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15678,"visible":true,"origin":"","legend":"","description":"","filename":"FigureLegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/c300b40dc10f1e788ae23e88.docx"},{"id":92866715,"identity":"d65968da-5856-4622-8b80-e9a397da9f06","added_by":"auto","created_at":"2025-10-06 13:14:53","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":151477,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/1cc86fc177a85ae3945e2673.docx"},{"id":92867135,"identity":"1feb47d4-d755-4d35-87b2-5ef836da5508","added_by":"auto","created_at":"2025-10-06 13:22:41","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18242,"visible":true,"origin":"","legend":"","description":"","filename":"TABLES.docx","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/dd59fd2f6332aa75a7c2bcb0.docx"},{"id":92866707,"identity":"6a47fa7d-b75b-448a-982a-a93d243d720c","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"json","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4952,"visible":true,"origin":"","legend":"","description":"","filename":"92fb97e3cef14ede9d1de5eab6300659.json","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/7ede48b3e90401da8f72a5ee.json"},{"id":92866709,"identity":"44eb880d-f6e8-433c-a63e-c227bdd0e747","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":109356,"visible":true,"origin":"","legend":"","description":"","filename":"92fb97e3cef14ede9d1de5eab63006591enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/40b0b5b85046fb5cc2283e4a.xml"},{"id":92866714,"identity":"7f76f902-f275-4e38-881f-69399cded655","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"rar","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13973733,"visible":true,"origin":"","legend":"","description":"","filename":"Figures.rar","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/dbb288409bfb202ff1c65919.rar"},{"id":92866711,"identity":"5df460f2-30d7-4ab4-83c2-86e97df4370a","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"xml","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":109654,"visible":true,"origin":"","legend":"","description":"","filename":"92fb97e3cef14ede9d1de5eab63006591structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/4ace589113c5e68184b93542.xml"},{"id":92866713,"identity":"8fee3282-55ac-4d21-8727-af19ad12f8ea","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"html","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":121780,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/7813883fddbc7a18feb3f7c0.html"},{"id":92866705,"identity":"5ee532ca-e234-4d20-9728-2d694b7c6246","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":235220,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eA. vulgaris\u003c/em\u003e ethyl acetate extract (AVEA) on the viability of MTC-TT cells after 24, 48, and 72 h of treatment, as determined by MTT assay. Values represent mean ± SD (n = 3 independent experiments, each with three technical replicates). Statistical analysis was performed using one-way ANOVA followed by Dunnett’s post hoc test (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 vs. control).\u003c/p\u003e","description":"","filename":"Figure1..png","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/232f8cf43d45e53a93d3bf0c.png"},{"id":92866702,"identity":"d6304e89-d735-4f61-b864-7e932d385524","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":234009,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eA. vulgaris\u003c/em\u003e ethyl acetate extract (AVEA) on the viability of WI-38 fibroblasts after 24, 48, and 72 h of treatment, as determined by MTT assay. Values represent mean ± SD (n = 3 independent experiments, each with three technical replicates). Statistical analysis was performed using one-way ANOVA followed by Dunnett’s post hoc test (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 vs. control).\u003c/p\u003e","description":"","filename":"Figure2..png","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/21fb0142df872b46ebe5d7b1.png"},{"id":92866704,"identity":"a0c9c1d6-c74d-49ef-9a00-73d32aa91f35","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":302594,"visible":true,"origin":"","legend":"\u003cp\u003eTUNEL assay images of MTC-TT cells after 48 h treatment with \u003cem\u003eA. vulgaris\u003c/em\u003e ethyl acetate extract at the IC₅₀ concentration. Panels: (A) transmitted light, (B) DAPI staining, (C) GFP channel (apoptotic nuclei), and (D) merged images. Groups: (1) DNase I–treated positive control, (2) enzyme-free negative control, and (3) extract-treated cells.\u003c/p\u003e","description":"","filename":"Figure5..png","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/6303ab4209e98349d93467c7.png"},{"id":92866706,"identity":"15eeb4eb-a222-4bf5-9adc-20a01d73b62b","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2749652,"visible":true,"origin":"","legend":"\u003cp\u003eTUNEL assay images of MTC-TT cells after 72 h treatment with \u003cem\u003eA. vulgaris\u003c/em\u003e ethyl acetate extract at the IC₅₀ concentration. Panels: (A) transmitted light, (B) DAPI staining, (C) GFP channel (apoptotic nuclei), and (D) merged images. Groups: (1) DNase I–treated positive control, (2) enzyme-free negative control, and (3) extract-treated cells.\u003c/p\u003e","description":"","filename":"Figure3..png","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/453726b4d8ece950e59654b3.png"},{"id":92867137,"identity":"31c4edda-2731-466c-86fd-7be572cc2844","added_by":"auto","created_at":"2025-10-06 13:22:53","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2467541,"visible":true,"origin":"","legend":"\u003cp\u003eRelative mRNA expression levels of CDKN1A, BAX, BCL-2, MMP2, and MMP9 genes in MTC-TT cells treated with \u003cem\u003eA. vulgaris\u003c/em\u003e ethyl acetate extract compared with untreated controls. Data are presented as mean ± SD from three independent experiments. Gene expression levels were normalized to β-actin and analyzed using the 2^−ΔΔCt method. Statistical significance is indicated as \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, \u003cstrong\u003ep\u003c/strong\u003e \u0026lt; 0.01, and \u003cem\u003e\u003cstrong\u003ep\u003c/strong\u003e\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure4..png","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/f8c600ec50d5a85234a56391.png"},{"id":92866710,"identity":"ad1882dc-30f0-4d51-a04e-a69e68afa875","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":5241971,"visible":true,"origin":"","legend":"\u003cp\u003eColony formation assay of MTC-TT cells treated with A. vulgaris ethyl acetate extract at the IC₅₀ concentration for 24, 48, and 72 h. Groups: (1) untreated control, (2) solvent control (1% DMSO), and (3) extract-treated cells. A marked reduction in colony number was observed in the extract-treated groups compared with controls.\u003c/p\u003e","description":"","filename":"Figure6..png","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/5a5495778fa1e526e825cad7.png"},{"id":92866708,"identity":"1e0ec297-ad60-4f55-80c0-4348ee47de71","added_by":"auto","created_at":"2025-10-06 13:14:41","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":5594213,"visible":true,"origin":"","legend":"\u003cp\u003eWound-healing assay of MTC-TT cells treated with A. vulgaris ethyl acetate extract at the IC₅₀ concentration. Images were captured at 0, 24, 48, and 72 h. Panels: (A–C) baseline images at zero h for untreated control, DMSO control, and extract-treated groups, respectively; (D–F) corresponding wound areas after incubation. Quantitative analysis showed significantly reduced wound closure in extract-treated cells compared with controls (p \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"Figure7..png","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/889ccb5bb840289e9c2e8e46.png"},{"id":94493162,"identity":"e0ffd710-2de7-4135-bdbc-fa90008e4723","added_by":"auto","created_at":"2025-10-27 17:30:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":17759304,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7646704/v1/bf46a0c4-0253-45a0-9586-ed9ab3636fbd.