Abstract
Background:
N6-methyladenosine (m6A) modification regulates the processes of RNA splicing, subcellular localization, translation and stability by changing the RNA structure and the interaction between RNA and RNA-binding proteins to ensure the timely and accurate expression of genes. In this study, we investigated m6A-related mRNAs and for the first time explored effective prevention and treatment targets in endometriosis (EM).
Methods
By arraystar m6A-mRNA epitranscriptomic microarray, biological information analysis technologies, and validation of other databases, aberrant m6A-related mRNAs were uncovered, as well as efficient therapeutic drugs.
Results
FN1, VCAM1, RAP1A, BRCA1, CCNA2 and CDK1 might be vital m6A-related mRNAs, and VCAM1 and RAP1A may be the most important two. A few crucial small-molecule agents supply new views for the treatment of EM.
Conclusion
These results demonstrated novel insights into m6A modification of EM and revealed potential biomarkers and precision medicine strategies for EM.
Introduction
Endometriosis refers to the process of growth and lesions of active endometrial tissue outside the uterine cavity, which is a common disease and refractory disease in women of childbearing age, with an incidence of 10%–15% and a significant upward trend (). Although it is benign lesions, its biological behavior is similar to that of malignant tumors, manifested as adhesion, implantation, infiltration, metastasis and recurrence (). This kind of benign nature and similar malignant behavior has always been a very difficult problem in gynecological clinics (). At present, there are many hypotheses about the pathogenesis of internal heterogeneity, including the theory of menstrual blood reflux, intestinal metaplasia, immune system abnormalities, genetic factors, etc., but none of them can explain the diversity of clinical manifestations and the complexity of treatment, and the source molecular mechanism remains to be clarified ().
In recent years, DNA methylation and protein post-translational modification have laid a good research foundation for epigenetics (). On this basis, RNA methylation modification gradually caused a new wave of epigenetic research (). N6-methyladenosine (m6A) is a dynamic reversible methylation modification that occurs on the sixth nitrogen atom of adenine, widely present in eukaryotic mRNAs, mainly distributed near stop codons, 3′untranslated regions and exon regions, is a common modification of RNA methylation, and is also a chemical modification with the highest RNA abundance in eukaryotic cells (). Similar to DNA methylation, RNA m6A modification is also catalyzed by methyltransferase and demethyltransferase-mediated mediation (). Methyltransferases include METTL3, METTL14, etc., demethyltransferases include FTO, ALKBH5, etc., and m6A-binding proteins include YTHDF1, YTHDF2, etc (; ). Recently, after in-depth research on the regulation between the dynamic balance of methylation and demethylation of m6A modification, it has been found that RNA m6A modification is closely related to RNA metabolism, including the regulation of RNA structure, variable cleavage of RNA, translation and degradation of RNA, and transport of RNA (; ; ). In addition, RNA m6A modification can also affect the occurrence and development of a variety of biological processes and diseases (). For example, METTL3 and METTL14 drive aging-related secretory phenotypes; FTO is associated with obesity; YTHDF1 promotes stress particle formation.
At present, no research has been reported on whether RNA m6A modification is involved in the occurrence and development of internal heterogeneity (). From the perspective of RNA m6A modification, this study explores the role and potential regulatory mechanism of RNA m6A modification in endochromatics, so as to further deepen the understanding of the occurrence and development of endocytosis.
In this article, data from arraystar m6A-mRNA epitranscriptomic microarray were analyzed and integrated to screen out abnormal m6A-related biomarkers. A protein‒protein interaction (PPI) network was established to identify vital nodes. In addition, the GSE5108 database and Turku Endometriosis Database were used to validate the key genes. Finally, we evaluated drugs for endometriosis and provided new ideas for diagnostic and therapeutic targets.
Methods
Collection of tissue samples
A total of 15 ectopic endometriotic samples and 15 normal endometrium were collected. Ectopic endometriotic samples from patients who underwent surgery without chemotherapy and perimenopausal at the First Affiliated Hospitals of Harbin Medical University. Normal samples from patients who underwent hysterectomy because of uterine leiomyoma. All normal endometrium were pathologically confirmed absence of endometriosis and other endometrial disorders. All patients had regular menstrual cycles. Women receiving hormone therapy or with other serious disease were excluded. To minimize confounding effects, all samples were collected at the same menstrual phase, with standardized tissue preservation and uniform laboratory procedures. Potential confounding influences were further controlled by statistical adjustment and principal component analysis (PCA). The research was approved by the ethics committee of the First Affiliated Hospital of Harbin Medical University. All tissues were immediately preserved in liquid nitrogen until use. The diagnosis of each specimen has been revealed based on histopathological evaluation.
Arraystar m6A-mRNA epitranscriptomic microarray
Ectopic endometrium and normal endometrium tissues for microarray were collected from six patients (3V3). A total of RNA was quantified applying the NanoDrop ND-1000 and RNA integrity was evaluated by Bioanalyzer 2100 or Mops electrophoresis. RNAs were incubated with anti- N6-methyladenosine (m6A) antibody. The m6A-methylated RNAs were eluted from the immunoprecipitated magnetic beads, and unmodified RNAs were achieved from the supernatant. The modified and unmodified RNAs were augmented as cRNAs and labelled with Cy5 and Cy3, respectively, though Arraystar RNA Labeling protocol. The cRNAs were hybridized onto an Arraystar Human mRNA Epitranscriptomic Microarray (8 × 60 K, Arraystar). After washing the slides, the arrays were scanned with an Agilent Scanner G2505C. The raw microarray data are available in GEO (GSE248593), while other data are included in the supplementary materials.
