LncRNA-MSTRG.16919.1 regulates the proliferation of BHV-1 in MDBK cells through TAK1/TAB1/TAB2/TAB3 complexes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LncRNA-MSTRG.16919.1 regulates the proliferation of BHV-1 in MDBK cells through TAK1/TAB1/TAB2/TAB3 complexes Fan Zhang, Caina Song, Jinzhu Ma, Liquan Yu, Chen Peng, Wenxue Wu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9233725/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Background: Bovine herpesvirus type 1 (BHV-1) is the primary pathogen responsible for infectious rhinotracheitis in cattle, leading to significant economic losses in the cattle industry. Long non-coding RNAs (lncRNAs) are multifunctional transcriptional regulators that play a role in the regulation of host-virus-specific interactions. Results: Our previous study found that lncRNA-MSTRG.16919.1 is highly expressed in BHV-1 infected MDBK cells. Functional assays showed that its silencing reduced viral DNA replication, downregulated transcription and protein expression of glycoproteins gB and gD, and decreased virion production, indicating that it promotes BHV-1 proliferation. Further investigation revealed that knockdown of this lncRNA reduced protein levels of TAB1, TAB2, TAB3, and TAK1. To validate the involvement of the TAK1/TABs complex, we overexpressed TAK1 or TAB2 in cells with lncRNA knockdown. Overexpression restored viral DNA synthesis, gB and gD expression, and virus titers, counteracting the suppression caused by lncRNA silencing. Moreover, TAK1 or TAB2 overexpression elevated protein levels of TAB3, TAB1, TAK1, NF-κB, and JNK. Conclusions: These results demonstrate that lncRNA-MSTRG.16919.1 facilitates BHV-1 replication by modulating the TAK1-TABs complex and activating the NF-κB pathway. These findings provide foundational insights for studying the function and regulatory mechanisms of lncRNA-MSTRG.16919.1 in organisms, and contribute to the understanding of the pathogenic mechanisms of BHV-1, aiding in the prevention and control of bovine respiratory diseases. Bovine herpesvirus type I LncRNA-MSTRG.16919.1 TAK1 TAB2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background Infectious Bovine Rhinotracheitis (IBR) is a contact infectious disease caused by Bovine Herpes Virus Type I (BHV-1). Infected cattle exhibit symptoms such as rhinitis, high fever, and respiratory distress. The disease reduces milk production, impairs fertility, hinders fetal growth and development, increases culling and mortality rates, and may even lead to abortion( 1 ). Currently, due to an incomplete understanding of its pathogenic mechanism, no effective prevention or control measures are available. Therefore, investigating the pathogenic mechanism of BHV-1 and developing preventive strategies are crucial. Bovine Herpes Virus Type I (BHV-1) belongs to the α-herpesvirus subfamily of the Herpesviridae family. Its genome consists of double-stranded DNA and encodes approximately 33 structural proteins. Among them, gB, gC, and gD are glycoproteins on the viral surface that facilitate host cell invasion and viral spread. These glycoproteins also serve as key antigens in activating the host immune response( 2 ). Long non-coding RNAs (lncRNAs) are a class of non-coding RNAs longer than 200 nucleotides, lacking a complete open reading frame (ORF). Thousands of lncRNAs are regulated by RNA viruses or DNA viruses( 3 ). When the body is infected by a virus, the host cells counteract the infection by generating various lncRNAs. Meanwhile, the virus itself can also alleviate the activation of antiviral cells by expressing various lncRNAs, thereby promoting and establishing its infection( 4 ). Transforming growth factor-beta activator protein 1 (TAK1), a member of the mitogen-activated protein kinase (MAP3K) family( 5 ), is an important regulatory molecule of the innate immune system, capable of participating in inflammatory and antiviral immune responses. TAK1 is activated by pro-inflammatory cytokines, including tumor necrosis factor-α (TNFα) and interleukin-1β (IL-1β), and mediates the activation of nuclear factor-κB (NF-κB), c-Jun N-terminal kinase (JNK) and p38 MAPK( 6 – 8 ). In all these pathways, TAK1 is considered a key regulator of NF-κB and MAPKs( 9 ). TAK1 and MAP3K7-binding protein 2 (TAB2) are evolutionarily conserved genes present in both plants and animals. As an adaptor protein, TAB2 participates in multiple signaling pathways, including IL-1, mitogen activated protein kinase (MAPK)( 10 ), JNK, and NF-κB pathways( 11 ). Liu et al demonstrated that TAB2 SUMOylation disrupts tumor necrosis factor receptor associated factor 6 (TRAF6) recruitment by the TAB2/TAK1 complex, thereby inhibiting downstream MAPK and NF-κB signaling pathways( 12 ). In addition, Gong et al found that overexpression of rhesus monkey TRIM5α (TRIM5arh) inhibited HIV-1 long terminal repeat (HIV-1 LTR) promoter activity by downregulating TAK1/TAB1/TAB2/TAB3 complex-mediated NF-κB activation and promoting TAB2 degradation via the lysosomal pathway( 13 ). Lei et al reported that EV71 suppresses NF-κB activation by targeting the TAK1/TAB1/TAB2/TAB3 complex. The interaction between enterovirus 71 (EV71) and the TAK1 complex influences viral infection( 14 ). The TAK1-TABs complex phosphorylates inhibitor of κB kinase β (IKKβ) at Ser177 and Ser181, which is essential for NF-κB activation( 15 ). Additionally, the TAK1-TAB complex is crucial for interleukin-1 receptor (IL-1R), tumor necrosis factor receptor (TNFR), and TLR-mediated signaling pathways, which activate MAPK and NF-κB( 16 ). Whether lncRNA-MSTRG.16919.1 consequently promotes BHV-1 proliferation by targeting the TAK1/TAB1/TAB2/TAB3 complex remains unclear. Previous studies demonstrated that the expression of lncRNA-MSTRG.16919.1 was upregulated following BHV-1 infection. Since this lncRNA is newly identified, its exact function remains unknown. To investigate the function and mechanism of lncRNA-MSTRG.16919.1 , we examined its subcellular localization and analyzed its effects on BHV-1 replication and the expression of TAK1/TAB1/TAB2/TAB3 under lncRNA-MSTRG.16919.1 knockdown. This approach aimed to further elucidate the molecular mechanism by which lncRNA-MSTRG.16919.1 promotes BHV-1 proliferation and to provide a reference for studying the pathogenesis of BHV-1. Results The results of LncRNA-MSTRG.16919.1 expression and subcellular localization LncRNA-MSTRG.16919.1 is a novel lncRNA identified by transcriptome sequencing of BHV-1 infected MDBK cell samples in our research team. To confirm the accuracy of the sequencing results, the expression of this gene was assessed using RT-qPCR. The results indicated that its expression was upregulated following BHV-1 infection, consistent with the sequencing data, as shown in Figure 1A. The function of lncRNAs is closely linked to their subcellular localization. To further investigate the function of lncRNA-MSTRG.16919.1 , its cellular localization was examined by software prediction, nuclear and cytoplasm separation experiments and in situ hybridization experiments. The results predicted by lncLocator showed 89.5% of lncRNA-MSTRG.16919.1 was in the cytoplasm and 6.8% in the nucleus (Table 1). The results of nucleoplasmic separation experiment showed that lncRNA-MSTRG.16919.1 was distributed predominantly in the cytoplasm (89%) with a minor nuclear fraction (11%). However, upon BHV-1 infection, its cytoplasmic localization increased to 94%, while nuclear levels dropped to approximately 5%, suggesting that roughly 5% of lncRNA-MSTRG.16919.1 was relocalized from the nucleus to the cytoplasm (Figure 1B and 1C). GAPDH and 18S were used as a cytoplasmic reference and U6 was used as a nuclear reference. The results of the fluorescence in situ hybridization (FISH) assays are shown in Fig. 1D, which generally align with the results of nuclear-cytoplasmic fractionation assay and the software prediction. These findings suggest that 1ncRNA-MSTRG.16919.1 is mainly located in the cytoplasm and a small portion of 1ncRNA-MSTRG.16919.1 is transferred from the nucleus to the cytoplasm of cells following viral infection. Table 1 The Result of lncRNA-MSTRG.16919.1 in lncLocator Prediction Subcellular locations Score Cytoplasm 0.895 Nucleus 0.068 Ribosome 0.011 Cytosol 0.023 Exosome 0.002 The results of LncRNA-MSTRG.16919.1 silencing and BHV-1 proliferation-related factors detection To investigate the effect of lncRNA-MSTRG.16919.1 on BHV-1 replication, siRNA targeting lncRNA-MSTRG.16919.1 was transfected into MDBK cells to interfere with its function, then cells were inoculated with BHV-1. The copy number of BHV-1 DNA, mRNA and protein levels of glycoproteins gB and gD, and the production of viral particle were measured. The results showed the copy number of viral DNA is significant reduced in 6T group (Figure 2A), indicating that silencing lncRNA-MSTRG.16919.1 inhibits viral DNA replication. The transcript level (Figure 2B-D) and protein expression (Figure 2G) analysis of glycoprotein gB and gD genes were significantly reduced in group 6T, further indicating that lncRNA-MSTRG.16919.1 promotes BHV-1 replication in MDBK cells. To assess the effect of lncRNA-MSTRG.16919.1 on viral yield, the tissue culture infective dose 50% (TCID 50 ) and performed plaque assays were measured under lncRNA-MSTRG.16919.1 interference. The number of CPE wells was recorded. The data were calculated using the Reed-Muench method, and the TCID 50 values of each group were as follows: the TCID 50 of the 6T group was 8.7×10 4 / mL, the TCID 50 of the NC group was 2.3×10 5 / mL, and the TCID 50 of the MB group was 2.96×10 5 /mL, and the obtained TCID 50 values were plotted in a bar graph. As shown in Figure 2E, the TCID 50 values in the 6T group were significantly higher than those in the other groups, indicating that silencing lncRNA-MSTRG.16919.1 inhibited viral replication. The results of the plaque assays (Figure 2F) showed that the viral titres were 6.33 × 10 5 (PFU/mL) for 6T, 8.83 × 10 5 (PFU/mL) for NC, and 1.25 × 10 6 (PFU/mL) for MB. The 6T group exhibited a lower viral titer compared to the NC and MB groups, indicating that silencing lncRNA-MSTRG.16919.1 suppressed viral replication. These results suggest that lncRNA-MSTRG.16919.1 promotes BHV-1 proliferation in MDBK cells. LncRNA-MSTRG.16919.1 involved in NF-κB and MAPK signaling pathways As lncRNA-MSTRG.16919.1 is a novel lncRNA, its function and mechanism have not been reported. To investigate the molecular mechanism by which lncRNA-MSTRG.16919.1 promotes viral proliferation, transcriptome sequencing was performed on lncRNA-MSTRG.16919.1 silenced samples. The results of this analysis were previously published by our team(17). Data analysis revealed that lncRNA-MSTRG.16919.1 may be involved in NF-κB and MAPK signaling pathways. Some literatures also reported that some proteins such as TAK1/TAB1/TAB2/TAB3 complex were involved in the activation of NF-κB signaling pathway. Therefore, the expression of TAB3, TAK1, TAB1, NF-κB, JNK, IκB, p-IκB, and other proteins associated with NF-κB and MAPK were examined. The results were shown in Figure 3. the expression of TAB3, TAK1, TAB1, NF-κB, JNK, p-IκB proteins were downregulated in 6T group compared to the NC, MB, and MDBK cell groups, suggesting that lncRNA-MSTRG.16919.1 influences TAK1/TAB1/TAB2/TAB3 complex and the NF-κB signaling pathway. Construction of TAK1 or TAB2 overexpressing cell lines To demonstrate that lncRNA-MSTRG.16919.1 interacts with the TAK1/TAB1/TAB2/TAB3 complex, TAK1 or TAB2 genes were constructed into lentiviral vectors (Previous research in our team). Recombinant lentiviral were transfected into MDBK cells, and Western blot analysis revealed elevated expression of TAK1 and TAB2 proteins, confirming that TAK1 and TAB2 were effectively expressed in MDBK cells (Figure 4). The results of knockdown of lncRNA-MSTRG.16919.1 in cells overexpression TAK1 or TAB2 and BHV-1 proliferation-related factors detection To further investigate whether the effect of lncRNA-MSTRG.16919.1 on BHV-1 proliferation occurs through the TAK1/TAB1/TAB2/TAB3 complex, we performed a knockdown of lncRNA-MSTRG.16919.1 in TAK1 and TAB2 stable-expressed cells. These cells were then inoculated with the BHV-1. The transcription levels of the viral glycoproteins B and D are shown in Figures 5A and 5B. When lncRNA-MSTRG.16919.1 were silenced in cells overexpression TAK1 or TAB2, the transcription levels of the viral glycoproteins B and D were restored (6T group). The trend in protein expression changes followed the same pattern as the transcription levels (Figures 5F). The results of the viral TCID50 experiments were as follows: the TCID50 was 1.23×107/mL in the overexpression TAK1 group, 9.4×106/mL in the overexpression TAB2 group, 8.7×105/mL in the 6T group, and 4×106/mL in the MB group, and the obtained TCID50 values were plotted on a bar graph, and the results are shown in Figure 5C. The analysis showed that viral titers were increased in the overexpression of TAK1 and TAB2 groups. Statistical results from