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Antioxidant and Anticancer Effects of Alchemilla vulgaris Extract on Medullary Thyroid Carcinoma Cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe International Agency for Research on Cancer (IARC) reported that in 2022, approximately 20\u0026nbsp;million new cancer cases and 9.7\u0026nbsp;million cancer deaths occurred worldwide, confirming cancer as a persistent global health problem. Thyroid cancer, the most frequent endocrine malignancy, has shown a marked increase in incidence over recent decades, with distinct variations across regions [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Hazard and co-workers identified medullary thyroid carcinoma (MTC) as a separate pathological type in 1959 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. This uncommon but aggressive cancer originates from parafollicular C cells that produce calcitonin and accounts for about 5% of thyroid cancers [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. It is characterized by a high tendency to spread to cervical and regional lymph nodes, and distant organ involvement is also common, factors that largely account for its unfavorable prognosis [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Management of localized medullary thyroid carcinoma generally requires total thyroidectomy in combination with central compartment dissection and, in many cases, lateral neck node dissection [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Because parafollicular C cells cannot uptake radioactive iodine, radioiodine therapy is not effective in MTC, and traditional chemotherapeutic regimens show only modest benefit while being associated with substantial toxicity [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Evidence indicates that plant-derived secondary metabolites interact with a wide range of molecular targets. Their antineoplastic activity involves several processes, including the mitigation of oxidative stress [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], modulating cellular signaling pathways [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], and remodeling of the tumor microenvironment [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The use of A. vulgaris in folk medicine, particularly for gynecological ailments, is well documented [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The plant is rich in polyphenols and has been reported to exert anti-inflammatory [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], antioxidant [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], antiviral [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], and wound-healing [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] activities. Native to Europe and Central Asia, the species also grows abundantly in the highlands of Turkey [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Its extracts, depending on the solvent used, contain diverse bioactive compounds such as flavonoids, flavonol glycosides, phenolic acids, and ellagitannins [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], these compounds not only mitigate oxidative stress and suppress inflammation [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], but also display cytotoxic, antiproliferative, anti-invasive, and apoptosis-inducing properties in various cancer cell lines, including breast, colon, ovarian, cervical, melanoma, and neuroblastoma [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan additionalcitationids=\"CR26 CR27\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In addition to their antioxidant effects, the polyphenolic constituents of \u003cem\u003eA. vulgaris\u003c/em\u003e may exhibit context-dependent pro-oxidant activity in cancer cells with enhanced metabolic activity, thereby promoting cell death through oxidative stress\u0026ndash;mediated mechanisms [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Although the antioxidant properties of A. vulgaris are well documented, little is known about its activity in tumor types with limited therapeutic options, such as medullary thyroid carcinoma. Exploring these effects could provide valuable insights into its underlying mechanisms and contribute to the identification of nutraceutical candidates with potential clinical relevance. On this basis, the current study aimed to assess the in vitro antioxidant capacity of the ethyl acetate extract of \u003cem\u003eA. vulgaris\u003c/em\u003e and to investigate its cytotoxic, antiproliferative, pro-apoptotic, and anti-migratory effects in MTC-TT cells.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eEthical Statement\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eEthical approval for this research was obtained from the \u003cem\u003eKafkas University Faculty of Medicine Ethics Committee\u0026nbsp;\u003c/em\u003eon 27 March 2024 (Approval number: 2024/401).\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eChemicals\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eReagents of analytical grade were used throughout the study. For antioxidant assays, thiocyanate, Folin\u0026ndash;Ciocalteu reagent, sodium carbonate, ferricyanide, trichloroacetic acid, and ferric chloride were obtained from Sigma-Aldrich (St. Louis, MO, USA). For cell culture, RPMI-1640 medium (Thermo Fisher Gibco, Cat. No. 21875-034), fetal bovine serum (Capricorn Scientific, Cat. No. FBS-11A), and penicillin\u0026ndash;streptomycin (Thermo Fisher Gibco, Cat. No. 15140-122) were used. The MTT kit (Beyotime Biotechnology, Cat. No: ST1537) and doxorubicin (Sigma-Aldrich, Cat. No: D9542) were applied in the relevant assays.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003ePlant material and extraction\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eAerial parts of \u003cem\u003eAlchemilla vulgaris\u003c/em\u003e were obtained from a commercial source (Kayalar Spice Seed Food Company, Ankara, Turkey; registration no: TR-06-K-009592). The plant material was ground, then extracted with ethyl acetate using a Soxhlet apparatus at 50 \u0026deg;C for 48 h. The solvent was removed under reduced pressure, and the crude extract was lyophilized (5 mmHg). A stock solution (100 mg/mL) was prepared in DMSO, filtered through 0.22 \u0026micro;m syringe filters, and kept at \u0026minus;20 \u0026deg;C until required.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eDetermination of Total Antioxidant Activity (TAA) of the Extract\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eTAA was evaluated by the thiocyanate method using a linoleic acid emulsion, according to Mitsuda et al.\u0026nbsp;[31]. Extract solutions (1\u0026ndash;10 mg/mL) were prepared in KH₂PO₄ buffer (0.2 M, pH 7.0) with linoleic acid and incubated at 37 \u0026deg;C. Every 12 h, ethanol, ammonium thiocyanate, and FeCl₂ were added. The absorbance at 500 nm was recorded, where lower values corresponded to more potent antioxidant activity. Ascorbic acid and trolox were used as reference antioxidants.\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eDetermination of Total Phenolic Compound Content (TPC)\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eThe phenolic content of the extract was quantified with the Folin\u0026ndash;Ciocalteu method\u0026nbsp;[32]. Briefly, 0.25 mg of dried extract was dissolved in 0.25 mL ethyl acetate and reacted with 1.25 mL Folin\u0026ndash;Ciocalteu reagent. After 5 min of incubation at 30 \u0026deg;C, 2 mL of 7.5% Na₂CO₃ was added, and the mixture was kept at 30 \u0026deg;C for 90 min. Absorbance was measured at 765 nm. Results were obtained from a standard curve of gallic acid (0\u0026ndash;200 \u0026micro;g/mL) and reported as mg gallic acid equivalents (GAE) per g of extract.