Agilent Feature Extraction software (version 11.0.1.1) was applied to analyze acquired array images. Raw intensities of Cy5-labelled and Cy3-labelled cRNAs were normalized to the average of log2-scaled intensities of the Spike-in RNA. Afterwards,the probe signals with present or marginal quality control flags in at least three out of six samples were retained for next analyses. The quantity of m6A modification was calculated as the m6A methylation level based on the Cy5-labelled normalized intensities. Aberrantly m6A-methylated RNAs between ectopic endometrium and normal endometrium tissues were identified by filtering with the fold change and statistical thresholds. Hierarchical Clustering was used to present the distinguishable m6A-methylation pattern among tissues. Aberrantly m6A-methylated mRNAs were analyzed for GO and KEGG pathway enrichment.
Protein-protein interaction network analysis and hub gene selection
Differently m6A-methylated mRNAs were uploaded to STRING database to establish their Protein-protein interaction (PPI) network. The minimum required interaction score was set at >0.9 and the disconnected genes were hidden in the network. The Cytoscape software was used to present the PPI network and select hub genes. Venn diagram was used to show the top ten modules in betweenness, degree and closeness three different algorithm analysis through Cytoscape. The topological parameter thresholds were defined as: degree (top 10%), betweenness centrality (top 5%–10%), and closeness centrality (top 5%–10%). To ensure the robustness of hub gene identification, threshold sensitivity analysis was conducted by adjusting the cutoff criteria. The results confirmed that core hub genes including VCAM1, RAP1A and FN1 were consistently detected across different threshold settings.
Validation of the novel hub genes in other databases
For other database identification, the authors sought the gene expression profile dataset GSE5108, which was derived from the platform GPL2895 (GE Healthcare/Amersham Biosciences CodeLink Human Whole Genome Bioarray) and the Turku Endometriosis Database (https://endometdb.utu.fi), which was used to confirm the hub genes in endometriosis samples. Furthermore, ROC analysis was showed the diagnostic values of the hub genes using GraphPad Prism 9.3.1.
Discovery of small molecular drugs
The differently m6A-methylated mRNAs were introduced into the CMap database (https://clue.io/), a publicly accessible validation of small molecular drugs website. PubChem (https://pubchem.ncbi.nml.gov) was used for 3D structure of the established potential small molecules. The STITCH database (http://stitch.embl.de) was applied to search the connection between hub genes and small molecules.
Molecular docking analysis
Firstly, we downloaded the 3D structures of small molecules from the PubChem database; imported the structures into ChemBio3D Ultra 14.0 and set Minimum RMS Gradient to 0.001; and then performed hydrogenation, charge calculation, charge distribution, the rotatable key set in the Autodock Tools-1.5.6. Secondly, we downloaded VCAM1 and RAP1A protein structures from the PDB database; used Pymol2.3.0 to remove protein crystal water, primitive ligands; and then imported protein structures into Autodock Tools. Thirdly, PyMOL2.3.0 was used to analyze the interaction mode of the docking results.
RNA extraction and quantitative real-time PCR (qRT-PCR)
Ectopic endometrium and normal endometrium tissues for microarray were selected from 24 patients (12V12). This was an exploratory study, and the sample size was limited by specimen availability. Total RNA was extracted by TRIzol reagent (Invitrogen, CA, USA) in ectopic and normal samples. RNA was reverse transcribed into cDNA using EasyScript™ Reverse Transcriptase (Beijing TransGen Biotech, China). RNA expression levels were detected by qPCR using SYBR Green PCR MasterMix (Takara, Japan) and TaqMan MicroRNA Assay Kit on a CFX96 real-time PCR Detection System (Bio-Rad, Hercules, CA, USA). The relative expression of VCAM1 and RAP1A was normalized to GAPDH, and calculated by 2−ΔΔCT method. PCR reaction conditions were as follows: 95 °C for 2 min, followed by 40 cycles of amplification at 95 °C for 15 s and 60 °C for 1 min. Primer sequences used in our research are presented in Table 1.
TABLE 1
| Primer | Sequence (5′–3′) |
|---|---|
| VCAM1 forward | GATTCTGTGCCCACAGTAAGGC |
| VCAM1 reverse | TGGTCACAGAGCCACCTTCTTG |
| RAP1A forward | ACTTACAGGACCTGAGGGAACAG |
| RAP1A reverse | CCTGCTCTTTGCCAACTACTCG |
| GAPDH forward | CAGGAGGCATTGCTGATGAT |
| GAPDH reverse | GAAGGCTGGGGCTCATTT |
qRT-PCR primer sequences used in our research.
Statistical analysis
Student’s t-test was used to compare the expression of aberrantly m6A-mRNAs. Statistical tests were set as two-sided, and the difference was considered significant at p < 0.05 (ns, p ≥ 0.05; *, p < 0.05; **, p < 0.01; ***, p < 0.001).
Results
Determination of aberrantly m6A-methylated mRNAs in endometriosis
M6A–mRNA epitranscriptomic microarray was proceeded with the samples from ectopic endometrium and normal endometrium. To contrast two groups for aberrantly m6A methylation level, the fold change (FC) and statistical significance of the difference (p-value) were calculated for each transcript. The default thresholds are |FC| ≥2 and p-values <0.05. Multiple testing correction was performed using the Benjamini–Hochberg (BH) method to control the false discovery rate (FDR). Raw microarray data were subjected to background correction and quantile normalization. Principal component analysis (PCA) was utilized to evaluate and minimize batch effects, and samples from the same batch were equally distributed between case and control groups. Raw microarray data were processed with background correction and quantile normalization. Principal component analysis (PCA) was applied to assess and minimize batch effects, and samples within each batch were equally allocated across case and control groups. A total of 8333 m6A-methylated mRNAs were obtained, including 1631 hypermethylated-upregulated expressed mRNAs, 219 hypomethylated-upregulated expressed mRNAs and 6483 hypomethylated-downregulated expressed mRNAs (Figures 1A,B). Moreover, the clustering analysis displayed differential m6A methylation levels in the ectopic and normal endometrium (Figure 1C).
