Salviaflaside in water-soluble fraction of heated water extracted from defatted perilla frutescens Britton var. Japonica Hara seed residue suppresses osteoclast differentiation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Salviaflaside in water-soluble fraction of heated water extracted from defatted perilla frutescens Britton var. Japonica Hara seed residue suppresses osteoclast differentiation Hiroyuki Asano, Sogo Nishimoto This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7296078/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Oct, 2025 Read the published version in Cytotechnology → Version 1 posted 9 You are reading this latest preprint version Abstract Polyphenols have physiological effects such as antioxidants and anti-inflammatory effects and have been reported to osteoporosis and inflammatory diseases. Rosmarinic acid is a natural polyphenol contained in Lamiaceae herbs, such as Perilla frutescens, sage and sweet basil. Salviaflaside is a glycosidized compound of rosmarinic acid. It was one of the major components of the defatted Perilla frulescens Britton var. Japonica Hara (egoma) seed residue extract. In this study, we investigated the anti-osteoporotic effects of the water-soluble layer fraction of egoma residue heated water extract (DPH-W) and Salviaflaside on bone marrow-derived macrophages (BMMs). DPH-W reduced the number of tartrate-resistant acid phosphatase (TRAP) positive osteoclasts in BMM treated with receptor-activated nuclear factor kappa B ligand (RANKL). The mRNA expression levels of NFATc1 and CTSK, which are responsible for osteoclast differentiation and bone resorption were suppressed. Salviaflaside decreased TRAP activity and suppressed the expression of osteoclast differentiation-related genes. Our findings indicate that egoma seed residue and Salviaflaside may have potential as a useful therapeutic or prophylactic agent for the suppression of bone loss. RANKL Osteoclast Bone Polyphenol Salviaflaside Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Bone metabolism is maintained by the balance between bone formation and resorption. Their balance plays an important role in bone health. Bone formation is carried out by osteoblasts while bone resorption is the activity of osteoclasts. Bone remodeling processes are influenced by a variety of factors, including age, nutritional status, exercise habits, and genetic factors (Heaney et al. 2000 ; Feng et al. 2011). Osteoclasts are multinucleated giant cells that differentiate from monocyte-macrophage precursor cells, and their ability is to resorb mineralized tissues (Udagawa et al. 1990 ). This process is tightly regulated by M-CSF (Macrophage colony-stimulating factor) and RANKL (Wada et al. 2006 ). RANKL promotes osteoclast differentiation and activation by binding to RANK receptors on the surface of osteoclast precursor cells while M-CSF supports osteoclast survival and proliferation (Wada et al. 2006 ; Hodge et al. 2007 ). Mature osteoclasts adhere to the bone surface and create an acidic environment. They secrete proteases (such as cathepsin K) to degrade inorganic components of bone and collagen. (Sundaram et al. 2007 ). Regulation of osteoclast differentiation and activity is the most important factor in reducing age-related bone loss. Egoma is an annual herb of the Perilla family cultivated mainly in Asia. Egoma oil contains α-linolenic acid (ALA), an omega-3 fatty acid and is widely used for food. (Asif. 2011; Kim et al. 2016 ). Egoma is rich in antioxidants which help reduce oxidative stress (Masuda et al. 2018 ). It is also important in bone metabolism and reduction of oxidative stress may contribute to the maintenance of healthy bone cells. It has been suggested that egoma oil or leaf extracts may contribute to the promotion of bone formation and the inhibition of bone resorption (Phromnoi et al. 2022 ; Matsuzaki et al. 2023 ). The mechanism by egoma oil and egoma extracts inhibit osteoclast differentiation requires further study, but existing data suggest its osteoprotective effects. The egoma residue obtained after oil extraction from egoma seeds also has a variety of uses. The oil and fat content are reduced, but it contains abundant fiber, protein, vitamins, and minerals (Gaihre et al. 2022 ). This suggests that the egoma residue may also have high health value and improved bone metabolism. In this study, we investigated the effects of the water-soluble layer fraction obtained by liquid-liquid partitioning of defatted egoma seed residue extract on osteoclast differentiation. We also examined the inhibition of osteoclast differentiation by Salviaflaside in the water-soluble fraction. Materials and methods Reagents Dulbecco’s Modified Eagle Medium (DMEM), RANKL, M-CSF, penicillin/streptomycin (P/S), Acetonitrile and Acetic acid were obtained from Wako Pure Chemical Inc (Osaka, Japan). Heat-inactivated fetal bovine serum (FBS), p-nitrophenyl phosphate (pNPP) were purchased from Sigma Aldrich (Tokyo, Japan). PCR primers were obtained from Greiner Bio-One (Tokyo, Japan). Salviaflaside reference Standard were purchased from ALB Material Inc (USA). All the chemicals used in the experiments of analytical grade or complied with the level required for cell culture. Preparation for DPH-W Defatted egoma seed residue was purchased from the Japan Egoma Association (Gunma, Japan). The residue was powdered with a milling machine and then extracted with hot water for 30 minutes. The filtration was lyophilized and used as a hot water extract of defatted egoma seed residue: DPH. Liquid-liquid partitioning was performed to obtain three fractionated samples from DPH powder: ethyl acetate layer fraction (DPH-EA), butanol layer fraction (DPH-Bu), and water layer fraction (DPH-W). HPLC Analysis The HPLC system used a binary pump and UV detector (Hitachi Primaide 1110 Pump and 1410 UV detector, Tokyo, Japan). DPH-W analysis was performed on a 10 µL sample injected into an InertSil HPLC Column HILIC (GL science inc, Tokyo, Japan) analytical column (4.6 x 250 mm, 5 µm). The mobile phase was a gradient of solvent A (milliQ-water) and solvent B (acetonitrile). The gradient flow program was 0 min: 5% A, 95% B; 5 min: 5% A, 95% B; 15 min: 40% A, 60% B; 25 min: 50% A, 50% B; 1.0 mL/min flow rate, Elution was monitored at 220 nm. Salviaflaside (1 ng/mL) was used as a standard compound. Animals ddY female mice were obtained from Japan SLC Inc (Shizuoka, Japan). Mice were housed at the animal housing facility of Ishikawa Prefectural University at 24 ± 1 ℃, 50 ± 2% humidity, and a 12-hour light/dark cycle, with free access to feed and water. Animal studies were conducted in accordance with protocols and guidelines approved by the University of Ishikawa Animal Care and Use Committee. Cultures of bone marrow cells Bone marrow cells were obtained from the tibia and femur of ddY female mice. Bone marrow cells were added to 10% FBS supplemented D-MEM containing 20 ng/ml M-CSF and cultured for 3 days, and the adherent cells were used as Bone marrow macrophages (BMM) in subsequent experiments. BMM were cultured with M-CSF (20 ng/mL) and RANKL (20 ng/mL) for 4–7 days to induce osteoclasts. Viability assay The cytotoxicity by the specimen was measured using the WST-8 assay (Cell Counting Kit-8, Dojindo, Tokyo, Japan) for cellular nicotinamide adenine dinucleotide-dependent succinate dehydrogenase activity, which is proportional to cell metabolic activity or survival. After incubation, cells were treated with WST-8 Solution for 3 hours and absorbance was measured at 450 nm using a Varioskan LUX multimode microplate reader (Thermo Fisher Scientific Inc, Osaka, Japan). TRAP staining assay After 7 days of incubation from the addition of RANKL, osteoclasts specific TRAP staining was performed using a TRAP/ALP stain kit as per the manufacturer’s directions (Wako Pure Chemical Inc, Osaka, Japan). TRAP-positive