the plaque assay were shown in Figures 5D, further confirmed the increased viral titers in these groups. The results of viral DNA copy number experiments are shown in Figures 5E. The results showed that the amount of BHV-1 viral nucleic acid was elevated in the overexpression TAK1 and TAB2 groups. These findings indicate that overexpression of TAK1 and TAB2 restored the inhibition of viral replication caused by lncRNA-MSTRG.16919.1 knockdown. Results of protein levels of NF-κB signaling pathway-related genes In order to detect the effect on NF-κB signaling pathway after overexpression of TAK1 and TAB2, we examined the protein levels of the relevant genes, and the results of the Western Blot experiments are shown in Fig. 6, when overexpression of TAK1 and TAB2, the protein expression levels of TAB3, TAK1, TAB1, NF-κB, and JNK increased, while the IκB level decreased, indicating that the inhibitory effect of lncRNA-MSTRG.16919.1 on BHV-1 was attenuated when overexpressing TAK1 or TAB2. Discussion BHV-1, a member of the herpesvirus family, causes multiple diseases in cattle. At present, the replication and growth characteristics of BHV-1 virus have been relatively clear, but the pathogenic mechanism of BHV-1, and the interaction between the BHV-1 and the host still requires further research, which is very beneficial for the prevention and control of infectious bovine rhinotracheitis. Long non-coding RNAs are a class of molecules with poly-A tails but do not encode proteins. and can be specifically expressed in different tissues. It was previously regarded as transcriptional noise( 18 – 20 ). LncRNAs have a variety of functions, including regulation of transcription patterns, modulation of protein activity, and serving as precursors for small RNAs( 21 , 22 ). Recent studies indicate that some viruses can regulate host and viral gene expression by regulating lncRNAs that have an effect on viral latency or replication. For example, when influenza A virus (IAV) infects A549 cells, a novel lncRNA reduces IAV replication by affecting the expression of interferon β1, suggesting that this lncRNA is a key regulator of the host antiviral response( 23 ). Conversely, some lncRNAs facilitate viral replication by evading cytoplasmic surveillance, thereby weakening antiviral immunity( 24 ). For example, the 3’-untranslated region (3’UTR) of the flavivirus genome can transcribe small ncRNAs, namely subgenomic flavivirus RNA (sfRNA). This lncRNA shields viral RNA in infected cells from degradation by host exoribonuclease 1 (XRN1)( 25 ). It remains unclear whether lncRNAs are produced following BHV-1 infection and what regulatory effects they may have on the virus. Our study revealed that lncRNA-MSTRG.16919.1 expression was up-regulated in MDBK cells post-BHV-1 infection( 17 ). As this is a newly identified gene with an unknown function, further research is needed to elucidate its role and underlying mechanisms. We analyzed lncRNA-MSTRG.16919.1 expression at the transcriptional level using RT-qPCR. The results confirmed an up-regulation trend consistent with sequencing data, warranting further investigation. The subcellular localization of lncRNAs is closely associated with their function( 26 ). In the nucleus, lncRNAs interact with chromatin to modulate transcriptional regulation, influencing nuclear spatial organization( 27 ). In the cytoplasm, lncRNAs regulate post-transcriptional processes, including signal transduction, translation, and gene expression( 28 ). LncRNA-MSTRG.16919.1 are newly identified, it is essential to determine his subcellular localization. So we applied the lncLocator online prediction software to predict the subcellular localization of lncRNA-MSTRG.16919.1 by sequence, and the results showed that lncRNA-MSTRG.16919.1 is found mainly in the cytoplasm, with a small amount is present in the nucleus. Nucleoplasm fractionation and fluorescence in situ hybridization (FISH) experiments further confirmed that lncRNA-MSTRG.16919.1 is primarily localized in the cytoplasm, with a minor presence in the nucleus. According to nucleoplasm fractionation data, 89% of lncRNA-MSTRG.16919.1 was localized in the cytoplasm in uninfected cells. Upon viral infection, its cytoplasmic proportion increased to 94%, suggesting a minor translocation from the nucleus to the cytoplasm. These findings suggest that lncRNA-MSTRG.16919.1 may regulate gene expression at the post-transcriptional level. The BHV-1 genome encodes approximately 33 structural proteins, and both gB and gD proteins belong to the structural proteins of the virus, and the amount of their protein expression can reflect the number of viruses to a certain extent. Thus, gB and gD genes were selected to investigate the impact of lncRNA-MSTRG.16919.1 on viral proliferation. Their expression was analyzed at both transcriptional and protein levels, and viral titers were measured using TCID 50 and the plaque assay. Combined experimental results indicate that lncRNA-MSTRG.16919.1 enhances BHV-1 proliferation in MDBK cells. TAK1 is an important molecule in the natural immune signaling pathway and can undergo phosphorylation, ubiquitination and acetylation upon stimulation. TAK1-binding protein 2 (TAB2) is a protein that binds to TAK1 and belongs to the TAB family, which also includes TAB1 and TAB3. Typically, TAB2 binds to TAK1, TAB1, and TAB3 to form the TAK1/TAB1/TAB2/3 complex, thereby regulates the activation of TAK1 and thus its biological functions( 29 ). Many viruses affect the activity of NF-κB and/or MAPK signaling pathways by modulating the TAK1-TABs complex( 6 ). Latent membrane protein 1 (LMP1) of human herpesvirus (Epstein-Barr virus, EBV) is a transmembrane protein capable of activating the NF-κB signaling pathway through activation of the signaling factor TNF. Studies have shown that the transmembrane region of LMP1 promotes the formation of TAK1-TAB2 complex by recruiting TRAF6, TAB2 and TAK1, which further activates the downstream JNK/MAPK signaling pathway. In addition, EBV is capable of interacting with host GPX4 and affecting the TAK1-TAB1/TAB3 complex, which regulates TAK1 kinase activity and further activates the downstream JNK/MAPK and NF-κB pathways( 30 ). Moreover, Herpes simplex virus (HSV), for example, is able to activate NF-κB upon infection of macrophages by activating IKK via upstream cytokines such as TAK1, MEKK1 and NIK( 31 , 32 ); Sendai virus (SeV) activates NF-κB and p38/MAPK signaling pathways via the RIG-I pathway during infection of fibroblasts and dendritic cells, in which TAK1-TABs also play an important role( 33 ). Thus, viruses regulate the activity of the TAK1-TABs complex through a variety of pathways, which in turn affect signaling pathway transduction, regulate gene transcription and cytokine production, and ultimately affect viral replication. Preliminary studies in our laboratory found that lncRNA-MSTRG.16919.1 may be involved in NF-κB, MAPK signaling pathway. Combined with the reports in the above literature, we focused our study on the TAK1/TAB1/TAB2/TAB3 complex, and the results confirmed that after silencing of lncRNA-MSTRG.16919.1 , the protein expression levels of TAK1, TAB1, TAB3 were all different degrees of down-regulation. It was demonstrated that lncRNA-MSTRG.16919.1 was associated with the TAK1/TAB1/TAB2/TAB3 complex. In order to verify the effect of TAK1/TAB1/TAB2/TAB3 complex, we constructed the TAK1 and TAB2 stably-transfected cell lines with lentiviral vectors on MDBK cells. On this basis, the effect of TAK1/TAB1/TAB2/TAB3 complex on virus proliferation was studied by knocking down lncRNA-MSTRG.16919.1. The results showed that overexpression of TAK1, TAB2 backfills the inhibition of viral replication caused by knockdown of lncRNA-MSTRG.16919.1 . In this study, we quantified the viral transcript level, protein level, DNA copy number and viral particles by down-regulating lncRNA-MSTRG.16919.1 , which resulted in significant inhibition of viral proliferation, suggesting that lncRNA-MSTRG.16919.1 has the role of promoting BHV-1 proliferation in MDBK. Through transcriptome sequencing of lncRNA-MSTRG.16919.1 -silenced samples, it was found that TAK1/TAB1/TAB2/TAB3 complex was significantly affected following lncRNA-MSTRG.16919.1 silencing. Viral suppression was attenuated, indicating that overexpression of TAK1 and TAB2 backfills the suppression of viral replication caused by knockdown of lncRNA-MSTRG.16919.1. Meanwhile, after overexpression of TAK1 and TAB2, the expression of TAK1, TAB1, TAB3, were up-regulated. These findings indicate that lncRNA-MSTRG.16919.1 promotes BHV-1 replication in MDBK cells by targeting the TAK1/TAB1/TAB2/TAB3 complex. This study provides basic information on the function and regulatory mechanism of lncRNA-MSTRG.16919.1 in cells, and also beneficial for the prevention and control of infectious bovine rhinotracheitis. Conclusions In summary, our study demonstrates that lncRNA-MSTRG.16919.1 promotes BHV‑1 replication by regulating the TAK1‑TABs complex and activating the NF‑κB pathway, revealing its role in host–virus interaction and offering potential targets for controlling bovine respiratory diseases. Methods Experimental materials TAK1, TAB2 stably-transfected cell lines, Madin-darby bovine kidney cells (MDBK), and Bovine herpesvirus 1 (BHV-1), were preserved in the Animal Infectious Disease Rapid Diagnostic Laboratory of China Agricultural University. DMEM medium (Gibco, USA); Polyglutamine (Brain, China); Puromycin (MCE, USA); RNA Extraction Kit RC101, Reverse Transcription Kit R323, Real-Time Fluorescent Quantitative PCR Kit Q711 (Vazyme, China); Goat Anti-Rabbit IgG-HRP Antibody, Beta Actin Antibody (Bioss, China); ECL Colour Developing Solution (Merck, Germany); Pre-stained Protein Marker, BCA Quantification Kit (Biosharp, China), RIPA Lysate (Solarbio, China); TAK1, TBK1, TAB2, TAB3 (Affinity Biosciences, China); Ribo lncRNA Smart Silencer interfering fragments (RiboBio, China) were designed and synthesised. LncRNA-MSTRG.16919.1 expression validation Total RNA was extracted from BHV-1-infected MDBK cells (33 h post-infection) and uninfected control cells using the Trizol method. The RNA was then reverse transcribed into cDNA and analyzed by real-time quantitative PCR to determine the relative transcript levels of lncRNA-MSTRG.16919.1 . The total RNA of cell samples was extracted using the RNA Extraction Kit RC101(Vazyme, China) according to the instructions of the kit, and the mass concentration of RN-A was detected by NanoDrop 2000. Reverse transcription was carried out using Vazyme reverse transcription reagent (R323, Vazyme, China). The primers for real-time fluorescence quantitative PCR were synthesized by Sangon Biotech (Shanghai) Co., Lt. The primers used for RT-qPCR are listed below. LncRNA-MSTRG.16919.1 : forward sequence, GCCCTCAATCTTTCCCAGCATC and reverse sequence, GGCAGCAAGGAGATCAAACCAGT; UCHL5: forwared sequence, ACAAAGACAACTTGCTGAGGAAC and reverse sequence, GGCAACCTCTGACTGAATAGCACTT. Ubiquitin C-terminal Hydrolase L5 (UCHL5) was used as the internal control and the results were calculated with the 2 −ΔΔCt method. LncRNA-MSTRG.16919.1 subcellular localization assay The subcellular localization of lncRNA-MSTRG.16919.1 was verified by fluorescence in situ hybridization experiments and nuclear and cytoplasmic fractionation assay. The operation was performed according to the instruction manual of Ribo™ Fluorescent In Situ Hybridization Kit. The fluorescent labelled probes lncRNA-MSTRG.16919.1 , U6 RNA and 18S rRNA were designed and synthesized by Guangzhou RiboBio Co., Ltd.. Nucleus and cytoplasmic RNA of the samples were extracted separately according to NORGEN's Cytoplasmic and Nucleus RNA Extraction Kit #21000 (Norgen Biotek Corporation, Canada). After the Ct values of lncRNA-MSTRG.16919.1 , U6, GAPDH, and 18S were measured by RT-qPCR in the cytoplasm and nucleus, respectively, the following formula was applied to calculate the percentage of each gene in the cytoplasm and nucleus. The primers used for RT-qPCR are listed below. U6: forward sequence, GCTCGCTTCGGCAGCACATATA and reverse sequence, CGAATTTGCGTGTCATCCTTGCG; 18S: forw-ard sequence, GGACACGGACAGGATTGACAGATTG and reverse sequence, CATGCCCAGAGTCTCGTTCGTTATC; GAPDH: forward sequence, ACGGCAAGTTCAACGGCACAG and reverse sequence, CCACATACTCAGCACCAGCATCAC. Cytoplasm %=2 Ct nucleus / (2 Ct nucleus +2 Ct cytoplasm ) ×100% Nucleus %= 2 CT cytoplasm / (2 Ct nucleus + 2 CTcytoplasm ) ×100% LncRNA-MSTRG.16919.1 knock-down and BHV-1 proliferation-related factors detection LncRNA-MSTRG.16919.1 knock-down The knockdown of lncRNA-MSTRG.16919.1 was performed using the same method as described in our prior work ( 17 ). Quantitative detection of viral DNA In order to detect the effect of lncRNA-MSTRG.16919.1 on viral DNA replication, silencing-treated MDBK cells were infected with BHV-1 for 33 h, the DNA of the samples was extracted with the Viral Genomic DNA Extraction Kit (DP315) from Tiangen Biochemical Technology (Beijing) Co., LTD, and then the amount of viral DNA