FIGURE 1
Functional enrichment analysis of hyper- and hypo-methylated m6A methylated mRNAs
Gene ontology (GO)and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses exhibited the biological function of differentially m6A-methylated mRNAs in endometriosis. The top 10 enriched biological processes (BP), cellular components (CC) and molecular function (MF) genes with hyper-and hypo-methylated m6A were verified. In BP analysis, hypermethylated genes were mainly enriched in the terms ‘response to stimulus’, ‘signaling’ and ‘regulation of response to stimulus’. CC analysis revealed enrichment predominantly in the term ‘cell periphery’,‘plasma membrane’ and ‘intrinsic component of membrane’. In addition, MF analysis uncovered enrichment in the terms ‘molecular transducer activity’, ‘signaling receptor activity’, and ‘protein-containing complex binding’ (Figure 2A). Hypomethylated genes were remarkably enriched in the terms ‘cellular process’ in biological process analysis. In CC analysis, the hypomethylated genes were obviously enriched in the terms ‘intracellular anatomical structure’ and ‘organelle’. Additionally, MF analysis indicated enrichment with the terms ‘binding’, and ‘protein binding’ (Figure 2B). The result from KEGG analysis demonstrated that hypermethylated genes were strikingly enriched in the signaling pathway of cell adhesion molecules, osteoclast differentiation and staphylococcus aureus infection, while the hypomethylated genes were mainly linked to amyotrophic lateral sclerosis, cell cycle and ribosome (Figures 2C,D). These pathways elucidated that differences in the m6A methylation profiles maybe have crucial effect in the etiopathogenesis of endometriosis.
FIGURE 2
PPI networks analysis of the hub genes
The PPI network of hypermethylated-upregulated expressed mRNAs consisted of 40 nodes and 45 edges (Figure 3A). The cytoHubba plug-in was applied to selected the top ten hub m6A-related mRNAs by three different algorithms–degree, betweenness and closeness. The hub mRNAs were DMD, MYLK, FN1, PXN, ICAM1 and VCAM1 overlapping three different features among the hypermethylated-upregulated expressed mRNAs (Figure 3B), which might have important roles on m6A methylation in endometriosis. The PPI network for hypomethylated-upregulated expressed mRNAs is unraveled in Figure 3C. Three mRNAs ITGB1, RAP1A and RHOA which can be considered key mRNAs are clearly shown in the network.
FIGURE 3
The PPI network for hypomethylated-downregulated expressed mRNAs is displayed in Figure 3D. To validate the hub nodes from hypomethylated-downregulated expressed mRNAs, the authors also chose the top ten mRNAs from the three topological features above and harvested that six mRNAs, BRCA1, TP53, CCNB1, CCNA2, CDK1, and UBA52 (Figure 3E). A total of 15 mRNAs were screened from the PPI network for further validation from clinical tissues (Figure 3F).
Validation of the novel hub mRNAs in other databases
To further verify the findings, the authors searched the Turku Endometriosis Database to identified the expression of the 15 hub mRNAs (Figure 4A). The 15 hub mRNAs expression trends between two groups were consistent with the authors’ results, although it was not known whether the differences were statistically significant. Moreover, the GSE5108 database was applied to explore the expression level of these hub mRNAs (Figure 4B). Among the 15 hub mRNAs, eight mRNAs were highly statistically significant. Meanwhile, ROC analysis in the GSE5108 database elucidated the diagnostic significance of the eight candidate mRNAs. Their AUC values were all higher than 0.7, and these results revealed that these seven key notes maybe have certain value for diagnosing endometriosis (Figure 4C).
FIGURE 4
Substantiation of small-molecule therapeutic drugs
With retrieving the CMAP database, abundant remarkable small-molecule agents targeting endometriosis were screened. The top five small-module agents with high correlations with endometriosis were GW-4064, homochlorcyclizine, ibuprofen, quizartinib, and VEGF-receptor-2-kinase-inhibitor-IV. The 3D structures of the above five chemicals that may be selected for potential treatment options were acquired from PubChem and were shown in (Figure 5A).
FIGURE 5
Hunting the connection between candidate gene and drug
Through the analysis of eight hub mRNAs in the STITCH database, the authors revealed VCAM1 and RAP1A play a vital role in endometriosis. Next step, they aimed to find chemical compounds acting on VCAM1 and RAP1A to observe new treatment of endometriosis. In the compound-protein interaction network, the compound guanosine which interact with VCAM1 and RAP1A were identified for subsequent analysis (Figure 5B).
Molecular docking of the hub gene and therapeutic target
Molecular docking analysis validated atorvastatin and fenofibrate to VCAM1 binding fractions of −5.7 kcal/mol and −5.4 kcal/mol, respectively, which indicated that there was a compelling binding effect between them. Atorvastatin interacts with VCAM1 mainly through the formation of hydrogen bonding and hydrophobic force. Atorvastatin formed hydrogen bonds with ARG-123, ASP-122, ASP-143, ALA-144, ILE-88, and the length of hydrogen bonds were 2.2Å, 2.1Å, 2.1Å, 2.1Å, 2.7Å, 2.5Å, respectively. Atorvastatin had hydrophobic effects with ASP-178, ILE-177, TYR-89, GLU-87 (Figure 5C). Fenofibrate interacts with VCAM1 mainly through the formation of hydrogen bonding and hydrophobic force. Fenofibrate formed hydrogen bonds with ALA-144, and the length of hydrogen bonds was 3.7Å. Fenofibrate had hydrophobic effects with ASP-122, TYR-119, PRO-120, ILE-177, ASP-178, GLU-87 (Figure 5D).