multinucleated cells with three or more nuclei were observed under a microscope. TRAP activity assay After 4 days of incubation from the addition of RANKL, Cells were treated with 1% Triton-X100. p-nitrophenyl phosphate (pNPP) was used as substrate and treated with buffer solution (pH 5.9) containing 100 mM sodium acetate and 50 mM sodium tartrate and incubated at 37 ℃ for 30 minutes. The reaction was stopped by adding 0.5 N NaOH. Absorbance was read at 405 nm. qRT-PCR Total RNA was extracted from cultured cells using ISOGEN II (NipponGene, Tokyo, Japan). First-strand complementary DNA was reverse transcribed from total RNA (1 µg) using ReverTra Ace® (Toyobo, Osaka, Japan) according to the manufacturer's protocol. Real-time PCR (qRT-PCR) was performed using the CFX96 TM Real-Time System (Thermo Fisher Scientific Inc, Osaka, Japan) and THUNDER BIRD NEXT qPCR Mix (Toyobo, Osaka, Japan). Gene expression levels were normalized against GAPDH. PCR primer sequences are listed in Table 1 . Data were analyzed using the 2 −⊿⊿CT method. Table 1 Primer sequences used for reverse transcription quantitative PCR. Target gene Forward primer(5’-3’) Reverse primer(5’-3’) GAPDH ctacactgaggaccaggttgtct gtcataccaggaaatgagcttgac NFATc1 aacgccctgaccaccgatag gggaagtcagaagtgggtgga CTSK caccagaagcagtataacagcaag catatgtatggacaccaagagagg DC-STAMP gtcatgtgctactcctgttcactc aggtttcagagaggtaagactcca MMP-9 atgtacccgctgtatagctacctc gaggtatagtgggacacatagtgg TRAP tacctgtgtggacatgacc cagatccatagtgaaaccgc Statistical analysis All data are expressed as means ± SEM over at least three experiments. Statistical significance was assessed against controls by one-way ANOVA and Dunnett's multiple comparison test. P -values < 0.05 were considered significant. Results Component analysis of DPH-W The compounds of DPH-W were analyzed using HILIC columns and HPLC-UV systems to characterize their chemical composition. One of the major components was identified as Salviaflaside based on its retention time and UV absorption spectrum, which were consistent with those of the standard compounds (Fig. 1 b-c). In addition, rosmarinic acid was detected in the DPH-EA and DPH-Bu fractions, as confirmed by comparison with reference compounds and previous reports (Data not shown). These findings suggest that different extraction fractions contain distinct bioactive compounds, which may contribute to their varying biological activities. Rosmarinic acid has been previously reported to exhibit beneficial effects on bone metabolism. However, the physiological effects of its glycosylated derivative, Salviaflaside on bone metabolism remain unclear. Effects of DPH-W and Salviaflaside on cell viability The CCK-8 assay was used to evaluate the cytotoxicity of DPH-W and Salviaflaside on BMM. There was no significant difference in cell viability (Fig. 2 a-b). However, a decreasing trend in cell viability was observed at 200 µM for Salviaflaside ( p < 0.069), so concentrations below 100 µM were used in experiments. Notably, cell viability remained above 90% at concentration of 50 and 100 µM, suggesting minimal cytotoxic effects in this range. These results indicate that salviaflaside is relatively safe at low concentration but may exhibit cytotoxic effects at higher doses. Therefore, 100 µM was selected as the upper limit for further experiments to avoid potential confounding effects due to cytotoxicity. DPH-W inhibits osteoclast differentiation The inhibitory effects of DPH-W on osteoclast differentiation were examined. Osteoclast differentiation was estimated by TRAP-positive multinucleated cell formation in BMM upon the addition of RANKL. The number of TRAP-positive multinucleated osteoclasts formed was evaluated by TRAP staining, and compared to RANKL treatment alone, BMM stimulated with DPH-W showed a significant reduction in osteoclast formation (Fig. 3 a). With the addition of DPH-W at 1, 10, and 100 µg/mL, osteoclast formation and growth were strongly inhibited in a dose-dependent manner. Importantly, at 100 µg/mL, osteoclastogenesis was almost completely suppressed, with only a few TRAP-positive cells observed. These results suggest that DPH-W exerts potent anti-osteoclastogenic effects, potentially by interfering with RANKL-mediated signaling pathways. TRAP activity The effects of DPH-W and Salviaflaside on TRAP activity in RANKL-induced BMM were evaluated. DPH-W significantly reduced TRAP activity compared to the RANKL-treated alone (Fig. 3 b-c). Specifically, the addition of DPH-W reduced TRAP activity to 68 ± 8.6% at 10 µg/mL and further to 41 ± 10% at 100 µg/mL. Similarly, Salviaflaside strongly inhibited TRAP activity in a dose-dependent manner without exhibiting cytotoxic effects. At 25 µM, 50 µM, and 100 µM, TRAP activity decreased to 68 ± 5.3%, 64 ± 1.1% and 54 ± 4.4% respectively with the values corresponding to each concentration. These results indicate that both DPH-W and Salviaflaside effectively inhibited osteoclast differentiation by reducing TRAP activity. Salviaflaside, one of the major compounds found in DPH-W, is likely responsible for the observed inhibitory effects on TRAP activity. This suggests that the bioactive effects of DPH-W in inhibiting osteoclast differentiation may be attributed, at least in part to Salviaflaside. The concentration-dependent inhibition observed with both compounds suggests that their effects may be mediated through modulation of key signaling pathways involved in osteoclastogenesis, such as the RANK/RANKL signaling. Moreover, the absence of cytotoxicity at effective concentrations suggests their potential as therapeutic agents for conditions involving excessive osteoclast activity, such as osteoporosis and rheumatoid arthritis. DPH-W and Salviaflaside suppresses osteoclast differentiation and functional genes The expression levels of genes involved in osteoclast differentiation and function were evaluated. DPH-W showed inhibition of expression of NFATc1, a master regulator of osteoclast differentiation, compared to RANKL-only treated cells (Fig. 4 a). The mRNA levels of its downstream marker genes TRAP, CTSK, MMP-9, and DC-STAMP were also significantly reduced by 100 µg/mL DPH-W treatment (Fig. 4 b-e). Notably, Salviaflaside also dramatically suppressed NFATc1 expression (Fig. 5 a). Given that both DPH-W and Salviaflaside exhibited strong inhibitory effects on osteoclast-related gene expression, it is likely that Salviaflaside contributes, at least in part to the osteoclast-suppressive activity of DPH-W. Furthermore, Salviaflaside significantly downregulated the expression of TRAP, CTSK, MMP-9, and DC-STAMP like DPH-W, suggesting its potential role as a key bioactive compound responsible for these effects (Fig. 5 b-e). These findings show the potential of both DPH-W and Salviaflaside as effective inhibitors of osteoclastogenesis through NFATc1 suppression and subsequent downregulation of osteoclast-associated genes. Discussion Osteoporosis is caused by the predominance of bone resorption by osteoclasts that dissolve bone matrix (Feng et al. 2011). Osteoclasts are the only bone-resorbing cells in vivo , Osteoclast-targeted therapies are a useful approach to maintaining normal bone metabolism. Egoma ( perilla frutescens Britton var. Japonica Hara ) seeds are rich in fatty acids such as α-linolenic acid, linoleic acid, and oleic acid (Kim et al. 2016 ). These fatty acids have been shown to contribute to anti-inflammatory and antioxidant effects (Deng et al. 2023 ; Ion et al. 2011 ). α-linolenic acid is expected to improve bone metabolism through suppressing the production of inflammatory cytokines that promote bone resorption (Song et al. 2017 ). Egoma contains polyphenols such as rosmarinic acid and luteolin, which have been implicated in reducing oxidative stress (Vo et al. 2023 ; Mahwish et al. 2025 ). In this study, we investigated the effects of improving