Molecular Cloning and Immunogenicity Determination of Norovirus Proteins as Vaccine Candidates

preprint OA: closed
Full text JSON View at publisher
Full text 131,947 characters · extracted from preprint-html · click to expand
Molecular Cloning and Immunogenicity Determination of Norovirus Proteins as Vaccine Candidates | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular Cloning and Immunogenicity Determination of Norovirus Proteins as Vaccine Candidates Demet Yalçın Bingül, Gamze Başbülbül This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4269416/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Human Noroviruses (HuNoVs) are considered the main cause of gastroenteritis in developed and developing countries. Aim of this research was to recombinant production of some structural and functional Norovirus proteins and to determine their immunogenicity in mice. Synthetic VP1, VP2, p22 and a polypeptide (EP123) sequences were amplified with PCR and then amplicons in pET-30a (+) expression vector were transformed into E. coli BL21 cells. Recombinantly produced proteins were purified by Ni-NTA chromotograhy and ammonium sulphate precipitation. Molecular weights of recombinant VP1, VP2, P22 and EP123 were estimated as 63, 34.4, 26 and 27.9 kDa, respectively. Indirect ELISA method was applied to detect IgG levels from serum samples of vaccinated mice. Considering that samples with a p/n ratio of 2 and greater than 2 were positive, VP1 was found to be immunogenic up to a dilution of 1/160 (p/n = 2.09). While VP2 and P22 were found to be immunogenic up to a dilution of 1/80 and 1/20 respectively, EP123 did not give positive result in any dilution. These results suggest that recombinantly produced VP1, has immunogenic potential, whereas VP2, P22 and EP123 polypeptide did not show promising result as a vaccine candidate. Noroviruses Escherichia coli Recombinant Protein Production Cloning Immune response Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 1. Introduction Human Noroviruses (HuNoVs) are accepted as the main cause of non-bacterial gastroenteritis in developed and developing countries [1, 2]. The spread of the disease in epidemics is especially common in closed areas such as cruise ships, hospitals, homes for aged, schools and kindergartens. This is because HuNoVs are very easily transmitted from person to person, and the virus can survive in contaminated areas for up to several days. HuNoVs can be transmitted through contact with an infected person or with contaminated surfaces, objects or by consuming contaminated food and water [3, 4]. All age groups especially infants, the elderly and immunocompromised patients are susceptible to HuNoVs. Globally, HuNoVs causes an estimated 699 million cases of illness and 219,000 deaths each year, resulting in over $4 billion in direct medical costs and over $60 billion in indirect medical costs [5, 6]. HuNoVs are non-enveloped viruses with a single-stranded RNA (ssRNA+) genome of about 7.5 kb. The genome of HuNoV is organized into three Open Reading Frames (ORFs). ORF1 encodes a polyprotein which is consisting of six nonstructural (NS) proteins. Starting from the 5′ end, respectively, non-structural proteins are p48, nucleoside triphosphatase (NTPase), p22, VPg, protease (Pro) and RNA dependent RNA polymerase (RdRp). ORF2 encodes the major structural protein (VP1) and ORF3 encodes a small structural protein (VP2) [7-9]. HuNoVs are classified according to the similarity of the highly conserved regions of RdRp and VP1 [10]. Accordingly, Noroviruses (NoVs) are divided into ten genogroups (GI–GX). GI, GII, GIV, GVIII and GIX cause disease in humans [11]. GII.4 is the only genotype associated with global gastroenteritis pandemics [12, 13]. GII.4 viruses have caused all six major HuNoVs pandemics over the past two decades [12, 14-19]. Although the World Health Organization (WHO) stated that developing a HuNoVs vaccine should be an absolute priority in 2016, currently no HuNoVs vaccine have been licensed. The major obstacle to the development of an effective HuNoVs vaccine is the lack of robust and reproducible in-vivo and in-vitro infection models. It has been reported that HuNoVs can efficiently infect B cells [20, 21] and human intestinal enteroids [22-24] for the development of these culture systems. The application of recombinant viral antigens has been an important approach in diagnostic and vaccine development studies. A series of HuNoVs vaccines have been designed based on Virus-like particles (VLPs) or P particles contained within VP1 due to their structural and functional properties. VLPs are antigenically similar to the viral particle and can induce a specific antibody response when administered both enterally and parenterally without any risk of infection [25]. As a NoV vaccine candidate, especially VP1, which forms VLPs, has been used in both preclinical and clinical studies [26]. To date, NoV VP1 protein has been successfully obtained using various expression systems, including insect cells, P. pastoris , N. benthamiana and E. coli [8, 27-32]. The finding that VP2 is not necessary for the formation of VLPs has caused it not to be preferred in vaccine studies [33, 34]. In this study, we aimed to produce recombinant HuNoV proteins that could be vaccine candidates against norovirus infection and to reveal their immunogenic potentials. To the best of our knowledge, the feasibility of the p22 protein and EP123 polypeptide consisting of epitopes has not been tested before as vaccine candidates. Although it has been observed that these proteins do not induce an immune response against norovirus, it is important to test the multi-epitope approach in-vivo . 2. Materials and Methods 2.1 Ethics statement Animal experiments were carried out in accordance with the rules of Aydın Adnan Menderes University animal experiments local ethics committee (HADYEK). The research protocol was approved by HADYEK (64583101/2021/032). 2.2 Plasmids, bacterial strains, and culture conditions E. coli DH10B, BL21 (DE3) strains and pET-30a (+) vector were used for HuNoVs DNA manipulations, amplification and expression. Tryptic soy agar (TSA), Luria-Bertani (LB) agar and broth were used for cultivation of E. coli strains. 2.3 Supply and amplification of gene sequences Gene sequences encoding VP1, VP2, and p22 proteins were retrieved from Norovirus Hu/GII.4/New Orleans1805 (GenBank accession code: GU445325.2) complete genome are included in Supplementary Informations. Codon optimizations for heterologous expression in E . coli Genescript online tool was used. After VP1, VP2 and p22 genes were analyzed using the online program http://sysbio.unl.edu/SVMTriP/result.php epitope maps of the proteins were obtained. A polypeptide sequence (EP123) was created by taking three (highest scoring) epitope regions for VP1 and VP2 and two for p22 (Supplementary Fig. S1-S3). A 690-base fragment consisting of 8 epitopes containing 20 amino acids each and 10 glycine amino acids between the two epitopes was designed (Fig. 1). The final DNA sequences were synthesized by Triogen Biotechnology Company (Turkey). The synthetic VP1 and EP123 genes were delivered in plasmid vector pEX-A258 vector, while VP2 and p22 are provided in the pEX-A128 vector (Fig. 2). 2.4 Cloning of VP1, VP2, p22 and EP123 genes Plasmid Isolation and Restriction Plasmids contained optimized Norovirus gene sequences were dissolved in Tris-EDTA (TE) (10mM) buffer according to the manufacturer's protocol and then transferred to E. coli DH10B competent by heat shock transformation method [35]. pEX-A258 and pEX-A128 plasmid DNAs were isolated with the GeneAll-ExprepTM-Plasmid SV plasmid extraction kit. Restriction process was applied to confirm the presence of gene fragments in the isolated plasmids. For restriction of VP1 and EP123; 10 µL plasmid, 6 µL sterile water, 2 µL 10X buffer, 1 µL XhoI and 1 µL XbaI enzyme (FastDigest, Thermo Fhiser Scientific, USA) were used. For restriction of VP2 and p22; 10 µL plasmid, 6 µL sterile water, 2 µL 10X buffer, 1 µL BamHI and 1 µL NotI enzyme were used. The restriction process of each gene was performed in separate tubes. The reaction was incubated at 37°C for 30 minutes. It was run on 1% w/v agarose gel. Amplification Primers with restriction sites for use in cloning were designed based on optimized gene sequences (Table 1). Using the isolated plasmids as template DNA, the gene regions of interest were amplified by PCR. Table 1 Primers and sequences used in the study Primer Sequence (5 ′ -3 ′ ) Reference VP1F AT GAATTC ATGAAGATGGCGAGCAGCGA This study VP1R ATA AAGCTT TTACAGCGCACGACGACGA This study VP2F AT GAATTC ATGGCGGGTGCGTTTTTCGC This study VP2R ATA AAGCTT TTAAACACGGCTTTCGCCA This study p22F AT GAATTC ATGGGCCCGGCGCTGACCAC This study p22R ATA AAGCTT TTACTCGGTCTTGATGTCA This study EP123F AT GAATTC ATGGCGGGTGACGATGTGTT This study EP123R ATA AAGCTT TTACGCACCCGCCAGTTCG This study T7-F TAATACGACTCACTATAGGG Addgene T7-R GCTAGTTATTGCTCAGCGG Addgene Sequences in italic are restriction enzyme sequences ( GAATTC : EcoRI, AAGCTT : HindIII) Amplification was made using 1X Taq buffer, 2 mM MgCl 2 , 0.2 mM dNTPs, 0.4 pmol per primer, 1.5U Taq polymerase (Thermo Scientific, ABD) and also 1 µL of total DNA was added to the mixture. PCR conditions were givenin Table 2. Table 2 PCR conditions for VP1, VP2, P22 and EP123 genes PCR Reactions Temperature ( o C) Time Cycle Initial Denaturation 95 5 min 1 Denaturation 95 30 sec 35 Annealing VP1 VP2 P22 EP123 30 sec 60 57 53 60 Extension 72 VP1 VP2 P22 EP123 1.5 min 1 min 1 min 30 sec Final extension 72 10 min 1 Transfer of Genes into the Expression Vector pET-30a (+) Amplicons of each gene and the vector pET-30a (+) purified with the plasmid extraction kit were subjected to restriction with the EcoRI/HindIII enzymes in separate tubes. Restriction products were isolated by the phenol-chloroform-isoamylalcohol (25:24:1) method and purified by ethanol precipitation. For the ligation reaction, 2 µL of 10X T4 DNA ligase buffer (Thermo Fhiser Scientific, USA) and 1 µL of T4 DNA Ligase (5 U/µL) were added to 17 µL of restriction products and incubated at 22 °C overnight. For inactivation of T4 DNA ligase, the ligand was incubated at 70 °C for 5 min. The ligated constructs were transformed into BL21 (DE3) E. coli cells by chemical transformation and recombinant colonies selected on TSA medium supplemented with 50 mg/L kanamycin [35]. Colony PCR was performed on the selected colonies with both the T7 primers of the vector and the designed primers. Additionally, plasmids were extracted from PCR positive colonies and were screened by digestion with EcoRI and HindIII enzymes and sent to Medsantek (Istanbul) for sequence analysis. 2.5 Expression and Purification Recombinant Proteins Expression of VP1, VP2, P22 and EP123 in E. coli To detect recombinant protein production, each plasmid-carrying colony (VP1, VP2, p22 and EP123) was incubated in 10 mL LB medium containing 50 µg/mL kanamycin. Transformants were cultured at 37°C and 600 nm until the optical density (OD) reached 0.5-0.6 (~3 h); then 0.5 mM isopropyl-β-D-thio-galactoside (IPTG) was added for induction. After IPTG induction, the cultures were continuously incubated at room temperature with shaking at 200 rpm for 24h. Cells were harvested by centrifugation at 5000 rpm for 10 min at 4°C and homogenized with 1 mL 1xPBS. Cells were lysed and evaluated for protein expression levels and protein solubility by SDS-PAGE (12.5% w/v polyacrylamide) [36, 37]. Large-scale protein expression was performed in 1 L aerated medium. Cultures were grown in LB medium supplemented with kanamycin (50 µg/mL) at 37 °C until OD600: 0.5–0.6. Protein expression was induced by the addition of 0.5 mM IPTG and performed for 24 h at room temperature. The cells were collected by centrifugation under the same conditions, and 50 mL of 1X PBS was added to the pellet, and the cells were washed twice and stored at -80 o C. Protein determinations were determined according to the Bradford method and using bovine serum albumin (BSA) as the standard [38]. Purification of recombinant VP1, VP2, P22 and EP123 proteins Since the recombinant proteins carry the His-tag located on the pET30-a (+) backbone, they were first purified with the Immobilized Metal Affinity Chromatography (IMAC) column, which can capture this tag. According to the Bio-Rad EconoFit IMAC Ni-NTA column purification protocol; recombinant protein samples at -80 o C were first placed on ice and allowed to thaw in a controlled manner. ~5 g of pellet was suspended by adding 15 mL of IMAC Lysis Buffer (300 mM NaCl, 50 mM NaH 2 PO 4 , 5 mM Imidazole, pH: 8). Cells were lysed three times for 1 min with a probe-type sonicator and kept on ice for 1 min. The supernatant portion of the samples, which were centrifuged at 15000 rpm and +4 o C for 30 minutes, was filtered through a 0.45 µ filter. The chromatography column was washed with the above-mentioned wash buffer (25 mL) and equilibration was performed. The column was first washed with wash buffer without imidazole, then with 20 mM, and finally with 40 mM imidazole. Elution buffer with 250 mM imidazole was used in each application. Elution was continued until OD 280 decreased to ~0.1 [39]. As the second method, ammonium sulfate precipitation was used to precipitate the proteins in the cell-free supernatants obtained from liquid culture. In order to optimize ammonium sulfate precipitation, samples treated with 20%, 40%, 60%, 80% saturated ammonium sulfate for half an hour (+4 °C) and in a magnetic stirrer were centrifuged at 5000 rpm (+4 °C) for 30 min. Pellets were dissolved in phosphate buffer (20 mM, pH 7.0). The precipitate was dialyzed against the same phosphate buffer for overnight on a magnetic stirrer at +4 ºC, using a 14000 Da dialysis membrane (Sigma-Aldrich, D9777-100FT) [40]. Polyacrylamide gel electrophoresis (SDS-PAGE) To visualize the proteins, a 12.5% separation and 4% loading gel was prepared and the proteins were run with a vertical electrophoresis device. Then, the proteins were visualized by staining the gel [36]. 