Molecular docking analysis validated guanosine to RAP1A binding fractions of −6.4 kcal/mol. Guanosine formed hydrogen bonds with PHE-23, ASN-155 and VAL-154, and the length of hydrogen bonds were 3.6Å, 2.8Å and 3.6Å, respectively. Guanosine had hydrophobic effects with GLN-22 (Figure 5E).
Expression of VCAM1 and RAP1A in clinical tissues
VCAM1 and RAP1A expression in tissues were detected by qRT-PCR assay. The analysis data showed that VCAM1 and RAP1A were over expressed in ectopic tissues than normal tissues (Figure 6).
FIGURE 6
Discussion
Endometriosis has been progressing very slowly in terms of pathogenesis and early diagnosis over the years due to its symptom-driven approach diagnosis, and treatment relying on laparoscopic examination (). Previous studies on the pathogenesis of endometriosis have mainly focused on searching for pathogenic genes, with little research on the role of RNA in gene expression (). Similarly, due to the unclear molecular mechanism of endometriosis and limited current treatment methods, the discovery of new therapeutic targets and effective drug molecules remains a focus of research. This study used arraystar m6A-mRNA epitranscriptomic microarray, biological information analysis technologies to demonstrate the existence of abnormally expressed mRNA during the disease onset process, and screened out 15 important nodes. After being validated by other databases, eight mRNA with high diagnostic value were screened out. Based on the above results, we evaluated the correlation between molecules and genes of the drugs, and also indicated that some drugs and genes have more significant effects in treating diseases.
This study presents notable innovations. Previous studies have mainly focused on m6A regulatory proteins (writers, erasers, and readers), whereas our study directly analyzed m6A methylation at the whole-transcriptome level and performed an integrated analysis of the m6A methylome and transcriptome. We identified novel hub genes and potential targeted small-molecule compounds. Furthermore, our findings were validated at multiple levels using clinical samples and several public databases.
GO enrichment and KEGG analysis indicate that abnormal methylation affects certain functions and pathways, which may provide new bioinformatics basis for explaining the complex pathogenesis of endometriosis. The validation of m6A hypermethylated and hypomethylated genes indicates that hypermethylated genes are mainly enriched in “signaling”, “protein-containing complex binding”, “regulation of response to stimulus”, and other aspects while hypomethylated genes are mainly enriched in “cellular process” and “protein binding”. KEGG analysis results confirm that hypermethylation genes are significantly enriched in signaling pathways such as cell adhesion molecules, while the hypomethylated genes were mainly linked to cell cycle and ribosome. M6A mRNA not only directly promotes the growth and proliferation of ectopic endometrium, as well as the migration, adhesion, and release of inflammatory factors through epigenetic signaling pathways, but also plays a role in the cell adhesion pathway due to its high methylation characteristics. An experiment has observed an increase in NF-κB activity and adhesion ability in ectopic endometrium (). Compared with cultured endometrial stromal cells, the expression of intercellular adhesion molecule-1 (ICAM-1) mRNA and protein in endometriosis is enhanced (). Therefore, abnormal cell adhesion is considered a key initiating factor for ectopic endometrial growth. The significant enrichment of hypermethylated m6A mRNA in pathways such as cell adhesion molecules indicates its role in the pathogenesis of endometriosis. The presence of more hypomethylation genes in ectopic endometrium indicates that hypomethylation genes play a more important role in ectopic endometrial lesions. Hypomethylation of m6A can lead to the inactivation of the AKT pathway, thereby increasing the proliferation and tumorigenicity of endometrial cancer cells (). Therefore, the similar carcinoid nature of endometriosis and endometrial cancer allows us to reasonably infer that low methylation of m6A can have the same effect on ectopic endometrial cells. In addition, the m6A hypomethylation gene is significantly associated with the Hippo signaling pathway, and activation of this pathway can enhance cell proliferation and apoptosis (). M6A hypomethylation activated PPP2R2D and YWHAZ genes may be involved in the pathogenesis of endometriosis, while PPP2R2D and YWHAZ are involved in cell proliferation and migration (). Through the above two pathways, m6A hypomethylation is enriched in the cell cycle and ribosome pathway, thereby affecting endometriosis.
After protein-protein interaction network analysis and hub gene selection, a total of 15 mRNA nodes with hypermethylated-upregulated expression, hypomethylated-upregulated expression, and hypomethylated-downregulated expression were selected from them. After applying GSE5108 database and ROC analysis, eight out of 15 key nodes showed diagnostic value. Among them, FN1 is significantly associated with the risk of endometriosis through the involvement of sex steroid hormone pathways. By mediating multiple interactions between cells and extracellular matrix, its encoded fibronectin can participate in important cellular activities such as cell adhesion, migration, growth, and differentiation, and also plays a key role in cell healing, blood coagulation, and metastasis (). Multiple studies on FN1 have found that the rs1250248 SNP at the FN1 site is significantly associated with moderate to severe endometriosis (). SICAM-1 and sVCAM-1, as glycoproteins that promote cell proliferation and neovascularization, play important roles in promoting inflammation and immune response (). Due to the interference of sICAM-1 with the function of natural killer (NK) cells, serum sICAM-1 may be associated with the active inflammatory stage of endometriosis (). The differential expression and alteration of ICAM-1 in endometriosis may be involved in the mechanism of evading immune surveillance, allowing for the diffusion of endometrial cells and invading other parts of the uterus (). A Study has found that sICAM-1 levels in patients with endometriosis are higher than those in unaffected patients, and the sVCAM-1/sICAM-1 ratio plays a role as a diagnostic tool for this disease (). The expression imbalance of ITBG1 in patients with endometriosis affects the adhesion and invasiveness of endometrial stromal cells, leading to the onset of endometriosis. The Rho family serves as molecular switches involved in the regulation of various cellular functions, including cytoskeletal organization, growth, and differentiation. In endometriosis, the RhoA content in ectopic endometrial cells is significantly higher than that in ectopic endometrial cells, which is related to promoting the migration of endometrial cells in endometriosis (). At the same time, some studies suggest that the increased expression of RhoA protein in endometrial stromal cells may be involved in the pathogenesis of endometriosis related fibrosis (). As a tumor suppressor gene involved in DNA damage repair, BRCA1’s high-risk mutations will lead to the failure of important error free DNA repair processes (homologous directed repair), significantly increasing the risk of cancer (). Similar BRCA1 gene mutations have been found in multiple studies on genomic mutations in endometriosis, endometrial cancer, or ovarian cancer (). The TP53 gene, as a representative tumor suppressor gene, plays an important role in regulating cell growth and preventing cancer (). The product of the TP53 gene, the p53 protein, usually induces cell apoptosis, cell cycle arrest, or cell aging during DNA damage, thereby inhibiting the proliferation of damaged cells, maintaining genomic integrity, and preventing tumor occurrence (). The polymorphism of the TP53 gene codon 72 is considered a risk factor for endometriosis ().