bone metabolism in an extract of the egoma residue which is then discarded. Component analysis was performed on the ethyl acetate fraction, the butanol fraction, and the water-soluble layer fraction obtained by liquid-liquid partitioning of the heated water extract of the egoma residue. The major component of the ethyl acetate and butanol layer fraction was rosmarinic acid. The water-soluble layer fraction contained Salviaflaside, a glycoside of rosmarinic acid. Rosmarinic acid is a natural compound that has been shown to inhibit osteoclast differentiation (Omori et al. 2015 ; Li et al. 2022 ). However, the results of pharmacological studies on Salviaflaside are largely unknown. The water-soluble layer fraction of egoma seed residue (DPH-W) and its major component, Salviaflaside were each examined for their ability to improve bone metabolism. DPH-W inhibited the formation of TRAP-positive multinucleated giant cells derived from BMM and TRAP enzyme activity without cytotoxicity. DPH-W and Salviaflaside attenuated BMM-derived osteoclast formation by inhibiting the expression of the transcription factor NFATc1. Monocytes and macrophages in the bone marrow differentiate into osteoclasts upon stimulation with M-CSF or RANKL. (Nakashima et al. 2011). TRAP is highly expressed during osteoclast differentiation and promotes osteoclast migration and bone resorption (Suzumoto et al. 2005 ). NFATc1 is a master regulator of osteoclastogenesis and is responsible for regulating the expression of osteoclast-specific genes (Shinohara et al. 2007). This study showed that Salviaflaside improved bone metabolism by inhibiting bone resorption. We intend to compare the activity of rosmarinic acid and Salviaflaside, and to study the effects of their simultaneous action in the future. We have also shown that all three fractions of egoma residue promote the enzymatic activity of ALP produced by osteoblasts (data not shown). Rosmarinic acid has been reported to not only inhibit bone resorption by osteoclasts, but also to improve bone formation by promoting cell proliferation of osteoblasts (Lee et al. 2015 ). The effect of Salviaflaside on bone formation should also be investigated. These findings suggest that rosmarinic acid and Salviaflaside from egoma residue regulate bone metabolism by promoting osteoblast differentiation and suppressing osteoclast formation. In conclusion, DPH-W suppresses osteoclastogenesis by inhibiting the expression of NFATc1 and thus acts to inhibit bone resorption. And its active compounds, rosmarinic acid and Salviaflaside, contributed to the inhibition of bone resorption. These findings suggest that Salviaflaside may lead to the development of useful tools for the prevention and treatment of osteoporosis. Declarations The authors declare that they have no competing interests. Part of this study was funded by the Graduate Student Success Project (Daigakuin Katsuyaku Project) of Ishikawa Prefectural University, Japan. All animal procedures were performed in accordance with institutional guidelines and were approved by the Animal Care Committee of Ishikawa Prefectural University (Approval No. R4-14-8). A.H. designed and performed the experiments, analyzed the data, and wrote the manuscript. N.S. supervised the project and contributed to the review and editing of the manuscript. Both authors read and approved the final version of the manuscript. Author Contribution H.A. designed and performed the experiments, analyzed the data, and wrote the manuscript. N.S. supervised the study and reviewed the manuscript. All authors reviewed and approved the final version of the manuscript. Acknowledgement We gratefully acknowledge the support from the Graduate Student Success Project at Ishikawa Prefectural University. References Asif M (2011) Health effects of omega-3,6,9 fatty acids: Perilla frutescens is a good example of plant oils. Orient. Pharm. Exp. Med . 11:51–59. Deng Y, Li W, Zhang Y, Li J, He F, Dong K, Hong Z, Luo R, Pei X (2023) α-Linolenic Acid Inhibits RANKL-Induced Osteoclastogenesis In Vitro and Prevents Inflammation In Vivo . Foods . 12(3):682. Feng X, McDonald JM (2011) Disorders of bone remodeling. Annu Rev Pathol . 6:121–45. Gaihre YR, Iwamoto A, Oogai S, Hamajima H, Tsuge K, Nagata Y, Yanagita T (2022) Perilla pomace obtained from four different varieties have different levels and types of polyphenols and anti-allergic activity. Cytotechnology. 74(2):341–349. Heaney RP, Abrams S, Dawson-Hughes B, Looker A, Marcus R, Matkovic V, Weaver C (2000) Peak Bone Mass. Osteoporos Int . 11(12):985–1009. Hodge JM, Kirkland MA, Nicholson GC (2007) Multiple roles of M-CSF in human osteoclastogenesis. J Cell Biochem . 102(3):759–768. Ion G, Fazio K, Akinsete JA, Hardman WE (2011) Effects of canola and corn oil mimetic on Jurkat cells. Lipids Health Dis . 10:90. Kim HU, Lee KR, Shim D, Lee JH, Chen GQ, Hwang S (2016) Transcriptome analysis and identification of genes associated with ω-3 fatty acid biosynthesis in Perilla frutescens (L.) var. frutescens . BMC Genomics . 17:474. Lee JW, Asai M, Jeon SK, Iimura T, Yonezawa T, Cha BY, Woo JT, Yamaguchi A (2015) Rosmarinic acid exerts an antiosteoporotic effect in the RANKL-induced mouse model of bone loss by promotion of osteoblastic differentiation and inhibition of osteoclastic differentiation. Mol Nutr Food Res . 59(3):386–400. Li Q, Tao X, Zhang Y (2022) Rosmarinic acid alleviates diabetic osteoporosis by suppressing the activation of NLRP3 inflammasome in rats. Physiol Int . 109(1):46–57. Mahwish, Imran M, Naeem H, Hussain M, Alsagaby SA, Abdulmonem WA, Mujtaba A, Abdelgawad MA, Ghoneim MM, Ei-ghorab AH, Selim S, Jaouni SKA, Mostafa EM, Yehuala TF (2025) Antioxidative and Anticancer Potential of Luteolin: A Comprehensive Approach Against Wide Range of Human Malignancies. Food Sci Nutr. 13(1):e4682. Masuda A, Hidaka K, Hoda S, Taniguchi A, Doi S, Masuda T (2018) Radical Scavenging Properties of Roasted Egoma ( Perilla frutescens var. frutescens ) Oils and Identification of Their Characteristic Scavengers. J Nutr Sci Vitaminol . 64(6):466–472. Matsuzaki K, Hossain S, Wakatsuki H, Tanabe Y, Ohno M, Kato S, Shido O, Hashimoto M (2023) Perilla seed oil improves bone health by inhibiting bone resorption in healthy Japanese adults: A 12-month, randomized, double-blind, placebo-controlled trial. Phytother Res . 37(6):2230–2241. Nakashima T, Takayanagi H (2011) New regulation mechanisms of osteoclast differentiation. Ann NY Acad Sci. 1240:E13-8. Omori A, Yoshimura Y, Deyama Y, Suzuki K (2015) Rosmarinic acid and arbutin suppress osteoclast differentiation by inhibiting superoxide and NFATc1 downregulation in RAW 264.7 cells. Biomed Rep . 3(4):483–490. Phromnoi K, Yodkeeree S, Pintha K, Mapoung S, Suttajit M, Saenjum C, Dejkriengkraikul (2022) Anti-Osteoporosis Effect of Perilla frutescens Leaf Hexane Fraction through Regulating Osteoclast and Osteoblast Differentiation. Molecules. 27(3):824. Shinohara M, Takayanagi H (2007) Novel osteoclast signaling mechanisms. Curr Osteoporos Rep . 5(2):67–72. Song J, Jing Z, Hu W, Yu J, Cui X (2017) α-Linolenic Acid Inhibits Receptor Activator of NF-κB Ligand Induced (RANKL-Induced) Osteoclastogenesis and Prevents Inflammatory Bone Loss via Downregulation of Nuclear Factor-KappaB-Inducible Nitric Oxide Synthases (NF-κB-iNOS) Signaling Pathways. Med Sci Monit . 23:5056–5069. Sundaram K, Nishimura R, Senn J, Youssef RF, London SD, Reddy SV (2007) RANK ligand signaling modulates the matrix metalloproteinase-9 gene expression during osteoclast differentiation. Exp Cell Res 313:168–178. Suzumoto R, Takami M, Sasaki T (2005) Differentiation and function of osteoclasts cultured on bone and cartilage. J Electron Microsc (Tokyo) 54(6):529–40. Udagawa N, Takahashi N, Akatsu T, Tanaka H, Sasaki T, Nishihara T, Koga T, Martin TJ, Suda T (1990) Origin of osteoclasts: mature monocytes and macrophages are capable of differentiating into osteoclasts under a suitable microenvironment prepared by bone marrow-derived stromal cells. Proc Natl Acad Sci USA 87:7260–7264. Vo QV, Hoa NT, Flavel M, Thong NM, Boulebd H, Nam PC, Quang DT, Mechler A (2023) A Comprehensive Study of the Radical Scavenging Activity of Rosmarinic Acid. J Org Chem. 88(24):17237–17248. Wada T, Nakashima T, Hiroshi N, Penninger JM (2006) RANKL-RANK signaling in osteoclastogenesis and bone disease. Trends Mol Med 12:17–25. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 01 Oct, 2025 Read the published version in Cytotechnology → Version 1 posted Editorial decision: Revision requested 29 Aug, 2025 Reviews received at journal 27 Aug, 2025 Reviews received at journal 22 Aug, 2025 Reviewers agreed at journal 17 Aug, 2025 Reviewers agreed at journal 14 Aug, 2025 Reviewers invited by journal 13 Aug, 2025 Editor assigned by journal 07 Aug, 2025 Submission checks completed at journal 07 Aug, 2025 First submitted to journal 05 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7296078","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":501420016,"identity":"255541d2-b2a7-4275-8ab5-64fbefd3a1da","order_by":0,"name":"Hiroyuki Asano","email":"","orcid":"","institution":"Ishikawa Prefectural University","correspondingAuthor":false,"prefix":"","firstName":"Hiroyuki","middleName":"","lastName":"Asano","suffix":""},{"id":501420017,"identity":"8b44beff-e1d4-48aa-8177-96d716f7b0d0","order_by":1,"name":"Sogo Nishimoto","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA80lEQVRIiWNgGAWjYDACZiD+YMCQwMaDLCpBQAvjDNK0gHQBVScw8BBQBQfm7OyPP9sU1OXx8Rx+JvGD4U5iA/vhBwyWO3BrsWzmMZPOMThczMbbZibZw/AssYEnzYBB8gxuLQaHediYcwwOJLbxM5jd4P13OLGBIYeBQbINnxagwywM6oBa2L/d/MMA1ML/hpAWBgNpBgPmxDbeHrPbPCAtEgRt4QF6weBwYhvPmfLfMgzPjNsknhkcwOuX88cff/jxpy5xfk/6ZsM3DHdk+/mTHz6WxBNi6OAAAxuQPCzZQIoWEGD8SIKWUTAKRsEoGPYAABSBTPo8owJqAAAAAElFTkSuQmCC","orcid":"","institution":"Ishikawa Prefectural University","correspondingAuthor":true,"prefix":"","firstName":"Sogo","middleName":"","lastName":"Nishimoto","suffix":""}],"badges":[],"createdAt":"2025-08-05 04:23:04","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7296078/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7296078/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10616-025-00847-y","type":"published","date":"2025-10-01T15:57:03+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":89580734,"identity":"46bf9451-b035-4f75-9426-59b03e4ad374","added_by":"auto","created_at":"2025-08-21 14:02:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":38449,"visible":true,"origin":"","legend":"\u003cp\u003eComponents analysis of DPH-W\u003c/p\u003e\n\u003cp\u003e(a) Molecular structure of Salviaflaside. (b) Chromatogram results for DPH-W. (c) Chromatogram results for a Salviaflaside.\u003c/p\u003e","description":"","filename":"AsanoCytotechnologymanuscript1.png","url":"https://assets-eu.researchsquare.com/files/rs-7296078/v1/20b556411b3020cd5ce83af3.png"},{"id":89580732,"identity":"385845d3-881d-4946-b496-598c975ed957","added_by":"auto","created_at":"2025-08-21 14:02:05","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":51568,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of DPH-W and Salviaflaside on Cell Viability\u003c/p\u003e\n\u003cp\u003e(a) Effect of DPH-W treatment on survival of BMM. Cell viability was measured by absorbance at 450 nm. Each data is mean ± SE, n = 3.\u003c/p\u003e","description":"","filename":"AsanoCytotechnologymanuscript2.png","url":"https://assets-eu.researchsquare.com/files/rs-7296078/v1/167207fe39cbcbe90d3f87ae.png"},{"id":89580487,"identity":"c9cfc724-d919-4b96-b5ba-6425c64e1ca8","added_by":"auto","created_at":"2025-08-21 13:54:02","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1190033,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of DPH-W and Salviaflaside treatment on osteoclast differentiation.\u003c/p\u003e\n\u003cp\u003eEffect of DPH-W and Salviaflaside treatment on differentiation into osteoclasts by TRAP staining and activity. (a) BMM was treated with RANKL and DPH-W for 7 days and TRAP+ stained osteoclasts were photographed. Scale bar 200 nm. (b-c) BMM was treated with RANKL and DPH-W or Salviaflaside for 4 days and TRAP activity was measured. Controls were RANKL (+) with only RANKL and RANKL (-) without RANKL and without induction of osteoclast differentiation. Each data is mean ± SE, n = 4. Compared with *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001 vs RANKL(+) by Dunnett test.\u003c/p\u003e","description":"","filename":"AsanoCytotechnologymanuscript3.png","url":"https://assets-eu.researchsquare.com/files/rs-7296078/v1/95b2036bdb70e21bea0b9c4f.png"},{"id":89580737,"identity":"9127597d-64c4-4092-8ef7-b3292231c06e","added_by":"auto","created_at":"2025-08-21 14:02:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":156613,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of DPH-W treatment on osteoclast differentiation-related gene expression\u003c/p\u003e\n\u003cp\u003eEffect of DPH-W on mRNA expression of osteoclast differentiation-related genes NFATc1 (a), TRAP (b), DC-STAMP(c), MMP-9 (d) and CTSK(e) by real-time PCR. Bone marrow cells were cultured in M-CSF-containing medium for 3 days, and then cultured with M-CSF, RANKL, and DPH-W for 2 to 4 days to induce osteoclast differentiation. As controls, RANKL (+) with only RANKL and RANKL (-) without RANKL and without osteoclast differentiation induction were prepared. Each data is mean ± SE, n = 3. Compared with *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 vs RANKL(+) by Dunnett test.\u003c/p\u003e","description":"","filename":"AsanoCytotechnologymanuscript4.png","url":"https://assets-eu.researchsquare.com/files/rs-7296078/v1/93f8937aa22f04e19be1d31b.png"},{"id":89580532,"identity":"11272981-7397-4232-bf24-34bc3fb1e9d8","added_by":"auto","created_at":"2025-08-21 13:54:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":184082,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of Salviaflaside treatment on osteoclast differentiation-related gene expression\u003c/p\u003e\n\u003cp\u003eEffect of Salviaflaside on mRNA expression of osteoclast differentiation-related genes NFATc1 (a), TRAP (b), DC-STAMP(c), MMP-9 (d) and CTSK(e) by real-time PCR. Bone marrow cells were cultured in M-CSF-containing medium for 3 days, and then cultured with M-CSF, RANKL and Salviaflaside for 2 to 4 days to induce osteoclast differentiation. As controls, RANKL (+) with only RANKL and RANKL (-) without RANKL and without osteoclast differentiation induction were prepared. Each data is mean ± SE, n = 3. Compared with *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 vs RANKL(+) by Dunnett test.\u003c/p\u003e","description":"","filename":"AsanoCytotechnologymanuscript5.png","url":"https://assets-eu.researchsquare.com/files/rs-7296078/v1/01c1aa202694225be8a2528e.png"},{"id":92884650,"identity":"6d278640-94a2-439c-9785-9b28b23ccf6a","added_by":"auto","created_at":"2025-10-06 16:13:47","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2003049,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7296078/v1/d5e68395-53ef-47f5-8fee-e070ec4e60b8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Salviaflaside in water-soluble fraction of heated water extracted from defatted perilla frutescens Britton var. Japonica Hara seed residue suppresses osteoclast differentiation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBone metabolism is maintained by the balance between bone formation and resorption. Their balance plays an important role in bone health. Bone formation is carried out by osteoblasts while bone resorption is the activity of osteoclasts. Bone remodeling processes are influenced by a variety of factors, including age, nutritional status, exercise habits, and genetic factors (Heaney et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Feng et al. 2011). Osteoclasts are multinucleated giant cells that differentiate from monocyte-macrophage precursor cells, and their ability is to resorb mineralized tissues (Udagawa et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1990\u003c/span\u003e). This process is tightly regulated by M-CSF (Macrophage colony-stimulating factor) and RANKL (Wada et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). RANKL promotes osteoclast differentiation and activation by binding to RANK receptors on the surface of osteoclast precursor cells while M-CSF supports osteoclast survival and proliferation (Wada et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Hodge et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Mature osteoclasts adhere to the bone surface and create an acidic environment. They secrete proteases (such as cathepsin K) to degrade inorganic components of bone and collagen. (Sundaram et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Regulation of osteoclast differentiation and activity is the most important factor in reducing age-related bone loss.