2.6 Immunization 7-week-old female BALB/c mice were used in this study. Experimental animals were kept in cages of 5 each under normal conditions (20-24 0 C, 50-60% humidity) and were fed ad-libitum with ready-made commercial pellet feeds. During the experimental phase, animals were kept in single cages. Ribi Adjuvant (Sigma Adjuvant System-S6322) was prepared by dissolving it in PBS in accordance with the manufacturer's instructions. Considering the recommended antigen concentration (0.05-0.25 mg/mL), 200 µL/animal of antigen-adjuvant (1:1) mixture was applied to 50 µg/animal. It was administered intramuscularly to a group of 20 Balb/C mice 3 times at 2-week intervals. Only PBS was applied to the control group. At the end of the experimental phase (2 weeks after the last dose was given), the animals were sacrificed and blood samples were taken by intracardiac drawing and collected into EDTA tubes. Then, the serum was separated, and stored at -20 o C. 2.7 Determination of antibody titers in sera ELISA method was used to determine the serum IgG levels. After the wells of the ELISA plates were coated with 100 µL antigen solution (10 µg/mL), they were incubated at +4 °C overnight. Unbound antigens were removed by washing 3 times with PBS-Tween 20 buffer. Two-hundred microliters of casein solution (0.2%) was added to each well and kept at 37 °C for 1 h. The wells then were washed 3 times with PBS-Tween 20 buffer. Immunized mouse sera (primary antibodies) were diluted 1/20, 1/80, 1/160 and 1/320 in PBS and blood serum from a non-immunized mouse was prepared in the same way and 100 µL was added to each well and incubated at 37 °C for 1 h. The plates were washed 3 times with washing buffer. Anti-mouse IgG conjugate (secondary antibody) diluted at 1/1000 was added to each well as 100 µL and kept at 37 °C for 1 h. Then, the wells were washed 6 times with washing buffer. Substrate buffer was added to each well as 100 µL and the plate was left in a dark environment for 30 min. The absorbance values of the microplates were read against the negative control at a wavelength of 450 nm in an ELISA reader. Infected mouse serum was used as a positive control and casein buffer was used as a negative control. The absorbance ratios (p/n) of positive (p) and negative (n) serum samples were calculated. P/n ratio values greater than 2 and 2 were considered positive [41]. 3. Results 3.1 Cloning and expression of VP1, VP2, p22 and EP123 Genes The results of the restriction procedures performed to confirm the presence of gene fragments in the plasmids are given below (Fig. 3). Since the non-specific bands in the EP123 amplicons could not be purified with the PCR Clean-up Kit, the amplicons were extracted from the gel. The second image from the right is of the purified EP123 amplicon (Fig. 4). The cloning process was started with this clean 696 bp band obtained from EP123. Amplicons and purified vectors were cut with the same enzymes (EcoRI/HindIII) (Fig. 5). Thus, the circular structure of the vector became linear. In order to confirm the transformations, random colonies were selected from transformants growing on selective medium plates and colony PCR was performed with both T7F&T7R primers and gene-specific primers (Fig. 6). Selected positive colonies were inoculated into liquid media containing kanamycin. One amplicon for each gene confirmed by colony PCR and restriction analysis was sent to Medsantek for sequence analysis for verification purposes. Post-sequence evaluation results of VP1, VP2, p22 and EP123 genes using the nucleotide-nucleotide BLAST program are listed respectively (Detailed images are in the Supplementary Fig. S4-S7). Cloned HuNoV genes Scientific Name Identity Percentage Reference VP1 VP1-Norovirus GII 91.89% QXU65774.1 VP2 Capsid protein VP2 (Norovirus Hu/Norwalk/10368/2010/VNM) 95.52% AFX81251.1 P22 Non-structural polyprotein (Norovirus Hu/GII.4/New Orleans 1805/2009/USA) 98.90% ADD10374.2 EP123 BP68 (synthetic construct) 85.11% ABR68643.1 For SDS-PAGE analysis, colonies carrying each gene were seeded separately on selective media. Total protein isolation was performed by inducing IPTG. It has been observed that 24 hours is sufficient incubation time for the culture planted to be used in the purification stage. 3.2 Purification of VP1, VP2, p22 and EP123 Proteins VP1 recombinant protein was partially purified in a single step by applying an imidazole gradient with an IMAC column. The strongest band was found to be belong the sample (3 mL) passed through 40 mM imidazole wash buffer and 250 mM elution buffer loaded (Fig. 7A). Ten mililiter of the sample was passed through 40 mM imidazole washing buffer and 250 mM elution buffer to increase the visibility of protein and examined by SDS-PAGE analysis (Fig. 7B). Molecular weight of VP1 recombinant protein was estimated as ~63 kDa. VP2 recombinant protein could not be obtained as a result of imidazole gradient application with the IMAC column. Therefore, ammonium sulfate precipitation was applied to both the pellet and the supernatant samples. The estimated molecular weight of the recombinant VP2 protein was 34.4 kDa. For further purification, supernatant was precipitated with 40% (NH 4 ) 2 SO 4 and dialysate was visualized by SDS-PAGE (Fig. 8). Considering the 0.8 kDa size of the 6xHis tag on pET-30a, it is not surprising that we see a band image over 35 kDa. The protein sample dissolved in 20 mM phosphate buffer was dialyzed against the same buffer overnight at +4 o C. p22 protein was first loaded onto the IMAC column and then further purified by ammonium sulfate precipitation (Fig. 9). As a result of applying an imidazole gradient to the recombinant protein, after treatment with imidazole-free washing buffer and 250 mM imidazole elution buffer, a band of approximately the size of 26 kDa was visualized by SDS-PAGE (Fig 9A). In the second stage, the proteins obtained from the elution were collected (10 mL) and precipitated with different concentrations of ammonium sulfate and sample obtained with (NH 4 ) 2 SO 4 at 80% saturation was used for further steps. (Fig. 9B), Recombinant protein p22 dissolved in 20 mM phosphate buffer was dialyzed against the same buffer overnight at +4 o C. As a result of treatment with imidazole-free washing buffer and 250 mM imidazole elution buffer to EP123 protein sample, the appropriate size band (27.9 kDa) was visualized by SDS-PAGE (Fig. 10A). Subsequently, the proteins obtained from the elution were collected (10 mL) and precipitation was performed with different concentrations of ammonium sulfate solution. EP123 protein sample precipitated with (NH 4 ) 2 SO 4 at 80% saturation was dissolved in 20 mM phosphate buffer and dialyzed against the same buffer overnight at +4 o C. After VP1, VP2, p22 and EP123 proteins were partially purified, each of the buffer solutions containing the proteins was replaced with PBS (pH: 7.4) using the Bio-Rad EconoFit Desalting (2ml) Column. Protein amounts were measured by the Bradford method before and after the desalt process (Supplementary Table S1). After this process, it was observed that the protein concentration decreased, except for VP2. 3.3 Immunogenicity Levels of VP1, VP2, p22and EP123 Recombinant Proteins Using the indirect ELISA method, IgG levels of immunized animals were measured and their immunogenicity was evaluated (Table 3). Considering that samples with a p/n ratio of 2 and greater than 2 were positive, VP1 was found to be most immunogenic protein up to a dilution of 1/160 (p/n = 2.09). It was concluded that VP2 was immunogenic up to 1/80 dilution (p/n= 2.28), while p22 was immunogenic up to 1/20 dilution (p/n= 2.17). The polypeptide consisting of epitopes (EP123) did not give positive result in any dilution. In order for an antigen to be considered immunogenic, it must be positive at a dilution of up to 1/160 [42]. According to these results, only VP1 can be considered as an immunogen (Fig. 11). Table 3 Indirect ELISA results (based on 3 replicate experiment results) 1/20 1/80 1/160 1/320 Kazein Buffer VP1 0.315 0.243 0.216 0.162 0.103 VP2 0.232 0.215 0.176 0.118 0.094 p22 0.207 0.165 0.120 0.084 0.095 EP123 0.096 0.088 0.087 0.080 0.082 4. Discussion In this study, capsid proteins of GII.4 norovirus, a non-structural protein (p22) and a polypeptide consisting of multi-epitopes were recombinantly produced in E. coli and their antigenic properties were compared. Virus-Like Particles (VLPs), composed of the major capsid protein VP1, are highly immunogenic and are the most studied vaccine candidates due to their well-studied immunogenicity and epitope profiles [43]. The minor capsid protein VP2 was obtained using the mammalian expression system (Human embryonic kidney 293 cells). It has been reported that it is not necessary for the formation of recombinant VLPs, but it increases the expression of VP1 and helps maintain its stability [33, 34]. However, the immunogenicity and epitopes of HuNoV nonstructural proteins have not been well characterized [44]. A recent study investigating humoral immune responses to HuNoV in children across Europe reported antigenicity at NS1/2 (p48) and NS4 (p22) [45]. Based on this, we specifically aimed to characterize a non-structural protein (p22) of NoV and a multi-epitope approach. To date, NoV VP1 protein has been successfully produced recombinantly using mammalian, yeast, plant and bacterial expression systems, mostly in insect cells [8, 27-32]. While the VP1, VP2 and p22 genes were cloned without any problems, the EP123 gene was extracted from the gel because it could not be obtained as a single band during cloning. Thus, the PCR product was concentrated as a single and clean band to be used in the purification stage. Additionally, when designing peptides, taking into account the bonds between epitopes, the use of bioinformatics tools, and the selection of epitopes with immunogenic potential may be important in obtaining the product in pure form. HuNoV proteins VP1, VP2, p22, and EP123 were partially purified by HisTrap and ammonium sulfate precipitation, while VP1 and VP2 proteins were partially obtained in one step, p22 and EP123 proteins were required two steps. In addition, after purifying VP1, two close bands were obtained in the SDS-PAGE image (Fig. 7B), which was reported by Koho et al. also observed this situation [46]. P protein and major capsid protein VP1 of NoV GII.4 strain were recombinantly produced and purified in P. pastoris . P protein was directly purified using HisTrap and ion exchange chromatography. Similarly, HuNoV capsid protein VP1 was also obtained with high purity using HisTrap and gel filtration chromatography. Both purified HuNoV P particles and VP1 retained tissue-blood group antigen binding ability. Scanning Electron Microscope (SEM) analysis and a saliva binding assay showed that both purified HuNoV P complex and HuNoV VLPs retained their stability and biological functions [47]. Tomé-Amat et al. purified NoV VLPs obtained directly from the culture medium using P. pastoris with a purity of over 90% using ion exchange chromatography [48]. Huo et al. produced VLPs in E. coli with high purity by applying ammonium sulfate precipitation, size-dependent chromatography (SEC) and ammonium sulfate precipitation methods, respectively [31]. They reported that the cold shock expression system (pCold) used in their study is a new approach to produce NoV VLPs in E. coli and that this system is a safe tool for developing low-cost NoV vaccines in the future. Recombinant VP1, VP2, p22 and EP123 proteins were administered to mice intramuscularly together with Ribi adjuvant. In order to individually evaluate the immunogenicity of norovirus proteins, experimental animals were immunized with each recombinant protein separately. When the IgG levels in the serum of mice were examined, only the VP1 protein, among the NoV proteins produced in E. coli , showed immunogenic properties. When VLPs produced and purified in the cold shock expression vector pCold-III of E. coli were compared with VLPs purified from the recombinant baculovirus expression system, VLP obtained from E. coli had higher IgG antibody titers and blocking antibody titers [31]. Mice immunized with VLPs purified from insect cells produced GII.17-specific serum and effectively blocked the binding of GII.17 VLPs to tissue-blood group antigens [47]. The kinetics of serum IgG and fecal IgA antibody responses were examined when crude yeast extracts containing VA387 recombinant capsid protein were administered to mice via oral immunization. Oral administration of yeast cell lysates containing 0.1 mg of VLP without adjuvant resulted in systemic and mucosal immune responses in mice. Significantly higher and earlier responses were observed in mice receiving a higher dose of antigen (1 mg/dose). It has been observed that the immune response against NoVs is related to the dose of the vaccine given to the animals and the number of immunizations [28]. A bivalent VLP norovirus vaccine candidate containing GI.4 and GII.4 antigens (rNV-2v) transiently produced in N. benthamiana has demonstrated the safety and tolerability of the vaccine in rabbit studies. Additionally, strong rNV-2v-specific antibody responses were observed in both male and female rabbits in the absence of adjuvants with very high levels of blocking antibodies [49]. As we expected, immunogenic properties of recombinantly produced VP1 obtained in our study are consistent with literature information. However, our main goal was to reveal whether proteins other than VP1 were immunogenic or not. Studies such as the immunization of healthy adults with univalent or bivalent NoV VLPs produced using the recombinant baculovirus expression system and the challenge of humans with natural immun in recent years have guided our understanding of NoV immune responses. The divalent vaccine (GI.1 and GII.4) being developed by the pharmaceutical company Hillevax is the only candidate to report clinical efficacy to date. It is progressing towards phase III trials in adults and children from 5 months of age [50]. Since there is a need to find suitable polyvalent vaccine candidates that provide immunity to various genogroups against norovirus, it is very important to test the multi-epitope peptide vaccine approach in the laboratory environment. In-silico studies have provided a new perspective