By using ROC analysis, we elucidated the diagnostic significance of candidate mRNA for endometriosis. By searching the CMAP database, we identified several small molecule drugs with significant therapeutic effects on endometriosis. These research results undoubtedly clarify the future research direction for the diagnosis and treatment of diseases. The survival and growth of ectopic endometrial lesions depend on the local estrogen (E2) produced by endometriotic implants, and aromatase is a key enzyme in estrogen biosynthesis. Estrogen mainly regulates its biological response through its two different estrogen receptors, ERa and ERb. ERb promotes the proliferation of endometriosis tissue and inhibits cell death by interacting with inflammatory body complexes and cytoplasmic apoptosis mechanisms, thereby promoting the progress of endometriosis (). Therefore, any method that reduces the expression and/or activity of aromatase and ERb may become a new treatment strategy for endometriosis. Farnesoid X receptor agonist GW4064 treatment inhibits the expression of aromatase and ERb by increasing the recruitment of FXR and Stat3 to the CYP19A1 and ESR2 promoter regions in ESCs (). Ibuprofen, as a common non steroidal anti-inflammatory drug with antipyretic and analgesic properties, has been widely used for pain relief caused by endometriosis, and its therapeutic effect on the disease has also been revealed in this study. In years of research on the pathogenesis of endometriosis, the role of angiogenesis has been demonstrated. VEGF is considered a major factor in neovascularization due to its promotion of increased vascular permeability, extracellular matrix degeneration, endothelial cell migration, proliferation, and angiogenesis. Therefore, VEGF receptor-2 kinase inhibitor IV can interfere with the occurrence and development of diseases by blocking VEGF.
Molecular docking results only provide computational evidence of potential binding interactions, rather than confirmed pharmacological activity. The binding energies of VCAM1 and RAP1A were −5 to −6 kcal/mol, indicating a moderate binding affinity. Nevertheless, moderate binding may still exert biological effects within the cellular microenvironment. These compounds are regarded as preliminary candidates and require further experimental validation. Collectively, these findings offer a rational starting point and theoretical foundation for subsequent drug screening.
Through this experimental study, we have concluded that VCAM1 and RAP1A are overexpressed in ectopic tissues compared to normal tissues. In previous studies, VCAM-1 has been reported to overexpress in the serum of patients with many types of malignant tumors, such as breast cancer, gastric cancer, ovarian cancer and melanoma (; ). In a study evaluating new biomarkers for stage III and IV endometriosis, it was found that postoperative sVCAM-1 expression decreased in patients with endometriosis, indicating that sVCAM-1 levels may be associated with the presence of ectopic endometrium (). In a study on the role and mechanism of VCAM-1 in endometriosis, it was found that VCAM-1 mRNA levels in human endometriosis tissue were increased compared to normal endometrial tissue (). These studies are consistent with our conclusion that VCAM-1 hypermethylation upregulates expression. VCAM-1/CD106 is a member of the immunoglobulin (Ig) superfamily and is believed to be an inducible cell surface glycoprotein primarily present on the endothelium. VCAM-1 plays an important role in cellular immune response, mediating the rolling and adhesion cascade reactions of circulating white blood cells towards and across the endothelium. In addition to being expressed on the cell membrane, VCAM-1 can also be cleaved into soluble form (sVCAM-1) from endothelial or other cell surfaces. The serum sVCAM-1 levels in patients with immune diseases and various malignant tumors increase (). In addition, VCAM-1 has been reported to promote and maintain the establishment of tumor vascular systems in many types of cancer by mediating tumor cell adhesion to vascular endothelial cells and promoting metastasis processes, thereby playing a role in the progression of metastasis in these tumors (). In this study, we found that RAP1A was hypomethylated and upregulated. In previous studies, RAP1A was overexpressed in many cancers (). Research has found that RAP1A and EPAC1 are highly expressed in ovarian endometriosis, and their expression is positively correlated. It is speculated that RAP1A and EPAC1 may cooperate and participate in the occurrence and development of EMs and the regulation of dysmenorrhea (). Similarly, the conclusions we obtained in this study confirm the above conclusions. RAS related proteins (RAP) GTPases are highly expressed in platelets and are key regulatory factors for cell adhesion, cytoskeletal remodeling, and MAP kinase signaling (). There are five members in mammals, including RAP1A and RAP1B, and RAP1A and RAP1B are highly homologous isomers. Research has shown that RAP gtpases, especially RAP1A and RAP1B, drive platelet activation at the site of vascular injury by switching on various platelet reactions, including internal and external activation and secretion of integrins, as well as the formation of eicosane like mediators (). They are key molecular switches that activate/adhere to platelets at the site of injury. RAP1A deficiency affects FGF2 related angiogenesis, reduces macrophage migration ability, bone marrow cell and lymphocyte chemotaxis, and also affects cell adhesion, migration, phagocytosis, and oxidative burst of white blood cells (). The above two types of mRNA affect the underlying pathogenesis of endometriosis through various pathways such as angiogenesis and cell adhesion, thereby participating in the growth and proliferation of ectopic endometrium. Therefore, these two types of mRNA are highly likely to be indispensable m6A related mRNA in endometriosis.