\u003c/p\u003e\u003cp\u003eEgoma is an annual herb of the Perilla family cultivated mainly in Asia. Egoma oil contains α-linolenic acid (ALA), an omega-3 fatty acid and is widely used for food. (Asif. 2011; Kim et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Egoma is rich in antioxidants which help reduce oxidative stress (Masuda et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). It is also important in bone metabolism and reduction of oxidative stress may contribute to the maintenance of healthy bone cells. It has been suggested that egoma oil or leaf extracts may contribute to the promotion of bone formation and the inhibition of bone resorption (Phromnoi et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Matsuzaki et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The mechanism by egoma oil and egoma extracts inhibit osteoclast differentiation requires further study, but existing data suggest its osteoprotective effects. The egoma residue obtained after oil extraction from egoma seeds also has a variety of uses. The oil and fat content are reduced, but it contains abundant fiber, protein, vitamins, and minerals (Gaihre et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This suggests that the egoma residue may also have high health value and improved bone metabolism. In this study, we investigated the effects of the water-soluble layer fraction obtained by liquid-liquid partitioning of defatted egoma seed residue extract on osteoclast differentiation. We also examined the inhibition of osteoclast differentiation by Salviaflaside in the water-soluble fraction.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eReagents\u003c/p\u003e\u003cp\u003eDulbecco\u0026rsquo;s Modified Eagle Medium (DMEM), RANKL, M-CSF, penicillin/streptomycin (P/S), Acetonitrile and Acetic acid were obtained from Wako Pure Chemical Inc (Osaka, Japan). Heat-inactivated fetal bovine serum (FBS), p-nitrophenyl phosphate (pNPP) were purchased from Sigma Aldrich (Tokyo, Japan). PCR primers were obtained from Greiner Bio-One (Tokyo, Japan). Salviaflaside reference Standard were purchased from ALB Material Inc (USA). All the chemicals used in the experiments of analytical grade or complied with the level required for cell culture.\u003c/p\u003e\u003cp\u003ePreparation for DPH-W\u003c/p\u003e\u003cp\u003eDefatted egoma seed residue was purchased from the Japan Egoma Association (Gunma, Japan). The residue was powdered with a milling machine and then extracted with hot water for 30 minutes. The filtration was lyophilized and used as a hot water extract of defatted egoma seed residue: DPH. Liquid-liquid partitioning was performed to obtain three fractionated samples from DPH powder: ethyl acetate layer fraction (DPH-EA), butanol layer fraction (DPH-Bu), and water layer fraction (DPH-W).\u003c/p\u003e\u003cp\u003eHPLC Analysis\u003c/p\u003e\u003cp\u003eThe HPLC system used a binary pump and UV detector (Hitachi Primaide 1110 Pump and 1410 UV detector, Tokyo, Japan). DPH-W analysis was performed on a 10 \u0026micro;L sample injected into an InertSil HPLC Column HILIC (GL science inc, Tokyo, Japan) analytical column (4.6 x 250 mm, 5 \u0026micro;m). The mobile phase was a gradient of solvent A (milliQ-water) and solvent B (acetonitrile). The gradient flow program was 0 min: 5% A, 95% B; 5 min: 5% A, 95% B; 15 min: 40% A, 60% B; 25 min: 50% A, 50% B; 1.0 mL/min flow rate, Elution was monitored at 220 nm. Salviaflaside (1 ng/mL) was used as a standard compound.\u003c/p\u003e\u003cp\u003eAnimals\u003c/p\u003e\u003cp\u003eddY female mice were obtained from Japan SLC Inc (Shizuoka, Japan). Mice were housed at the animal housing facility of Ishikawa Prefectural University at 24\u0026thinsp;\u0026plusmn;\u0026thinsp;1 ℃, 50\u0026thinsp;\u0026plusmn;\u0026thinsp;2% humidity, and a 12-hour light/dark cycle, with free access to feed and water. Animal studies were conducted in accordance with protocols and guidelines approved by the University of Ishikawa Animal Care and Use Committee.\u003c/p\u003e\u003cp\u003eCultures of bone marrow cells\u003c/p\u003e\u003cp\u003eBone marrow cells were obtained from the tibia and femur of ddY female mice. Bone marrow cells were added to 10% FBS supplemented D-MEM containing 20 ng/ml M-CSF and cultured for 3 days, and the adherent cells were used as Bone marrow macrophages (BMM) in subsequent experiments. BMM were cultured with M-CSF (20 ng/mL) and RANKL (20 ng/mL) for 4\u0026ndash;7 days to induce osteoclasts.\u003c/p\u003e\u003cp\u003eViability assay\u003c/p\u003e\u003cp\u003eThe cytotoxicity by the specimen was measured using the WST-8 assay (Cell Counting Kit-8, Dojindo, Tokyo, Japan) for cellular nicotinamide adenine dinucleotide-dependent succinate dehydrogenase activity, which is proportional to cell metabolic activity or survival. After incubation, cells were treated with WST-8 Solution for 3 hours and absorbance was measured at 450 nm using a Varioskan LUX multimode microplate reader (Thermo Fisher Scientific Inc, Osaka, Japan).\u003c/p\u003e\u003cp\u003eTRAP staining assay\u003c/p\u003e\u003cp\u003eAfter 7 days of incubation from the addition of RANKL, osteoclasts specific TRAP staining was performed using a TRAP/ALP stain kit as per the manufacturer\u0026rsquo;s directions (Wako Pure Chemical Inc, Osaka, Japan). TRAP-positive multinucleated cells with three or more nuclei were observed under a microscope.\u003c/p\u003e\u003cp\u003eTRAP activity assay\u003c/p\u003e\u003cp\u003eAfter 4 days of incubation from the addition of RANKL, Cells were treated with 1% Triton-X100. p-nitrophenyl phosphate (pNPP) was used as substrate and treated with buffer solution (pH 5.9) containing 100 mM sodium acetate and 50 mM sodium tartrate and incubated at 37 ℃ for 30 minutes. The reaction was stopped by adding 0.5 N NaOH. Absorbance was read at 405 nm.\u003c/p\u003e\u003cp\u003eqRT-PCR\u003c/p\u003e\u003cp\u003eTotal RNA was extracted from cultured cells using ISOGEN II (NipponGene, Tokyo, Japan). First-strand complementary DNA was reverse transcribed from total RNA (1 \u0026micro;g) using ReverTra Ace\u0026reg; (Toyobo, Osaka, Japan) according to the manufacturer's protocol. Real-time PCR (qRT-PCR) was performed using the CFX96\u003csup\u003eTM\u003c/sup\u003eReal-Time System (Thermo Fisher Scientific Inc, Osaka, Japan) and THUNDER BIRD NEXT qPCR Mix (Toyobo, Osaka, Japan). Gene expression levels were normalized against GAPDH. PCR primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Data were analyzed using the 2\u003csup\u003e\u0026minus;⊿⊿CT\u003c/sup\u003e method.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences used for reverse transcription quantitative PCR.