from which drugs can be designed using genomic, proteomic and immunoinformatics approaches, minimizing the time and cost required in the development process. It was applied in-vivo using the multi-epitope approach consisting of the p22 protein, which has not been studied much as a vaccine candidate to date, and the epitopes of VP1, VP2 and p22. Thus, it was possible to compare the effectiveness of recombinantly produced vaccine candidates with each other. Declarations Acknowledgements This study was funded by Aydın Adnan Menderes University BAP FEF-21016. Demet YALÇIN BİNGÜL was supported by 100/2000 YOK scholarship in Turkey. Author contributions DYB performed the data analysis and visualization. She also prepared the original draft of the article with the help of GB. GB designed and supervised this study. Data availability Most data from this study are presented in the supplementary material. Conflict of interest The authors have no competing interests to declare that are relevant to the content of this article. References Glass RI, Parashar UD, Estes MK (2009) Norovirus gastroenteritis. N Engl J Med 361:1776–1785. https://doi.org/10.1056/NEJMra0804575 Hall AJ, Lopman BA, Payne DC, Patel MM, Gastan˜ aduy PA, Vinje´ J, Parashar UD (2013) Norovirus disease in the United States. Emerg Infect Dis 19:1198–1205. http://dx.doi.org/10.3201/eid1908.130465 Fankhauser RL, Monroe SS, Noel JS, Humphrey CD, Bresee JS, Parashar UD et al (2002) Epidemiologic and molecular trends of “Norwalk-like viruses” associated with outbreaks of gastroenteritis in the United States. J Infect Dis 186:1–7. https://doi.org/10.1086/341085 Lopman BA, Reacher MH, van Duijnhoven Y, Hanon FX, Brown D, Koopmans M (2003) Viral gastroenteritis outbreaks in Europe, 1995–2000. Emerg Infect Dis 9:90–96. https://doi.org/10.3201/eid0901.020184 Hallowell BD, Parashar UD, Hall AJ (2019) Epidemiologic challenges in norovirus vaccine development. Hum Vaccin Immunother 15:1279–1283. https://doi.org/10.1080/21645515.2018.1553594 Zhang M, Fu M, Hu Q (2021) Advances in Human Norovirus Vaccine Research. Vaccines 9, 732. https://doi.org/10.3390/vaccines9070732 May J, Viswanathan P, Ng KK-S, Medvedev A, Korba B (2014) The P4-P2′ amino acids surrounding human norovirus polyprotein cleavage sites define the core sequence regulating self-processing order. J Virol 88:10738–47. https://doi.org/10.1128/JVI.01357-14 Thorne LG & Goodfellow IG (2014) Norovirus gene expression and replication. J Gen Virol 95:278–291. https://doi.org/10.1099/vir.0.059634-0 Conley MJ, McElwee M, Azmi L, Gabrielsen M, Byron O et al (2019) Calicivirus VP2 forms a portal-like assembly following receptor engagement. Nature 565:377–381. https://doi.org/10.1038/s41586-018-0852-1 Cannon JL, Lindesmith LC, Donaldson EF, Saxe L, Baric RS, Vinje J (2009) Herd immunity to GII.4 noroviruses is supported by outbreak patient sera. J Virol 83:5363–74. https://doi.org/10.1128/JVI.02518-08 Hung CH, Yen JB, Chang PJ, Chen LW, Huang TY, Tsai WJ, Tsai YC (2023) Characterization of Human Norovirus Nonstructural Protein NS1.2 Involved in the Induction of the Filamentous Endoplasmic Reticulum, Enlarged Lipid Droplets, LC3 Recruitment, and Interaction with NTPase and NS4. Viruses 15, 812. https://doi.org/10.3390/v15030812 Tu ET-V, Bull RA, Greening GE, Hewitt J, Lyon MJ, Marshall JA et al (2008) Epidemics of gastroenteritis during 2006 were associated with the spread of norovirus GII. 4 variants 2006a and 2006b. Clin Infect Dis 46:413–20. https://doi.org/10.1086/525259 Siebenga J, Vennema H, Zheng D, Vinje´ J, Lee BE et al (2009) Norovirus illness is a global problem: emergence and spread of norovirus GII.4 variants, 2001–2007. J Infect Dis 200:802–812. https://doi.org/10.1086/605127 Noel JS, Fankhauser RL, Ando T, Monroe SS, Glass RI (1999) Identification of a distinct common strain of ‘norwalk-like viruses’ having a global distribution. J Infect Dis 179:1334–1344. https://doi.org/10.1086/314783 White PA, Hansman GS, Li A et al (2002) Norwalk-like virus 95/96-US strain is a major cause of gastroenteritis outbreaks in Australia. J Med Virol 68:113–118. https://doi.org/10.1002/jmv.10177 Lopman B, Vennema H, Kohil E, Pothier P et al (2004) Increase in viral gastroenteritis outbreaks in Europe and epidemic spread of new norovirus variant. Lancet 363:682–688. https://doi.org/10.1016/S0140-6736(04)15641-9 Widdowson MA, Cramer EH, Hadley L et al (2004) Outbreaks of acute gastroenteritis on cruise ships and on land: identification of a predominant circulating strain of norovirus-United States, 2002. J Infect Dis 190:27–36. https://doi.org/10.1086/420888 Bull RA, Tu ET, McIver CJ, Rawlinson WD, White PA (2006) Emergence of a new norovirus genotype GII.4 variant associated with global outbreaks of gastroenteritis. J Clin Microbiol 44:327–333. https://doi.org/10.1128/JCM.44.2.327-333.2006 Eden JS, Bull RA, Tu E, Mclver CJ, Lyon MJ et al (2010) Norovirus GII.4 variant 2006b caused epidemics of acute gastroenteritis in Australia during 2007 and 2008. J Clin Virol 49:265–271. https://doi.org/10.1016/j.jcv.2010.09.001 Jones MK, Grau KR, Costantini V, Kolawole AO, de Graaf M, Freiden P et al (2015) Human norovirus culture in B cells. Nat Protoc 10:1939–47. https://doi.or/10.1038/nprot.2015.121 Kolawole AO, Rocha-Pereira J, Elftman MD, Neyts J, Wobus CE (2016) Inhibition of human norovirus by a viral polymerase inhibitor in the B cell culture system and in the mouse model. Antivir Res 132:46–49. https://doi.org/10.1016/j.antiviral.2016.05.011 Ettayebi K, Crawford SE, Murakami K, Broughman JR, Karandikar U et al (2016) Replication of human noroviruses in stem cell-derived human enteroids. Science 353(6306):1387–1393. https://doi.org/10.1126/science.aaf5211 Costantini V, Morantz EK, Browne H, Ettayebi K, Zeng XL, Atmar RL et al (2018) Human Norovirus Replication in Human Intestinal Enteroids as Model to Evaluate Virus Inactivation. Emerg Infect Dis 24:1453–1464. https://doi.org/10.3201/eid2408.180126 Alvarado G, Ettayebi K, Atmar RL, Bombardi RG, Kose N, Estes MK, Crowe Jr JE (2018) Human Monoclonal Antibodies That Neutralize Pandemic GII.4 Noroviruses. Gastroenterology 155:1898–1907. https://doi.org/10.1053/j.gastro.2018.08.039 Richardson C, Bargatze RF, Goodwin R, Mendelman PM (2013) Norovirus virüs like particle vaccines for the prevention of acute gastroenteritis. Expert Rev Vaccines 12:155–67. https://doi.org/10.1586/erv.12.145 Lucero Y, Vidal R, O’Ryan GM (2018) Norovirus vaccines under development. Vaccine 36(36):5435–5441. https://doi.org/10.1016/j.vaccine.2017.06.043 Mason HS, Ball JM, Shi JJ, Jiang X, Estes MK, Arntzen CJ (1996) Expression of Norwalk virus capsid protein in transgenic tobacco and potato and its oral immunogenicity in mice. Proc Natl Acad Sci USA, 93:5335–5340. https://doi.org/10.1073/pnas.93.11.5335 Xia M, Farkas T, Jiang X (2007) Norovirus Capsid Protein Expressed in Yeast Forms Virus-like Particles and Stimulates Systemic and Mucosal Immunity in Mice Following an Oral Administration of Raw Yeast Extracts. J Med Virol 79(1):74–83. https://doi.org/10.1002/jmv.20762 Santi L, Batchelor L, Huang Z, Hjelm B, Kilbourne J, Arntzen CJ et al (2008) An efficient plant viral expression system generating orally immunogenic Norwalk virus-like particles. Vaccine 26:1846–1854. https://doi.org/10.1016/j.vaccine.2008.01.053 Kim JW, Kong YJ, Kim MS, Lee HJ, Lee SW, Kang SY (2015) Expression of human norovirus VP1 gene and VP1-specific monoclonal antibodies. J Biomed Res 16(3):109–114. https://doi.org/10.12729/jbr.2015.16.3.109 Huo Y, Wan X, Ling T, Wu J, Wang W, Shen S (2018) Expression and purification of norovirus virüs like particles in Escherichia coli and their immunogenicity in mice. Molecular Immunology 93:278–284. http://dx.doi.org/10.1016/j.molimm.2017.07.014 Malm M, Diessner A, Tamminen K, Liebscher M, Vesikari T, Blazevic V (2019) Rotavirus VP6 as an adjuvant for bivalent Norovirus vaccine produced in Nicotiana benthamiana . Pharmaceutics 11, 229. https://doi.org/10.3390/pharmaceutics11050229 Vongpunsawad S, Prasad BV, Estes MK (2013) Norwalk virus minor capsid protein VP2 associates within the VP1 shell domain. J Virol 87:4818–25. https://doi.org/10.1128/JVI.03508-12 Lin Y, Fengling L, Lianzhu W, Yuxiu Z, Yanhua J (2014) Function of VP2 protein in the stability of the secondary structure of virus-like particles of genogroup II norovirus at different pH levels: function of VP2 protein in the stability of NoV VLPs. J Microbiol 52:970–5. https://doi.org/10.1007/s12275-014-4323-6 Sambrook J, Fritsch EF, Maniatis T (2001) Molecular cloning: A Laboratory Manual. Preparation and Transformation of Competent E. coli using Calcium Chloride. Irwin N, Janssen KA. Cold Spring Harbor Laboratory Press, New York Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227(5259): 680–685. https://doi.org/10.1038/227680a0 Crowe J, Dobeli H, Genz R, Hochuli E, Stuber D, Henco K (1994) 6xHis-Ni-NTA chromatography as a superior technique in recombinant protein expression/purification. In: Harwood AJ (eds) Methods in Molecular Biology, Vol 31 Protocols for Gene Analysis. Humana Press Inc, Totowa, NJ, pp 371–387. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 7: 72, 248 – 54. https://doi.org/10.1006/abio.1976.9999 Crowne J, Masone BS, Ribbe J (1995) One-step purification of recombinant proteins with the 6xHis tag and Ni-NTA resin. Mol Biotecnol 4(3):27–58. https://doi.org/10.1007/BF02779018 Tuncer M (2008) Protein Saflaştırma-1 Kromatografik Yöntemler, Can Matbaacılık, Mersin/Türkiye. Savigny D de & Voller A (1980) The Communication of ELISA Data from Laboratory to Clinician. Journal of Immunoassay 1(1):105–128. https://doi.org/10.1080/01971528008055779 Shi L, Wang J, Wang P, Li G, Gong M, Yuan W, Zhu H (2012) Development of an indirect enzyme-linked immunosorbent assay (ELISA) assay based on a recombinant truncated VP2 (tVP2) protein for the detection of canine parvovirus antibodies. Afr J Biotechnol 11(93):16034–16039. https://doi.org/10.5897/AJB12.2446 Debbink K, Lindesmith LC & Baric RS (2014) The state of norovirus vaccines. Clin Infect Dis 58:1746–1752. https://doi.org/10.1093/cid/ciu120 Su L, Huang W, Neill FH, Estes MK, Atmar RL & Palzkill T (2023) Mapping human norovirus antigens during infection reveals the breadth of the humoral immune response. npj Vaccines 8:87. https://doi.org/10.1038/s41541-023-00683-1 Villabruna N, Izquierdo-Lara RW, Schapendonk CME, de Bruin E, Chandler F, Thao TTN et al (2022) Profiling of humoral immune responses to norovirus in children across Europe. Sci Rep 12(1):14275. https://doi.org/10.1038/s41598-022-18383-6 Koho T, Huhti L, Blazevic V, Nurminen K, Butcher SJ, Laurinmaki P et al (2012) Production and characterization of virus-like particles and the P domain protein of GII.4 norovirus. Journal of Virological Methods 179:1–7. https://doi.org/10.1016/j.jviromet.2011.05.009 Chen YL& Huang CT (2020) Establishment of a two-step purification scheme for tag-free recombinant Taiwan native norovirus P and VP1 proteins. Journal of Chromatography B 1159, 122357. https://doi.org/10.1016/j.jchromb.2020.122357 Tomé-Amat J, Fleischer L, Parker SA, Bardliving CL& Batt CA (2014) Secreted production of assembled Norovirus virus-like particles from Pichia pastoris . Microbial Cell Factories, 13:134. https://doi.org/10.1186/s12934-014-0134-z Tusé D, Malm M, Tamminen K, Diessner A, Thieme F, Jarczowski F et al (2022) Safety and immunogenicity studies in animal models support clinical development of a bivalent norovirus-like particle vaccine produced in plants. Vaccine 40(7):977–87. https://doi.org/10.1016/j.vaccine.2022.01.009 Armah G, Lopman BA, Vinjé J, O'Ryan M, Lanata CF, Groome M et al (2023) Vaccine value profile for norovirus. Vaccine 41:S134-S152. https://doi.org/10.1016/j.vaccine.2023.03.034 Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformations.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4269416","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":291783268,"identity":"cd4a8f98-16b5-485f-ac68-833f683a2a30","order_by":0,"name":"Demet Yalçın Bingül","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABA0lEQVRIiWNgGAWjYDCCAxBKhoGZgfHBhwogk5m5gbAWIOYBamE2nHEGpIWRWC0MDGzSnG0gIQJa+I53Jz7+2GbHw9/Oe9iYcV5tNH87UMuPim04tUieObvZ4GBbMo/EYb7Ex4XbjufOOMzYwNhz5jZOLQY3crdJHGxj5jFg5jE2nrntWG4DUAszYxseLfffbv9xsK0epMVMmnfOsdz5BLXc4N3GcLDtMFRLQ03uBkJaJM/kbpY4c+440C88xoYzjh3I3QjUchCfX/iOn934oaKsWo6//4zhgw81dbnzzh8++OBHBW4tYMDIBmceBpMH8KsHgT9wVh1hxaNgFIyCUTDiAABT82ALf7OHdAAAAABJRU5ErkJggg==","orcid":"","institution":"Aydın Adnan Menderes University","correspondingAuthor":true,"prefix":"","firstName":"Demet","middleName":"Yalçın","lastName":"Bingül","suffix":""},{"id":291783269,"identity":"7d2d491a-76fd-4476-8704-80548a45f1c0","order_by":1,"name":"Gamze Başbülbül","email":"","orcid":"","institution":"Aydın Adnan Menderes University","correspondingAuthor":false,"prefix":"","firstName":"Gamze","middleName":"","lastName":"Başbülbül","suffix":""}],"badges":[],"createdAt":"2024-04-15 11:31:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4269416/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4269416/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55250802,"identity":"56e82908-7a99-4e0c-95e0-34702393547a","added_by":"auto","created_at":"2024-04-24 17:36:43","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":42063,"visible":true,"origin":"","legend":"\u003cp\u003ePolypeptide structure consisting of epitopes (EP123) (Gly: Glycine)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/17c001e2583d5c0dccc6cfa4.png"},{"id":55250807,"identity":"bd2e7156-18d2-4290-ba2f-a3fe03c28de2","added_by":"auto","created_at":"2024-04-24 17:36:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":151683,"visible":true,"origin":"","legend":"\u003cp\u003eSynthetic DNAs of VP1, VP2, p22 and EP123 inserted into the standard vectors\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/159a487930bc6bb37a87f7a5.png"},{"id":55250806,"identity":"b155719a-9e49-44c8-937d-8502997b9971","added_by":"auto","created_at":"2024-04-24 17:36:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":357068,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel images of VP1, VP2, p22 after restriction. \u003cstrong\u003e1)\u003c/strong\u003e