was detected in the lncRNA-MSTRG.16919.1 silencing-treated group by TaqMan fluorescence quantitative PCR. TaqMan probes and primers were designed using Primer Premier 5, and the primers and probes were synthesised by Sangon Biotech (Shanghai) Co., Lt. The primers used for RT-qPCR are listed below. BoHV-1072401: forward sequence, TAGTGGCTGGCCGTTTGCT and reverse sequence, ACACACGCGCACGCAAC. TaqMan real-time PCR probe sequence: TTGGCAATTTACGTTCCGTCGAC. The fluoresc-eeent group is 6-FAM and the quenching group is BHQ1.The program conditions of Taq-Man real-time PCR were as follows: 95℃ for 600s; 45 cycles were performed at 95°C for 30s and 58°C for 30s. Quantitative detection of viral glycoprotein gB/gD mRNA Cellular RNA extraction and cDNA acquisition were carried out according to step 1.2. lncRNA-MSTRG.16919.1 Real-time fluorescence quantitative PCR was performed to detect the transcript levels of gB and gD genes of BHV-1 after lncRNA-MSTRG.16919.1 gene silencing. The primer sequences are as follows. gTB: forward sequence, CGTACACGTTCAAGGCCTACATTTAC and reverse sequence, GTCCGTGTACTGGTTTGTAATGG; gD: forward sequence, ATTACGAGCAAAAGAAGGTTCTGCG and reverse sequence, TAGCCCTTCGACTCCTCAAAATACG. The detection of viral glycoprotein gB/gD protein After lncRNA-MSTRG.16919.1 silenced and infected with BHV-1 for 33 h, the samples were lysed using high efficiency RIPA cell lysis solution (Solarbio). The samples were collected after lysis on ice for 30 min. The centrifugation was performed at 4°C and 12000 rpm/min for 5 min, and the supernatant was collected, and the protein concentration was determined by BCA Protein Quantification Kit (Vazyme). The protein samples were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and subjected to western blot (WB) detection. The primary antibody was a monoclonal antibody against BHV-1 gB and gD glycoproteins (1:500 dilution), and the secondary antibody was a goat anti-mouse IgG-HRP antibody (1:5000 dilution), which were prepared in our laboratory, and the samples were incubated at room temperature for 2h. Virus TCID 50 assay In order to detect the change of BHV-1 virus particle amount after lncRNA-MSTRG.16919.1 silencing treatment, we performed tissue culture infective dose 50% (TCID 50 ) assay. Firstly, the virus was diluted by taking 9 sterile EP tubes and adding 900 µL of DMEM to each of them, taking 100 µL of the virus stock solution pre-stored at 4°C and adding it to the first EP tube, blowing and mixing it and then removing 100 µL and adding it to the second EP tube, and diluting the virus solution in gradients of 10 − 1 , 10 − 2 , 10 − 3 , 10 − 4 , 10 − 5 , 10 − 6 , 10 − 7 and 10 − 8 dilutions; they were added to 96-well plates at 10 µL/well, and eight replicate wells were prepared for each concentration in three independent replicate experiments. The treated 96-well plates were incubated at 37℃ in a 5% CO 2 incubator for 1 h. Subsequently, 90 µL of DMEM medium containing only 1% penicillin and streptomycin was added to each well and incubated for 72 h. The CPE were observed by Inverted Fluorescence Microscope (Olympus), and TCID 50 /100 µL was calculated according to the number of CPE wells. The TCID₅₀ of treated viral strains was calculated using the Reed-Muench method. Proportional Distance (PD) = [(% positive at dilution above 50%) − 50%] / [(% positive above 50%) - (% positive below 50%)] Log₁₀TCID₅₀ = (Proportional Distance × log₁₀ dilution factor) + log₁₀ of the highest dilution showing ≥ 50% cytopathic effect (CPE) Plaque assay To further validate the change in the number of BHV-1 after lncRNA-MSTRG.16919.1 silencing treatment, we further determined the viral titre by plaque forming units (PFUs) assay. Virus was diluted as in Virus TCID50 assay, and each gradient was added to a six-well plate containing MDBK cells at 200 µL/well, and three wells were set up for each concentration gradient with three independent replicates of the assay. The plates were incubated at 37°C, 5% CO 2 for 1 h. The plates were gently shaken at 20 min intervals to make the viral solution come into contact with the cells evenly. After incubation for 1 h, 2 mL of an equal volume mixture of 2% low melting point agarose and 2% complete medium was added to each well, and left at room temperature for 20 min. After the coverings in the cell plates solidified, they were inverted and stored in 37°C, 5% CO 2 incubator for 3–5 days to observe the formation time, morphology and number of plaques. The emerging plaque were stained using 0.02% neutral red. Observe the morphology of the plaque and record the number of plaques, and calculate the viral titer according to the following formula: Viral Titer Calculation Formula: Plaque-forming units (PFU)/mL = (Mean plaque count × Reciprocal of dilution factor) ÷ Inoculum volume (mL) Expression of TAK1 and TAB2 protein We packaged the bovine TAK1 and TAB2 genes into lentivirus, followed by infection of MDBK cells. Puromycin was used for selection. The TAK1 and TAB2 stable-transfected cell lines were cultured in complete DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin at 37°C with 5% CO 2 . After 3–5 generations, the cells were inoculated into 6-well plates according to 1 × 10 6 cells/well, and protein samples were collected when confluence reached about 80%. The samples were lysed by high-efficiency RIPA cell lysis solution (Solarbio) on ice for 30 min, and gently tapped every 5 min to make them fully lysed, and the processed samples were collected into sterile centrifuge tubes. After centrifugation, the supernatant was divided and stored while protein concentration was determined. The protein expression in each group was detected by using Western blot. Knockdown lncRNA-MSTRG.16919.1 in the cells of overexpression TAK1 or TAB2 and BHV-1 proliferation-related factors detection Overexpressing TAK1, TAK1-NC, TAB2 or TAB2-NC cell lines and MDBK cells were resuscitated, and after the cells were passaged to 3–5 generations, they were inoculated into 6-well plates according to 1.6×10 5 /well, and when the confluence rate reached about 50%-60%, Ribo lncRNA Smart Silencer transfection was performed. After 24 h, BHV-1 was inoculated into the cells at a dose of MOI 1. After incubation for 1 h at 37°C with 5% CO 2 , DMEM medium containing only 1% penicillin was added, and the cells were placed in a cell culture incubator for further incubation, and cells not inoculated with the virus were set up as the control group, and CPE was observed at 33 h post-infection for the collection and preservation of protein and nucleic acid samples. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Availability of data and materials The sequence data for LncRNA-MSTRG.16919.1 reported in this study have been deposited in the GenBank database under accession number PZ291134. These data are currently held as private and will be released upon the formal publication of this manuscript. The raw RNA-sequencing data generated in this study have been deposited in the NCBI Sequence Read Archive (SRA) repository, PRJNA1449764 (https://dataview.ncbi.nlm.nih.gov/object/PRJNA1449764?reviewer=n0ahikvoi8aouqi790fr4i4he9) and PRJNA1453208 (https://dataview.ncbi.nlm.nih.gov/object/PRJNA1453208?reviewer=7e5vc0hm6jmcuko3013tf7o1hj). All other relevant data supporting the findings of this study are included within the article and its supplementary information files, or are available from the corresponding author upon reasonable request. Competing interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding This work was supported by the Natural Science Foundation of China (No.32473006). Acknowledgements Not Applicable. Authors' contributions Fan Zhang: methodology, data curation, writing-original draft. Caina Song: validation. Jinzhu Ma: supervision. Liquan Yu: supervision. Chen Peng: supervision. Wenxue Wu: supervision, writing-reviewing and editing, funding acquisition. Baifen Song: supervision, writing-reviewing and editing, funding acquisition. References Chase CCL, Fulton RW, O’Toole D, Gillette B, Daly RF, Perry G, et al. Bovine herpesvirus 1 modified live virus vaccines for cattle reproduction: Balancing protection with undesired effects. Veterinary Microbiology. 2017 Jul 1;Recent Advances in Vaccine Research Against Economically Important Viral Diseases of Food Animals206:69–77. doi:10.1016/j.vetmic.2017.03.016 Righi C, Franzoni G, Feliziani F, Jones C, Petrini S. The Cell-Mediated Immune Response against Bovine alphaherpesvirus 1 (BoHV-1) Infection and Vaccination. Vaccines. 2023 Apr;11(4):785. doi:10.3390/vaccines11040785 Ouyang J, Hu J, Chen JL. lncRNAs regulate the innate immune response to viral infection. WIREs RNA. 2016 Jan;7(1):129–43. doi:10.1002/wrna.1321 Liu W, Ding C. Roles of LncRNAs in Viral Infections. Front Cell Infect Microbiol. 2017 May 26;7. doi:10.3389/fcimb.2017.00205 Ajibade AA, Wang HY, Wang RF. Cell type-specific function of TAK1 in innate immune signaling. Trends in Immunology. 2013 Jul 1;34(7):307–16. doi:10.1016/j.it.2013.03.007 Dai L, Aye Thu C, Liu XY, Xi J, Cheung PCF. TAK1, more than just innate immunity. IUBMB Life. 2012 Oct;64(10):825–34. doi:10.1002/iub.1078 PubMed PMID: 22941947. Fan Y, Yu Y, Shi Y, Sun W, Xie M, Ge N, et al. Lysine 63-linked Polyubiquitination of TAK1 at Lysine 158 Is Required for Tumor Necrosis Factor α- and Interleukin-1β-induced IKK/NF-κB and JNK/AP-1 Activation*. Journal of Biological Chemistry. 2010 Feb 19;285(8):5347–60. doi:10.1074/jbc.M109.076976 Silverman N, Zhou R, Erlich RL, Hunter M, Bernstein E, Schneider D, et al. Immune activation of NF-kappaB and JNK requires Drosophila TAK1. J Biol Chem. 2003 Dec 5;278(49):48928–34. doi:10.1074/jbc.M304802200 PubMed PMID: 14519762. Shim JH, Xiao C, Paschal AE, Bailey ST, Rao P, Hayden MS, et al. TAK1, but not TAB1 or TAB2, plays an essential role in multiple signaling pathways in vivo. Genes Dev. 2005 Nov 15;19(22):2668–81. doi:10.1101/gad.1360605 PubMed PMID: 16260493; PubMed Central PMCID: PMC1283960. Ori D, Kato H, Sanjo H, Tartey S, Mino T, Akira S, et al. Essential Roles of K63-Linked Polyubiquitin-Binding Proteins TAB2 and TAB3 in B Cell Activation via MAPKs. J Immunol. 2013 Apr 1;190(8):4037–45. doi:10.4049/jimmunol.1300173 Zhuang ZH, Sun L, Kong L, Hu JH, Yu MC, Reinach P, et al. Drosophila TAB2 is required for the immune activation of JNK and NF-kappaB. Cellular Signalling. 2006 Jul 1;18(7):964–70. doi:10.1016/j.cellsig.2005.08.020 Liu KL, Yang YC, Yao HT, Chia TW, Lu CY, Li CC, et al. Docosahexaenoic acid inhibits inflammation via free fatty acid receptor FFA4, disruption of TAB2 interaction with TAK1/TAB1 and downregulation of ERK-dependent Egr-1 expression in EA.hy926 cells. Molecular Nutrition & Food Research. 2016;60(2):430–43. doi:10.1002/mnfr.201500178 Gong J, Shen XH, Qiu H, Chen C, Yang RG. Rhesus monkey TRIM5α represses HIV-1 LTR promoter activity by negatively regulating TAK1/TAB1/TAB2/TAB3-complex-mediated NF-κB activation. Arch Virol. 2011 Nov;156(11):1997–2006. doi:10.1007/s00705-011-1097-6 PubMed PMID: 21918865. Lei X, Han N, Xiao X, Jin Q, He B, Wang J. Enterovirus 71 3C inhibits cytokine expression through cleavage of the TAK1/TAB1/TAB2/TAB3 complex. J Virol. 2014 Sep 1;88(17):9830–41. doi:10.1128/JVI.01425-14 PubMed PMID: 24942571; PubMed Central PMCID: PMC4136319. Alam SK, Wang L, Zhu Z, Hoeppner LH. IKKα promotes lung adenocarcinoma growth through ERK signaling activation via DARPP-32-mediated inhibition of PP1 activity. NPJ Precis Oncol. 2023 Mar 25;7(1):33. doi:10.1038/s41698-023-00370-3 PubMed PMID: 36966223; PubMed Central PMCID: PMC10039943. Zheng Y, Yu M, Chen Y, Xue L, Zhu W, Fu G, et al. CARD19, a Novel Regulator of the TAK1/NF-κB Pathway in Self-Reactive B Cells. J Immunol. 2023 May 1;210(9):1222–35. doi:10.4049/jimmunol.2200639 PubMed PMID: 36961449; PubMed Central PMCID: PMC10156913. Zhang F, Jiang K, Wang Y, Ma J, Song B. Analysis of the Function of LncRNA-MSTRG.16919.1 in BHV-1-Infected Bovine Kidney Subculture Cells by Transcriptome Sequencing. Viruses. 2022 Oct;14(10):2104. doi:10.3390/v14102104 Moon SL, Dodd BJT, Brackney DE, Wilusz CJ, Ebel GD, Wilusz J. Flavivirus sfRNA suppresses antiviral RNA interference in cultured cells and mosquitoes and directly interacts with the RNAi machinery. Virology. 2015 Nov 1;485:322–9. doi:10.1016/j.virol.2015.08.009 Palazzo AF, Lee ES. Non-coding RNA: what is functional and what is junk? Front Genet. 2015;6:2. doi:10.3389/fgene.2015.00002 PubMed PMID: 25674102; PubMed Central PMCID: PMC4306305. Sullivan CS. New roles for large and small viral RNAs in evading host defences. Nat Rev Genet. 2008 Jul;9(7):503–7. doi:10.1038/nrg2349 Colombo T, Farina L, Macino G, Paci P. PVT1: a rising star among oncogenic long noncoding RNAs. Biomed Res Int. 2015;2015:304208. doi:10.1155/2015/304208 PubMed PMID: 25883951; PubMed Central PMCID: PMC4391155. Ding Y zhong, Zhang Z wang, Liu Y li, Shi C xu, Zhang J, Zhang Y guang. Relationship of long noncoding RNA and viruses. Genomics. 