Nevertheless, two limitations of this study deserve further clarification. Firstly, the current study is constrained by the relatively limited number of clinical specimens. Subsequent research will employ expanded patient cohorts and conduct extensive functional assays together with rigorous validation to consolidate the present observations. Secondly, inconsistencies between hub genes identified via microarray profiling and those confirmed in public databases may mainly stem from discrepancies in analytical platforms and study designs. Our microarray investigation was based on a single-center cohort with a modest sample size and homogeneous clinical characteristics. By comparison, public repositories such as the GEO database often contain mixed samples with diverse ethnicities, distinct disease stages, and varied prior therapeutic interventions, which naturally results in divergent gene expression patterns and candidate hub genes. Variations in data preprocessing protocols and normalization strategies across different datasets may also account for such inconsistencies.
This study suggests that abnormal methylation of some mRNA may be involved in the pathogenesis of endometriosis. Understanding and discovering these abnormally methylated mRNA and their pathways of action will provide the possibility of discovering new biomarkers for endometriosis, and utilizing these research results may make significant contributions to discovering new treatment methods for endometriosis.
Conclusion
In summary, with arraystar m6A-mRNA epitranscriptomic microarray, biological information analysis technologies, and validation of other databases, aberrant m6A-related mRNAs were uncovered, as well as efficient therapeutic drugs. Ultimately, we discovered that VCAM1 and RAP1A may be essential m6A-related mRNA of EM. Importantly, we also searched for a few efficient small-molecule agents that provide new views for the treatment of EM. These results provide fresh insights into m6A methylation in EM and reveal potential biomarkers and precision medicine for EM.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/supplementary material.
Ethics statement
The studies involving humans were approved by the Ethics Committee of Harbin Medical University. The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent for participation in this study was provided by the participants’ legal guardians/next of kin.
Author contributions
YH: Funding acquisition, Writing – review and editing. CR: Data curation, Writing – original draft, Validation. LL: Validation, Writing – original draft. JL: Writing – original draft, Methodology. GZ: Investigation, Funding acquisition, Writing – review and editing.
Funding
The author(s) declared that financial support was received for this work and/or its publication. This study was supported by the Natural Science Foundation of Heilongjiang Province (JJ2023YX0413), the National Natural Science Foundation of China (82101725) and the Key R&D Plan Projects in Heilongjiang Province (GA21C008). The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.
Acknowledgments
We would like to thank all the colleagues in our research.
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Abbreviations
m6A, N6-methyladenosine; EM, Endometriosis; GO, Gene ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; BP, biological processes; CC, cellular components; MF, molecular function; PPI, Protein-protein interaction.
References
1
BanksR. E.GearingA. J.HemingwayI. K.NorfolkD. R.PerrenT. J.SelbyP. J. (1993). Circulating intercellular adhesion molecule-1 (ICAM-1), E-selectin and vascular cell adhesion molecule-1 (VCAM-1) in human malignancies. Br. J. Cancer68 (1), 122–124. 10.1038/bjc.1993.298
2
BhariV. K.KumarD.KumarS.MishraR. (2021). Shelterin complex gene: prognosis and therapeutic vulnerability in cancer. Biochem. Biophys. Rep.26, 100937. 10.1016/j.bbrep.2021.100937
3
BulunS. E.YilmazB. D.SisonC.MiyazakiK.BernardiL.LiuS.et al (2019). Endometr. Endocr. Rev.40 (4), 1048–1079. 10.1210/er.2018-00242
4
BurneyR. O.GiudiceL. C. (2012). Pathogenesis and pathophysiology of endometriosis. Fertil. Steril.98 (3), 511–519. 10.1016/j.fertnstert.2012.06.029
5
CaronE. (2003). Cellular functions of the Rap1 GTP-binding protein: a pattern emerges. J. Cell Sci.116 (Pt 3), 435–440. 10.1242/jcs.00238
6
ChenQ.ZhangX. H.MassaguéJ. (2011). Macrophage binding to receptor VCAM-1 transmits survival signals in breast cancer cells that invade the lungs. Cancer Cell20 (4), 538–549. 10.1016/j.ccr.2011.08.025
7
DingY. B.ChenG. Y.XiaJ. G.ZangX. W.YangH. Y.YangL. (2003). Association of VCAM-1 overexpression with oncogenesis, tumor angiogenesis and metastasis of gastric carcinoma. World J. Gastroenterol.9 (7), 1409–1414. 10.3748/wjg.v9.i7.1409
8
Gaia-OlteanA. I.PopL. A.CojocneanuR. M.BuseM.ZimtaA. A.KubelacP.et al (2021). The shifting landscape of genetic alterations separating endometriosis and ovarian endometrioid carcinoma. Am. J. Cancer Res.11 (4), 1754–1769.