\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eDetermination of the Reducing Power of the Extract (RP)\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eReducing power was analyzed using the potassium ferricyanide method [33]. In this assay, 0.5 mg of extract in 0.5 mL ethyl acetate was mixed with phosphate buffer (0.02 M, pH 6.6) and 1% K₃[Fe(CN)₆], and incubated at 50 \u0026deg;C for 30 min. After treatment with 10% trichloroacetic acid and centrifugation at 3000 rpm for 10 min, the supernatant was combined with distilled water and 0.1% FeCl₃. The absorbance at 700 nm was recorded, where higher values corresponded to greater reducing potential.\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eCell Lines and Cell Culture\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eMTC-TT cells (ATCC CRL-1803) and WI-38 fibroblasts (ATCC CCL-75) were obtained from the American Type Culture Collection (Manassas, VA, USA). They were grown in RPMI-1640 medium with 10% fetal bovine serum and 1% penicillin\u0026ndash;streptomycin at 37 \u0026deg;C in a CO₂ incubator (5% CO₂, humidified).\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eMTT Cell Viability Assay\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eThe MTT assay (Beyotime, Cat. No: ST1537) was applied to measure viability in MTC-TT and WI-38 cells. Cells were seeded in 96-well plates (7 \u0026times; 10\u0026sup3;/well) and cultured for 24 h before treatment with the extract (5\u0026ndash;50 \u0026micro;g/mL for MTC-TT; 10\u0026ndash;100 \u0026micro;g/mL for WI-38) for 24, 48, or 72 h. MTT reagent was added for four hours, after which the formazan crystals were dissolved with SDS\u0026ndash;HCl. Absorbance readings were taken at 570 nm, using 690 nm as a reference. Cell viability (%) was calculated against untreated control values. IC₅₀ values were obtained using nonlinear regression with GraphPad Prism 8.0.2, and the selectivity index (SI) was expressed as the ratio of IC₅₀ normal to IC₅₀ cancer.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eTUNEL Assay\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eApoptosis was evaluated with the Elabscience\u0026reg; One-step TUNEL In Situ Green Apoptosis Kit (Cat. No: E-CK-A321, Elabscience). MTC-TT cells (1 \u0026times; 10⁴/well) were treated with the IC₅₀ dose of the extract for 48 and 72 h. Groups included untreated control, DNase I-treated positive control, enzyme-free control, and extract-treated cells. After fixation in 4% paraformaldehyde, TUNEL labeling was performed following the kit protocol. Nuclei were counterstained with DAPI, and fluorescence was observed using an EVOS\u0026trade; FL Color Imaging System under transmitted light, DAPI, and GFP channels. Apoptotic cells were counted in random fields based on green fluorescence.\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eColony Formation Assay\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eFor the colony formation assay, 1 \u0026times; 10\u0026sup3; MTC-TT cells were seeded in 6-well plates. Three conditions were used: untreated control, 1% DMSO control, and extract at IC₅₀ for 24, 48, or 72 h. Plates were incubated for 12 days, with medium refreshed every 2\u0026ndash;3 days. Colonies were fixed with 4% formaldehyde and stained using 1% crystal violet. Colonies of 50 cells or more were counted under a microscope, and ImageJ v1.53a (NIH, Bethesda, MD, USA) was used for quantification.\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eWound Healing Assay\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eCell migration was assessed using a wound-healing assay. Confluent monolayers of MTC-TT cells were wounded using a sterile 10 \u0026micro;L pipette tip, and detached cells were gently removed by washing with PBS. Treatments were applied at IC₅₀ concentrations of the extract, while control wells received only culture medium. Images were taken at 0, 24, 48, and 72 h from predefined positions using constant magnification. Wound closure was calculated relative to the initial wound size using ImageJ software and expressed as percentage closure.\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eGene Expression Analysis\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eFor gene expression analysis, MTC-TT cells (1.5 \u0026times; 10⁵/well) were treated with the extract (IC₅₀) for 48 or 72 h. RNA was isolated using TRI Reagent\u0026trade; (MRC, Cat. No. TR118), and the concentration and purity were checked using a NanoDrop\u0026trade; spectrophotometer (Thermo Fisher Scientific, USA). cDNA was prepared with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA). Real-time PCR was performed on a StepOnePlus instrument (Applied Biosystems) using SYBR Green Master Mix (Enzo Life Sciences, USA). Target genes included \u003cem\u003eCDKN1A\u0026nbsp;\u003c/em\u003e(p21), \u003cem\u003eBAX, BCL-2, MMP2\u003c/em\u003e, and \u003cem\u003eMMP9\u003c/em\u003e, with \u0026beta;\u003cem\u003e-actin\u003c/em\u003e as the reference. Primer details are listed in Table 1. Expression levels were determined by the 2\u0026minus;\u0026Delta;\u0026Delta;Ct approach.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eStatistical Analyses\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eAll experiments were repeated three times. Data are reported as mean values with standard deviations (SD). One-way ANOVA with Duncan\u0026rsquo;s post hoc test was used for TAA, TPC, and RP analyses. MTT, colony formation, and wound healing results were analyzed with two-way ANOVA and Tukey\u0026rsquo;s post hoc test. Student\u0026rsquo;s t-test was applied for gene expression analysis. Differences with p \u0026lt; 0.05, p \u0026lt; 0.01, and p \u0026lt; 0.001 were considered statistically significant.\u0026nbsp;\u003c/p\u003e"},{"header":"Results and Discussion","content":"\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eIn-vitro Antioxidant Capacity of Alchemilla Vulgaris Ethyl Acetate Extract\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eAcross the tested concentration range (1\u0026ndash;10 mg/mL), AVEA exhibited an apparent dose-dependent increase in total antioxidant activity (TAA, ferric\u0026ndash;thiocyanate method; 60 h, 500 nm), reducing power (RP; 700 nm), and total phenolic content (TPC). Specifically, TAA inhibition rose from 75.8% at 1 mg/mL to 85.3% at 10 mg/mL, while the corresponding absorbance decreased from 0.844 \u0026plusmn; 0.006 to 0.513 \u0026plusmn; 0.003 (lower absorbance reflecting higher inhibition in this assay). RP increased from 0.066 \u0026plusmn; 0.006 to 1.298 \u0026plusmn; 0.003, and TPC increased from 16.81 \u0026plusmn; 0.053 to 26.49 \u0026plusmn; 0.050 mg GAE/g lyophilizate (Table 2). The positive controls behaved as expected (e.g., Trolox 1 mg/mL: 82.1% inhibition). The parallel rise in TPC with both TAA and RP indicates that phenolic enrichment accounts for much of the antioxidant capacity observed in AVEA, aligning with prior reports that link phenolic abundance to stronger radical-scavenging and electron-donating properties in \u003cem\u003eA. vulgaris\u003c/em\u003e and related botanicals [21, 26, 34, 35]. Polyphenols can quench radicals through hydrogen/electron donation, and may, to a limited extent, modulate redox-sensitive signaling pathways (e.g., NF-\u0026kappa;B, Nrf2) [36, 37]. Consistent with solvent-polarity effects, ethyl acetate extraction frequently yields fractions enriched in mid-polarity phenolics that track with higher RP and TAA metrics [21, 26]. These findings confirm a significant dose\u0026ndash;response relationship in the antioxidant properties of the ethyl acetate extract of A. vulgaris, indicating that phenolic compounds play a significant role in this activity (Table 2).