2016 Apr;107(4):150–4. doi:10.1016/j.ygeno.2016.01.007 PubMed PMID: 26826341. Doncheva NT, Morris JH, Gorodkin J, Jensen LJ. Cytoscape StringApp: Network Analysis and Visualization of Proteomics Data. J Proteome Res. 2019 Feb 1;18(2):623–32. doi:10.1021/acs.jproteome.8b00702 PubMed PMID: 30450911; PubMed Central PMCID: PMC6800166. Chen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018 Sep 1;34(17):i884–90. doi:10.1093/bioinformatics/bty560 PubMed PMID: 30423086; PubMed Central PMCID: PMC6129281. Zhao L, Xia M, Wang K, Lai C, Fan H, Gu H, et al. A Long Non-coding RNA IVRPIE Promotes Host Antiviral Immune Responses Through Regulating Interferon β1 and ISG Expression. Front Microbiol. 2020 Feb 20;11. doi:10.3389/fmicb.2020.00260 Bridges MC, Daulagala AC, Kourtidis A. LNCcation: lncRNA localization and function. J Cell Biol. 2021 Feb 1;220(2):e202009045. doi:10.1083/jcb.202009045 PubMed PMID: 33464299; PubMed Central PMCID: PMC7816648. Melé M, Mattioli K, Mallard W, Shechner DM, Gerhardinger C, Rinn JL. Chromatin environment, transcriptional regulation, and splicing distinguish lincRNAs and mRNAs. Genome Res. 2017 Jan;27(1):27–37. doi:10.1101/gr.214205.116 PubMed PMID: 27927715; PubMed Central PMCID: PMC5204342. Clemson CM, Hutchinson JN, Sara SA, Ensminger AW, Fox AH, Chess A, et al. An Architectural Role for a Nuclear Noncoding RNA: NEAT1 RNA Is Essential for the Structure of Paraspeckles. Molecular Cell. 2009 Mar 27;33(6):717–26. doi:10.1016/j.molcel.2009.01.026 Xia Z, Xu G, Yang X, Peng N, Zuo Q, Zhu S, et al. Inducible TAP1 Negatively Regulates the Antiviral Innate Immune Response by Targeting the TAK1 Complex. J Immunol. 2017 May 1;198(9):3690–704. doi:10.4049/jimmunol.1601588 PubMed PMID: 28356387. Yuan L, Li S, Chen Q, Xia T, Luo D, Li L, et al. EBV infection-induced GPX4 promotes chemoresistance and tumor progression in nasopharyngeal carcinoma. Cell Death Differ. 2022 Aug;29(8):1513–27. doi:10.1038/s41418-022-00939-8 PubMed PMID: 35105963; PubMed Central PMCID: PMC9346003. Lu X, Huang C, Zhang Y, Lin Y, Wang X, Li Q, et al. The Us2 Gene Product of Herpes Simplex Virus 2 modulates NF-κB activation by targeting TAK1. Sci Rep. 2017 Aug 21;7:8396. doi:10.1038/s41598-017-08856-4 PubMed PMID: 28827540; PubMed Central PMCID: PMC5566419. Mogensen TH, Melchjorsen J, Höllsberg P, Paludan SR. Activation of NF-kappa B in virus-infected macrophages is dependent on mitochondrial oxidative stress and intracellular calcium: downstream involvement of the kinases TGF-beta-activated kinase 1, mitogen-activated kinase/extracellular signal-regulated kinase kinase 1, and I kappa B kinase. J Immunol. 2003 Jun 15;170(12):6224–33. doi:10.4049/jimmunol.170.12.6224 PubMed PMID: 12794154. Mikkelsen SS, Jensen SB, Chiliveru S, Melchjorsen J, Julkunen I, Gaestel M, et al. RIG-I-mediated activation of p38 MAPK is essential for viral induction of interferon and activation of dendritic cells: dependence on TRAF2 and TAK1. J Biol Chem. 2009 Apr 17;284(16):10774–82. doi:10.1074/jbc.M807272200 PubMed PMID: 19224920; PubMed Central PMCID: PMC2667765. Additional Declarations No competing interests reported. Supplementary Files lncRNAMSTRG.16919.1Sequence.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 15 May, 2026 Reviewers agreed at journal 03 May, 2026 Reviewers agreed at journal 29 Apr, 2026 Reviewers invited by journal 23 Apr, 2026 Editor assigned by journal 19 Apr, 2026 Editor invited by journal 18 Apr, 2026 Submission checks completed at journal 17 Apr, 2026 First submitted to journal 17 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9233725","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":633720210,"identity":"2044ccc8-2555-431c-8e97-0f41e203ee48","order_by":0,"name":"Fan Zhang","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Fan","middleName":"","lastName":"Zhang","suffix":""},{"id":633720211,"identity":"24ab4086-29e4-40e7-9800-4c72ea77b1fa","order_by":1,"name":"Caina Song","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Caina","middleName":"","lastName":"Song","suffix":""},{"id":633720212,"identity":"e7ae6001-7474-40e1-8ae5-391487d73e36","order_by":2,"name":"Jinzhu Ma","email":"","orcid":"","institution":"Heilongjiang Bayi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jinzhu","middleName":"","lastName":"Ma","suffix":""},{"id":633720213,"identity":"71591079-7aad-4793-9596-ae84ca609521","order_by":3,"name":"Liquan Yu","email":"","orcid":"","institution":"Heilongjiang Bayi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Liquan","middleName":"","lastName":"Yu","suffix":""},{"id":633720214,"identity":"aa20a352-cc01-4314-8fb3-d8bdf1b478af","order_by":4,"name":"Chen Peng","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Chen","middleName":"","lastName":"Peng","suffix":""},{"id":633720215,"identity":"896950af-1ac9-40f2-a557-e7561cd1d861","order_by":5,"name":"Wenxue Wu","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Wenxue","middleName":"","lastName":"Wu","suffix":""},{"id":633720216,"identity":"8518fe03-addc-4042-88b1-ac840fa55536","order_by":6,"name":"Baifen Song","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABA0lEQVRIie3PMUvDQBjG8TccZLpy63so5Cu8EoiKxX6VK4WbMnSSDlKuFNKlOqfg53BOCTgdcQ10SXF0SRHESRpXwWvHgvcbj+d/3AF43oliACgAglmjJn0uhDkukQZYSY3V5zIvjkqgS0Itt1nZJ6Pc82jxUL6P769QnC1jGmavnKAI2l36d0K20jf5C6J8sheNqjb8khkmV8+OBNMk5iFOqU5jUncbfm2KkPUcSZT/JN+IgzpNUIUVp0K5E+guf+tliIRao8qKwwlZm7DVIyLWo5KUHXGZr+fOv0SLZfwx/pyiyIez7dfkdiDEfN3uXA8DCPHXQWCc+w5rDy08z/P+uT2AUlKaOHj1eAAAAABJRU5ErkJggg==","orcid":"","institution":"China Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Baifen","middleName":"","lastName":"Song","suffix":""}],"badges":[],"createdAt":"2026-03-26 11:53:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9233725/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9233725/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":108450789,"identity":"79efe3e7-0c3f-4b47-8670-95587f27c482","added_by":"auto","created_at":"2026-05-04 19:25:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":661023,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eLncRNA-MSTRG.16919.1\u003c/em\u003e expression and localization results\u003c/p\u003e\n\u003cp\u003e(A) RT-qPCR validation of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e expression, with \u0026nbsp;\u0026nbsp;experimental groups on the horizontal axis and the fold change of \u003cem\u003elncRNA-MSTRG.16919.1 \u0026nbsp;\u0026nbsp;\u003c/em\u003erelative to the control group on the vertical axis. (B) Localization of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e \u0026nbsp;in the MDBK cell group. (C) Localization of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e after \u0026nbsp;\u0026nbsp;BHV-1 inoculation for 33 hours. Horizontal axis represents experimental \u0026nbsp;\u0026nbsp;groups, and vertical axis shows the percentage of each gene in the \u0026nbsp;\u0026nbsp;cytoplasmic and nuclear fractions of MDBK cells. (D) Subcellular localization \u0026nbsp;\u0026nbsp;of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e. BLANK represents the MDBK cell group; MB \u0026nbsp;\u0026nbsp;represents the group inoculated with BHV-1 for 33 hours. U6 and 18S serve as \u0026nbsp;\u0026nbsp;cytosolic and cytoplasmic endogenous references, respectively. Red \u0026nbsp;\u0026nbsp;fluorescence indicates the probe, and blue fluorescence indicates DAPI.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-9233725/v1/f7df3a2b3987ea6a746d4ae9.png"},{"id":108450797,"identity":"bfe8558c-895a-4056-8657-c0d5b9f5b136","added_by":"auto","created_at":"2026-05-04 19:25:11","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":347575,"visible":true,"origin":"","legend":"\u003cp\u003eDetection results of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e silencing and its effects on viral infection\u003c/p\u003e\n\u003cp\u003e(A) The copy number of BHV-1 DNA. (B) Relative transcript levels of\u003cem\u003e lncRNA-MSTRG.16919.1 \u003c/em\u003egene\u003cem\u003e. \u003c/em\u003e(C) Relative transcript levels of BHV-1 gB gene. (D) Relative transcript levels of BHV-1 gD gene. (E) TCID\u003csub\u003e50 \u003c/sub\u003evalues of\u003csub\u003e \u003c/sub\u003eBHV-1. (F) Results of plaque assay. The x-axis represents the experimental groups, while the y-axis indicates the viral titer.\u003cem\u003e \u003c/em\u003e(G) The western blot results of viral gB and gD protein.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-9233725/v1/a606370488a841df71606d94.png"},{"id":108450780,"identity":"07fc1742-76f1-467e-bf3a-c49cc43baea9","added_by":"auto","created_at":"2026-05-04 19:25:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":764582,"visible":true,"origin":"","legend":"\u003cp\u003eDetection results of protein levels of key molecules of virus infection-related signaling pathways\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-9233725/v1/351efdf5dd29bcaa10c2ae5a.png"},{"id":108493685,"identity":"0aa19c24-25d0-4a47-82c0-bbb0a00fce9f","added_by":"auto","created_at":"2026-05-05 10:01:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":163625,"visible":true,"origin":"","legend":"\u003cp\u003eResults of TAK1 and TAB2 overexpression detection\u003c/p\u003e\n\u003cp\u003e(A) (B)TAK1 overexpression assay \u0026nbsp;\u0026nbsp;results. (C) TAB2 overexpression assay results. The Blank group represents the MDBK cell \u0026nbsp;\u0026nbsp;group, the TAK1-Myc group consists of TAK1 overexpression stable transfected \u0026nbsp;\u0026nbsp;cells with a Myc tag, the TAK1-NC group includes MDBK cells transfected with \u0026nbsp;\u0026nbsp;an empty vector, the TAB2-Flag group consists of TAB2 overexpression stable \u0026nbsp;\u0026nbsp;transfected cells with a Flag tag, and the TAB2-NC group represents MDBK \u0026nbsp;\u0026nbsp;cells transfected with an empty vector.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-9233725/v1/a92bc7f986f79615a7daa1ad.png"},{"id":108450793,"identity":"3e77f5c0-3ce0-4e45-83a9-b1119661c30d","added_by":"auto","created_at":"2026-05-04 19:25:10","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":420663,"visible":true,"origin":"","legend":"\u003cp\u003eThe results of knockdown of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e in cells overexpression TAK1 or TAB2 and BHV-1 proliferation-related factors detection\u003c/p\u003e\n\u003cp\u003e(A) Results of viral glycoprotein B transcript levels. (B) Results of viral glycoprotein D transcript levels. (C) Results of TCID\u003csub\u003e50 \u003c/sub\u003eassay. (D) Results of plaque assay. (E) Results of BHV-1 DNA levels. (F) Results of viral glycoprotein B and D western blot.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-9233725/v1/c0b11e563a84cb02735f92f6.png"},{"id":108450794,"identity":"f46af23a-fbf4-48a6-8848-12f90434b098","added_by":"auto","created_at":"2026-05-04 19:25:10","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":496447,"visible":true,"origin":"","legend":"\u003cp\u003eResults of protein level detection of NF-κB signaling pathway related genes\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-9233725/v1/e4c765e2e43d9e07374c3148.png"},{"id":108804098,"identity":"180eb1e1-5c74-4ba4-8c1c-3548fcbe83ba","added_by":"auto","created_at":"2026-05-08 15:15:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3616610,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9233725/v1/e1266664-ca07-4317-af78-bd49711bdf52.pdf"},{"id":108450778,"identity":"dacc9c91-1513-4b0b-a41d-aa87b5478d3e","added_by":"auto","created_at":"2026-05-04 19:25:01","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":16200,"visible":true,"origin":"","legend":"","description":"","filename":"lncRNAMSTRG.16919.1Sequence.docx","url":"https://assets-eu.researchsquare.com/files/rs-9233725/v1/21ee0b260e5606c25fd385a3.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"LncRNA-MSTRG.16919.1 regulates the proliferation of BHV-1 in MDBK cells through TAK1/TAB1/TAB2/TAB3 complexes","fulltext":[{"header":"Background","content":"\u003cp\u003eInfectious Bovine Rhinotracheitis (IBR) is a contact infectious disease caused by Bovine Herpes Virus Type I (BHV-1). Infected cattle exhibit symptoms such as rhinitis, high fever, and respiratory distress. The disease reduces milk production, impairs fertility, hinders fetal growth and development, increases culling and mortality rates, and may even lead to abortion(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Currently, due to an incomplete understanding of its pathogenic mechanism, no effective prevention or control measures are available. Therefore, investigating the pathogenic mechanism of BHV-1 and developing preventive strategies are crucial.