9
GiudiceL. C.KaoL. C. (2004). Endometriosis. Lancet364, 1789–1799. 10.1016/S0140-6736(04)17403-5
10
González-RamosR.DefrèreS.DevotoL. (2012). Nuclear factor-kappaB: a main regulator of inflammation and cell survival in endometriosis pathophysiology. Fertil. Steril.98 (3), 520–528. 10.1016/j.fertnstert.2012.06.021
11
HalmeJ.HammondM. G.HulkaJ. F.RajS. G.TalbertL. M. (1984). Retrograde menstruation in healthy women and in patients with endometriosis. Obstet. Gynecol.64 (2), 151–154.
12
HanS. J.JungS. Y.WuS. P.HawkinsS. M.ParkM. J.KyoS.et al (2015). Estrogen receptor β modulates apoptosis complexes and the inflammasome to drive the pathogenesis of endometriosis. Cell163 (4), 960–974. 10.1016/j.cell.2015.10.034
13
HanX.LiuJ.ChengG.CuiS. (2020). Gene signatures and prognostic values of m6a rna methylation regulators in ovarian cancer. Cancer control.27 (1), 7–30. 10.1177/1073274820960460
14
HuangW.ChenT. Q.FangK.ZengZ. C.YeH.ChenY. Q. (2021). N6-methyladenosine methyltransferases: functions, regulation, and clinical potential. J. Hematology and Oncology14 (1), 117. 10.1186/s13045-021-01129-8
15
JiangQ. Y.XiaJ. M.DingH. G.FeiX. W.LinJ.WuR. J. (2012). RNAi-mediated blocking of ezrin reduces migration of ectopic endometrial cells in endometriosis. Mol. Hum. Reprod.18 (9), 435–441. 10.1093/molehr/gas019
16
JiangL.ZhangM.WuJ.WangS.YangX.YiM.et al (2020). Exploring diagnostic m6a regulators in endometriosis. Aging12 (24), 25916–25938. 10.18632/aging.202163
17
JonesA.LechnerM.FourkalaE. O.KristeleitR.WidschwendterM. (2010). Emerging promise of epigenetics and DNA methylation for the diagnosis and management of women’s cancers. Epigenomics2 (1), 9–38. 10.2217/epi.09.47
18
JoshiN. R.SuR. W.ChandramouliG. V.KhooS. K.JeongJ. W.YoungS. L.et al (2015). Altered expression of microRNA-451 in eutopic endometrium of baboons (Papio anubis) with endometriosis. Hum. Reprod.30 (12), 2881–2891. 10.1093/humrep/dev229
19
KernS. E.KinzlerK. W.BakerS. J.NigroJ. M.RotterV.LevineA. J.et al (1991). Mutant p53 proteins bind DNA abnormally in vitro. Oncogene6 (1), 131–136.
20
KovalakE. E.KaracanT.ZengiO.Karabay AkgülÖ.ÖzyürekŞ. E.GüraslanH. (2023). Evaluation of new biomarkers in stage III and IV endometriosis. Gynecol. Endocrinol.39 (1), 2217290. 10.1080/09513590.2023.2217290
21
KrishnamoorthyK.DecherneyA. H. (2017). Genetics of endometriosis. Clin. Obstet. Gynecol.60 (3), 531–538. 10.1097/GRF.0000000000000293
22
KuesselL.WenzlR.ProestlingK.BalendranS.PateiskyP.Yotovastet al (2017). Soluble VCAM-1/soluble ICAM-1 ratio is a promising biomarker for diagnosing endometriosis. Hum. Reprod.32 (4), 770–779. 10.1093/humrep/dex028
23
LeeY.ChoeJ.ParkO. H.KimY. K. (2020). Molecular mechanisms driving mRNA degradation by m6A modification. Trends Genetics 2020;TIG36 (3), 177–188. 10.1016/j.tig.2019.12.007
24
LiY.YanJ.DeP.ChangH. C.YamauchiA.ChristophersonK. W.et al (2007). RAP1A null mice have altered myeloid cell functions suggesting distinct roles for the closely related Rap1a and 1b proteins. J. Immunol.179 (12), 8322–8331. 10.4049/jimmunol.179.12.8322
25
LiX.XiongW.LongX.DaiX.PengY.XuY.et al (2021). Inhibition of METTL3/m6A/miR126 promotes the migration and invasion of endometrial stromal cells in endometriosis. Biol. Reproduction105 (5), 1221–1233. 10.1093/biolre/ioab152
26
LiH.WangC.LanL.YanL.LiW.EvansI.et al (2022a). Mettl3 promotes oxaliplatin resistance of gastric cancer cd133+stem cells by promoting parp1 mrna stability. Cell. Mol. Life Sci.79 (3), 135. 10.1007/s00018-022-04129-0
27
LiW. S.LiY. L.CaoR.HaC. F.SunS.YuL.et al (2022b). Differential expression and bioinformatics analysis of tRF/tiRNA in endometriosis patients. Biomed. Res. Int.2022, 9911472. 10.1155/2022/9911472
28
LiuJ.EckertM. A.HaradaB. T.LiuS. M.LuZ.YuK.et al (2018). m6A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat. Cell Biol.20 (9), 1074–1083. 10.1038/s41556-018-0174-4
29
MoynahanM. E.JasinM. (2010). Mitotic homologous recombination maintains genomic stability and suppresses tumorigenesis. Nat. Rev. Mol. Cell Biol.11 (3), 196–207. 10.1038/nrm2851
30
OosterlynckD. J.MeulemanC.WaerM.VandeputteM.KoninckxP. R. (1992). The natural killer activity of peritoneal fluid lymphocytes is decreased in women with endometriosis. Fertil. Steril.58 (2), 290–295. 10.1016/s0015-0282(16)55224-8
31
OsbornL.HessionC.TizardR.VassalloC.LuhowskyjS.Chi-RossoG.et al (1989). Direct expression cloning of vascular cell adhesion molecule 1, a cytokine-induced endothelial protein that binds to lymphocytes. Cell59 (6), 1203–1211. 10.1016/0092-8674(89)90775-7