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTarget gene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse primer(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ectacactgaggaccaggttgtct\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003egtcataccaggaaatgagcttgac\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNFATc1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eaacgccctgaccaccgatag\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003egggaagtcagaagtgggtgga\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCTSK\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ecaccagaagcagtataacagcaag\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ecatatgtatggacaccaagagagg\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDC-STAMP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003egtcatgtgctactcctgttcactc\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eaggtttcagagaggtaagactcca\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMMP-9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eatgtacccgctgtatagctacctc\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003egaggtatagtgggacacatagtgg\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTRAP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003etacctgtgtggacatgacc\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ecagatccatagtgaaaccgc\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eAll data are expressed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM over at least three experiments. Statistical significance was assessed against controls by one-way ANOVA and Dunnett's multiple comparison test. \u003cem\u003eP\u003c/em\u003e-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eComponent analysis of DPH-W\u003c/p\u003e\u003cp\u003eThe compounds of DPH-W were analyzed using HILIC columns and HPLC-UV systems to characterize their chemical composition. One of the major components was identified as Salviaflaside based on its retention time and UV absorption spectrum, which were consistent with those of the standard compounds (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb-c). In addition, rosmarinic acid was detected in the DPH-EA and DPH-Bu fractions, as confirmed by comparison with reference compounds and previous reports (Data not shown). These findings suggest that different extraction fractions contain distinct bioactive compounds, which may contribute to their varying biological activities. Rosmarinic acid has been previously reported to exhibit beneficial effects on bone metabolism. However, the physiological effects of its glycosylated derivative, Salviaflaside on bone metabolism remain unclear.\u003c/p\u003e\u003cp\u003eEffects of DPH-W and Salviaflaside on cell viability\u003c/p\u003e\u003cp\u003eThe CCK-8 assay was used to evaluate the cytotoxicity of DPH-W and Salviaflaside on BMM. There was no significant difference in cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-b). However, a decreasing trend in cell viability was observed at 200 \u0026micro;M for Salviaflaside (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.069), so concentrations below 100 \u0026micro;M were used in experiments. Notably, cell viability remained above 90% at concentration of 50 and 100 \u0026micro;M, suggesting minimal cytotoxic effects in this range. These results indicate that salviaflaside is relatively safe at low concentration but may exhibit cytotoxic effects at higher doses. Therefore, 100 \u0026micro;M was selected as the upper limit for further experiments to avoid potential confounding effects due to cytotoxicity.\u003c/p\u003e\u003cp\u003eDPH-W inhibits osteoclast differentiation\u003c/p\u003e\u003cp\u003eThe inhibitory effects of DPH-W on osteoclast differentiation were examined. Osteoclast differentiation was estimated by TRAP-positive multinucleated cell formation in BMM upon the addition of RANKL. The number of TRAP-positive multinucleated osteoclasts formed was evaluated by TRAP staining, and compared to RANKL treatment alone, BMM stimulated with DPH-W showed a significant reduction in osteoclast formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). With the addition of DPH-W at 1, 10, and 100 \u0026micro;g/mL, osteoclast formation and growth were strongly inhibited in a dose-dependent manner. Importantly, at 100 \u0026micro;g/mL, osteoclastogenesis was almost completely suppressed, with only a few TRAP-positive cells observed. These results suggest that DPH-W exerts potent anti-osteoclastogenic effects, potentially by interfering with RANKL-mediated signaling pathways.\u003c/p\u003e\u003cp\u003eTRAP activity\u003c/p\u003e\u003cp\u003eThe effects of DPH-W and Salviaflaside on TRAP activity in RANKL-induced BMM were evaluated. DPH-W significantly reduced TRAP activity compared to the RANKL-treated alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb-c). Specifically, the addition of DPH-W reduced TRAP activity to 68\u0026thinsp;\u0026plusmn;\u0026thinsp;8.6% at 10 \u0026micro;g/mL and further to 41\u0026thinsp;\u0026plusmn;\u0026thinsp;10% at 100 \u0026micro;g/mL. Similarly, Salviaflaside strongly inhibited TRAP activity in a dose-dependent manner without exhibiting cytotoxic effects. At 25 \u0026micro;M, 50 \u0026micro;M, and 100 \u0026micro;M, TRAP activity decreased to 68\u0026thinsp;\u0026plusmn;\u0026thinsp;5.3%, 64\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1% and 54\u0026thinsp;\u0026plusmn;\u0026thinsp;4.4% respectively with the values corresponding to each concentration. These results indicate that both DPH-W and Salviaflaside effectively inhibited osteoclast differentiation by reducing TRAP activity. Salviaflaside, one of the major compounds found in DPH-W, is likely responsible for the observed inhibitory effects on TRAP activity. This suggests that the bioactive effects of DPH-W in inhibiting osteoclast differentiation may be attributed, at least in part to Salviaflaside. The concentration-dependent inhibition observed with both compounds suggests that their effects may be mediated through modulation of key signaling pathways involved in osteoclastogenesis, such as the RANK/RANKL signaling. Moreover, the absence of cytotoxicity at effective concentrations suggests their potential as therapeutic agents for conditions involving excessive osteoclast activity, such as osteoporosis and rheumatoid arthritis.\u003c/p\u003e\u003cp\u003eDPH-W and Salviaflaside suppresses osteoclast differentiation and functional genes\u003c/p\u003e\u003cp\u003eThe expression levels of genes involved in osteoclast differentiation and function were evaluated. DPH-W showed inhibition of expression of NFATc1, a master regulator of osteoclast differentiation, compared to RANKL-only treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). The mRNA levels of its downstream marker genes TRAP, CTSK, MMP-9, and DC-STAMP were also significantly reduced by 100 \u0026micro;g/mL DPH-W treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb-e). Notably, Salviaflaside also dramatically suppressed NFATc1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). Given that both DPH-W and Salviaflaside exhibited strong inhibitory effects on osteoclast-related gene expression, it is likely that Salviaflaside contributes, at least in part to the osteoclast-suppressive activity of DPH-W. Furthermore, Salviaflaside significantly downregulated the expression of TRAP, CTSK, MMP-9, and DC-STAMP like DPH-W, suggesting its potential role as a key bioactive compound responsible for these effects (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb-e). These findings show the potential of both DPH-W and Salviaflaside as effective inhibitors of osteoclastogenesis through NFATc1 suppression and subsequent downregulation of osteoclast-associated genes.