\u003c/p\u003e\n\u003ch2\u003e\u003cstrong\u003e\u003cem\u003eIn vitro Anticancer Properties of A. vulgaris Extract\u003c/em\u003e\u003c/strong\u003e\u003c/h2\u003e\n\u003ch3\u003e\u003cstrong\u003e\u003cem\u003eEffect on Cell Viability\u003c/em\u003e\u003c/strong\u003e\u003c/h3\u003e\n\u003cp\u003eMTT assay results demonstrated a pronounced dose- and time-dependent reduction in cell viability\u0026nbsp;in the medullary thyroid carcinoma cell line (MTC-TT) following treatment with the ethyl acetate extract of \u003cem\u003eA. vulgaris\u003c/em\u003e (AVEA) (Figure 1). The IC₅₀ values were calculated as\u0026nbsp;43.6 \u0026micro;g/mL at 24 h, 40.9 \u0026micro;g/mL at 48 h, and 18.9 \u0026micro;g/mL at 72 h (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.005). In contrast, cytotoxicity was less pronounced in the non-malignant WI-38 fibroblast line, with IC₅₀ values of\u0026nbsp;78.3, 74.9, and 72.3 \u0026micro;g/mL\u0026nbsp;at the corresponding time points (Figure 2). The resulting selectivity indices (SI; WI-38/MTC-TT) of\u0026nbsp;1.80, 1.83, and 3.83\u0026nbsp;indicate that the extract preferentially targets tumor cells, particularly after 72 h of exposure.\u0026nbsp;These findings are consistent with previous reports showing that \u003cem\u003eA. vulgaris\u003c/em\u003e extracts prepared with different solvents exert cytotoxic effects across a range of cancer cell types. For example, the ethyl acetate fraction exhibited the lowest IC₅₀ value (18.7 \u0026micro;g/mL) in PC-3 prostate cancer cells, highlighting its tumor-selective profile [21]. Similarly, in breast (MDA-MB-231), bladder (T24), and lung (A549) cancer cells, treatment with 1 mg/mL extract for 72 h reduced viability by 75%, 62.9%, and 45.5%, respectively, underscoring the role of phenolic compounds in mediating cytotoxicity [35]. Ethanol extracts of \u003cem\u003eA. vulgaris\u003c/em\u003e also induced dose-dependent cytotoxicity in A549 and HCT116 cells with IC₅₀ values of approximately 36 \u0026micro;g/mL [26], nd high tumor selectivity was observed in 4T1 and human breast cancer cells after 72 h of treatment [27]. In addition, investigations on melanoma have demonstrated that the extract produces a pronounced loss of viability in highly invasive B16F10 cells. In contrast, the effect is more limited in the less aggressive B16F1 subline, suggesting that cellular invasiveness may influence sensitivity to treatment [28]. Consistently, the ethyl acetate fraction exhibited potent cytotoxic activity in SH-SY5Y neuroblastoma cells, with an IC₅₀ value of 12.29 \u0026micro;g/mL [38]. In contrast, the methanol/water extract displayed only moderate effects in PC-3, MCF-7, and Caco-2 cells (IC₅₀: 88.6\u0026ndash;110.5 \u0026micro;g/mL), yet demonstrated notable selectivity toward PC-3 cells, as indicated by a high SI value of 6.7 [25]. Furthermore, the extract\u0026apos;s dose-dependent bidirectional effects were demonstrated by noting that viability was maintained at high concentrations in healthy human lymphocytes, while significant decreases were observed at low concentrations [39]. The time-dependent increase in cytotoxicity and SI values observed in our study may be linked to the so-called \u0026ldquo;antioxidant paradox.\u0026rdquo; In cancer cells, elevated metabolic activity and increased intracellular Fe\u0026sup2;⁺/Fe\u0026sup3;⁺ and Cu\u0026sup2;⁺ ion levels facilitate redox cycling of flavonoids. Catechol-type structures in the B ring of flavonoids can reduce these metal ions, which subsequently react with intracellular H₂O₂ to generate highly reactive hydroxyl radicals. This pro-oxidant effect may trigger oxidative stress\u0026ndash;related cell death pathways, including apoptosis, necrosis, or ferroptosis [29]. Thus, the phenolic richness of \u003cem\u003eA. vulgaris\u0026nbsp;\u003c/em\u003eethyl acetate extract likely contributes not only to its antioxidant potential but also to its pro-oxidant cytotoxic effects, selectively enhancing its activity against cancer cells.\u003c/p\u003e\n\u003ch3\u003e\u003cstrong\u003e\u003cem\u003eApoptotic Effect\u003c/em\u003e\u003c/strong\u003e\u003c/h3\u003e\n\u003cp\u003eTo investigate whether the reduction in cell viability was associated with apoptosis, TUNEL staining was performed at 48 and 72 h (Figures 3 and 4). In MTC-TT cells treated with the IC₅₀ dose of the ethyl acetate extract, the total cell number at 48 h was 225.0 \u0026plusmn; 10.0 (n = 3), with 13.0 \u0026plusmn; 4.0 apoptotic cells, corresponding to an apoptotic index of 5.8%. At 72 h, the total cell number declined to 53.0 \u0026plusmn; 6.0, while the number of apoptotic cells increased to 16.0 \u0026plusmn; 4.0, yielding an apoptotic rate of 30.2% (\u003cem\u003ep\u003c/em\u003e = 0.0029). These findings indicate a time-dependent increase in apoptosis, confirming the pro-apoptotic activity of the extract. Consistent with these morphological data, gene expression analysis revealed a marked upregulation of the pro-apoptotic \u003cem\u003eBAX\u0026nbsp;\u003c/em\u003egene and downregulation of the anti-apoptotic\u0026nbsp;\u003cem\u003eBCL-2\u003c/em\u003e gene (Figure 5). After 48 h of treatment,\u0026nbsp;\u003cem\u003eBAX\u003c/em\u003e expression increased\u0026nbsp;2.01 \u0026plusmn; 0.06-fold (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001), whereas \u003cem\u003eBCL-2\u003c/em\u003e expression decreased to\u0026nbsp;0.22 \u0026plusmn; 0.004-fold (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001) relative to the control. At 72 h, \u003cem\u003eBAX\u003c/em\u003e expression further increased (2.65 \u0026plusmn; 0.09-fold, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001), while \u003cem\u003eBCL-2\u0026nbsp;\u003c/em\u003eexpression remained strongly suppressed (0.24 \u0026plusmn; 0.03-fold, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001). These results are consistent with previous studies that have reported apoptosis induction by A. vulgaris extracts in various tumor models. For example, ethanol extracts induced both early and late apoptosis in lung cancer cells after 72 hours\u0026nbsp;[26]. In melanoma, a stronger apoptotic response was observed in the highly invasive B16F10 line than in the less aggressive B16F1 line, although caspase activation remained limited\u0026nbsp;[28]. Similarly, in 4T1 breast cancer cells, exposure to the extract induced early apoptosis in the majority of cells, accompanied by only mild caspase activation\u0026nbsp;[27]. In PC-3 prostate cancer cells, increased apoptosis correlated with elevated \u003cem\u003eBAX\u003c/em\u003e and reduced \u003cem\u003eBCL-2\u0026nbsp;\u003c/em\u003eexpression\u0026nbsp;[25]. Comparable findings were also obtained in MTC-TT cells treated with ferulic acid, which upregulated \u003cem\u003eBAX\u003c/em\u003e while downregulating BCL-2\u0026nbsp;[40], and with boric acid, which was shown to modulate Bcl-2 family members toward a pro-apoptotic profile\u0026nbsp;[41]. The observed increase in \u003cem\u003eBAX/BCL-2\u003c/em\u003e ratio enhances mitochondrial outer membrane permeability, promoting cytochrome c release and activation of the intrinsic apoptotic cascade. This is consistent with the well-documented role of polyphenolic compounds in shifting the \u003cem\u003eBAX/BCL-2\u003c/em\u003e balance toward apoptosis, thereby contributing to the antitumor activity of the extract.