\u003c/p\u003e \u003cp\u003eBovine Herpes Virus Type I (BHV-1) belongs to the α-herpesvirus subfamily of the Herpesviridae family. Its genome consists of double-stranded DNA and encodes approximately 33 structural proteins. Among them, gB, gC, and gD are glycoproteins on the viral surface that facilitate host cell invasion and viral spread. These glycoproteins also serve as key antigens in activating the host immune response(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eLong non-coding RNAs (lncRNAs) are a class of non-coding RNAs longer than 200 nucleotides, lacking a complete open reading frame (ORF). Thousands of lncRNAs are regulated by RNA viruses or DNA viruses(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). When the body is infected by a virus, the host cells counteract the infection by generating various lncRNAs. Meanwhile, the virus itself can also alleviate the activation of antiviral cells by expressing various lncRNAs, thereby promoting and establishing its infection(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTransforming growth factor-beta activator protein 1 (TAK1), a member of the mitogen-activated protein kinase (MAP3K) family(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e), is an important regulatory molecule of the innate immune system, capable of participating in inflammatory and antiviral immune responses. TAK1 is activated by pro-inflammatory cytokines, including tumor necrosis factor-α (TNFα) and interleukin-1β (IL-1β), and mediates the activation of nuclear factor-κB (NF-κB), c-Jun N-terminal kinase (JNK) and p38 MAPK(\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). In all these pathways, TAK1 is considered a key regulator of NF-κB and MAPKs(\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). TAK1 and MAP3K7-binding protein 2 (TAB2) are evolutionarily conserved genes present in both plants and animals. As an adaptor protein, TAB2 participates in multiple signaling pathways, including IL-1, mitogen activated protein kinase (MAPK)(\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e), JNK, and NF-κB pathways(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Liu et al demonstrated that TAB2 SUMOylation disrupts tumor necrosis factor receptor associated factor 6 (TRAF6) recruitment by the TAB2/TAK1 complex, thereby inhibiting downstream MAPK and NF-κB signaling pathways(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). In addition, Gong et al found that overexpression of rhesus monkey TRIM5α (TRIM5arh) inhibited HIV-1 long terminal repeat (HIV-1 LTR) promoter activity by downregulating TAK1/TAB1/TAB2/TAB3 complex-mediated NF-κB activation and promoting TAB2 degradation via the lysosomal pathway(\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Lei et al reported that EV71 suppresses NF-κB activation by targeting the TAK1/TAB1/TAB2/TAB3 complex. The interaction between enterovirus 71 (EV71) and the TAK1 complex influences viral infection(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). The TAK1-TABs complex phosphorylates inhibitor of κB kinase β (IKKβ) at Ser177 and Ser181, which is essential for NF-κB activation(\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Additionally, the TAK1-TAB complex is crucial for interleukin-1 receptor (IL-1R), tumor necrosis factor receptor (TNFR), and TLR-mediated signaling pathways, which activate MAPK and NF-κB(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Whether \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e consequently promotes BHV-1 proliferation by targeting the TAK1/TAB1/TAB2/TAB3 complex remains unclear.\u003c/p\u003e \u003cp\u003ePrevious studies demonstrated that the expression of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e was upregulated following BHV-1 infection. Since this lncRNA is newly identified, its exact function remains unknown. To investigate the function and mechanism of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e, we examined its subcellular localization and analyzed its effects on BHV-1 replication and the expression of TAK1/TAB1/TAB2/TAB3 under \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e knockdown. This approach aimed to further elucidate the molecular mechanism by which \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e promotes BHV-1 proliferation and to provide a reference for studying the pathogenesis of BHV-1.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eThe results of \u003cem\u003eLncRNA-MSTRG.16919.1\u003c/em\u003e expression and subcellular localization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLncRNA-MSTRG.16919.1\u003c/em\u003e is a novel lncRNA identified by transcriptome sequencing of BHV-1 infected MDBK cell samples in our research team. To confirm the accuracy of the sequencing results, the expression of this gene was assessed using RT-qPCR. The results indicated that its expression was upregulated following BHV-1 infection, consistent with the sequencing data, as shown in Figure 1A. The function of lncRNAs is closely linked to their subcellular localization. To further investigate the function of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e, its cellular localization was examined by software prediction, nuclear and cytoplasm separation experiments and in situ hybridization experiments. The results predicted by lncLocator showed 89.5% of \u003cem\u003elncRNA-MSTRG.16919.1 was\u0026nbsp;\u003c/em\u003ein the cytoplasm and 6.8% in the nucleus (Table 1). The results of nucleoplasmic separation experiment showed that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e was distributed predominantly in the cytoplasm (89%) with a minor nuclear fraction (11%). However, upon BHV-1 infection, its cytoplasmic localization increased to 94%, while nuclear levels dropped to approximately 5%, suggesting that roughly 5% of \u003cem\u003elncRNA-MSTRG.16919.1\u0026nbsp;\u003c/em\u003ewas relocalized from the nucleus to the cytoplasm (Figure 1B and 1C). GAPDH and 18S were used as a cytoplasmic reference and U6 was used as a nuclear reference. The results of the fluorescence in situ hybridization (FISH) assays are shown in Fig. 1D, which generally align with the results of nuclear-cytoplasmic fractionation assay and the software prediction. These findings suggest that \u003cem\u003e1ncRNA-MSTRG.16919.1\u003c/em\u003e is mainly located in the cytoplasm and a small portion of \u003cem\u003e1ncRNA-MSTRG.16919.1\u003c/em\u003e is transferred from the nucleus to the cytoplasm of cells following viral infection.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 1 The Result of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e in lncLocator Prediction\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"566\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46.0039%;\"\u003e\n \u003cp\u003eSubcellular locations\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53.9961%;\"\u003e\n \u003cp\u003eScore\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46.0039%;\"\u003e\n \u003cp\u003eCytoplasm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53.9961%;\"\u003e\n \u003cp\u003e0.895\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46.0039%;\"\u003e\n \u003cp\u003eNucleus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53.9961%;\"\u003e\n \u003cp\u003e0.068\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46.0039%;\"\u003e\n \u003cp\u003eRibosome\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53.9961%;\"\u003e\n \u003cp\u003e0.011\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46.0039%;\"\u003e\n \u003cp\u003eCytosol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53.9961%;\"\u003e\n \u003cp\u003e0.023\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 46.0039%;\"\u003e\n \u003cp\u003eExosome\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 53.9961%;\"\u003e\n \u003cp\u003e0.002\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eThe results of \u003cem\u003eLncRNA-MSTRG.16919.1\u003c/em\u003e silencing and BHV-1 proliferation-related factors detection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the effect of\u003cem\u003e\u0026nbsp;lncRNA-MSTRG.16919.1\u0026nbsp;\u003c/em\u003eon BHV-1 replication, siRNA targeting \u003cem\u003elncRNA-MSTRG.16919.1\u0026nbsp;\u003c/em\u003ewas transfected into MDBK cells to interfere with its function, then cells were inoculated with BHV-1. The copy number of BHV-1 DNA, mRNA and protein levels of glycoproteins gB and gD, and the production of viral particle were measured. The results showed the copy number of viral DNA is significant reduced in 6T group (Figure 2A), indicating that silencing \u003cem\u003elncRNA-MSTRG.16919.1\u0026nbsp;\u003c/em\u003einhibits viral DNA replication. The transcript level (Figure 2B-D) and protein expression (Figure 2G) analysis of glycoprotein gB and gD genes were significantly reduced in group 6T, further indicating that \u003cem\u003elncRNA-MSTRG.16919.1\u0026nbsp;\u003c/em\u003epromotes BHV-1 replication in MDBK cells.\u003c/p\u003e\n\u003cp\u003eTo assess the effect of \u003cem\u003elncRNA-MSTRG.16919.1\u0026nbsp;\u003c/em\u003eon viral yield, the tissue culture infective dose 50% (TCID\u003csub\u003e50\u003c/sub\u003e) and performed plaque assays were measured under \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e interference. The number of CPE wells was recorded. The data were calculated using the Reed-Muench method, and the TCID\u003csub\u003e50\u003c/sub\u003e values of each group were as follows: the TCID\u003csub\u003e50\u003c/sub\u003e of the 6T group was 8.7\u0026times;10\u003csup\u003e4\u003c/sup\u003e/ mL, the TCID\u003csub\u003e50\u003c/sub\u003e of the NC group was 2.3\u0026times;10\u003csup\u003e5\u003c/sup\u003e/ mL, and the TCID\u003csub\u003e50\u003c/sub\u003e of the MB group was 2.96\u0026times;10\u003csup\u003e5\u003c/sup\u003e/mL, and the obtained TCID\u003csub\u003e50\u0026nbsp;\u003c/sub\u003evalues were plotted in a bar graph. As shown in Figure 2E, the TCID\u003csub\u003e50\u0026nbsp;\u003c/sub\u003evalues in the 6T group were significantly higher than those in the other groups, indicating that silencing \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e inhibited viral replication. The results of the plaque assays (Figure 2F) showed that the viral titres were 6.33 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e (PFU/mL) for 6T, 8.83 \u0026times; 10\u003csup\u003e5\u0026nbsp;\u003c/sup\u003e(PFU/mL) for NC, and 1.25 \u0026times; 10\u003csup\u003e6\u0026nbsp;\u003c/sup\u003e(PFU/mL) for MB. The 6T group exhibited a lower viral titer compared to the NC and MB groups, indicating that silencing \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e suppressed viral replication. These results suggest that \u003cem\u003elncRNA-MSTRG.16919.1\u0026nbsp;\u003c/em\u003epromotes BHV-1 proliferation in MDBK cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003cem\u003eLncRNA-MSTRG.16919.1\u003c/em\u003e involved in NF-\u0026kappa;B and MAPK signaling pathways\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e is a novel lncRNA, its function and mechanism have not been reported. To investigate the molecular mechanism by which \u003cem\u003elncRNA-MSTRG.16919.1\u0026nbsp;\u003c/em\u003epromotes viral proliferation, transcriptome sequencing was performed on \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e silenced samples. The results of this analysis were previously published by our team(17). Data analysis revealed that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e may be involved in NF-\u0026kappa;B and MAPK signaling pathways. Some literatures also reported that some proteins such as TAK1/TAB1/TAB2/TAB3 complex were involved in the activation of NF-\u0026kappa;B signaling pathway. Therefore, the expression of TAB3, TAK1, TAB1, NF-\u0026kappa;B, JNK, I\u0026kappa;B, p-I\u0026kappa;B, and other proteins associated with NF-\u0026kappa;B and MAPK were examined. The results were shown in Figure 3. the expression of TAB3, TAK1, TAB1, NF-\u0026kappa;B, JNK, p-I\u0026kappa;B proteins were downregulated in 6T group compared to the NC, MB, and MDBK cell groups, suggesting that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e influences TAK1/TAB1/TAB2/TAB3 complex and the NF-\u0026kappa;B signaling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConstruction of TAK1 or TAB2 overexpressing cell lines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo demonstrate that lncRNA-MSTRG.16919.1 interacts with the TAK1/TAB1/TAB2/TAB3 complex, TAK1 or TAB2 genes were constructed into lentiviral vectors (Previous research in our team). Recombinant lentiviral were transfected into MDBK cells, and Western blot analysis revealed elevated expression of TAK1 and TAB2 proteins, confirming that TAK1 and TAB2 were effectively expressed in MDBK cells (Figure 4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe results of knockdown of lncRNA-MSTRG.16919.1 in cells overexpression TAK1 or TAB2 and BHV-1 proliferation-related factors detection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further investigate whether the effect of lncRNA-MSTRG.16919.1 on BHV-1 proliferation occurs through the TAK1/TAB1/TAB2/TAB3 complex, we performed a knockdown of lncRNA-MSTRG.16919.1 in TAK1 and TAB2 stable-expressed cells. These cells were then inoculated with the BHV-1. The transcription levels of the viral glycoproteins B and D are shown in Figures 5A and 5B. When lncRNA-MSTRG.16919.1 were silenced in cells overexpression TAK1 or TAB2, the transcription levels of the viral glycoproteins B and D were restored (6T group). The trend in protein expression changes followed the same pattern as the transcription levels (Figures 5F). The results of the viral TCID50 experiments were as follows: the TCID50 was 1.23\u0026times;107/mL in the overexpression TAK1 group, 9.4\u0026times;106/mL in the overexpression TAB2 group, 8.7\u0026times;105/mL in the 6T group, and 4\u0026times;106/mL in the MB group, and the obtained TCID50 values were plotted on a bar graph, and the results are shown in Figure 5C. The analysis showed that viral titers were increased in the overexpression of TAK1 and TAB2 groups. Statistical results from the plaque assay were shown in Figures 5D, further confirmed the increased viral titers in these groups. The results of viral DNA copy number experiments are shown in Figures 5E. The results showed that the amount of BHV-1 viral nucleic acid was elevated in the overexpression TAK1 and TAB2 groups. These findings indicate that overexpression of TAK1 and TAB2 restored the inhibition of viral replication caused by lncRNA-MSTRG.16919.1 knockdown.