pEX-A258+VP1; 4069 bp, \u003cstrong\u003e2)\u003c/strong\u003e pEX-A258; 2446 bp, VP1; 1623 bp, \u003cstrong\u003e3)\u003c/strong\u003e pEX-A128+VP2; 3257 bp, \u003cstrong\u003e4)\u003c/strong\u003e pEX-A128; 2450 bp, VP2; 807 bp, \u003cstrong\u003e5)\u003c/strong\u003e pEX-A128+p22; 2993 bp, \u003cstrong\u003e6)\u003c/strong\u003e pEX-A128; 2450 bp, p22; 543 bp, \u003cstrong\u003eM\u003c/strong\u003e: Marker (λ-Pst)\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/0d780d0fea07eb679ac67b81.png"},{"id":55251943,"identity":"9145fa6b-b9ac-4925-ab57-f1468247d0e3","added_by":"auto","created_at":"2024-04-24 17:44:43","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":573293,"visible":true,"origin":"","legend":"\u003cp\u003eRecovery of EP123 amplicons by gel extraction\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/7a582be46ad69ca6f661ff5b.png"},{"id":55251944,"identity":"61d9ccbc-cf26-4ede-97d9-6189a8be0b95","added_by":"auto","created_at":"2024-04-24 17:44:44","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":325259,"visible":true,"origin":"","legend":"\u003cp\u003eDigestion of gene fragments (VP1, VP2, p22 and EP123) and expression vector (pET-30a) with EcoRI and HindIII enzymes. M: λ-PstI Marker\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/a67c47d988e0314cfa6c6db9.png"},{"id":55250801,"identity":"b8d49018-7101-4837-8498-438ea41d1140","added_by":"auto","created_at":"2024-04-24 17:36:43","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":277064,"visible":true,"origin":"","legend":"\u003cp\u003eColony PCR results with gene-specific primers for VP1, VP2, p22 and EP123\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/25c6f1f94a7aea48b57a90b2.png"},{"id":55250808,"identity":"9f6fa802-9a1c-446a-9b4c-3e7ea3ecb8f8","added_by":"auto","created_at":"2024-04-24 17:36:44","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":429348,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e VP1 protein obtained by application of imidazole gradient. \u003cstrong\u003e1-5\u003c/strong\u003e application of wash buffer with 20 mM imidazole (1; sample loading, 2-5; elution) and elution buffer with 250 mM imidazole. \u003cstrong\u003e6-10\u003c/strong\u003e application of wash buffer with 40 mM imidazole (6; sample loading, 7-10; elution) and elution buffer with 250 mM imidazole. \u003cstrong\u003e11\u003c/strong\u003e induced BL21 lysate, \u003cstrong\u003e12\u003c/strong\u003e SDS-PAGE image of uninduced BL21 lysate. \u003cstrong\u003eB\u003c/strong\u003e partial purification of VP1 by washing with 40 mM imidazole and elution buffer with 250 mM imidazole (1-wash, 2-3 elutions)\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/eafe9e5d7800b441ab8012f9.png"},{"id":55250809,"identity":"cca1d0b9-95cc-4f9d-a9d0-8d182942514e","added_by":"auto","created_at":"2024-04-24 17:36:44","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":520446,"visible":true,"origin":"","legend":"\u003cp\u003eGel images of VP2 protein as a result of ammonium sulfate precipitation. \u003cstrong\u003e1-4\u003c/strong\u003e precipitation of the supernatant with 20%, 40%, 60%, 80% (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, respectively. \u003cstrong\u003e6\u003c/strong\u003e VP2 lysate \u003cstrong\u003e7-10\u003c/strong\u003e precipitation of the pellet with 20%, 40%, 60%, 80% (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, respectively. \u003cstrong\u003e11 \u003c/strong\u003eprecipitate the concentrated (500 mL) VP2 supernatant with 40% (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/906f3e160bd28cd20c8e3ae9.png"},{"id":55250805,"identity":"1ca671cc-34b2-4d87-bb29-6144e23a7e9f","added_by":"auto","created_at":"2024-04-24 17:36:43","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":351183,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e SDS-PAGE gel images of p22 recombinant protein as a result of IMAC application. Washing without imidazole (A1; lysate and A2-A4; elution) and elution buffer with 250 mM imidazole. \u003cstrong\u003eB\u003c/strong\u003e precipitation of p22 with ammonium sulfate. \u003cstrong\u003e1-4\u003c/strong\u003e precipitation of p22 with 20%-40%-60%-80% (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, respectively.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/a31fdf8b25a810471b305185.png"},{"id":55250803,"identity":"f06703a6-f310-4f20-8fe6-c694c493b986","added_by":"auto","created_at":"2024-04-24 17:36:43","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":382110,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e gel image of EP123 recombinant protein as a result of IMAC application. Washing without imidazole (\u003cstrong\u003eA1\u003c/strong\u003e lysate, \u003cstrong\u003eA2-A6\u003c/strong\u003e elution) and elution buffer with 250 mM imidazole. \u003cstrong\u003eB\u003c/strong\u003e precipitation of EP123 with ammonium sulfate. \u003cstrong\u003e1-4\u003c/strong\u003e precipitation of EP123 with 20%-40%-60%-80% (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e respectively.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/a62d7ab67f5a2802b59bcbbc.png"},{"id":55250811,"identity":"2659c7bd-f94a-4bcf-87d5-eae2e5f35aaf","added_by":"auto","created_at":"2024-04-24 17:36:44","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":31311,"visible":true,"origin":"","legend":"\u003cp\u003eEvaluation of immunogenicities of VP1, VP2, p22 and EP123\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/74fb286352fea38960e2de33.png"},{"id":58417742,"identity":"80a97d1a-9d25-488a-8171-3d81d012564a","added_by":"auto","created_at":"2024-06-15 13:52:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3733416,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/37726907-b953-4dcd-8967-a7424cf8f89d.pdf"},{"id":55250804,"identity":"e99edc09-dcad-4108-81f8-1119ac88d231","added_by":"auto","created_at":"2024-04-24 17:36:43","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":439497,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformations.docx","url":"https://assets-eu.researchsquare.com/files/rs-4269416/v1/15b381eeb277ea3569a8fc08.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eMolecular Cloning and Immunogenicity Determination of Norovirus Proteins as Vaccine Candidates\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eHuman Noroviruses (HuNoVs) are accepted as the main cause of non-bacterial gastroenteritis in developed and developing countries [1, 2]. The spread of the disease in epidemics is especially common in closed areas such as cruise ships, hospitals, homes for aged, schools and kindergartens. This is because HuNoVs are very easily transmitted from person to person, and the virus can survive in contaminated areas for up to several days. HuNoVs can be transmitted through contact with an infected person or with contaminated surfaces, objects or by consuming contaminated food and water [3, 4]. All age groups especially infants, the elderly and immunocompromised patients are susceptible to HuNoVs. Globally, HuNoVs causes an estimated 699 million cases of illness and 219,000 deaths each year, resulting in over $4 billion in direct medical costs and over $60 billion in indirect medical costs [5, 6].\u003c/p\u003e\n\u003cp\u003eHuNoVs are non-enveloped viruses with a single-stranded RNA (ssRNA+) genome of about 7.5 kb. The genome of HuNoV is organized into three Open Reading Frames (ORFs). ORF1 encodes a polyprotein which is consisting of six nonstructural (NS) proteins. Starting from the 5\u0026prime; end, respectively, non-structural proteins are p48, nucleoside triphosphatase (NTPase), p22, VPg, protease (Pro) and RNA dependent RNA polymerase (RdRp). ORF2 encodes the major structural protein (VP1) and ORF3 encodes a small structural protein (VP2) [7-9]. HuNoVs are classified according to the similarity of the highly conserved regions of RdRp and VP1 [10]. Accordingly, Noroviruses (NoVs) are divided into ten genogroups (GI\u0026ndash;GX). GI, GII, GIV, GVIII and GIX cause disease in humans [11]. GII.4 is the only genotype associated with global gastroenteritis pandemics [12, 13]. GII.4 viruses have caused all six major HuNoVs pandemics over the past two decades [12, 14-19].\u003c/p\u003e\n\u003cp\u003eAlthough the World Health Organization (WHO) stated that developing a HuNoVs vaccine should be an absolute priority in 2016, currently no HuNoVs vaccine have been licensed. The major obstacle to the development of an effective HuNoVs vaccine is the lack of robust and reproducible \u003cem\u003ein-vivo\u003c/em\u003e and \u003cem\u003ein-vitro\u003c/em\u003e infection models. It has been reported that HuNoVs can efficiently infect B cells [20, 21] and human intestinal enteroids [22-24] for the development of these culture systems.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe application of recombinant viral antigens has been an important approach in diagnostic and vaccine development studies. A series of HuNoVs vaccines have been designed based on Virus-like particles (VLPs) or P particles contained within VP1 due to their structural and functional properties. VLPs are antigenically similar to the viral particle and can induce a specific antibody response when administered both enterally and parenterally without any risk of infection [25]. As a NoV vaccine candidate, especially VP1, which forms VLPs, has been used in both preclinical and clinical studies [26]. To date, NoV VP1 protein has been successfully obtained using various expression systems, including insect cells, \u003cem\u003eP. pastoris\u003c/em\u003e, \u003cem\u003eN. benthamiana\u003c/em\u003e and \u003cem\u003eE. coli\u003c/em\u003e [8, 27-32]. The finding that VP2 is not necessary for the formation of VLPs has caused it not to be preferred in vaccine studies [33, 34].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this study, we aimed to produce recombinant HuNoV proteins that could be vaccine candidates against norovirus infection and to reveal their immunogenic potentials. To the best of our knowledge, the feasibility of the p22 protein and EP123 polypeptide consisting of epitopes has not been tested before as vaccine candidates. Although it has been observed that these proteins do not induce an immune response against norovirus, it is important to test the multi-epitope approach \u003cem\u003ein-vivo\u003c/em\u003e.\u003c/p\u003e"},{"header":"2.\tMaterials and Methods ","content":"\u003cp\u003e\u003cstrong\u003e2.1 Ethics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnimal experiments were carried out in accordance with the rules of Aydın Adnan Menderes University animal experiments local ethics committee (HADYEK). The research protocol was approved by HADYEK (64583101/2021/032).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Plasmids, bacterial strains, and culture conditions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e DH10B, BL21 (DE3) strains and pET-30a (+) vector were used for HuNoVs DNA manipulations, amplification and expression. Tryptic soy agar (TSA), Luria-Bertani (LB) agar and broth were used for cultivation of \u003cem\u003eE. coli\u0026nbsp;\u003c/em\u003estrains.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Supply and amplification of gene sequences\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGene sequences encoding VP1, VP2, and p22 proteins were retrieved from Norovirus Hu/GII.4/New Orleans1805 (GenBank accession code: GU445325.2) complete genome are included in Supplementary Informations.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eCodon optimizations for heterologous expression in \u003cem\u003eE\u003c/em\u003e. \u003cem\u003ecoli\u0026nbsp;\u003c/em\u003eGenescript\u003cem\u003e\u0026nbsp;\u003c/em\u003eonline tool was used. \u0026nbsp;After VP1, VP2 and p22 genes were analyzed using the online program http://sysbio.unl.edu/SVMTriP/result.php epitope maps of the proteins were obtained. A polypeptide sequence (EP123) was created by taking three (highest scoring) epitope regions for VP1 and VP2 and two for p22 (Supplementary Fig. S1-S3). A 690-base fragment consisting of 8 epitopes containing 20 amino acids each and 10 glycine amino acids between the two epitopes was designed (Fig. 1).\u003c/p\u003e\n\u003cp\u003eThe final DNA sequences were synthesized by Triogen Biotechnology Company (Turkey).\u0026nbsp;The synthetic VP1 and EP123 genes were delivered in plasmid\u0026nbsp;vector pEX-A258 vector, while VP2 and p22 are provided in the pEX-A128 vector (Fig. 2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Cloning of VP1, VP2, p22 and EP123 genes\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cul\u003e\n \u003cli\u003e\u003cem\u003e\u003cu\u003ePlasmid Isolation and Restriction\u003c/u\u003e\u003c/em\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003ePlasmids contained optimized Norovirus gene sequences were dissolved in Tris-EDTA (TE) (10mM) buffer according to the manufacturer\u0026apos;s protocol and then transferred to \u003cem\u003eE. coli\u003c/em\u003e DH10B competent by heat shock transformation method [35]. pEX-A258 and pEX-A128 plasmid DNAs were isolated with the GeneAll-ExprepTM-Plasmid SV plasmid extraction kit. Restriction process was applied to confirm the presence of gene fragments in the isolated plasmids. For restriction of VP1 and EP123; 10 \u0026micro;L plasmid, 6 \u0026micro;L sterile water, 2 \u0026micro;L 10X buffer, 1 \u0026micro;L XhoI and 1 \u0026micro;L XbaI enzyme (FastDigest, Thermo Fhiser Scientific, USA) were used. For restriction of VP2 and p22; 10 \u0026micro;L plasmid, 6 \u0026micro;L sterile water, 2 \u0026micro;L 10X buffer, 1 \u0026micro;L BamHI and 1 \u0026micro;L NotI enzyme were used. The restriction process of each gene was performed in separate tubes. The reaction was incubated at 37\u0026deg;C for 30 minutes. It was run on 1% w/v agarose gel.\u003c/p\u003e\n\u003cul\u003e\n \u003cli\u003e\u003cem\u003e\u003cu\u003eAmplification\u003c/u\u003e\u003c/em\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003ePrimers with restriction sites for use in cloning were designed based on optimized gene sequences (Table 1). Using the isolated plasmids as template DNA, the gene regions of interest were amplified by PCR.