\u003c/p\u003e\n\u003ch3\u003e\u003cstrong\u003e\u003cem\u003eAntiproliferative effect\u003c/em\u003e\u003c/strong\u003e\u003c/h3\u003e\n\u003cp\u003eVisual evidence from colony formation assays after treatment of MTC-TT cells with A. vulgaris ethyl acetate extract at IC₅₀ doses for 24, 48, and 72 hours is presented in Figure 6. The untreated control and solvent (1% DMSO) groups showed stable proliferation over time, with average colony counts of 222.0 \u0026plusmn; 3.0 and 207.0 \u0026plusmn; 5.0 at 24 h, 266.0 \u0026plusmn; 3.0 and 239.0 \u0026plusmn; 5.0 at 48 h, and 287.0 \u0026plusmn; 3.0 and 248.0 \u0026plusmn; 5.0 at 72 h, respectively. In contrast, extract-treated cells exhibited markedly reduced colony formation, with counts of 106,0 \u0026plusmn; 15,0, 106,0 \u0026plusmn; 15,0, and 78,0 \u0026plusmn; 5,0 \u0026nbsp;at 24, 48, and 72 h, corresponding to 51%, 45%, and 31% inhibition, respectively (p \u0026lt; 0.001). These findings clearly indicate that A. vulgaris ethyl acetate extract exerts a time-dependent suppression of proliferative capacity in MTC-TT cells. At the molecular level, the expression of\u0026nbsp;\u003cem\u003eCDKN1A\u003c/em\u003e (p21) exhibited a dual-phase expression profile. A marked suppression was observed at 48 hours (0.4974 \u0026plusmn; 0.01084-fold, p \u0026lt; 0.0001), whereas by 72 hours transcript levels had risen substantially, reaching 4.251 \u0026plusmn; 0.1171-fold compared with the control (p \u0026lt; 0.0001) (Figure 5). The late-phase increase in p21 is consistent with prior studies showing that various phytochemicals suppress cell cycle progression through p53-independent or partially p53-dependent induction of p21 [42, 43]. The late-phase increase in p21 is consistent with prior studies showing that various phytochemicals suppress cell cycle progression through p53-independent or partially p53-dependent induction of p21[42, 43].\u0026nbsp;In MTC models, elevated CDK5 activity has also been linked to increased p21 at both mRNA and protein levels (Pozo et al., 2015), suggesting that our results align with previously described regulatory mechanisms\u0026nbsp;[44]. The transient reduction at 48 h may reflect early stress-induced suppression of p21 transcription, proteasome-mediated degradation, or functional relocalization of p21 as reported for other plant-derived compounds\u0026nbsp;[45, 46]. Such dynamic regulation indicates that the antiproliferative effect of the extract involves time-dependent molecular switching, where transient loss of p21 is compensated by a strong late-phase induction, ultimately reinforcing growth inhibition.\u0026nbsp;These results are consistent with previous reports on different tumor models, where cell division was suppressed in A549 lung carcinoma\u0026nbsp;[26], proliferation was inhibited through G1-phase cell cycle arrest in PC-3 prostate carcinoma\u0026nbsp;[25], colony-forming capacity was reduced by approximately 20% in 4T1 breast carcinoma\u0026nbsp;[27], and colony viability was significantly decreased in SH-SY5Y neuroblastoma cells\u0026nbsp;[38]. Overall, the evidence suggests that the ethyl acetate extract of A. vulgaris exhibits notable antiproliferative activity, which appears to be mediated, at least in part, by the regulation of the p21 pathway.\u003c/p\u003e\n\u003ch3\u003e\u003cstrong\u003e\u003cem\u003eAnti-migratory Effect\u003c/em\u003e\u003c/strong\u003e\u003c/h3\u003e\n\u003cp\u003eThe wound-healing assay performed in MTC-TT cells demonstrated that treatment with the ethyl acetate extract of \u003cem\u003eA. vulgaris\u003c/em\u003e at IC₅₀ concentrations led to a marked inhibition of migration (Figure 7). Pixel-based quantification of wound closure revealed closure rates of 54.83% \u0026plusmn; 1.36 at 24 h, 55.67% \u0026plusmn; 3.93 at 48 h, and 58.30% \u0026plusmn; 2.79 at 72 h compared with controls (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001). In contrast to the control and solvent groups, the wound area did not close significantly over the 24\u0026ndash;72 h period, underscoring the inhibitory effect of the extract on cell motility. Expression profiling demonstrated that the anti-migratory effect of the extract was accompanied by marked alterations in invasion-related genes, as shown in Figure 5. At 48 h, \u003cem\u003eMMP2\u0026nbsp;\u003c/em\u003etranscript levels decreased to 0.01920 \u0026plusmn; 0.006306-fold (\u003cem\u003ep\u003c/em\u003e = 0.0382), while \u003cem\u003eMMP9\u0026nbsp;\u003c/em\u003eexpression was reduced to 0.1825 \u0026plusmn; 0.004424-fold (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001) compared with controls. Following this early suppression, both genes displayed a compensatory increase at 72 h, with \u003cem\u003eMMP2\u003c/em\u003e rising to 1.311 \u0026plusmn; 0.07614-fold (\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001) and \u003cem\u003eMMP9\u003c/em\u003e to 1.449 \u0026plusmn; 0.1039-fold (\u003cem\u003ep\u003c/em\u003e = 0.0002). These results suggest that the inhibitory effect of A. vulgaris ethyl acetate extract on cell migration is closely associated with the transient downregulation of \u003cem\u003eMMP2\u003c/em\u003e and \u003cem\u003eMMP9\u003c/em\u003e. At the same time, the subsequent upregulation at later time points suggests the activation of adaptive responses that may restore invasive potential.\u0026nbsp;Our results are consistent with previous studies showing reduced migration in 4T1 breast carcinoma cells [27] and significant anti-migratory effects of \u003cem\u003eA. vulgaris\u003c/em\u003e extract in SH-SY5Y neuroblastoma cells [38].\u0026nbsp;The observed transient inhibition of MMP2 and MMP9 at 48 h corresponds to earlier studies, which have shown that the invasive capacity of medullary thyroid carcinoma cells can be reduced through the regulation of these enzymes\u0026nbsp;[40, 47]. The subsequent increase at 72 h may be explained by compensatory cellular mechanisms activated under prolonged stress, as MMP transcription is known to be dynamically regulated via NF-\u0026kappa;B and AP-1 signaling\u0026nbsp;[48, 49]. Moreover, alterations in cell\u0026ndash;cell and cell\u0026ndash;matrix interactions during extended incubation could contribute to the reactivation of MMP expression. Similar time-dependent bidirectional effects of plant-derived compounds on MMP regulation have also been described\u0026nbsp;[50]. Taken together, these data indicate that the ethyl acetate extract of A. vulgaris suppresses migration in MTC-TT cells, likely through early downregulation of \u003cem\u003eMMP2\u003c/em\u003e and \u003cem\u003eMMP9\u003c/em\u003e. However, the subsequent upregulation of gene expression at later stages highlights adaptive mechanisms that may enable tumor cells to restore their invasive capacity partially, emphasizing the need to evaluate long-term treatment effects.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study demonstrates that the ethyl acetate extract of Alchemilla vulgaris exerts significant antitumor activity against medullary thyroid carcinoma (MTC-TT) cells. The extract showed strong antioxidant capacity attributable to its high phenolic content and induced selective cytotoxicity in tumor cells while sparing normal fibroblasts. Treatment activated the intrinsic apoptotic pathway by modulating \u003cem\u003eBAX\u003c/em\u003e and \u003cem\u003eBCL-2\u003c/em\u003e, suppressed clonogenic proliferation in association with the time-dependent regulation of \u003cem\u003eCDKN1A\u003c/em\u003e, and inhibited cell migration through transient downregulation of \u003cem\u003eMMP2\u003c/em\u003e and \u003cem\u003eMMP9\u003c/em\u003e expression. When considered as a whole, these findings indicate that the anticancer activity of A. vulgaris is mediated by multiple, interconnected molecular pathways. Given its low toxicity toward normal cells and broad spectrum of biological effects, the extract may represent a promising candidate for further development as a nutraceutical or adjuvant therapeutic option in aggressive and treatment-resistant thyroid cancers.