32
RahmiogluN.NyholtD. R.MorrisA. P.MissmerS. A.MontgomeryG. W.ZondervanK. T. (2014). Genetic variants underlying risk of endometriosis: insights from meta-analysis of eight genome-wide association and replication datasets. Hum. Reprod. Update20 (5), 702–716. 10.1093/humupd/dmu015
33
RiesR. J.ZaccaraS.KleinP.Olarerin-GeorgeA.JaffreyS. R.PickeringB. F.et al (2019). M6a enhances the phase separation potential of mrna. Nature571 (7765), 424–428. 10.1038/s41586-019-1374-1
34
RoblesA. I.LinkeS. P.HarrisC. C. (2002). The p53 network in lung carcinogenesis. Oncogene21 (45), 6898–6907. 10.1038/sj.onc.1205563
35
SoikkeliJ.PodlaszP.YinM.NummelaP.JahkolaT.VirolainenS.et al (2010). Metastatic outgrowth encompasses COL-I, FN1, and POSTN up-regulation and assembly to fibrillar networks regulating cell adhesion, migration, and growth. Am. J. Pathol.177 (1), 387–403. 10.2353/ajpath.2010.090748
36
SongG. G.LeeY. H. (2014). A meta-analysis of the association between p53 codon 72 polymorphism and susceptibility to endometriosis. Immunol. Invest43 (6), 595–605. 10.3109/08820139.2013.833623
37
SongY.FuJ.ZhouM.XiaoL.FengX.ChenH.et al (2016). Activated Hippo/Yes-Associated protein pathway promotes cell proliferation and anti-apoptosis in endometrial stromal cells of endometriosis. J. Clin. Endocrinol. Metab.101 (4), 1552–1561. 10.1210/jc.2016-1120
38
StefaniniL.BoulaftaliY.OuelletteT. D.HolinstatM.DésiréL.LeblondB.et al (2012). Rap1-Rac1 circuits potentiate platelet activation. Arterioscler. Thromb. Vasc. Biol.32 (2), 434–441. 10.1161/ATVBAHA.111.239194
39
ViganòP.GaffuriB.SomiglianaE.BusaccaM.Di BlasioA. M.VignaliM. (1998a). Expression of intercellular adhesion molecule (ICAM)-1 mRNA and protein is enhanced in endometriosis endometrial stromal cells in culture. Mol. Hum. Reprod.4 (12), 1150–1156. 10.1093/moehr/4.12.1150
40
ViganòP.GaffuriB.SomiglianaE.BusaccaM.Di BlasioA. M.VignaliM. (1998b). Expression of intercellular adhesion molecule (ICAM)-1 mRNA and protein is enhanced in endometriosis versus endometrial stromal cells in culture. Mol. Hum. Reprod.4 (12), 1150–1156. 10.1093/molehr/4.12.1150
41
VodolazkaiaA.El-AalamatY.PopovicD.MihalyiA.BossuytX.KyamaC. M.et al (2012). Evaluation of a panel of 28 biomarkers for the non-invasive diagnosis of endometriosis. Hum. Reprod.27 (9), 2698–2711. 10.1093/humrep/des234
42
WangY.NicholesK.ShihI. M. (2020). The origin and pathogenesis of endometriosis. Annu. Rev. Pathol.15, 71–95. 10.1146/annurev-pathmechdis-012419-032654
43
WuP. L.ZengC.ZhouY. F.YinL.YuX. L.XueQ. (2019). Farnesoid X receptor agonist GW4064 inhibits Aromatase and ERβ expression in human endometriotic stromal cells. Reprod. Sci.26 (8), 1111–1120. 10.1177/1933719118808912
44
YangY.HsuP. J.ChenY. S.YangY. G. (2018). Dynamic transcriptomic m6A decoration: writers, erasers, readers and functions in RNA metabolism. Cell Research28 (6), 616–624. 10.1038/s41422-018-0040-8
45
YotovaI. Y.QuanP.LeditznigN.BeerU.WenzlR.TschugguelW. (2011). Abnormal activation of Ras/Raf/MAPK and RhoA/ROCKII signalling pathways in eutopic endometrial stromal cells of patients with endometriosis. Hum. Reprod.26 (4), 885–897. 10.1093/humrep/der010
46
ZhangJ.LiH.YiD.LaiC.WangH.ZouW.et al (2019). Knockdown of vascular cell adhesion molecule 1 impedes transforming growth factor beta 1-mediated proliferation, migration, and invasion of endometriotic cyst stromal cells. Reprod. Biol. Endocrinol.17 (1), 69. 10.1186/s12958-019-0512-9
47
ZhaoY.ShiY.ShenH.XieW. (2020). m6A-binding proteins: the emerging crucial performers in epigenetics. J. Hematology and Oncology13 (1), 35. 10.1186/s13045-020-00872-8
Summary
Keywords
endometriosis, m6A-related mRNAs, RAP1A, therapeutic drugs, VCAM1
Citation
He Y, Ren C, Lei L, Li J and Zhang G (2026) Identification and exploration of potential N6-methylation related mRNAs in endometriosis. Front. Genet. 17:1790963. doi: 10.3389/fgene.2026.1790963
Received
19 January 2026
Revised
17 March 2026
Accepted
17 March 2026
Published
07 May 2026
Volume
17 - 2026
Edited by
Elena Criscuolo, Vita-Salute San Raffaele University, Italy
Reviewed by
Royana Singh, Banaras Hindu University, India
Widjiati Widjiati, Airlangga University, Indonesia
Updates
Copyright
© 2026 He, Ren, Lei, Li and Zhang.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Guangmei Zhang,
[email protected]
†These authors have contributed equally to this work
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.