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults of protein levels of NF-\u0026kappa;B signaling pathway-related genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to detect the effect on NF-\u0026kappa;B signaling pathway after overexpression of TAK1 and TAB2, we examined the protein levels of the relevant genes, and the results of the Western Blot experiments are shown in Fig. 6, when overexpression of TAK1 and TAB2, the protein expression levels of TAB3, TAK1, TAB1, NF-\u0026kappa;B, and JNK increased, while the I\u0026kappa;B level decreased, \u0026nbsp; indicating that the inhibitory effect of lncRNA-MSTRG.16919.1 on BHV-1 was attenuated when overexpressing TAK1 or TAB2.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eBHV-1, a member of the herpesvirus family, causes multiple diseases in cattle. At present, the replication and growth characteristics of BHV-1 virus have been relatively clear, but the pathogenic mechanism of BHV-1, and the interaction between the BHV-1 and the host still requires further research, which is very beneficial for the prevention and control of infectious bovine rhinotracheitis.\u003c/p\u003e \u003cp\u003eLong non-coding RNAs are a class of molecules with poly-A tails but do not encode proteins. and can be specifically expressed in different tissues. It was previously regarded as transcriptional noise(\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). LncRNAs have a variety of functions, including regulation of transcription patterns, modulation of protein activity, and serving as precursors for small RNAs(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). Recent studies indicate that some viruses can regulate host and viral gene expression by regulating lncRNAs that have an effect on viral latency or replication. For example, when influenza A virus (IAV) infects A549 cells, a novel lncRNA reduces IAV replication by affecting the expression of interferon β1, suggesting that this lncRNA is a key regulator of the host antiviral response(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Conversely, some lncRNAs facilitate viral replication by evading cytoplasmic surveillance, thereby weakening antiviral immunity(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). For example, the 3\u0026rsquo;-untranslated region (3\u0026rsquo;UTR) of the flavivirus genome can transcribe small ncRNAs, namely subgenomic flavivirus RNA (sfRNA). This lncRNA shields viral RNA in infected cells from degradation by host exoribonuclease 1 (XRN1)(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). It remains unclear whether lncRNAs are produced following BHV-1 infection and what regulatory effects they may have on the virus. Our study revealed that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e expression was up-regulated in MDBK cells post-BHV-1 infection(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). As this is a newly identified gene with an unknown function, further research is needed to elucidate its role and underlying mechanisms. We analyzed \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e expression at the transcriptional level using RT-qPCR. The results confirmed an up-regulation trend consistent with sequencing data, warranting further investigation.\u003c/p\u003e \u003cp\u003eThe subcellular localization of lncRNAs is closely associated with their function(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). In the nucleus, lncRNAs interact with chromatin to modulate transcriptional regulation, influencing nuclear spatial organization(\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). In the cytoplasm, lncRNAs regulate post-transcriptional processes, including signal transduction, translation, and gene expression(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). \u003cem\u003eLncRNA-MSTRG.16919.1\u003c/em\u003e are newly identified, it is essential to determine his subcellular localization. So we applied the lncLocator online prediction software to predict the subcellular localization of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e by sequence, and the results showed that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e is found mainly in the cytoplasm, with a small amount is present in the nucleus. Nucleoplasm fractionation and fluorescence in situ hybridization (FISH) experiments further confirmed that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e is primarily localized in the cytoplasm, with a minor presence in the nucleus. According to nucleoplasm fractionation data, 89% of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e was localized in the cytoplasm in uninfected cells. Upon viral infection, its cytoplasmic proportion increased to 94%, suggesting a minor translocation from the nucleus to the cytoplasm. These findings suggest that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e may regulate gene expression at the post-transcriptional level.\u003c/p\u003e \u003cp\u003eThe BHV-1 genome encodes approximately 33 structural proteins, and both gB and gD proteins belong to the structural proteins of the virus, and the amount of their protein expression can reflect the number of viruses to a certain extent. Thus, gB and gD genes were selected to investigate the impact of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e on viral proliferation. Their expression was analyzed at both transcriptional and protein levels, and viral titers were measured using TCID\u003csub\u003e50\u003c/sub\u003e and the plaque assay. Combined experimental results indicate that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e enhances BHV-1 proliferation in MDBK cells.\u003c/p\u003e \u003cp\u003eTAK1 is an important molecule in the natural immune signaling pathway and can undergo phosphorylation, ubiquitination and acetylation upon stimulation. TAK1-binding protein 2 (TAB2) is a protein that binds to TAK1 and belongs to the TAB family, which also includes TAB1 and TAB3. Typically, TAB2 binds to TAK1, TAB1, and TAB3 to form the TAK1/TAB1/TAB2/3 complex, thereby regulates the activation of TAK1 and thus its biological functions(\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMany viruses affect the activity of NF-κB and/or MAPK signaling pathways by modulating the TAK1-TABs complex(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Latent membrane protein 1 (LMP1) of human herpesvirus (Epstein-Barr virus, EBV) is a transmembrane protein capable of activating the NF-κB signaling pathway through activation of the signaling factor TNF. Studies have shown that the transmembrane region of LMP1 promotes the formation of TAK1-TAB2 complex by recruiting TRAF6, TAB2 and TAK1, which further activates the downstream JNK/MAPK signaling pathway. In addition, EBV is capable of interacting with host GPX4 and affecting the TAK1-TAB1/TAB3 complex, which regulates TAK1 kinase activity and further activates the downstream JNK/MAPK and NF-κB pathways(\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). Moreover, Herpes simplex virus (HSV), for example, is able to activate NF-κB upon infection of macrophages by activating IKK via upstream cytokines such as TAK1, MEKK1 and NIK(\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e); Sendai virus (SeV) activates NF-κB and p38/MAPK signaling pathways via the RIG-I pathway during infection of fibroblasts and dendritic cells, in which TAK1-TABs also play an important role(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). Thus, viruses regulate the activity of the TAK1-TABs complex through a variety of pathways, which in turn affect signaling pathway transduction, regulate gene transcription and cytokine production, and ultimately affect viral replication.\u003c/p\u003e \u003cp\u003ePreliminary studies in our laboratory found that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e may be involved in NF-κB, MAPK signaling pathway. Combined with the reports in the above literature, we focused our study on the TAK1/TAB1/TAB2/TAB3 complex, and the results confirmed that after silencing of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e, the protein expression levels of TAK1, TAB1, TAB3 were all different degrees of down-regulation. It was demonstrated that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e was associated with the TAK1/TAB1/TAB2/TAB3 complex. In order to verify the effect of TAK1/TAB1/TAB2/TAB3 complex, we constructed the TAK1 and TAB2 stably-transfected cell lines with lentiviral vectors on MDBK cells. On this basis, the effect of TAK1/TAB1/TAB2/TAB3 complex on virus proliferation was studied by knocking down \u003cem\u003elncRNA-MSTRG.16919.1.\u003c/em\u003e The results showed that overexpression of TAK1, TAB2 backfills the inhibition of viral replication caused by knockdown of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn this study, we quantified the viral transcript level, protein level, DNA copy number and viral particles by down-regulating \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e, which resulted in significant inhibition of viral proliferation, suggesting that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e has the role of promoting BHV-1 proliferation in MDBK. Through transcriptome sequencing of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e-silenced samples, it was found that TAK1/TAB1/TAB2/TAB3 complex was significantly affected following \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e silencing. Viral suppression was attenuated, indicating that overexpression of TAK1 and TAB2 backfills the suppression of viral replication caused by knockdown of \u003cem\u003elncRNA-MSTRG.16919.1.\u003c/em\u003e Meanwhile, after overexpression of TAK1 and TAB2, the expression of TAK1, TAB1, TAB3, were up-regulated. These findings indicate that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e promotes BHV-1 replication in MDBK cells by targeting the TAK1/TAB1/TAB2/TAB3 complex. This study provides basic information on the function and regulatory mechanism of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e in cells, and also beneficial for the prevention and control of infectious bovine rhinotracheitis.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn summary, our study demonstrates that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e promotes BHV‑1 replication by regulating the TAK1‑TABs complex and activating the NF‑κB pathway, revealing its role in host\u0026ndash;virus interaction and offering potential targets for controlling bovine respiratory diseases.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eExperimental materials\u003c/h2\u003e \u003cp\u003eTAK1, TAB2 stably-transfected cell lines, Madin-darby bovine kidney cells (MDBK), and Bovine herpesvirus 1 (BHV-1), were preserved in the Animal Infectious Disease Rapid Diagnostic Laboratory of China Agricultural University. DMEM medium (Gibco, USA); Polyglutamine (Brain, China); Puromycin (MCE, USA); RNA Extraction Kit RC101, Reverse Transcription Kit R323, Real-Time Fluorescent Quantitative PCR Kit Q711 (Vazyme, China); Goat Anti-Rabbit IgG-HRP Antibody, Beta Actin Antibody (Bioss, China); ECL Colour Developing Solution (Merck, Germany); Pre-stained Protein Marker, BCA Quantification Kit (Biosharp, China), RIPA Lysate (Solarbio, China); TAK1, TBK1, TAB2, TAB3 (Affinity Biosciences, China); Ribo lncRNA Smart Silencer interfering fragments (RiboBio, China) were designed and synthesised.