\u003c/p\u003e"},{"header":"Limitations","content":"\u003cp\u003eThis study has several limitations that should be considered when interpreting the findings. First, all experiments were conducted in vitro and restricted to a single medullary thyroid carcinoma cell line (MTC-TT); therefore, the results cannot be directly extrapolated to in vivo systems or to other thyroid cancer subtypes. Second, the extract tested is a complex phytochemical mixture, and the individual bioactive compounds responsible for the observed effects were not identified, which highlights the need for future studies involving fractionation and characterization of active constituents. Third, the analysis of molecular mechanisms was limited to mRNA expression; protein-level validation and functional assays were not performed, which would have provided more substantial evidence for the biological relevance of the implicated pathways. Fourth, the assessment of temporal dynamics was restricted to selected time points, which may not fully capture intermediate changes, particularly in the expression of \u003cem\u003eCDKN1A\u003c/em\u003e and \u003cem\u003eMMP2/9\u003c/em\u003e. Finally, although the preliminary selectivity data obtained in WI-38 fibroblasts are encouraging, validation using additional non-malignant cell models is required to confirm tumor-specific effects and to strengthen the translational potential of the findings.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of Interest\u003c/h2\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThis study was supported by the Scientific Research Projects Coordination Unit of Kafkas University under project number 2024-TS-54.\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eProject management: GZO. Literature review: GZO, MDU. Data analysis: all authors.Experimental studies: MDU. Article writing and editing: all authors.\u003c/p\u003e\n\u003ch2\u003eAcknowledgement\u003c/h2\u003e\n\u003cp\u003eAll Authors would like to thank the Scientific Research Projects Coordination Unit of Kafkas University for their work on the 2024-TS-54 Project.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBray, F., et al., \u003cem\u003eGlobal cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries.\u003c/em\u003e CA: a cancer journal for clinicians, 2018. \u003cstrong\u003e68\u003c/strong\u003e(6): p. 394-424.\u003c/li\u003e\n\u003cli\u003eBray, F., et al., \u003cem\u003eGlobal cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries.\u003c/em\u003e CA: a cancer journal for clinicians, 2024. \u003cstrong\u003e74\u003c/strong\u003e(3): p. 229-263.\u003c/li\u003e\n\u003cli\u003eHazard, J.B., W.A. HAWK, and G. CRILE JR, \u003cem\u003eMedullary (solid) carcinoma of the thyroid\u0026mdash;a clinicopathologic entity.\u003c/em\u003e The Journal of Clinical Endocrinology \u0026amp; Metabolism, 1959. \u003cstrong\u003e19\u003c/strong\u003e(1): p. 152-161.\u003c/li\u003e\n\u003cli\u003eSahakian, N., F. Castinetti, and P. Romanet, \u003cem\u003eMolecular basis and natural history of medullary thyroid cancer: it is (almost) all in the RET.\u003c/em\u003e Cancers, 2023. \u003cstrong\u003e15\u003c/strong\u003e(19): p. 4865.\u003c/li\u003e\n\u003cli\u003eTorino, F., et al., \u003cem\u003eMedullary thyroid cancer: a promising model for targeted therapy.\u003c/em\u003e Current molecular medicine, 2010. \u003cstrong\u003e10\u003c/strong\u003e(7): p. 608-625.\u003c/li\u003e\n\u003cli\u003eCeolin, L., et al., \u003cem\u003eMedullary thyroid carcinoma beyond surgery: advances, challenges, and perspectives.\u003c/em\u003e Endocrine-related cancer, 2019. \u003cstrong\u003e26\u003c/strong\u003e(9): p. R499-R518.\u003c/li\u003e\n\u003cli\u003eWells Jr, S.A., et al., \u003cem\u003eRevised American Thyroid Association guidelines for the management of medullary thyroid carcinoma: the American Thyroid Association Guidelines Task Force on medullary thyroid carcinoma.\u003c/em\u003e Thyroid, 2015. \u003cstrong\u003e25\u003c/strong\u003e(6): p. 567-610.\u003c/li\u003e\n\u003cli\u003eMaxwell, J.E., et al., \u003cem\u003eMedical management of metastatic medullary thyroid cancer.\u003c/em\u003e Cancer, 2014. \u003cstrong\u003e120\u003c/strong\u003e(21): p. 3287-3301.\u003c/li\u003e\n\u003cli\u003eWeng, C.-J. and G.-C. Yen, \u003cem\u003eFlavonoids, a ubiquitous dietary phenolic subclass, exert extensive in vitro anti-invasive and in vivo anti-metastatic activities.\u003c/em\u003e Cancer and Metastasis Reviews, 2012. \u003cstrong\u003e31\u003c/strong\u003e(1): p. 323-351.\u003c/li\u003e\n\u003cli\u003eWagner, K.-H. and I. Elmadfa, \u003cem\u003eBiological relevance of terpenoids: Overview focusing on mono-, di-and tetraterpenes.\u003c/em\u003e Annals of Nutrition and metabolism, 2003. \u003cstrong\u003e47\u003c/strong\u003e(3-4): p. 95-106.\u003c/li\u003e\n\u003cli\u003eLu, J.-J., et al., \u003cem\u003eAlkaloids isolated from natural herbs as the anticancer agents.\u003c/em\u003e Evidence‐Based Complementary and Alternative Medicine, 2012. \u003cstrong\u003e2012\u003c/strong\u003e(1): p. 485042.\u003c/li\u003e\n\u003cli\u003ePan, M.-H., C.-S. Lai, and C.-T. Ho, \u003cem\u003eAnti-inflammatory activity of natural dietary flavonoids.\u003c/em\u003e Food \u0026amp; function, 2010. \u003cstrong\u003e1\u003c/strong\u003e(1): p. 15-31.\u003c/li\u003e\n\u003cli\u003eAtanasov, A.G., et al., \u003cem\u003eDiscovery and resupply of pharmacologically active plant-derived natural products: A review.\u003c/em\u003e Biotechnology advances, 2015. \u003cstrong\u003e33\u003c/strong\u003e(8): p. 1582-1614.\u003c/li\u003e\n\u003cli\u003eCragg, G.M. and J.M. Pezzuto, \u003cem\u003eNatural products as a vital source for the discovery of cancer chemotherapeutic and chemopreventive agents.\u003c/em\u003e Medical Principles and Practice, 2016. \u003cstrong\u003e25\u003c/strong\u003e(Suppl. 2): p. 41-59.\u003c/li\u003e\n\u003cli\u003eCh\u0026aacute;irez-Ram\u0026iacute;rez, M.H., K.G. de la Cruz-L\u0026oacute;pez, and A. Garc\u0026iacute;a-Carranc\u0026aacute;, \u003cem\u003ePolyphenols as antitumor agents targeting key players in cancer-driving signaling pathways.\u003c/em\u003e Frontiers in pharmacology, 2021. \u003cstrong\u003e12\u003c/strong\u003e: p. 710304.\u003c/li\u003e\n\u003cli\u003eGhedira, K., P. Goetz, and R. Jeune, \u003cem\u003eAlchemilla vulgaris L.: Alch\u0026eacute;mille (Rosaceae).\u003c/em\u003e Phytotherapie-Heidelberg, 2012. \u003cstrong\u003e10\u003c/strong\u003e(4): p. 263.\u003c/li\u003e\n\u003cli\u003eMukhopadhyay, N., et al., \u003cem\u003eNatural product-driven dual COX-LOX inhibitors: Overview of recent studies on the development of novel anti-inflammatory agents.\u003c/em\u003e Heliyon, 2023. \u003cstrong\u003e9\u003c/strong\u003e(3).\u003c/li\u003e\n\u003cli\u003eBoroja, T., et al., \u003cem\u003eThe biological activities of roots and aerial parts of Alchemilla vulgaris L.\u003c/em\u003e South african journal of botany, 2018. \u003cstrong\u003e116\u003c/strong\u003e: p. 175-184.\u003c/li\u003e\n\u003cli\u003eFilippova, E., \u003cem\u003eAntiviral activity of Lady\u0026rsquo;s mantle (Alchemilla vulgaris L.) extracts against orthopoxviruses.\u003c/em\u003e Bulletin of Experimental Biology and Medicine, 2017. \u003cstrong\u003e163\u003c/strong\u003e(3): p. 374-377.\u003c/li\u003e\n\u003cli\u003eChoi, J., et al., \u003cem\u003eEffect of herbal mixture composed of Alchemilla vulgaris and Mimosa on wound healing process.\u003c/em\u003e Biomedicine \u0026amp; Pharmacotherapy, 2018. \u003cstrong\u003e106\u003c/strong\u003e: p. 326-332.\u003c/li\u003e\n\u003cli\u003eVlaisavljević, S., et al., \u003cem\u003eAlchemilla vulgaris agg.(Lady\u0026apos;s mantle) from central Balkan: antioxidant, anticancer and enzyme inhibition properties.\u003c/em\u003e RSC advances, 2019. \u003cstrong\u003e9\u003c/strong\u003e(64): p. 37474-37483.\u003c/li\u003e\n\u003cli\u003eNeagu, E., et al., \u003cem\u003eAssessment of acetylcholinesterase and tyrosinase inhibitory and antioxidant activity of Alchemilla vulgaris and Filipendula ulmaria extracts.\u003c/em\u003e Journal of the Taiwan Institute of Chemical Engineers, 2015. \u003cstrong\u003e52\u003c/strong\u003e: p. 1-6.