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e Primers and sequences used in the study\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.068493150684931%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.57925636007828%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequence (5\u003c/strong\u003e\u003cstrong\u003e\u0026prime;\u003c/strong\u003e\u003cstrong\u003e-3\u003c/strong\u003e\u003cstrong\u003e\u0026prime;\u003c/strong\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.35225048923679%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReference\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.068493150684931%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eVP1F\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.57925636007828%\" valign=\"top\"\u003e\n \u003cp\u003eAT\u003cem\u003eGAATTC\u003c/em\u003eATGAAGATGGCGAGCAGCGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.35225048923679%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.068493150684931%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eVP1R\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.57925636007828%\" valign=\"top\"\u003e\n \u003cp\u003eATA\u003cem\u003eAAGCTT\u003c/em\u003eTTACAGCGCACGACGACGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.35225048923679%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.068493150684931%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eVP2F\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.57925636007828%\" valign=\"top\"\u003e\n \u003cp\u003eAT\u003cem\u003eGAATTC\u003c/em\u003eATGGCGGGTGCGTTTTTCGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.35225048923679%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.068493150684931%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eVP2R\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.57925636007828%\" valign=\"top\"\u003e\n \u003cp\u003eATA\u003cem\u003eAAGCTT\u003c/em\u003eTTAAACACGGCTTTCGCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.35225048923679%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.068493150684931%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ep22F\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.57925636007828%\" valign=\"top\"\u003e\n \u003cp\u003eAT\u003cem\u003eGAATTC\u003c/em\u003eATGGGCCCGGCGCTGACCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.35225048923679%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.068493150684931%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ep22R\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.57925636007828%\" valign=\"top\"\u003e\n \u003cp\u003eATA\u003cem\u003eAAGCTT\u003c/em\u003eTTACTCGGTCTTGATGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.35225048923679%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.068493150684931%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eEP123F\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.57925636007828%\" valign=\"top\"\u003e\n \u003cp\u003eAT\u003cem\u003eGAATTC\u003c/em\u003eATGGCGGGTGACGATGTGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.35225048923679%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.068493150684931%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eEP123R\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.57925636007828%\" valign=\"top\"\u003e\n \u003cp\u003eATA\u003cem\u003eAAGCTT\u003c/em\u003eTTACGCACCCGCCAGTTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.35225048923679%\" valign=\"top\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.068493150684931%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eT7-F\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.57925636007828%\" valign=\"top\"\u003e\n \u003cp\u003eTAATACGACTCACTATAGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.35225048923679%\" valign=\"top\"\u003e\n \u003cp\u003eAddgene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.068493150684931%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eT7-R\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.57925636007828%\" valign=\"top\"\u003e\n \u003cp\u003eGCTAGTTATTGCTCAGCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.35225048923679%\" valign=\"top\"\u003e\n \u003cp\u003eAddgene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eSequences in italic are restriction enzyme sequences (\u003cem\u003eGAATTC\u003c/em\u003e: EcoRI, \u003cem\u003eAAGCTT\u003c/em\u003e: HindIII)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAmplification was made using 1X Taq buffer, 2 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.2 mM dNTPs, 0.4 pmol per primer, 1.5U Taq polymerase (Thermo Scientific, ABD) and also 1 \u0026micro;L of total DNA was added to the mixture. PCR conditions were givenin Table 2.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e PCR conditions for VP1, VP2, P22 and EP123 genes\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"633\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.40378548895899%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePCR Reactions\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.80441640378549%\" colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTemperature (\u003csup\u003eo\u003c/sup\u003eC)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.801261829652994%\" colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTime\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.990536277602523%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCycle\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.40378548895899%\" valign=\"top\"\u003e\n \u003cp\u003eInitial Denaturation\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.80441640378549%\" colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.801261829652994%\" colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e5 min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.990536277602523%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.40378548895899%\" valign=\"top\"\u003e\n \u003cp\u003eDenaturation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.80441640378549%\" colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.801261829652994%\" colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e30 sec\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.990536277602523%\" rowspan=\"5\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.02426343154246%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eAnnealing\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.878682842287695%\" valign=\"top\"\u003e\n \u003cp\u003eVP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.878682842287695%\" valign=\"top\"\u003e\n \u003cp\u003eVP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.145580589254767%\" valign=\"top\"\u003e\n \u003cp\u003eP22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.43847487001733%\" valign=\"top\"\u003e\n \u003cp\u003eEP123\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.63431542461005%\" colspan=\"4\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e30 sec\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.110132158590307%\" valign=\"top\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.110132158590307%\" valign=\"top\"\u003e\n \u003cp\u003e57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.704845814977972%\" valign=\"top\"\u003e\n \u003cp\u003e53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.07488986784141%\" valign=\"top\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.02426343154246%\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eExtension\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.341421143847484%\" colspan=\"4\" rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.43847487001733%\" valign=\"top\"\u003e\n \u003cp\u003eVP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.878682842287695%\" valign=\"top\"\u003e\n \u003cp\u003eVP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.878682842287695%\" valign=\"top\"\u003e\n \u003cp\u003eP22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.43847487001733%\" valign=\"top\"\u003e\n \u003cp\u003eEP123\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"26.829268292682926%\" valign=\"top\"\u003e\n \u003cp\u003e1.5 min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.170731707317074%\" valign=\"top\"\u003e\n \u003cp\u003e1 min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.170731707317074%\" valign=\"top\"\u003e\n \u003cp\u003e1 min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.829268292682926%\" valign=\"top\"\u003e\n \u003cp\u003e30 sec\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.40378548895899%\" valign=\"top\"\u003e\n \u003cp\u003eFinal extension\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"35.80441640378549%\" colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.801261829652994%\" colspan=\"4\" valign=\"top\"\u003e\n \u003cp\u003e10 min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.990536277602523%\" valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cul\u003e\n \u003cli\u003e\u003cem\u003e\u003cu\u003eTransfer of Genes into the Expression Vector pET-30a (+)\u003c/u\u003e\u003c/em\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eAmplicons of each gene and the vector pET-30a (+) purified with the plasmid extraction kit were subjected to restriction with the EcoRI/HindIII enzymes in separate tubes. Restriction products were isolated by the phenol-chloroform-isoamylalcohol (25:24:1) method and purified by ethanol precipitation. For the ligation reaction, 2 \u0026micro;L of 10X T4 DNA ligase buffer (Thermo Fhiser Scientific, USA) and 1 \u0026micro;L of T4 DNA Ligase (5 U/\u0026micro;L) were added to 17 \u0026micro;L of restriction products and incubated at 22 \u0026deg;C overnight. For inactivation of T4 DNA ligase, the ligand was incubated at 70 \u0026deg;C for 5 min.\u003c/p\u003e\n\u003cp\u003eThe ligated constructs were transformed into BL21 (DE3) \u003cem\u003eE. coli\u003c/em\u003e cells by chemical transformation and recombinant colonies selected on TSA medium supplemented with 50 mg/L kanamycin [35]. Colony PCR was performed on the selected colonies with both the T7 primers of the vector and the designed primers. Additionally, plasmids were extracted from PCR positive colonies and were screened by digestion with EcoRI and HindIII enzymes and sent to Medsantek (Istanbul) for sequence analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5 Expression and Purification Recombinant Proteins\u003c/strong\u003e\u003c/p\u003e\n\u003cul\u003e\n \u003cli\u003e\u003cem\u003e\u003cu\u003eExpression of VP1, VP2, P22 and EP123 in E. coli\u003c/u\u003e\u003c/em\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eTo detect recombinant protein production, each plasmid-carrying colony (VP1, VP2, p22 and EP123) was incubated in 10 mL LB medium containing 50 \u0026micro;g/mL kanamycin. Transformants were cultured at 37\u0026deg;C and 600 nm until the optical density (OD) reached 0.5-0.6 (~3 h); then 0.5 mM isopropyl-\u0026beta;-D-thio-galactoside (IPTG) was added for induction. After IPTG induction, the cultures were continuously incubated at room temperature with shaking at 200 rpm for 24h. Cells were harvested by centrifugation at 5000 rpm for 10 min at 4\u0026deg;C and homogenized with 1 mL 1xPBS. Cells were lysed and evaluated for protein expression levels and protein solubility by SDS-PAGE (12.5% w/v polyacrylamide) [36, 37].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLarge-scale protein expression was performed in 1 L aerated medium. Cultures were grown in LB medium supplemented with kanamycin (50 \u0026micro;g/mL) at 37 \u0026deg;C until OD600: 0.5\u0026ndash;0.6. Protein expression was induced by the addition of 0.5 mM IPTG and performed for 24 h at room temperature. The cells were collected by centrifugation under the same conditions, and 50 mL of 1X PBS was added to the pellet, and the cells were washed twice and stored at -80 \u003csup\u003eo\u003c/sup\u003eC. Protein determinations were determined according to the Bradford method and using bovine serum albumin (BSA) as the standard [38].\u003c/p\u003e\n\u003cul\u003e\n \u003cli\u003e\u003cem\u003e\u003cu\u003ePurification of recombinant VP1, VP2, P22 and EP123 proteins\u0026nbsp;\u003c/u\u003e\u003c/em\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eSince the recombinant proteins carry the His-tag located on the pET30-a (+) backbone, they were first purified with the Immobilized Metal Affinity Chromatography (IMAC) column, which can capture this tag. According to the Bio-Rad EconoFit IMAC Ni-NTA column purification protocol; recombinant protein samples at -80\u003csup\u003eo\u003c/sup\u003eC were first placed on ice and allowed to thaw in a controlled manner. ~5 g of pellet was suspended by adding 15 mL of IMAC Lysis Buffer (300 mM NaCl, 50 mM NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 5 mM Imidazole, pH: 8). Cells were lysed three times for 1 min with a probe-type sonicator and kept on ice for 1 min. The supernatant portion of the samples, which were centrifuged at 15000 rpm and +4 \u003csup\u003eo\u003c/sup\u003eC for 30 minutes, was filtered through a 0.45 \u0026micro; filter.\u003c/p\u003e\n\u003cp\u003eThe chromatography column was washed with the above-mentioned wash buffer (25 mL) and equilibration was performed. The column was first washed with wash buffer without imidazole, then with 20 mM, and finally with 40 mM imidazole. Elution buffer with 250 mM imidazole was used in each application. Elution was continued until OD\u003csub\u003e280\u003c/sub\u003e decreased to ~0.1 [39].\u003c/p\u003e\n\u003cp\u003eAs the second method, ammonium sulfate precipitation was used to precipitate the proteins in the cell-free supernatants obtained from liquid culture. In order to optimize ammonium sulfate precipitation, samples treated with 20%, 40%, 60%, 80% saturated ammonium sulfate for half an hour (+4 \u0026deg;C) and in a magnetic stirrer were centrifuged at 5000 rpm (+4 \u0026deg;C) for 30 min. Pellets were dissolved in phosphate buffer (20 mM, pH 7.0). The precipitate was dialyzed against the same phosphate buffer for overnight on a magnetic stirrer at +4 \u0026ordm;C, using a 14000 Da dialysis membrane (Sigma-Aldrich, D9777-100FT) [40].