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOsteoporosis is caused by the predominance of bone resorption by osteoclasts that dissolve bone matrix (Feng et al. 2011). Osteoclasts are the only bone-resorbing cells \u003cem\u003ein vivo\u003c/em\u003e, Osteoclast-targeted therapies are a useful approach to maintaining normal bone metabolism. Egoma (\u003cem\u003eperilla frutescens Britton var. Japonica Hara\u003c/em\u003e) seeds are rich in fatty acids such as α-linolenic acid, linoleic acid, and oleic acid (Kim et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). These fatty acids have been shown to contribute to anti-inflammatory and antioxidant effects (Deng et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Ion et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). α-linolenic acid is expected to improve bone metabolism through suppressing the production of inflammatory cytokines that promote bone resorption (Song et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Egoma contains polyphenols such as rosmarinic acid and luteolin, which have been implicated in reducing oxidative stress (Vo et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Mahwish et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). In this study, we investigated the effects of improving bone metabolism in an extract of the egoma residue which is then discarded. Component analysis was performed on the ethyl acetate fraction, the butanol fraction, and the water-soluble layer fraction obtained by liquid-liquid partitioning of the heated water extract of the egoma residue. The major component of the ethyl acetate and butanol layer fraction was rosmarinic acid. The water-soluble layer fraction contained Salviaflaside, a glycoside of rosmarinic acid. Rosmarinic acid is a natural compound that has been shown to inhibit osteoclast differentiation (Omori et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, the results of pharmacological studies on Salviaflaside are largely unknown. The water-soluble layer fraction of egoma seed residue (DPH-W) and its major component, Salviaflaside were each examined for their ability to improve bone metabolism. DPH-W inhibited the formation of TRAP-positive multinucleated giant cells derived from BMM and TRAP enzyme activity without cytotoxicity. DPH-W and Salviaflaside attenuated BMM-derived osteoclast formation by inhibiting the expression of the transcription factor NFATc1. Monocytes and macrophages in the bone marrow differentiate into osteoclasts upon stimulation with M-CSF or RANKL. (Nakashima et al. 2011). TRAP is highly expressed during osteoclast differentiation and promotes osteoclast migration and bone resorption (Suzumoto et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). NFATc1 is a master regulator of osteoclastogenesis and is responsible for regulating the expression of osteoclast-specific genes (Shinohara et al. 2007). This study showed that Salviaflaside improved bone metabolism by inhibiting bone resorption. We intend to compare the activity of rosmarinic acid and Salviaflaside, and to study the effects of their simultaneous action in the future. We have also shown that all three fractions of egoma residue promote the enzymatic activity of ALP produced by osteoblasts (data not shown). Rosmarinic acid has been reported to not only inhibit bone resorption by osteoclasts, but also to improve bone formation by promoting cell proliferation of osteoblasts (Lee et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The effect of Salviaflaside on bone formation should also be investigated. These findings suggest that rosmarinic acid and Salviaflaside from egoma residue regulate bone metabolism by promoting osteoblast differentiation and suppressing osteoclast formation. In conclusion, DPH-W suppresses osteoclastogenesis by inhibiting the expression of NFATc1 and thus acts to inhibit bone resorption. And its active compounds, rosmarinic acid and Salviaflaside, contributed to the inhibition of bone resorption. These findings suggest that Salviaflaside may lead to the development of useful tools for the prevention and treatment of osteoporosis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eThe authors declare that they have no competing interests. Part of this study was funded by the Graduate Student Success Project (Daigakuin Katsuyaku Project) of Ishikawa Prefectural University, Japan. All animal procedures were performed in accordance with institutional guidelines and were approved by the Animal Care Committee of Ishikawa Prefectural University (Approval No. R4-14-8).\u003c/p\u003e\u003cp\u003eA.H. designed and performed the experiments, analyzed the data, and wrote the manuscript. N.S. supervised the project and contributed to the review and editing of the manuscript. Both authors read and approved the final version of the manuscript.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eH.A. designed and performed the experiments, analyzed the data, and wrote the manuscript. N.S. supervised the study and reviewed the manuscript. All authors reviewed and approved the final version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe gratefully acknowledge the support from the Graduate Student Success Project at Ishikawa Prefectural University.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAsif M (2011) Health effects of omega-3,6,9 fatty acids: \u003cem\u003ePerilla frutescens\u003c/em\u003e is a good example of plant oils. \u003cem\u003eOrient. Pharm. Exp. Med\u003c/em\u003e. 11:51\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeng Y, Li W, Zhang Y, Li J, He F, Dong K, Hong Z, Luo R, Pei X (2023) α-Linolenic Acid Inhibits RANKL-Induced Osteoclastogenesis In Vitro and Prevents Inflammation \u003cem\u003eIn Vivo\u003c/em\u003e. \u003cem\u003eFoods\u003c/em\u003e. 12(3):682.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFeng X, McDonald JM (2011) Disorders of bone remodeling. \u003cem\u003eAnnu Rev Pathol\u003c/em\u003e. 6:121\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGaihre YR, Iwamoto A, Oogai S, Hamajima H, Tsuge K, Nagata Y, Yanagita T (2022) Perilla pomace obtained from four different varieties have different levels and types of polyphenols and anti-allergic activity. \u003cem\u003eCytotechnology.\u003c/em\u003e 74(2):341\u0026ndash;349.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHeaney RP, Abrams S, Dawson-Hughes B, Looker A, Marcus R, Matkovic V, Weaver C (2000) Peak Bone Mass. \u003cem\u003eOsteoporos Int\u003c/em\u003e. 11(12):985\u0026ndash;1009.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHodge JM, Kirkland MA, Nicholson GC (2007) Multiple roles of M-CSF in human osteoclastogenesis. \u003cem\u003eJ Cell Biochem\u003c/em\u003e. 102(3):759\u0026ndash;768.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIon G, Fazio K, Akinsete JA, Hardman WE (2011) Effects of canola and corn oil mimetic on Jurkat cells. \u003cem\u003eLipids Health Dis\u003c/em\u003e. 10:90.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim HU, Lee KR, Shim D, Lee JH, Chen GQ, Hwang S (2016) Transcriptome analysis and identification of genes associated with ω-3 fatty acid biosynthesis in \u003cem\u003ePerilla frutescens (L.) var. frutescens\u003c/em\u003e. \u003cem\u003eBMC Genomics\u003c/em\u003e. 17:474.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee JW, Asai M, Jeon SK, Iimura T, Yonezawa T, Cha BY, Woo JT, Yamaguchi A (2015) Rosmarinic acid exerts an antiosteoporotic effect in the RANKL-induced mouse model of bone loss by promotion of osteoblastic differentiation and inhibition of osteoclastic differentiation. \u003cem\u003eMol Nutr Food Res\u003c/em\u003e. 59(3):386\u0026ndash;400.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Q, Tao X, Zhang Y (2022) Rosmarinic acid alleviates diabetic osteoporosis by suppressing the activation of NLRP3 inflammasome in rats. \u003cem\u003ePhysiol Int\u003c/em\u003e. 109(1):46\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMahwish, Imran M, Naeem H, Hussain M, Alsagaby SA, Abdulmonem WA, Mujtaba A, Abdelgawad MA, Ghoneim MM, Ei-ghorab AH, Selim S, Jaouni SKA, Mostafa EM, Yehuala TF (2025) Antioxidative and Anticancer Potential of Luteolin: A Comprehensive Approach Against Wide Range of Human Malignancies. \u003cem\u003eFood Sci Nutr.