\u003c/li\u003e\n\u003cli\u003eArbel\u0026aacute;ez, L.F.G., et al., \u003cem\u003eCardioprotection and natural polyphenols: An update of clinical and experimental studies.\u003c/em\u003e Food \u0026amp; function, 2018. \u003cstrong\u003e9\u003c/strong\u003e(12): p. 6129-6145.\u003c/li\u003e\n\u003cli\u003eEbrahimi, R., et al., \u003cem\u003eExploring the links between polyphenols, Nrf2, and diabetes: A review.\u003c/em\u003e Biomedicine \u0026amp; Pharmacotherapy, 2025. \u003cstrong\u003e186\u003c/strong\u003e: p. 118020.\u003c/li\u003e\n\u003cli\u003eIbrahim, O.H., et al., \u003cem\u003ePhytochemical characterization, antimicrobial activity and in vitro antiproliferative potential of Alchemilla vulgaris Auct root extract against prostate (PC-3), breast (MCF-7) and colorectal adenocarcinoma (Caco-2) cancer cell lines.\u003c/em\u003e Plants, 2022. \u003cstrong\u003e11\u003c/strong\u003e(16): p. 2140.\u003c/li\u003e\n\u003cli\u003eJelača, S., et al., \u003cem\u003eBeyond traditional use of Alchemilla vulgaris: genoprotective and antitumor activity in vitro.\u003c/em\u003e Molecules, 2022. \u003cstrong\u003e27\u003c/strong\u003e(23): p. 8113.\u003c/li\u003e\n\u003cli\u003eJelača, S., et al., \u003cem\u003eDual role of Alchemilla vulgaris L. extract in breast cancer regression: reestablishment of effective immune response.\u003c/em\u003e Pharmaceuticals, 2024. \u003cstrong\u003e17\u003c/strong\u003e(3): p. 286.\u003c/li\u003e\n\u003cli\u003eJelača, S., et al., \u003cem\u003eAntimelanoma Effects of Alchemilla vulgaris: A Comprehensive In Vitro and In Vivo Study.\u003c/em\u003e Diseases, 2024. \u003cstrong\u003e12\u003c/strong\u003e(6): p. 125.\u003c/li\u003e\n\u003cli\u003eFarhan, M. and A. Rizvi, \u003cem\u003eUnderstanding the prooxidant action of plant polyphenols in the cellular microenvironment of malignant cells: Role of copper and therapeutic implications.\u003c/em\u003e Frontiers in Pharmacology, 2022. \u003cstrong\u003e13\u003c/strong\u003e: p. 929853.\u003c/li\u003e\n\u003cli\u003eLe\u0026oacute;n-Gonz\u0026aacute;lez, A.J., C. Auger, and V.B. Schini-Kerth, \u003cem\u003ePro-oxidant activity of polyphenols and its implication on cancer chemoprevention and chemotherapy.\u003c/em\u003e Biochemical pharmacology, 2015. \u003cstrong\u003e98\u003c/strong\u003e(3): p. 371-380.\u003c/li\u003e\n\u003cli\u003eMistuda, H., K. Yuasumoto, and K. Iwami, \u003cem\u003eAntioxidation action of indole compounds during the autoxidation of linoleic acid.\u003c/em\u003e 1996.\u003c/li\u003e\n\u003cli\u003eSlinkard, K. and V.L. Singleton, \u003cem\u003eTotal phenol analysis: automation and comparison with manual methods.\u003c/em\u003e American journal of enology and viticulture, 1977. \u003cstrong\u003e28\u003c/strong\u003e(1): p. 49-55.\u003c/li\u003e\n\u003cli\u003eYen, G.-C. and H.-Y. Chen, \u003cem\u003eAntioxidant activity of various tea extracts in relation to their antimutagenicity.\u003c/em\u003e Journal of agricultural and food chemistry, 1995. \u003cstrong\u003e43\u003c/strong\u003e(1): p. 27-32.\u003c/li\u003e\n\u003cli\u003eTrouillas, P., et al., \u003cem\u003eAntioxidant, anti-inflammatory and antiproliferative properties of sixteen water plant extracts used in the Limousin countryside as herbal teas.\u003c/em\u003e Food chemistry, 2003. \u003cstrong\u003e80\u003c/strong\u003e(3): p. 399-407.\u003c/li\u003e\n\u003cli\u003eBilu\u0026scaron;ić, T., I. \u0026Scaron;ola, and V. Čike\u0026scaron; Čulić, \u003cem\u003eIdentification of Flavonoids, Antioxidant and Antiproliferative Activity of Aqueous Infusions of Calendula officinalis L., Chelidonium majus L., Teucrium chamaedrys L. and Alchemilla vulgaris L.\u003c/em\u003e Food technology and biotechnology, 2024. \u003cstrong\u003e62\u003c/strong\u003e(1): p. 49-58.\u003c/li\u003e\n\u003cli\u003eGranado-Serrano, A.B., et al., \u003cem\u003eEpicatechin induces NF-\u0026kappa;B, activator protein-1 (AP-1) and nuclear transcription factor erythroid 2p45-related factor-2 (Nrf2) via phosphatidylinositol-3-kinase/protein kinase B (PI3K/AKT) and extracellular regulated kinase (ERK) signalling in HepG2 cells.\u003c/em\u003e British Journal of Nutrition, 2010. \u003cstrong\u003e103\u003c/strong\u003e(2): p. 168-179.\u003c/li\u003e\n\u003cli\u003ePandey, K.B. and S.I. Rizvi, \u003cem\u003ePlant polyphenols as dietary antioxidants in human health and disease.\u003c/em\u003e Oxidative medicine and cellular longevity, 2009. \u003cstrong\u003e2\u003c/strong\u003e(5): p. 270-278.\u003c/li\u003e\n\u003cli\u003eMoqidem, Y., \u003cem\u003eEvaluation of the Anticancer Potential of Alchemilla vulgaris Extract Against Human Neuroblastoma Cells.\u003c/em\u003e 2021.\u003c/li\u003e\n\u003cli\u003eAl-Osaj, S.L., K.W. Al-Sammarraei, and L. Al-Osaj, \u003cem\u003eCytotoxic evaluation of Alchemilla vulgaris extract in normal blood lymphocytes.\u003c/em\u003e World J. Pharmaceut. Res, 2016. \u003cstrong\u003e5\u003c/strong\u003e(4): p. 237-252.\u003c/li\u003e\n\u003cli\u003eDodurga, Y., et al., \u003cem\u003eAnti-proliferative and anti-invasive effects of ferulic acid in TT medullary thyroid cancer cells interacting with URG4/URGCP.\u003c/em\u003e Tumor Biology, 2016. \u003cstrong\u003e37\u003c/strong\u003e(2): p. 1933-1940.\u003c/li\u003e\n\u003cli\u003eYıldırım, O., et al., \u003cem\u003eIn vitro effects of boric acid on cell cycle, apoptosis, and miRNAs in medullary thyroid cancer cells.\u003c/em\u003e Biological Trace Element Research, 2025. \u003cstrong\u003e203\u003c/strong\u003e(2): p. 799-809.\u003c/li\u003e\n\u003cli\u003eLaka, K. and Z. Mbita, \u003cem\u003eP53-Related anticancer activities of Drimia calcarata bulb extracts against lung cancer.\u003c/em\u003e Frontiers in Molecular Biosciences, 2022. \u003cstrong\u003e9\u003c/strong\u003e: p. 876213.\u003c/li\u003e\n\u003cli\u003eRajabi, L., et al., \u003cem\u003eAqueous and ethanolic extracts of Moringa oleifera leaves induce selective cytotoxicity in Raji and Jurkat cell lines by activating the P21 pathway independent of P53.\u003c/em\u003e Molecular Biology Reports, 2025. \u003cstrong\u003e52\u003c/strong\u003e(1): p. 102.\u003c/li\u003e\n\u003cli\u003ePozo, K., et al., \u003cem\u003eDifferential expression of cell cycle regulators in CDK5-dependent medullary thyroid carcinoma tumorigenesis.\u003c/em\u003e Oncotarget, 2015. \u003cstrong\u003e6\u003c/strong\u003e(14): p. 12080.\u003c/li\u003e\n\u003cli\u003eJung, Y.-S., Y. Qian, and X. Chen, \u003cem\u003eExamination of the expanding pathways for the regulation of p21 expression and activity.\u003c/em\u003e Cellular signalling, 2010. \u003cstrong\u003e22\u003c/strong\u003e(7): p. 1003-1012.\u003c/li\u003e\n\u003cli\u003eGartel, A.L. and A.L. Tyner, \u003cem\u003eThe role of the cyclin-dependent kinase inhibitor p21 in apoptosis.\u003c/em\u003e Molecular cancer therapeutics, 2002. \u003cstrong\u003e1\u003c/strong\u003e(8): p. 639-649.\u003c/li\u003e\n\u003cli\u003eV\u0026aacute;zquez-Lorente, H., et al., \u003cem\u003eMatrix Metalloproteinases 2 and 9 and Their Tissue Inhibitors in the Diagnostics of Medullary Thyroid Carcinoma.\u003c/em\u003e Applied Immunohistochemistry \u0026amp; Molecular Morphology, 2023. \u003cstrong\u003e31\u003c/strong\u003e(2): p. 121-127.\u003c/li\u003e\n\u003cli\u003ePage-McCaw, A., A.J. Ewald, and Z. Werb, \u003cem\u003eMatrix metalloproteinases and the regulation of tissue remodelling.\u003c/em\u003e Nature reviews Molecular cell biology, 2007. \u003cstrong\u003e8\u003c/strong\u003e(3): p. 221-233.\u003c/li\u003e\n\u003cli\u003eKessenbrock, K., V. Plaks, and Z. Werb, \u003cem\u003eMatrix metalloproteinases: regulators of the tumor microenvironment.\u003c/em\u003e Cell, 2010. \u003cstrong\u003e141\u003c/strong\u003e(1): p. 52-67.\u003c/li\u003e\n\u003cli\u003eOverall, C.M. and O. Kleifeld, \u003cem\u003eValidating matrix metalloproteinases as drug targets and anti-targets for cancer therapy.