\u0026nbsp;\u003c/p\u003e\n\u003cul\u003e\n \u003cli\u003e\u003cem\u003e\u003cu\u003ePolyacrylamide gel electrophoresis (SDS-PAGE)\u003c/u\u003e\u003c/em\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eTo visualize the proteins, a 12.5% separation and 4% loading gel was prepared and the proteins were run with a vertical electrophoresis device. Then, the proteins were visualized by staining the gel [36].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Immunization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e7-week-old female BALB/c mice were used in this study. Experimental animals were kept in cages of 5 each under normal conditions (20-24 \u003csup\u003e0\u003c/sup\u003eC, 50-60% humidity) and were fed ad-libitum with ready-made commercial pellet feeds. During the experimental phase, animals were kept in single cages. Ribi Adjuvant (Sigma Adjuvant System-S6322) was prepared by dissolving it in PBS in accordance with the manufacturer\u0026apos;s instructions. Considering the recommended antigen concentration (0.05-0.25 mg/mL), 200 \u0026micro;L/animal of antigen-adjuvant (1:1) mixture was applied to 50 \u0026micro;g/animal. It was administered intramuscularly to a group of 20 Balb/C mice 3 times at 2-week intervals. Only PBS was applied to the control group. At the end of the experimental phase (2 weeks after the last dose was given), the animals were sacrificed and blood samples were taken by intracardiac drawing and collected into EDTA tubes. Then, the serum was separated, and stored at -20 \u003csup\u003eo\u003c/sup\u003eC. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7 Determination of antibody titers in sera\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eELISA method was used to determine the serum IgG levels. \u0026nbsp;After the wells of the ELISA plates were coated with 100 \u0026micro;L antigen solution (10 \u0026micro;g/mL), they were incubated at +4 \u0026deg;C overnight. Unbound antigens were removed by washing 3 times with PBS-Tween 20 buffer. Two-hundred microliters of casein solution (0.2%) was added to each well and kept at 37 \u0026deg;C for 1 h. The wells then were washed 3 times with PBS-Tween 20 buffer. Immunized mouse sera (primary antibodies) were diluted 1/20, 1/80, 1/160 and 1/320 in PBS and blood serum from a non-immunized mouse was prepared in the same way and 100 \u0026micro;L was added to each well and incubated at 37 \u0026deg;C for 1 h. The plates were washed 3 times with washing buffer. Anti-mouse IgG conjugate (secondary antibody) diluted at 1/1000 was added to each well as 100 \u0026micro;L and kept at 37 \u0026deg;C for 1 h. Then, the wells were washed 6 times with washing buffer. Substrate buffer was added to each well as 100 \u0026micro;L and the plate was left in a dark environment for 30 min. The absorbance values of the microplates were read against the negative control at a wavelength of 450 nm in an ELISA reader. Infected mouse serum was used as a positive control and casein buffer was used as a negative control. The absorbance ratios (p/n) of positive (p) and negative (n) serum samples were calculated. P/n ratio values greater than 2 and 2 were considered positive [41].\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 Cloning and expression of VP1, VP2, p22 and EP123 Genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of the restriction procedures performed to confirm the presence of gene fragments in the plasmids are given below (Fig. 3).\u003c/p\u003e\n\u003cp\u003eSince the non-specific bands in the EP123 amplicons could not be purified with the PCR Clean-up Kit, the amplicons were extracted from the gel. The second image from the right is of the purified EP123 amplicon (Fig. 4). The cloning process was started with this clean 696 bp band obtained from EP123.\u003c/p\u003e\n\u003cp\u003eAmplicons and purified vectors were cut with the same enzymes (EcoRI/HindIII) (Fig. 5). Thus, the circular structure of the vector became linear.\u003c/p\u003e\n\u003cp\u003eIn order to confirm the transformations, random colonies were selected from transformants growing on selective medium plates and colony PCR was performed with both T7F\u0026amp;T7R primers and gene-specific primers (Fig. 6). Selected positive colonies were inoculated into liquid media containing kanamycin.\u003c/p\u003e\n\u003cp\u003eOne amplicon for each gene confirmed by colony PCR and restriction analysis was sent to Medsantek for sequence analysis for verification purposes. Post-sequence evaluation results of VP1, VP2, p22 and EP123 genes using the nucleotide-nucleotide BLAST program are listed respectively (Detailed images are in the Supplementary Fig. S4-S7). \u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.211920529801326%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eCloned HuNoV genes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.88079470198676%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eScientific Name\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.8476821192053%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIdentity Percentage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.05960264900662%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReference\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.211920529801326%\" valign=\"top\"\u003e\n \u003cp\u003eVP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.88079470198676%\" valign=\"top\"\u003e\n \u003cp\u003eVP1-Norovirus GII\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.8476821192053%\" valign=\"top\"\u003e\n \u003cp\u003e91.89%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.05960264900662%\" valign=\"top\"\u003e\n \u003cp\u003eQXU65774.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.211920529801326%\" valign=\"top\"\u003e\n \u003cp\u003eVP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.88079470198676%\" valign=\"top\"\u003e\n \u003cp\u003eCapsid protein VP2 (Norovirus Hu/Norwalk/10368/2010/VNM)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.8476821192053%\" valign=\"top\"\u003e\n \u003cp\u003e95.52%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.05960264900662%\" valign=\"top\"\u003e\n \u003cp\u003eAFX81251.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.211920529801326%\" valign=\"top\"\u003e\n \u003cp\u003eP22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.88079470198676%\" valign=\"top\"\u003e\n \u003cp\u003eNon-structural polyprotein (Norovirus Hu/GII.4/New Orleans 1805/2009/USA)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.8476821192053%\" valign=\"top\"\u003e\n \u003cp\u003e98.90%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.05960264900662%\" valign=\"top\"\u003e\n \u003cp\u003eADD10374.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"18.211920529801326%\" valign=\"top\"\u003e\n \u003cp\u003eEP123\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.88079470198676%\" valign=\"top\"\u003e\n \u003cp\u003eBP68 (synthetic construct)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.8476821192053%\" valign=\"top\"\u003e\n \u003cp\u003e85.11%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.05960264900662%\" valign=\"top\"\u003e\n \u003cp\u003eABR68643.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eFor SDS-PAGE analysis, colonies carrying each gene were seeded separately on selective media. Total protein isolation was performed by inducing IPTG. It has been observed that 24 hours is sufficient incubation time for the culture planted to be used in the purification stage.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Purification of VP1, VP2, p22 and EP123 Proteins\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eVP1 recombinant protein was partially purified in a single step by applying an imidazole gradient with an IMAC column. The strongest band was found to be belong the sample (3 mL) passed through 40 mM imidazole wash buffer and 250 mM elution buffer loaded (Fig. 7A). Ten mililiter of the sample was passed through 40 mM imidazole washing buffer and 250 mM elution buffer to increase the visibility of protein and examined by SDS-PAGE analysis (Fig. 7B). \u0026nbsp; Molecular weight of VP1 recombinant protein was estimated as ~63 kDa.\u003c/p\u003e\n\u003cp\u003eVP2 recombinant protein could not be obtained as a result of imidazole gradient application with the IMAC column. Therefore, ammonium sulfate precipitation was applied to both the pellet and the supernatant samples. The estimated molecular weight of the recombinant VP2 protein was 34.4 kDa. For further purification, supernatant was precipitated with 40% (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u0026nbsp;\u003c/sub\u003eand dialysate was visualized by SDS-PAGE (Fig. 8). Considering the 0.8 kDa size of the 6xHis tag on pET-30a, it is not surprising that we see a band image over 35 kDa. The protein sample dissolved in 20 mM phosphate buffer was dialyzed against the same buffer overnight at +4\u003csup\u003eo\u003c/sup\u003eC.\u003c/p\u003e\n\u003cp\u003ep22 protein was first loaded onto the IMAC column and then further purified by ammonium sulfate precipitation (Fig. 9). As a result of applying an imidazole gradient to the recombinant protein, after treatment with imidazole-free washing buffer and 250 mM imidazole elution buffer, a band of approximately the size of 26 kDa was visualized by SDS-PAGE (Fig 9A). In the second stage, the proteins obtained from the elution were collected (10 mL) and precipitated with different concentrations of ammonium sulfate and sample obtained with (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e at 80% saturation was used for further steps. (Fig. 9B), Recombinant protein p22 dissolved in 20 mM phosphate buffer was dialyzed against the same buffer overnight at +4 \u003csup\u003eo\u003c/sup\u003eC.\u003c/p\u003e\n\u003cp\u003eAs a result of treatment with imidazole-free washing buffer and 250 mM imidazole elution buffer to EP123 protein sample, the appropriate size band (27.9 kDa) was visualized by SDS-PAGE (Fig. 10A). Subsequently, the proteins obtained from the elution were collected (10 mL) and precipitation was performed with different concentrations of ammonium sulfate solution. EP123 protein sample precipitated with (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e at 80% saturation was dissolved in 20 mM phosphate buffer and dialyzed against the same buffer overnight at +4 \u003csup\u003eo\u003c/sup\u003eC.\u003c/p\u003e\n\u003cp\u003eAfter VP1, VP2, p22 and EP123 proteins were partially purified, each of the buffer solutions containing the proteins was replaced with PBS (pH: 7.4) using the Bio-Rad EconoFit Desalting (2ml) Column. Protein amounts were measured by the Bradford method before and after the desalt process (Supplementary Table S1). After this process, it was observed that the protein concentration decreased, except for VP2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3 Immunogenicity Levels of VP1, VP2, p22and EP123 Recombinant Proteins\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsing the indirect ELISA method, IgG levels of immunized animals were measured and their immunogenicity was evaluated (Table 3). Considering that samples with a p/n ratio of 2 and greater than 2 were positive, VP1 was found to be most immunogenic protein up to a dilution of 1/160 (p/n = 2.09). It was concluded that VP2 was immunogenic up to 1/80 dilution (p/n= 2.28), while p22 was immunogenic up to 1/20 dilution (p/n= 2.17). The polypeptide consisting of epitopes (EP123) did not give positive result in any dilution. In order for an antigen to be considered immunogenic, it must be positive at a dilution of up to 1/160 [42]. According to these results, only VP1 can be considered as an immunogen (Fig. 11).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3\u003c/strong\u003e Indirect ELISA results (based on 3 replicate experiment results)\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"603\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.613598673300165%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003e1/20\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003e1/80\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003e1/160\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003e1/320\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.398009950248756%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eKazein Buffer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.613598673300165%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eVP1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.315\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.243\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.216\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.162\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.398009950248756%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.103\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.613598673300165%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eVP2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.232\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.215\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.176\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.118\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.398009950248756%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.094\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.613598673300165%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003ep22\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.207\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.165\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.120\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.084\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.398009950248756%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.095\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.613598673300165%\" valign=\"bottom\"\u003e\n \u003cp\u003e\u003cstrong\u003eEP123\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.096\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.088\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.087\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.24709784411277%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.080\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.398009950248756%\" valign=\"bottom\"\u003e\n \u003cp\u003e0.082\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"4.