\u003c/em\u003e 13(1):e4682.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMasuda A, Hidaka K, Hoda S, Taniguchi A, Doi S, Masuda T (2018) Radical Scavenging Properties of Roasted Egoma (\u003cem\u003ePerilla frutescens var. frutescens\u003c/em\u003e) Oils and Identification of Their Characteristic Scavengers. \u003cem\u003eJ Nutr Sci Vitaminol\u003c/em\u003e. 64(6):466\u0026ndash;472.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMatsuzaki K, Hossain S, Wakatsuki H, Tanabe Y, Ohno M, Kato S, Shido O, Hashimoto M (2023) Perilla seed oil improves bone health by inhibiting bone resorption in healthy Japanese adults: A 12-month, randomized, double-blind, placebo-controlled trial. \u003cem\u003ePhytother Res\u003c/em\u003e. 37(6):2230\u0026ndash;2241.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNakashima T, Takayanagi H (2011) New regulation mechanisms of osteoclast differentiation. \u003cem\u003eAnn NY Acad Sci.\u003c/em\u003e 1240:E13-8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOmori A, Yoshimura Y, Deyama Y, Suzuki K (2015) Rosmarinic acid and arbutin suppress osteoclast differentiation by inhibiting superoxide and NFATc1 downregulation in RAW 264.7 cells. \u003cem\u003eBiomed Rep\u003c/em\u003e. 3(4):483\u0026ndash;490.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePhromnoi K, Yodkeeree S, Pintha K, Mapoung S, Suttajit M, Saenjum C, Dejkriengkraikul (2022) Anti-Osteoporosis Effect of Perilla frutescens Leaf Hexane Fraction through Regulating Osteoclast and Osteoblast Differentiation. \u003cem\u003eMolecules.\u003c/em\u003e 27(3):824.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShinohara M, Takayanagi H (2007) Novel osteoclast signaling mechanisms. \u003cem\u003eCurr Osteoporos Rep\u003c/em\u003e. 5(2):67\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSong J, Jing Z, Hu W, Yu J, Cui X (2017) α-Linolenic Acid Inhibits Receptor Activator of NF-κB Ligand Induced (RANKL-Induced) Osteoclastogenesis and Prevents Inflammatory Bone Loss via Downregulation of Nuclear Factor-KappaB-Inducible Nitric Oxide Synthases (NF-κB-iNOS) Signaling Pathways. \u003cem\u003eMed Sci Monit\u003c/em\u003e. 23:5056\u0026ndash;5069.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSundaram K, Nishimura R, Senn J, Youssef RF, London SD, Reddy SV (2007) RANK ligand signaling modulates the matrix metalloproteinase-9 gene expression during osteoclast differentiation. \u003cem\u003eExp Cell Res\u003c/em\u003e 313:168\u0026ndash;178.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSuzumoto R, Takami M, Sasaki T (2005) Differentiation and function of osteoclasts cultured on bone and cartilage. \u003cem\u003eJ Electron Microsc (Tokyo)\u003c/em\u003e 54(6):529\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eUdagawa N, Takahashi N, Akatsu T, Tanaka H, Sasaki T, Nishihara T, Koga T, Martin TJ, Suda T (1990) Origin of osteoclasts: mature monocytes and macrophages are capable of differentiating into osteoclasts under a suitable microenvironment prepared by bone marrow-derived stromal cells. \u003cem\u003eProc Natl Acad Sci USA\u003c/em\u003e 87:7260\u0026ndash;7264.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVo QV, Hoa NT, Flavel M, Thong NM, Boulebd H, Nam PC, Quang DT, Mechler A (2023) A Comprehensive Study of the Radical Scavenging Activity of Rosmarinic Acid. \u003cem\u003eJ Org Chem.\u003c/em\u003e 88(24):17237\u0026ndash;17248.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWada T, Nakashima T, Hiroshi N, Penninger JM (2006) RANKL-RANK signaling in osteoclastogenesis and bone disease. \u003cem\u003eTrends Mol Med\u003c/em\u003e 12:17\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cytotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cyto","sideBox":"Learn more about [Cytotechnology](http://link.springer.com/journal/10616)","snPcode":"10616","submissionUrl":"https://submission.nature.com/new-submission/10616/3","title":"Cytotechnology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"RANKL, Osteoclast, Bone, Polyphenol, Salviaflaside","lastPublishedDoi":"10.21203/rs.3.rs-7296078/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7296078/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePolyphenols have physiological effects such as antioxidants and anti-inflammatory effects and have been reported to osteoporosis and inflammatory diseases. Rosmarinic acid is a natural polyphenol contained in Lamiaceae herbs, such as Perilla frutescens, sage and sweet basil. Salviaflaside is a glycosidized compound of rosmarinic acid. It was one of the major components of the defatted \u003cem\u003ePerilla frulescens Britton var. Japonica Hara\u003c/em\u003e (egoma) seed residue extract. In this study, we investigated the anti-osteoporotic effects of the water-soluble layer fraction of egoma residue heated water extract (DPH-W) and Salviaflaside on bone marrow-derived macrophages (BMMs). DPH-W reduced the number of tartrate-resistant acid phosphatase (TRAP) positive osteoclasts in BMM treated with receptor-activated nuclear factor kappa B ligand (RANKL). The mRNA expression levels of NFATc1 and CTSK, which are responsible for osteoclast differentiation and bone resorption were suppressed. Salviaflaside decreased TRAP activity and suppressed the expression of osteoclast differentiation-related genes. Our findings indicate that egoma seed residue and Salviaflaside may have potential as a useful therapeutic or prophylactic agent for the suppression of bone loss.\u003c/p\u003e","manuscriptTitle":"Salviaflaside in water-soluble fraction of heated water extracted from defatted perilla frutescens Britton var. Japonica Hara seed residue suppresses osteoclast differentiation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-21 13:53:40","doi":"10.21203/rs.3.rs-7296078/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-30T03:53:48+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-27T10:06:52+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-22T15:30:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"303935753818016255138813307842013145659","date":"2025-08-17T07:04:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"59848422654763413449436620203081276584","date":"2025-08-14T12:39:18+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-13T23:52:26+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-07T17:41:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-07T17:38:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cytotechnology","date":"2025-08-05T04:07:22+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cytotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cyto","sideBox":"Learn more about [Cytotechnology](http://link.springer.com/journal/10616)","snPcode":"10616","submissionUrl":"https://submission.nature.com/new-submission/10616/3","title":"Cytotechnology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"de87bf73-ab51-4287-8979-329eb4d9d820","owner":[],"postedDate":"August 21st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-10-06T16:11:58+00:00","versionOfRecord":{"articleIdentity":"rs-7296078","link":"https://doi.org/10.1007/s10616-025-00847-y","journal":{"identity":"cytotechnology","isVorOnly":false,"title":"Cytotechnology"},"publishedOn":"2025-10-01 15:57:03","publishedOnDateReadable":"October 1st, 2025"},"versionCreatedAt":"2025-08-21 13:53:40","video":"","vorDoi":"10.1007/s10616-025-00847-y","vorDoiUrl":"https://doi.org/10.1007/s10616-025-00847-y","workflowStages":[]},"version":"v1","identity":"rs-7296078","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7296078","identity":"rs-7296078","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.