\u003c/p\u003e \u003cp\u003e \u003cb\u003eLncRNA-MSTRG.16919.1\u003c/b\u003e \u003cb\u003eexpression validation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTotal RNA was extracted from BHV-1-infected MDBK cells (33 h post-infection) and uninfected control cells using the Trizol method. The RNA was then reverse transcribed into cDNA and analyzed by real-time quantitative PCR to determine the relative transcript levels of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eThe total RNA of cell samples was extracted using the RNA Extraction Kit RC101(Vazyme, China) according to the instructions of the kit, and the mass concentration of RN-A was detected by NanoDrop 2000. Reverse transcription was carried out using Vazyme reverse transcription reagent (R323, Vazyme, China). The primers for real-time fluorescence quantitative PCR were synthesized by Sangon Biotech (Shanghai) Co., Lt. The primers used for RT-qPCR are listed below. \u003cem\u003eLncRNA-MSTRG.16919.1\u003c/em\u003e: forward sequence, GCCCTCAATCTTTCCCAGCATC and reverse sequence, GGCAGCAAGGAGATCAAACCAGT; UCHL5: forwared sequence, ACAAAGACAACTTGCTGAGGAAC and reverse sequence, GGCAACCTCTGACTGAATAGCACTT. Ubiquitin C-terminal Hydrolase L5 (UCHL5) was used as the internal control and the results were calculated with the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cb\u003eLncRNA-MSTRG.16919.1\u003c/b\u003e \u003cb\u003esubcellular localization assay\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe subcellular localization of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e was verified by fluorescence in situ hybridization experiments and nuclear and cytoplasmic fractionation assay. The operation was performed according to the instruction manual of Ribo\u0026trade; Fluorescent In Situ Hybridization Kit. The fluorescent labelled probes \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e, U6 RNA and 18S rRNA were designed and synthesized by Guangzhou RiboBio Co., Ltd.. Nucleus and cytoplasmic RNA of the samples were extracted separately according to NORGEN's Cytoplasmic and Nucleus RNA Extraction Kit #21000 (Norgen Biotek Corporation, Canada). After the Ct values of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e, U6, GAPDH, and 18S were measured by RT-qPCR in the cytoplasm and nucleus, respectively, the following formula was applied to calculate the percentage of each gene in the cytoplasm and nucleus.\u003c/p\u003e \u003cp\u003eThe primers used for RT-qPCR are listed below. U6: forward sequence, GCTCGCTTCGGCAGCACATATA and reverse sequence, CGAATTTGCGTGTCATCCTTGCG; 18S: forw-ard sequence, GGACACGGACAGGATTGACAGATTG and reverse sequence, CATGCCCAGAGTCTCGTTCGTTATC; GAPDH: forward sequence, ACGGCAAGTTCAACGGCACAG and reverse sequence, CCACATACTCAGCACCAGCATCAC.\u003c/p\u003e \u003cp\u003eCytoplasm %=2\u003csup\u003eCt nucleus\u003c/sup\u003e/ (2\u003csup\u003eCt nucleus\u003c/sup\u003e +2\u003csup\u003eCt cytoplasm\u003c/sup\u003e) \u0026times;100%\u003c/p\u003e \u003cp\u003eNucleus %= 2\u003csup\u003eCT cytoplasm\u003c/sup\u003e/ (2\u003csup\u003eCt nucleus\u003c/sup\u003e + 2\u003csup\u003eCTcytoplasm\u003c/sup\u003e) \u0026times;100%\u003c/p\u003e \u003cp\u003e \u003cb\u003eLncRNA-MSTRG.16919.1\u003c/b\u003e \u003cb\u003eknock-down and BHV-1 proliferation-related factors detection\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cb\u003eLncRNA-MSTRG.16919.1\u003c/b\u003e \u003cb\u003eknock-down\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe knockdown of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e was performed using the same method as described in our prior work (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eQuantitative detection of viral DNA\u003c/h3\u003e\n\u003cp\u003eIn order to detect the effect of \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e on viral DNA replication, silencing-treated MDBK cells were infected with BHV-1 for 33 h, the DNA of the samples was extracted with the Viral Genomic DNA Extraction Kit (DP315) from Tiangen Biochemical Technology (Beijing) Co., LTD, and then the amount of viral DNA was detected in the \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e silencing-treated group by TaqMan fluorescence quantitative PCR. TaqMan probes and primers were designed using Primer Premier 5, and the primers and probes were synthesised by Sangon Biotech (Shanghai) Co., Lt. The primers used for RT-qPCR are listed below. BoHV-1072401: forward sequence, TAGTGGCTGGCCGTTTGCT and reverse sequence, ACACACGCGCACGCAAC. TaqMan real-time PCR probe sequence: TTGGCAATTTACGTTCCGTCGAC. The fluoresc-eeent group is 6-FAM and the quenching group is BHQ1.The program conditions of Taq-Man real-time PCR were as follows: 95℃ for 600s; 45 cycles were performed at 95\u0026deg;C for 30s and 58\u0026deg;C for 30s.\u003c/p\u003e\n\u003ch3\u003eQuantitative detection of viral glycoprotein gB/gD mRNA\u003c/h3\u003e\n\u003cp\u003eCellular RNA extraction and cDNA acquisition were carried out according to step 1.2. \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e Real-time fluorescence quantitative PCR was performed to detect the transcript levels of gB and gD genes of BHV-1 after \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e gene silencing. The primer sequences are as follows. gTB: forward sequence, CGTACACGTTCAAGGCCTACATTTAC and reverse sequence, GTCCGTGTACTGGTTTGTAATGG; gD: forward sequence, ATTACGAGCAAAAGAAGGTTCTGCG and reverse sequence, TAGCCCTTCGACTCCTCAAAATACG.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eThe detection of viral glycoprotein gB/gD protein\u003c/h2\u003e \u003cp\u003eAfter \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e silenced and infected with BHV-1 for 33 h, the samples were lysed using high efficiency RIPA cell lysis solution (Solarbio). The samples were collected after lysis on ice for 30 min. The centrifugation was performed at 4\u0026deg;C and 12000 rpm/min for 5 min, and the supernatant was collected, and the protein concentration was determined by BCA Protein Quantification Kit (Vazyme). The protein samples were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and subjected to western blot (WB) detection. The primary antibody was a monoclonal antibody against BHV-1 gB and gD glycoproteins (1:500 dilution), and the secondary antibody was a goat anti-mouse IgG-HRP antibody (1:5000 dilution), which were prepared in our laboratory, and the samples were incubated at room temperature for 2h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eVirus TCID\u003csub\u003e50\u003c/sub\u003e assay\u003c/h2\u003e \u003cp\u003eIn order to detect the change of BHV-1 virus particle amount after \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e silencing treatment, we performed tissue culture infective dose 50% (TCID\u003csub\u003e50\u003c/sub\u003e) assay. Firstly, the virus was diluted by taking 9 sterile EP tubes and adding 900 \u0026micro;L of DMEM to each of them, taking 100 \u0026micro;L of the virus stock solution pre-stored at 4\u0026deg;C and adding it to the first EP tube, blowing and mixing it and then removing 100 \u0026micro;L and adding it to the second EP tube, and diluting the virus solution in gradients of 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e and 10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e dilutions; they were added to 96-well plates at 10 \u0026micro;L/well, and eight replicate wells were prepared for each concentration in three independent replicate experiments. The treated 96-well plates were incubated at 37℃ in a 5% CO\u003csub\u003e2\u003c/sub\u003e incubator for 1 h. Subsequently, 90 \u0026micro;L of DMEM medium containing only 1% penicillin and streptomycin was added to each well and incubated for 72 h. The CPE were observed by Inverted Fluorescence Microscope (Olympus), and TCID\u003csub\u003e50\u003c/sub\u003e/100 \u0026micro;L was calculated according to the number of CPE wells.\u003c/p\u003e \u003cp\u003eThe TCID₅₀ of treated viral strains was calculated using the Reed-Muench method.\u003c/p\u003e \u003cp\u003eProportional Distance (PD) = [(% positive at dilution above 50%)\u0026thinsp;\u0026minus;\u0026thinsp;50%] / [(% positive above 50%) - (% positive below 50%)]\u003c/p\u003e \u003cp\u003eLog₁₀TCID₅₀ = (Proportional Distance \u0026times; log₁₀ dilution factor)\u0026thinsp;+\u0026thinsp;log₁₀ of the highest dilution showing\u0026thinsp;\u0026ge;\u0026thinsp;50% cytopathic effect (CPE)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePlaque assay\u003c/h2\u003e \u003cp\u003eTo further validate the change in the number of BHV-1 after \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e silencing treatment, we further determined the viral titre by plaque forming units (PFUs) assay. Virus was diluted as in Virus TCID50 assay, and each gradient was added to a six-well plate containing MDBK cells at 200 \u0026micro;L/well, and three wells were set up for each concentration gradient with three independent replicates of the assay. The plates were incubated at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e for 1 h. The plates were gently shaken at 20 min intervals to make the viral solution come into contact with the cells evenly. After incubation for 1 h, 2 mL of an equal volume mixture of 2% low melting point agarose and 2% complete medium was added to each well, and left at room temperature for 20 min. After the coverings in the cell plates solidified, they were inverted and stored in 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e incubator for 3\u0026ndash;5 days to observe the formation time, morphology and number of plaques. The emerging plaque were stained using 0.02% neutral red. Observe the morphology of the plaque and record the number of plaques, and calculate the viral titer according to the following formula:\u003c/p\u003e \u003cp\u003eViral Titer Calculation Formula:\u003c/p\u003e \u003cp\u003ePlaque-forming units (PFU)/mL = (Mean plaque count \u0026times; Reciprocal of dilution factor) \u0026divide; Inoculum volume (mL)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eExpression of TAK1 and TAB2 protein\u003c/h2\u003e \u003cp\u003eWe packaged the bovine TAK1 and TAB2 genes into lentivirus, followed by infection of MDBK cells. Puromycin was used for selection. The TAK1 and TAB2 stable-transfected cell lines were cultured in complete DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e. After 3\u0026ndash;5 generations, the cells were inoculated into 6-well plates according to 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/well, and protein samples were collected when confluence reached about 80%. The samples were lysed by high-efficiency RIPA cell lysis solution (Solarbio) on ice for 30 min, and gently tapped every 5 min to make them fully lysed, and the processed samples were collected into sterile centrifuge tubes. After centrifugation, the supernatant was divided and stored while protein concentration was determined. The protein expression in each group was detected by using Western blot.\u003c/p\u003e \u003cp\u003e \u003cb\u003eKnockdown\u003c/b\u003e \u003cb\u003elncRNA-MSTRG.16919.1\u003c/b\u003e \u003cb\u003ein the cells of overexpression TAK1 or TAB2 and BHV-1 proliferation-related factors detection\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOverexpressing TAK1, TAK1-NC, TAB2 or TAB2-NC cell lines and MDBK cells were resuscitated, and after the cells were passaged to 3\u0026ndash;5 generations, they were inoculated into 6-well plates according to 1.6\u0026times;10\u003csup\u003e5\u003c/sup\u003e/well, and when the confluence rate reached about 50%-60%, Ribo lncRNA Smart Silencer transfection was performed. After 24 h, BHV-1 was inoculated into the cells at a dose of MOI 1. After incubation for 1 h at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e, DMEM medium containing only 1% penicillin was added, and the cells were placed in a cell culture incubator for further incubation, and cells not inoculated with the virus were set up as the control group, and CPE was observed at 33 h post-infection for the collection and preservation of protein and nucleic acid samples.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sequence data for \u003cem\u003eLncRNA-MSTRG.16919.1\u003c/em\u003e reported in this study have been deposited in the GenBank database under accession number PZ291134. These data are currently held as private and will be released upon the formal publication of this manuscript. The raw RNA-sequencing data generated in this study have been deposited in the NCBI Sequence Read Archive (SRA) repository, PRJNA1449764 (https://dataview.ncbi.nlm.nih.gov/object/PRJNA1449764?reviewer=n0ahikvoi8aouqi790fr4i4he9) and PRJNA1453208 (https://dataview.ncbi.nlm.nih.gov/object/PRJNA1453208?reviewer=7e5vc0hm6jmcuko3013tf7o1hj). All other relevant data supporting the findings of this study are included within the article and its supplementary information files, or are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Natural Science Foundation of China\u0026nbsp;(No.32473006).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFan Zhang: methodology, data curation, writing-original draft. Caina Song: validation. Jinzhu Ma: supervision. Liquan Yu: supervision. Chen Peng: supervision. Wenxue Wu: supervision, writing-reviewing and editing, funding acquisition. Baifen Song: supervision, writing-reviewing and editing, funding acquisition.