\tDiscussion ","content":"\u003cp\u003eIn this study, capsid proteins of GII.4 norovirus, a non-structural protein (p22) and a polypeptide consisting of multi-epitopes were recombinantly produced in \u003cem\u003eE. coli\u003c/em\u003e and their antigenic properties were compared. Virus-Like Particles (VLPs), composed of the major capsid protein VP1, are highly immunogenic and are the most studied vaccine candidates due to their well-studied immunogenicity and epitope profiles [43]. The minor capsid protein VP2 was obtained using the mammalian expression system (Human embryonic kidney 293 cells). It has been reported that it is not necessary for the formation of recombinant VLPs, but it increases the expression of VP1 and helps maintain its stability [33, 34]. However, the immunogenicity and epitopes of HuNoV nonstructural proteins have not been well characterized [44]. A recent study investigating humoral immune responses to HuNoV in children across Europe reported antigenicity at NS1/2 (p48) and NS4 (p22) [45]. Based on this, we specifically aimed to characterize a non-structural protein (p22) of NoV and a multi-epitope approach. To date, NoV VP1 protein has been successfully produced recombinantly using mammalian, yeast, plant and bacterial expression systems, mostly in insect cells [8, 27-32]. While the VP1, VP2 and p22 genes were cloned without any problems, the EP123 gene was extracted from the gel because it could not be obtained as a single band during cloning. Thus, the PCR product was concentrated as a single and clean band to be used in the purification stage. Additionally, when designing peptides, taking into account the bonds between epitopes, the use of bioinformatics tools, and the selection of epitopes with immunogenic potential may be important in obtaining the product in pure form.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHuNoV proteins VP1, VP2, p22, and EP123 were partially purified by HisTrap and ammonium sulfate precipitation, while VP1 and VP2 proteins were partially obtained in one step, p22 and EP123 proteins were required two steps. In addition, after purifying VP1, two close bands were obtained in the SDS-PAGE image (Fig. 7B), which was reported by Koho et al. also observed this situation [46]. P protein and major capsid protein VP1 of NoV GII.4 strain were recombinantly produced and purified in \u003cem\u003eP. pastoris\u003c/em\u003e. P protein was directly purified using HisTrap and ion exchange chromatography. Similarly, HuNoV capsid protein VP1 was also obtained with high purity using HisTrap and gel filtration chromatography. Both purified HuNoV P particles and VP1 retained tissue-blood group antigen binding ability. Scanning Electron Microscope (SEM) analysis and a saliva binding assay showed that both purified HuNoV P complex and HuNoV VLPs retained their stability and biological functions [47]. Tom\u0026eacute;-Amat et al. purified NoV VLPs obtained directly from the culture medium using \u003cem\u003eP. pastoris\u003c/em\u003e with a purity of over 90% using ion exchange chromatography [48]. Huo et al. produced VLPs in \u003cem\u003eE. coli\u003c/em\u003e with high purity by applying ammonium sulfate precipitation, size-dependent chromatography (SEC) and ammonium sulfate precipitation methods, respectively [31]. They reported that the cold shock expression system (pCold) used in their study is a new approach to produce NoV VLPs in \u003cem\u003eE. coli\u003c/em\u003e and that this system is a safe tool for developing low-cost NoV vaccines in the future.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRecombinant VP1, VP2, p22 and EP123 proteins were administered to mice intramuscularly together with Ribi adjuvant. In order to individually evaluate the immunogenicity of norovirus proteins, experimental animals were immunized with each recombinant protein separately. When the IgG levels in the serum of mice were examined, only the VP1 protein, among the NoV proteins produced in \u003cem\u003eE. coli\u003c/em\u003e, showed immunogenic properties. When VLPs produced and purified in the cold shock expression vector pCold-III of \u003cem\u003eE. coli\u003c/em\u003e were compared with VLPs purified from the recombinant baculovirus expression system, VLP obtained from \u003cem\u003eE. coli\u003c/em\u003e had higher IgG antibody titers and blocking antibody titers [31]. Mice immunized with VLPs purified from insect cells produced GII.17-specific serum and effectively blocked the binding of GII.17 VLPs to tissue-blood group antigens [47]. The kinetics of serum IgG and fecal IgA antibody responses were examined when crude yeast extracts containing VA387 recombinant capsid protein were administered to mice via oral immunization. Oral administration of yeast cell lysates containing 0.1 mg of VLP without adjuvant resulted in systemic and mucosal immune responses in mice. Significantly higher and earlier responses were observed in mice receiving a higher dose of antigen (1 mg/dose). It has been observed that the immune response against NoVs is related to the dose of the vaccine given to the animals and the number of immunizations [28]. A bivalent VLP norovirus vaccine candidate containing GI.4 and GII.4 antigens (rNV-2v) transiently produced in \u003cem\u003eN. benthamiana\u003c/em\u003e has demonstrated the safety and tolerability of the vaccine in rabbit studies.\u0026nbsp;Additionally, strong rNV-2v-specific antibody responses were observed in both male and female rabbits in the absence of adjuvants with very high levels of blocking antibodies [49]. As we expected, immunogenic properties of recombinantly produced VP1 obtained in our study are consistent with literature information. However, our main goal was to reveal whether proteins other than VP1 were immunogenic or not.\u003c/p\u003e\n\u003cp\u003eStudies such as the immunization of healthy adults with univalent or bivalent NoV VLPs produced using the recombinant baculovirus expression system and the challenge of humans with natural immun in recent years have guided our understanding of NoV immune responses. The divalent vaccine (GI.1 and GII.4) being developed by the pharmaceutical company Hillevax is the only candidate to report clinical efficacy to date. It is progressing towards phase III trials in adults and children from 5 months of age [50]. Since there is a need to find suitable polyvalent vaccine candidates that provide immunity to various genogroups against norovirus, it is very important to test the multi-epitope peptide vaccine approach in the laboratory environment.\u0026nbsp;\u003cem\u003eIn-silico\u003c/em\u003e studies have provided a new perspective from which drugs can be designed using genomic, proteomic and immunoinformatics approaches, minimizing the time and cost required in the development process. It was applied \u003cem\u003ein-vivo\u003c/em\u003e using the multi-epitope approach consisting of the p22 protein, which has not been studied much as a vaccine candidate to date, and the epitopes of VP1, VP2 and p22. Thus, it was possible to compare the effectiveness of recombinantly produced vaccine candidates with each other.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by Aydın Adnan Menderes University BAP FEF-21016. Demet YAL\u0026Ccedil;IN BİNG\u0026Uuml;L was supported by 100/2000 YOK scholarship in Turkey.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e DYB performed the data analysis and visualization. She also prepared the original draft of the article with the help of GB. GB designed and supervised this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e Most data from this study are presented in the supplementary material.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e The authors have no competing interests to declare that are relevant to the content of this article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGlass RI, Parashar UD, Estes MK (2009) Norovirus gastroenteritis. N Engl J Med 361:1776\u0026ndash;1785. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1056/NEJMra0804575\u003c/span\u003e\u003cspan address=\"10.1056/NEJMra0804575\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHall AJ, Lopman BA, Payne DC, Patel MM, Gastan˜ aduy PA, Vinje\u0026acute; J, Parashar UD (2013) Norovirus disease in the United States. Emerg Infect Dis 19:1198\u0026ndash;1205. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.3201/eid1908.130465\u003c/span\u003e\u003cspan address=\"10.3201/eid1908.130465\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFankhauser RL, Monroe SS, Noel JS, Humphrey CD, Bresee JS, Parashar UD et al (2002) Epidemiologic and molecular trends of \u0026ldquo;Norwalk-like viruses\u0026rdquo; associated with outbreaks of gastroenteritis in the United States. J Infect Dis 186:1\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1086/341085\u003c/span\u003e\u003cspan address=\"10.1086/341085\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopman BA, Reacher MH, van Duijnhoven Y, Hanon FX, Brown D, Koopmans M (2003) Viral gastroenteritis outbreaks in Europe, 1995\u0026ndash;2000. Emerg Infect Dis 9:90\u0026ndash;96. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3201/eid0901.020184\u003c/span\u003e\u003cspan address=\"10.3201/eid0901.020184\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHallowell BD, Parashar UD, Hall AJ (2019) Epidemiologic challenges in norovirus vaccine development. Hum Vaccin Immunother 15:1279\u0026ndash;1283. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/21645515.2018.1553594\u003c/span\u003e\u003cspan address=\"10.1080/21645515.2018.1553594\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang M, Fu M, Hu Q (2021) Advances in Human Norovirus Vaccine Research. Vaccines 9, 732. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/vaccines9070732\u003c/span\u003e\u003cspan address=\"10.3390/vaccines9070732\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMay J, Viswanathan P, Ng KK-S, Medvedev A, Korba B (2014) The P4-P2\u0026prime; amino acids surrounding human norovirus polyprotein cleavage sites define the core sequence regulating self-processing order. J Virol 88:10738\u0026ndash;47. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/JVI.01357-14\u003c/span\u003e\u003cspan address=\"10.1128/JVI.01357-14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThorne LG \u0026amp; Goodfellow IG (2014) Norovirus gene expression and replication. J Gen Virol 95:278\u0026ndash;291. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1099/vir.0.059634-0\u003c/span\u003e\u003cspan address=\"10.1099/vir.0.059634-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConley MJ, McElwee M, Azmi L, Gabrielsen M, Byron O et al (2019) Calicivirus VP2 forms a portal-like assembly following receptor engagement. Nature 565:377\u0026ndash;381. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41586-018-0852-1\u003c/span\u003e\u003cspan address=\"10.1038/s41586-018-0852-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCannon JL, Lindesmith LC, Donaldson EF, Saxe L, Baric RS, Vinje J (2009) Herd immunity to GII.4 noroviruses is supported by outbreak patient sera. J Virol 83:5363\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/JVI.02518-08\u003c/span\u003e\u003cspan address=\"10.1128/JVI.02518-08\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHung CH, Yen JB, Chang PJ, Chen LW, Huang TY, Tsai WJ, Tsai YC (2023) Characterization of Human Norovirus Nonstructural Protein NS1.2 Involved in the Induction of the Filamentous Endoplasmic Reticulum, Enlarged Lipid Droplets, LC3 Recruitment, and Interaction with NTPase and NS4. Viruses 15, 812. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/v15030812\u003c/span\u003e\u003cspan address=\"10.3390/v15030812\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTu ET-V, Bull RA, Greening GE, Hewitt J, Lyon MJ, Marshall JA et al (2008) Epidemics of gastroenteritis during 2006 were associated with the spread of norovirus GII. 4 variants 2006a and 2006b. Clin Infect Dis 46:413\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1086/525259\u003c/span\u003e\u003cspan address=\"10.1086/525259\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiebenga J, Vennema H, Zheng D, Vinje\u0026acute; J, Lee BE et al (2009) Norovirus illness is a global problem: emergence and spread of norovirus GII.4 variants, 2001\u0026ndash;2007. J Infect Dis 200:802\u0026ndash;812. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1086/605127\u003c/span\u003e\u003cspan address=\"10.1086/605127\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoel JS, Fankhauser RL, Ando T, Monroe SS, Glass RI (1999) Identification of a distinct common strain of \u0026lsquo;norwalk-like viruses\u0026rsquo; having a global distribution. J Infect Dis 179:1334\u0026ndash;1344. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1086/314783\u003c/span\u003e\u003cspan address=\"10.1086/314783\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhite PA, Hansman GS, Li A et al (2002) Norwalk-like virus 95/96-US strain is a major cause of gastroenteritis outbreaks in Australia. J Med Virol 68:113\u0026ndash;118. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jmv.10177\u003c/span\u003e\u003cspan address=\"10.1002/jmv.10177\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopman B, Vennema H, Kohil E, Pothier P et al (2004) Increase in viral gastroenteritis outbreaks in Europe and epidemic spread of new norovirus variant. Lancet 363:682\u0026ndash;688. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0140-6736(04)15641-9\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(04)15641-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWiddowson MA, Cramer EH, Hadley L et al (2004) Outbreaks of acute gastroenteritis on cruise ships and on land: identification of a predominant circulating strain of norovirus-United States, 2002. J Infect Dis 190:27\u0026ndash;36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1086/420888\u003c/span\u003e\u003cspan address=\"10.1086/420888\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBull RA, Tu ET, McIver CJ, Rawlinson WD, White PA (2006) Emergence of a new norovirus genotype GII.4 variant associated with global outbreaks of gastroenteritis. J Clin Microbiol 44:327\u0026ndash;333. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/JCM.44.2.327-333.2006\u003c/span\u003e\u003cspan address=\"10.1128/JCM.44.2.327-333.2006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEden JS, Bull RA, Tu E, Mclver CJ, Lyon MJ et al (2010) Norovirus GII.4 variant 2006b caused epidemics of acute gastroenteritis in Australia during 2007 and 2008. J Clin Virol 49:265\u0026ndash;271. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jcv.2010.09.001\u003c/span\u003e\u003cspan address=\"10.1016/j.jcv.2010.09.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJones MK, Grau KR, Costantini V, Kolawole AO, de Graaf M, Freiden P et al (2015) Human norovirus culture in B cells. Nat Protoc 10:1939\u0026ndash;47. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.or/10.1038/nprot.2015.121\u003c/span\u003e\u003cspan address=\"https://doi.or/10.1038/nprot.2015.121\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKolawole AO, Rocha-Pereira J, Elftman MD, Neyts J, Wobus CE (2016) Inhibition of human norovirus by a viral polymerase inhibitor in the B cell culture system and in the mouse model. Antivir Res 132:46\u0026ndash;49. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.antiviral.2016.05.011\u003c/span\u003e\u003cspan address=\"10.1016/j.antiviral.2016.05.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEttayebi K, Crawford SE, Murakami K, Broughman JR, Karandikar U et al (2016) Replication of human noroviruses in stem cell-derived human enteroids. Science 353(6306):1387\u0026ndash;1393. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.aaf5211\u003c/span\u003e\u003cspan address=\"10.1126/science.aaf5211\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCostantini V, Morantz EK, Browne H, Ettayebi K, Zeng XL, Atmar RL et al (2018) Human Norovirus Replication in Human Intestinal Enteroids as Model to Evaluate Virus Inactivation. Emerg Infect Dis 24:1453\u0026ndash;1464. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3201/eid2408.180126\u003c/span\u003e\u003cspan address=\"10.3201/eid2408.180126\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlvarado G, Ettayebi K, Atmar RL, Bombardi RG, Kose N, Estes MK, Crowe Jr JE (2018) Human Monoclonal Antibodies That Neutralize Pandemic GII.4 Noroviruses. Gastroenterology 155:1898\u0026ndash;1907. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1053/j.gastro.2018.08.039\u003c/span\u003e\u003cspan address=\"10.1053/j.gastro.2018.08.039\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRichardson C, Bargatze RF, Goodwin R, Mendelman PM (2013) Norovirus vir\u0026uuml;s like particle vaccines for the prevention of acute gastroenteritis. Expert Rev Vaccines 12:155\u0026ndash;67. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1586/erv.12.145\u003c/span\u003e\u003cspan address=\"10.1586/erv.12.145\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLucero Y, Vidal R, O\u0026rsquo;Ryan GM (2018) Norovirus vaccines under development. Vaccine 36(36):5435\u0026ndash;5441. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vaccine.2017.06.043\u003c/span\u003e\u003cspan address=\"10.1016/j.vaccine.2017.06.043\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMason HS, Ball JM, Shi JJ, Jiang X, Estes MK, Arntzen CJ (1996) Expression of Norwalk virus capsid protein in transgenic tobacco and potato and its oral immunogenicity in mice. Proc Natl Acad Sci USA, 93:5335\u0026ndash;5340. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.93.11.5335\u003c/span\u003e\u003cspan address=\"10.1073/pnas.93.11.5335\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia M, Farkas T, Jiang X (2007) Norovirus Capsid Protein Expressed in Yeast Forms Virus-like Particles and Stimulates Systemic and Mucosal Immunity in Mice Following an Oral Administration of Raw Yeast Extracts. J Med Virol 79(1):74\u0026ndash;83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jmv.20762\u003c/span\u003e\u003cspan address=\"10.1002/jmv.20762\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanti L, Batchelor L, Huang Z, Hjelm B, Kilbourne J, Arntzen CJ et al (2008) An efficient plant viral expression system generating orally immunogenic Norwalk virus-like particles. Vaccine 26:1846\u0026ndash;1854. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vaccine.2008.01.053\u003c/span\u003e\u003cspan address=\"10.1016/j.vaccine.2008.01.053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim JW, Kong YJ, Kim MS, Lee HJ, Lee SW, Kang SY (2015) Expression of human norovirus VP1 gene and VP1-specific monoclonal antibodies. J Biomed Res 16(3):109\u0026ndash;114. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.12729/jbr.2015.16.3.109\u003c/span\u003e\u003cspan address=\"10.12729/jbr.2015.16.3.109\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuo Y, Wan X, Ling T, Wu J, Wang W, Shen S (2018) Expression and purification of norovirus vir\u0026uuml;s like particles in \u003cem\u003eEscherichia coli\u003c/em\u003e and their immunogenicity in mice. Molecular Immunology 93:278\u0026ndash;284. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1016/j.molimm.2017.07.014\u003c/span\u003e\u003cspan address=\"10.1016/j.molimm.2017.07.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMalm M, Diessner A, Tamminen K, Liebscher M, Vesikari T, Blazevic V (2019) Rotavirus VP6 as an adjuvant for bivalent Norovirus vaccine produced in \u003cem\u003eNicotiana benthamiana\u003c/em\u003e. Pharmaceutics 11, 229. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pharmaceutics11050229\u003c/span\u003e\u003cspan address=\"10.3390/pharmaceutics11050229\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVongpunsawad S, Prasad BV, Estes MK (2013) Norwalk virus minor capsid protein VP2 associates within the VP1 shell domain. J Virol 87:4818\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/JVI.03508-12\u003c/span\u003e\u003cspan address=\"10.1128/JVI.03508-12\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin Y, Fengling L, Lianzhu W, Yuxiu Z, Yanhua J (2014) Function of VP2 protein in the stability of the secondary structure of virus-like particles of genogroup II norovirus at different pH levels: function of VP2 protein in the stability of NoV VLPs. J Microbiol 52:970\u0026ndash;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12275-014-4323-6\u003c/span\u003e\u003cspan address=\"10.1007/s12275-014-4323-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSambrook J, Fritsch EF, Maniatis T (2001) Molecular cloning: A Laboratory Manual. Preparation and Transformation of Competent E. coli using Calcium Chloride. Irwin N, Janssen KA. Cold Spring Harbor Laboratory Press, New York\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227(5259): 680\u0026ndash;685. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/227680a0\u003c/span\u003e\u003cspan address=\"10.1038/227680a0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrowe J, Dobeli H, Genz R, Hochuli E, Stuber D, Henco K (1994) 6xHis-Ni-NTA chromatography as a superior technique in recombinant protein expression/purification. In: Harwood AJ (eds) Methods in Molecular Biology, Vol 31 Protocols for Gene Analysis. Humana Press Inc, Totowa, NJ, pp 371\u0026ndash;387.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 7: 72, 248\u0026thinsp;\u0026ndash;\u0026thinsp;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/abio.1976.9999\u003c/span\u003e\u003cspan address=\"10.1006/abio.1976.9999\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrowne J, Masone BS, Ribbe J (1995) One-step purification of recombinant proteins with the 6xHis tag and Ni-NTA resin. Mol Biotecnol 4(3):27\u0026ndash;58. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/BF02779018\u003c/span\u003e\u003cspan address=\"10.1007/BF02779018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTuncer M (2008) Protein Saflaştırma-1 Kromatografik Y\u0026ouml;ntemler, Can Matbaacılık, Mersin/T\u0026uuml;rkiye.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSavigny D de \u0026amp; Voller A (1980) The Communication of ELISA Data from Laboratory to Clinician. Journal of Immunoassay 1(1):105\u0026ndash;128. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/01971528008055779\u003c/span\u003e\u003cspan address=\"10.1080/01971528008055779\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi L, Wang J, Wang P, Li G, Gong M, Yuan W, Zhu H (2012) Development of an indirect enzyme-linked immunosorbent assay (ELISA) assay based on a recombinant truncated VP2 (tVP2) protein for the detection of canine parvovirus antibodies. Afr J Biotechnol 11(93):16034\u0026ndash;16039. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5897/AJB12.2446\u003c/span\u003e\u003cspan address=\"10.5897/AJB12.2446\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDebbink K, Lindesmith LC \u0026amp; Baric RS (2014) The state of norovirus vaccines. Clin Infect Dis 58:1746\u0026ndash;1752. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/cid/ciu120\u003c/span\u003e\u003cspan address=\"10.1093/cid/ciu120\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu L, Huang W, Neill FH, Estes MK, Atmar RL \u0026amp; Palzkill T (2023) Mapping human norovirus antigens during infection reveals the breadth of the humoral immune response. npj Vaccines 8:87. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41541-023-00683-1\u003c/span\u003e\u003cspan address=\"10.1038/s41541-023-00683-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVillabruna N, Izquierdo-Lara RW, Schapendonk CME, de Bruin E, Chandler F, Thao TTN et al (2022) Profiling of humoral immune responses to norovirus in children across Europe. Sci Rep 12(1):14275. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-022-18383-6\u003c/span\u003e\u003cspan address=\"10.1038/s41598-022-18383-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoho T, Huhti L, Blazevic V, Nurminen K, Butcher SJ, Laurinmaki P et al (2012) Production and characterization of virus-like particles and the P domain protein of GII.4 norovirus. Journal of Virological Methods 179:1\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jviromet.2011.05.009\u003c/span\u003e\u003cspan address=\"10.1016/j.jviromet.2011.05.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen YL\u0026amp; Huang CT (2020) Establishment of a two-step purification scheme for tag-free recombinant Taiwan native norovirus P and VP1 proteins. Journal of Chromatography B 1159, 122357. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jchromb.2020.122357\u003c/span\u003e\u003cspan address=\"10.1016/j.jchromb.2020.122357\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTom\u0026eacute;-Amat J, Fleischer L, Parker SA, Bardliving CL\u0026amp; Batt CA (2014) Secreted production of assembled Norovirus virus-like particles from \u003cem\u003ePichia pastoris\u003c/em\u003e. Microbial Cell Factories, 13:134. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12934-014-0134-z\u003c/span\u003e\u003cspan address=\"10.1186/s12934-014-0134-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTus\u0026eacute; D, Malm M, Tamminen K, Diessner A, Thieme F, Jarczowski F et al (2022) Safety and immunogenicity studies in animal models support clinical development of a bivalent norovirus-like particle vaccine produced in plants. Vaccine 40(7):977\u0026ndash;87. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vaccine.2022.01.009\u003c/span\u003e\u003cspan address=\"10.1016/j.vaccine.2022.01.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArmah G, Lopman BA, Vinj\u0026eacute; J, O'Ryan M, Lanata CF, Groome M et al (2023) Vaccine value profile for norovirus. Vaccine 41:S134-S152. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vaccine.2023.03.034\u003c/span\u003e\u003cspan address=\"10.1016/j.vaccine.2023.03.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Noroviruses, Escherichia coli, Recombinant Protein Production, Cloning, Immune response","lastPublishedDoi":"10.21203/rs.3.rs-4269416/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4269416/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHuman Noroviruses (HuNoVs) are considered the main cause of gastroenteritis in developed and developing countries. Aim of this research was to recombinant production of some structural and functional Norovirus proteins and to determine their immunogenicity in mice. Synthetic VP1, VP2, p22 and a polypeptide (EP123) sequences were amplified with PCR and then amplicons in pET-30a (+) expression vector were transformed into \u003cem\u003eE. coli\u003c/em\u003e BL21 cells. Recombinantly produced proteins were purified by Ni-NTA chromotograhy and ammonium sulphate precipitation. Molecular weights of recombinant VP1, VP2, P22 and EP123 were estimated as 63, 34.4, 26 and 27.9 kDa, respectively. Indirect ELISA method was applied to detect IgG levels from serum samples of vaccinated mice. Considering that samples with a p/n ratio of 2 and greater than 2 were positive, VP1 was found to be immunogenic up to a dilution of 1/160 (p/n\u0026thinsp;=\u0026thinsp;2.09). While VP2 and P22 were found to be immunogenic up to a dilution of 1/80 and 1/20 respectively, EP123 did not give positive result in any dilution. These results suggest that recombinantly produced VP1, has immunogenic potential, whereas VP2, P22 and EP123 polypeptide did not show promising result as a vaccine candidate.\u003c/p\u003e","manuscriptTitle":"Molecular Cloning and Immunogenicity Determination of Norovirus Proteins as Vaccine Candidates","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-24 17:36:37","doi":"10.21203/rs.3.rs-4269416/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"66b5c85b-2ed8-4611-8d99-5959f747268a","owner":[],"postedDate":"April 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-18T12:38:56+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-24 17:36:37","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4269416","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4269416","identity":"rs-4269416","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00