Isolation and molecular characterization of the first G8-type sheep rotavirus identified in China

preprint OA: closed
Full text JSON View at publisher
Full text 82,044 characters · extracted from preprint-html · click to expand
Isolation and molecular characterization of the first G8-type sheep rotavirus identified in China | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Isolation and molecular characterization of the first G8-type sheep rotavirus identified in China Ping Li, WenYan Gai, DengShuai Zhao, DaJun Zhang, Xing Yang, XiJuan Shi, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3788278/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective The objectives were to isolate the Chinese G8 sheep rotavirus and to study some of its genotypic characteristics, to provide basic information for the epidemiological pathology of sheep rotavirus and to provide key biological materials for the study of its pathogenic mechanism. Methods In 2023, anal swabs and small intestinal samples were collected from sheep with clinical manifestations of diarrhea at a Gansu sheep farm. Using RT-PCR, tissue sections, and virus isolation and identification methods, viral infections were investigated in sheep. Results RT-PCR and small intestinal immunohistochemistry confirmed rotavirus infection in the sheep. Rotavirus isolation in MA-104 cells revealed typical cytopathic lesions by the 10th blind transmission generation. Positively identification through indirect immunofluorescence and observation of characteristic 70 nm-sized rotavirus particles in transmission electron microscopy further supported the findings. The capsid protein VP7 and nonstructural protein NSP4 genotypes were identified as G8 and E2, respectively, making the first detection of the G8-type rotavirus in sheep in China. Conclusion This study successfully isolated G8-type sheep rotavirus for the first time in China, contributing valuable date for molecular epidemiological research on sheep rotavirus and providing essential biological materials for further investigations on its pathogenic mechanisms. Rotavirus Sheep Isolation and identification Genetic evolutionary analysis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Rotavirus (RV), a common enteric pathogen causing acute watery diarrhea in humans, other mammals, and birds, is an major zoonotic threat. RV is a leading cause of severe gastroenteritis globally in infants and young children, resulting in more than 500,000 annual deaths, particularly in developing countries [ 9 ] . Similarly, RV-associated enteritis poses a notable health risk to young cattle, horses, sheep, and piglets. Previous studies have indicated that RV infection is a leading cause of diarrhea in lambs, markedly impacting sheep farms. RV, characterized as a double-stranded RNA virus, in the Rotavirus genus of the family Reoviridae , presents as an icosahedron lacking a capsid, with particles meausring 66–75 nm in diameter. Its genome, approximately 18,522 bp long, comperises 11 segments of double-stranded RNA [ 7 ] . These segments encode six types of structural proteins (VP1-VP4, VP6, and VP7) and five nonstructural proteins (NSP1-NSP5) [ 18 ] . VP6, as the intermediate capsid layer, is an important immunogenic viral protein. Classification based on VP6 categorizes RVs into seven serogroups (types: A-G) and two subgroups (Ⅰ and Ⅱ) [ 2 , 4 ] . Among these, subgroup A RVs are the primary contributors gastrointestinal diseases in humans and animals. Surface coat proteins, VP4 and VP7, play pivotal roles in viral replication, inducing protective immunity neutralizing antibody production and adsorption and invasion regulation in the early stages of replication. Studies have shown that RV-type A from porcine and bovine sources can be transmitted to humans [ 12 , 16 , 20 ] . This transmission is related to RVs’ rapid mutation rate, genotypic complexity, and the ability of both heterologous and homologous strains to reassort and rearrange, creating new strains and expanding their host range. Evidence of recombination with human RV genes has been observed in RVs, such as Spanish sheep 762 strain G8P[14] type [ 5 ] , Korean goat GRV strain G3P[5] type [ 14 ] ,and Indian goat strain G1P[8] type [ 6 ] . This phenomenon not only poses a challenge for RV prevention and control in sheep but also represents a threat to public health safety. Therefore, the present study, we conducted pathogen detection, virus isolation and identification, and genetic evolution analyses of sheep with clinical diarrhea from a Gansu sheep farm, with the objective of providing key biological materials for understanding the genetic evolution of sheep RVs, enhancing epidemic prevention and control, and developing prevention and control products. Materials and Methods Materials Sample collection In 2023, anal swabs were collected from clinically diarrheic and clinically healthy sheep at a Gansu sheep farm. Following dissection, the duodenum, jejunum, and ileum were collected and individually preserved in 4% general-purpose tissue fixative. Reagents and cells RNA reverse transcription reagents, including 5× PrimeScript RT Master Mix, TB Green Premix Ex Taq™ II, 0.25% EDTA trypsin, and fetal bovine serum, were purchased from Shanghai Bioscience Biotechnology Company Limited. RNA extraction reagents, including Trizol, 0.25% EDTA trypsin, and Dulbecco’s Modified Eagle Medium, were obtained from Lanzhou Lihe Biotechnology Company. In addition, 2×Taq Master Mix and DL2000 Plus DNA Marker were purchased from Nanjing Novozymes Bio-technology Company. Anhydrous ethanol, chloroform, and isopropanol were obtained from Kangwei Century Bio-technology Company. Tissue fixative was purchased from Beijing Solabao Technology Company, and