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChase CCL, Fulton RW, O\u0026rsquo;Toole D, Gillette B, Daly RF, Perry G, et al. Bovine herpesvirus 1 modified live virus vaccines for cattle reproduction: Balancing protection with undesired effects. Veterinary Microbiology. 2017 Jul 1;Recent Advances in Vaccine Research Against Economically Important Viral Diseases of Food Animals206:69\u0026ndash;77. doi:10.1016/j.vetmic.2017.03.016\u003c/li\u003e\n\u003cli\u003eRighi C, Franzoni G, Feliziani F, Jones C, Petrini S. The Cell-Mediated Immune Response against Bovine alphaherpesvirus 1 (BoHV-1) Infection and Vaccination. Vaccines. 2023 Apr;11(4):785. doi:10.3390/vaccines11040785\u003c/li\u003e\n\u003cli\u003eOuyang J, Hu J, Chen JL. lncRNAs regulate the innate immune response to viral infection. WIREs RNA. 2016 Jan;7(1):129\u0026ndash;43. doi:10.1002/wrna.1321\u003c/li\u003e\n\u003cli\u003eLiu W, Ding C. Roles of LncRNAs in Viral Infections. Front Cell Infect Microbiol. 2017 May 26;7. doi:10.3389/fcimb.2017.00205\u003c/li\u003e\n\u003cli\u003eAjibade AA, Wang HY, Wang RF. Cell type-specific function of TAK1 in innate immune signaling. Trends in Immunology. 2013 Jul 1;34(7):307\u0026ndash;16. doi:10.1016/j.it.2013.03.007\u003c/li\u003e\n\u003cli\u003eDai L, Aye Thu C, Liu XY, Xi J, Cheung PCF. TAK1, more than just innate immunity. IUBMB Life. 2012 Oct;64(10):825\u0026ndash;34. doi:10.1002/iub.1078 PubMed PMID: 22941947.\u003c/li\u003e\n\u003cli\u003eFan Y, Yu Y, Shi Y, Sun W, Xie M, Ge N, et al. Lysine 63-linked Polyubiquitination of TAK1 at Lysine 158 Is Required for Tumor Necrosis Factor \u0026alpha;- and Interleukin-1\u0026beta;-induced IKK/NF-\u0026kappa;B and JNK/AP-1 Activation*. Journal of Biological Chemistry. 2010 Feb 19;285(8):5347\u0026ndash;60. doi:10.1074/jbc.M109.076976\u003c/li\u003e\n\u003cli\u003eSilverman N, Zhou R, Erlich RL, Hunter M, Bernstein E, Schneider D, et al. Immune activation of NF-kappaB and JNK requires Drosophila TAK1. J Biol Chem. 2003 Dec 5;278(49):48928\u0026ndash;34. doi:10.1074/jbc.M304802200 PubMed PMID: 14519762.\u003c/li\u003e\n\u003cli\u003eShim JH, Xiao C, Paschal AE, Bailey ST, Rao P, Hayden MS, et al. TAK1, but not TAB1 or TAB2, plays an essential role in multiple signaling pathways in vivo. Genes Dev. 2005 Nov 15;19(22):2668\u0026ndash;81. doi:10.1101/gad.1360605 PubMed PMID: 16260493; PubMed Central PMCID: PMC1283960.\u003c/li\u003e\n\u003cli\u003eOri D, Kato H, Sanjo H, Tartey S, Mino T, Akira S, et al. Essential Roles of K63-Linked Polyubiquitin-Binding Proteins TAB2 and TAB3 in B Cell Activation via MAPKs. J Immunol. 2013 Apr 1;190(8):4037\u0026ndash;45. doi:10.4049/jimmunol.1300173\u003c/li\u003e\n\u003cli\u003eZhuang ZH, Sun L, Kong L, Hu JH, Yu MC, Reinach P, et al. \u003cem\u003eDrosophila\u003c/em\u003e TAB2 is required for the immune activation of JNK and NF-kappaB. Cellular Signalling. 2006 Jul 1;18(7):964\u0026ndash;70. doi:10.1016/j.cellsig.2005.08.020\u003c/li\u003e\n\u003cli\u003eLiu KL, Yang YC, Yao HT, Chia TW, Lu CY, Li CC, et al. Docosahexaenoic acid inhibits inflammation via free fatty acid receptor FFA4, disruption of TAB2 interaction with TAK1/TAB1 and downregulation of ERK-dependent Egr-1 expression in EA.hy926 cells. Molecular Nutrition \u0026amp; Food Research. 2016;60(2):430\u0026ndash;43. doi:10.1002/mnfr.201500178\u003c/li\u003e\n\u003cli\u003eGong J, Shen XH, Qiu H, Chen C, Yang RG. Rhesus monkey TRIM5\u0026alpha; represses HIV-1 LTR promoter activity by negatively regulating TAK1/TAB1/TAB2/TAB3-complex-mediated NF-\u0026kappa;B activation. Arch Virol. 2011 Nov;156(11):1997\u0026ndash;2006. doi:10.1007/s00705-011-1097-6 PubMed PMID: 21918865.\u003c/li\u003e\n\u003cli\u003eLei X, Han N, Xiao X, Jin Q, He B, Wang J. Enterovirus 71 3C inhibits cytokine expression through cleavage of the TAK1/TAB1/TAB2/TAB3 complex. J Virol. 2014 Sep 1;88(17):9830\u0026ndash;41. doi:10.1128/JVI.01425-14 PubMed PMID: 24942571; PubMed Central PMCID: PMC4136319.\u003c/li\u003e\n\u003cli\u003eAlam SK, Wang L, Zhu Z, Hoeppner LH. IKK\u0026alpha; promotes lung adenocarcinoma growth through ERK signaling activation via DARPP-32-mediated inhibition of PP1 activity. NPJ Precis Oncol. 2023 Mar 25;7(1):33. doi:10.1038/s41698-023-00370-3 PubMed PMID: 36966223; PubMed Central PMCID: PMC10039943.\u003c/li\u003e\n\u003cli\u003eZheng Y, Yu M, Chen Y, Xue L, Zhu W, Fu G, et al. CARD19, a Novel Regulator of the TAK1/NF-\u0026kappa;B Pathway in Self-Reactive B Cells. J Immunol. 2023 May 1;210(9):1222\u0026ndash;35. doi:10.4049/jimmunol.2200639 PubMed PMID: 36961449; PubMed Central PMCID: PMC10156913.\u003c/li\u003e\n\u003cli\u003eZhang F, Jiang K, Wang Y, Ma J, Song B. Analysis of the Function of LncRNA-MSTRG.16919.1 in BHV-1-Infected Bovine Kidney Subculture Cells by Transcriptome Sequencing. Viruses. 2022 Oct;14(10):2104. doi:10.3390/v14102104\u003c/li\u003e\n\u003cli\u003eMoon SL, Dodd BJT, Brackney DE, Wilusz CJ, Ebel GD, Wilusz J. Flavivirus sfRNA suppresses antiviral RNA interference in cultured cells and mosquitoes and directly interacts with the RNAi machinery. Virology. 2015 Nov 1;485:322\u0026ndash;9. doi:10.1016/j.virol.2015.08.009\u003c/li\u003e\n\u003cli\u003ePalazzo AF, Lee ES. Non-coding RNA: what is functional and what is junk? Front Genet. 2015;6:2. doi:10.3389/fgene.2015.00002 PubMed PMID: 25674102; PubMed Central PMCID: PMC4306305.\u003c/li\u003e\n\u003cli\u003eSullivan CS. New roles for large and small viral RNAs in evading host defences. Nat Rev Genet. 2008 Jul;9(7):503\u0026ndash;7. doi:10.1038/nrg2349\u003c/li\u003e\n\u003cli\u003eColombo T, Farina L, Macino G, Paci P. PVT1: a rising star among oncogenic long noncoding RNAs. Biomed Res Int. 2015;2015:304208. doi:10.1155/2015/304208 PubMed PMID: 25883951; PubMed Central PMCID: PMC4391155.\u003c/li\u003e\n\u003cli\u003eDing Y zhong, Zhang Z wang, Liu Y li, Shi C xu, Zhang J, Zhang Y guang. Relationship of long noncoding RNA and viruses. Genomics. 2016 Apr;107(4):150\u0026ndash;4. doi:10.1016/j.ygeno.2016.01.007 PubMed PMID: 26826341.\u003c/li\u003e\n\u003cli\u003eDoncheva NT, Morris JH, Gorodkin J, Jensen LJ. Cytoscape StringApp: Network Analysis and Visualization of Proteomics Data. J Proteome Res. 2019 Feb 1;18(2):623\u0026ndash;32. doi:10.1021/acs.jproteome.8b00702 PubMed PMID: 30450911; PubMed Central PMCID: PMC6800166.\u003c/li\u003e\n\u003cli\u003eChen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018 Sep 1;34(17):i884\u0026ndash;90. doi:10.1093/bioinformatics/bty560 PubMed PMID: 30423086; PubMed Central PMCID: PMC6129281.\u003c/li\u003e\n\u003cli\u003eZhao L, Xia M, Wang K, Lai C, Fan H, Gu H, et al. A Long Non-coding RNA IVRPIE Promotes Host Antiviral Immune Responses Through Regulating Interferon \u0026beta;1 and ISG Expression. Front Microbiol. 2020 Feb 20;11. doi:10.3389/fmicb.2020.00260\u003c/li\u003e\n\u003cli\u003eBridges MC, Daulagala AC, Kourtidis A. LNCcation: lncRNA localization and function. J Cell Biol. 2021 Feb 1;220(2):e202009045. doi:10.1083/jcb.202009045 PubMed PMID: 33464299; PubMed Central PMCID: PMC7816648.\u003c/li\u003e\n\u003cli\u003eMel\u0026eacute; M, Mattioli K, Mallard W, Shechner DM, Gerhardinger C, Rinn JL. Chromatin environment, transcriptional regulation, and splicing distinguish lincRNAs and mRNAs. Genome Res. 2017 Jan;27(1):27\u0026ndash;37. doi:10.1101/gr.214205.116 PubMed PMID: 27927715; PubMed Central PMCID: PMC5204342.\u003c/li\u003e\n\u003cli\u003eClemson CM, Hutchinson JN, Sara SA, Ensminger AW, Fox AH, Chess A, et al. An Architectural Role for a Nuclear Noncoding RNA: \u003cem\u003eNEAT1\u003c/em\u003e RNA Is Essential for the Structure of Paraspeckles. Molecular Cell. 2009 Mar 27;33(6):717\u0026ndash;26. doi:10.1016/j.molcel.2009.01.026\u003c/li\u003e\n\u003cli\u003eXia Z, Xu G, Yang X, Peng N, Zuo Q, Zhu S, et al. Inducible TAP1 Negatively Regulates the Antiviral Innate Immune Response by Targeting the TAK1 Complex. J Immunol. 2017 May 1;198(9):3690\u0026ndash;704. doi:10.4049/jimmunol.1601588 PubMed PMID: 28356387.\u003c/li\u003e\n\u003cli\u003eYuan L, Li S, Chen Q, Xia T, Luo D, Li L, et al. EBV infection-induced GPX4 promotes chemoresistance and tumor progression in nasopharyngeal carcinoma. Cell Death Differ. 2022 Aug;29(8):1513\u0026ndash;27. doi:10.1038/s41418-022-00939-8 PubMed PMID: 35105963; PubMed Central PMCID: PMC9346003.\u003c/li\u003e\n\u003cli\u003eLu X, Huang C, Zhang Y, Lin Y, Wang X, Li Q, et al. The Us2 Gene Product of Herpes Simplex Virus 2 modulates NF-\u0026kappa;B activation by targeting TAK1. Sci Rep. 2017 Aug 21;7:8396. doi:10.1038/s41598-017-08856-4 PubMed PMID: 28827540; PubMed Central PMCID: PMC5566419.\u003c/li\u003e\n\u003cli\u003eMogensen TH, Melchjorsen J, H\u0026ouml;llsberg P, Paludan SR. Activation of NF-kappa B in virus-infected macrophages is dependent on mitochondrial oxidative stress and intracellular calcium: downstream involvement of the kinases TGF-beta-activated kinase 1, mitogen-activated kinase/extracellular signal-regulated kinase kinase 1, and I kappa B kinase. J Immunol. 2003 Jun 15;170(12):6224\u0026ndash;33. doi:10.4049/jimmunol.170.12.6224 PubMed PMID: 12794154.\u003c/li\u003e\n\u003cli\u003eMikkelsen SS, Jensen SB, Chiliveru S, Melchjorsen J, Julkunen I, Gaestel M, et al. RIG-I-mediated activation of p38 MAPK is essential for viral induction of interferon and activation of dendritic cells: dependence on TRAF2 and TAK1. J Biol Chem. 2009 Apr 17;284(16):10774\u0026ndash;82. doi:10.1074/jbc.M807272200 PubMed PMID: 19224920; PubMed Central PMCID: PMC2667765.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Bovine herpesvirus type I, LncRNA-MSTRG.16919.1, TAK1, TAB2","lastPublishedDoi":"10.21203/rs.3.rs-9233725/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9233725/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eBovine herpesvirus type 1 (BHV-1) is the primary pathogen responsible for infectious rhinotracheitis in cattle, leading to significant economic losses in the cattle industry. Long non-coding RNAs (lncRNAs) are multifunctional transcriptional regulators that play a role in the regulation of host-virus-specific interactions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003eOur previous study found that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003e is highly expressed in BHV-1 infected MDBK cells. Functional assays showed that its silencing reduced viral DNA replication, downregulated transcription and protein expression of glycoproteins gB and gD, and decreased virion production, indicating that it promotes BHV-1 proliferation. Further investigation revealed that knockdown of this lncRNA reduced protein levels of TAB1, TAB2, TAB3, and TAK1. To validate the involvement of the TAK1/TABs complex, we overexpressed TAK1 or TAB2 in cells with lncRNA knockdown. Overexpression restored viral DNA synthesis, gB and gD expression, and virus titers, counteracting the suppression caused by lncRNA silencing. Moreover, TAK1 or TAB2 overexpression elevated protein levels of TAB3, TAB1, TAK1, NF-κB, and JNK.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eThese results demonstrate that \u003cem\u003elncRNA-MSTRG.16919.1\u003c/em\u003efacilitates BHV-1 replication by modulating the TAK1-TABs complex and activating the NF-κB pathway. These findings provide foundational insights for studying the function and regulatory mechanisms of\u003cem\u003e lncRNA-MSTRG.16919.1\u003c/em\u003ein organisms, and contribute to the understanding of the pathogenic mechanisms of BHV-1, aiding in the prevention and control of bovine respiratory diseases.\u003c/p\u003e","manuscriptTitle":"LncRNA-MSTRG.16919.1 regulates the proliferation of BHV-1 in MDBK cells through TAK1/TAB1/TAB2/TAB3 complexes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-04 19:24:39","doi":"10.21203/rs.3.rs-9233725/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-05-15T14:52:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"7831580498275982169307160919160550381","date":"2026-05-04T03:36:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"3368254967241305775745432023627163931","date":"2026-04-29T06:27:05+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-23T20:42:50+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-19T19:04:51+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-04-18T16:12:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-17T07:25:20+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2026-04-17T06:54:04+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"39e9f1c6-6848-43e0-a4e1-bb2b681ac9c0","owner":[],"postedDate":"May 4th, 2026","published":true,"recentEditorialEvents":[{"type":"editorInvitedReview","content":"","date":"2026-05-15T14:52:57+00:00","index":41,"fulltext":""},{"type":"reviewerAgreed","content":"7831580498275982169307160919160550381","date":"2026-05-04T03:36:02+00:00","index":39,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-04T19:24:40+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-04 19:24:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9233725","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9233725","identity":"rs-9233725","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.