\u003c/em\u003e Nature Reviews Cancer, 2006. \u003cstrong\u003e6\u003c/strong\u003e(3): p. 227-239. \u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e Primer sequences used for quantitative real-time PCR analysis of target genes associated with cell cycle regulation, apoptosis, and invasion. Genes analyzed included \u003cem\u003eCDKN1A\u0026nbsp;\u003c/em\u003e(cyclin-dependent kinase inhibitor 1A, also known as p21), BAX (BCL2-associated X, an apoptosis regulator), \u003cem\u003eBCL-2\u003c/em\u003e (B-cell lymphoma 2), \u003cem\u003eMMP-2\u003c/em\u003e (matrix metalloproteinase 2), and \u003cem\u003eMMP-9\u003c/em\u003e (matrix metalloproteinase 9). \u003cem\u003eACTB\u0026nbsp;\u003c/em\u003e(\u0026beta;-actin) was employed as the endogenous housekeeping control for normalization of gene expression levels.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eGenes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer Sequences (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eCDKN1A (p21)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: GACTGTGATGCGCTAATGGC R: CGTGGGAAGGTAGAGCTTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eBAX\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: AGAGGATGATTGCCGCCGT R: CAACCACCCTGGTCTTGGATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eBCL-2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: TTGGCCCCCGTTGCTT R: CGGTTATCGTACCCCGTTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eMMP2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: TCTCCTGACATTGACCTTGGC R: CAAGGTGCTGGCTGAGTAGATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eMMP9\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: CCTTGTGCTCTTCCCTGGAG R: GGCCCCAGAGATTTCGACTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eACTB (\u0026beta;-actin)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eF: TCCTGTGGCATCCACGAAACT R: GAAGCATTGCGGTGGACGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003eF: forward primer; R: reverse primer.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e Total antioxidant activity (TAA; ferric\u0026ndash;thiocyanate method, read at 500 nm at 60 h), reducing power (RP; 700 nm), and total phenolic content (TPC; mg gallic acid equivalents per g lyophilizate, mg GAE/g) of \u003cem\u003eA. vulgaris\u003c/em\u003e ethyl acetate extract (AVEA). \u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eSamples\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eDose (mg/mL)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eTAA (Absorbance at 60 h, 500 nm)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eTAA (%) Inhibition\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eRP (700 nm, Absorbance)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eTPC (mg GAE/g lyophilizate)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eAVEA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.844 \u0026plusmn; 0.006ᵉ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e75.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.066 \u0026plusmn; 0.006ᵃ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e16.81 \u0026plusmn; 0.053ᵃ\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.696 \u0026plusmn; 0.004ᵈ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e80.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.373 \u0026plusmn; 0.005ᵇ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e22.50 \u0026plusmn; 0.075ᵇ\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.596 \u0026plusmn; 0.005ᶜ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e82.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.947 \u0026plusmn; 0.005ᶜ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e23.55 \u0026plusmn; 0.115ᶜ\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e10.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.513 \u0026plusmn; 0.003ᵇ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e85.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.298 \u0026plusmn; 0.003ᵈ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e26.49 \u0026plusmn; 0.050ᵈ\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eAscorbic acid\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.691 \u0026plusmn; 0.002ᶠ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e38.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eTrolox\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0.279 \u0026plusmn; 0.002ᵃ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e82.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eControl (DMSO)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3.499 \u0026plusmn; 0.003ᵍ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eControl (water)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1.563 \u0026plusmn; 0.003ᵍ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026mdash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003eValues are mean \u0026plusmn; SD (n = 3 independent experiments, each with 3 technical replicates). One-way ANOVA + Dunnett\u0026rsquo;s test vs. vehicle control (DMSO, final \u0026le; 0.5% v/v) for TAA; water control used for RP and TPC. Different letters within a column indicate significant differences. (p \u0026lt; 0.05).\u003c/em\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"A. vulgaris, antioxidant, medullary thyroid carcinoma, apoptosis, antiproliferative, migration","lastPublishedDoi":"10.21203/rs.3.rs-7646704/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7646704/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study examined the antioxidant and anticancer properties of the ethyl acetate extract of \u003cem\u003eAlchemilla vulgaris\u003c/em\u003e L. (\u003cem\u003eA. vulgaris\u003c/em\u003e) against medullary thyroid carcinoma (MTC-TT) cells. Antioxidant activity was measured through assays of total antioxidant capacity, phenolic content, and reducing power. Cytotoxicity, apoptosis, proliferation, and migration were evaluated using MTT, TUNEL, colony formation, and wound-healing assays. Gene expression of \u003cem\u003eCDKN1A, BAX, BCL-2, MMP2\u003c/em\u003e, and \u003cem\u003eMMP9\u003c/em\u003e was analyzed by RT-PCR. The extract showed strong antioxidant potential with high phenolic levels and notable reducing activity. Treatment of MTC-TT cells led to reduced viability in a time- and dose-dependent manner, with increased apoptosis, \u003cem\u003eBAX\u003c/em\u003e induction, \u003cem\u003eBCL-2\u003c/em\u003e repression, and elevation of \u003cem\u003eCDKN1A\u003c/em\u003e expression over time. Colony formation was significantly decreased, and wound healing assays confirmed reduced migration, which was consistent with transient downregulation of \u003cem\u003eMMP2\u003c/em\u003e and \u003cem\u003eMMP9\u003c/em\u003e. Selectivity was evident, as IC₅₀ values were substantially higher in WI-38 normal fibroblasts compared to tumor cells. These findings suggest that \u003cem\u003eA. vulgaris\u003c/em\u003e ethyl acetate extract exerts anticancer activity by influencing apoptosis, cell growth, and migration. Its phenolic richness and robust antioxidant profile highlight the extract as a promising nutraceutical candidate for further in vivo research in aggressive and treatment-resistant cancers such as MTC.\u003c/p\u003e","manuscriptTitle":"Antioxidant and Anticancer Effects of Alchemilla vulgaris Extract on Medullary Thyroid Carcinoma Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-06 13:14:36","doi":"10.21203/rs.3.rs-7646704/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"088159ff-3c16-4594-8978-25bdb3eaf002","owner":[],"postedDate":"October 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-27T17:30:28+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-06 13:14:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7646704","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7646704","identity":"rs-7646704","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}