anti-RV-VP6 protein monoclonal antibody (2B4) was obtained from Santa Cruz Biotechnology Company. MA-104 cells were provided by Lanzhou Institute of Veterinary Medicine, Chinese Academy of Agricultural Sciences. Methods RV testing Anal swabs were placed into 1 mL of precooled phosphate-buffered saline (PBS), thoroughly vortexed, and processed. Following three cycles of freezing and thawing, the samples underwent centrifugation at 4℃ and 12,000 rpm for 10 min. Subsequentiy, and 200 µL of the supernatant was used for total RNA extraction with TRIzol reagent. The remaining supernatant was stored at − 80℃ for future use. Extracted extracted RNA was reverse-transcribed at 37℃ for 15 min, 85℃ for 5 s and 4℃ for extension. RV was detected using the specific primers RV-F and RV-R(Table 1 ). The amplified fragment size was 160 bp. The PCR reaction system (50 µL) comprised 25 µL of 2×Taq Master Mix, 1 µL of upstream primer VP6-F, 1 µL of downstream primer VP6-R, 2 µL of cDNA template, and 50 µL of H 2 O added to the final volume. The PCR reaction conditions were as follows: denaturation at 95℃ for 3 min; cycling at 95℃ for 30 s, 50℃ for 30 s, 72℃ for 1 min, for 35 cycles; and extension at 72℃ for 10 min, with a final extension at 4℃.The PCR products were subjected to 1.5% agarose gel electrophoresis to detect amplified fragments sizes, after which they sequenced by Xi'an Prime Jersey Biotechnology. Histopathology and immunohistochemistry Pathological sections of the duodenum, jejunum and ileum both clinically diarrheic and clinically healthy sheep were subjected to hematoxylin and eosin (HE) staining and immunohistochemistry, with analysis conducted by Wuhan Xavier Biotechnology Company. Virus isolation workflow For improved virus invasion into the cells, trypsin at a final concentration of 15 µg/mL and 1% of double antibody (100 U/mL penicillin and 100 µg/mL streptomycin) were added to the supernatant of pretreated positive samples. After a 1 hand activation in a 37℃ water bath, MA-104 cells, grown into a monolayer, were separated from the culture medium, rinsed with PBS for three times, and treated with trypsin-activated RV solution. The cells were then incubated at 37°C with 5% CO 2 , with the virus solution gently shaken every 30 min to ensure sufficient and uniform virus absorption into the cells. After 2 h, the virus solution, was discarded, the cells were rinsed with PBS for 2–3 times, and cell maintenance solution was added with a final trypsin concentration of 4 µg/mL. A negative control group without trypsin was established.Cell lesions were observed for approximately 3 days in an incubator at 37°C, 5% CO 2 . After obvious lesions appeared in the inoculated cells, they were stored at − 80°C, frozen and thawed three times, centrifuged at 4°C and 12,000 rpm for 10 min to remove large cellular debris and other components, and the supernatant (viral liquid) was collected and stored at − 80°C for the next inoculation. Subsequently, the virus was passed blindly to the 10th generation. Transmission electron microscopy A 150 mL portion of the 10th generation virus was added to a 20% sucrose-bottomed ultracentrifuge tube and centrifuged at 170,000 g/min, 4℃ for 4 h. The supernatant was slowly discarded, and the virus was resuspended in an EP tube with 1 mL of PBS and spun at 4℃ overnight. On the following day, the virus was centrifuged in a sucrose density gradient at 220,000 g/min, and 4℃ for 4 h. The virus was then resuspended in the bottom of the tube with 500 ul PBS and subjected to desugarization centrifugation at 220 000 g/min, 4 ℃ for 2 h. The virus was then resuspended with 500 µL PBS in a 2% phosphotungstic acid negative staining solution, followed by observation under a transmission electron microscope. Indirect immunofluorescence assay MA-104 cells were inoculated into 24-well plates. When cells covered about 80% of the well bottoms, they were inoculated with virus solution. Negative control wells were established without the virus. After the inoculated cells displayed lesions, the medium was discarded, and the cells were washed with precooled PBS for once or twice for 5 min per wash. Fixation was performed using 4% paraformaldehyde for 1 h at room temperature, after which the liquid was discarded and the cells were washed three times with precooled PBS for 5 min per wash. For transfiltration, 0.1% Triton-X-100 was added to the cells, which were then allowed to stand for 30 min at room temperature. Subsequently, the liquid was discarded, and the cells were washed with precooled PBS for three times for 5 min per wash. For the closure step, 5% bovine serum albumin was added, and the cells were closed for 1 h at room temperature, followed by inoculation with virus solution. DAPI (1:3000 dilution) was added, and after 7 min in the dark, the cells were rinsed three times with precooled PBST at room temperature for 5 min per wash. Finally, the cells were observed under an inverted fluorescence microscope. RT-PCR and sequencing Viral RNA was extracted from the supernatant using TRIzol reagent (Takara, Dalian, China) according to the manufacturer’s instructions. Viral cDNA was obtained through reverse transcription using the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China) following the manufacturer’s instructions. For VP7 and VP4 amplification, primers targeting VP7 and NSP4 were used (Table 1 ). Conventional RT-PCR was used to amplify the complete VP7 and NSP4 genes. After purification, the products were cloned into the pMD-18T vector (TaKaRa, Dalian, China) for sequencing. Table 1 Primers for detection of rotavirus(RV-F and RV-R) and amplification of VP7 and NSP4 genes Name Sequence(5’−3’) Reference RV-F GATGTCCTGTACTCCTTGT [3] RV-R GGTAGATTACCAATTCCTCC VP7-F GGCTTTAAAAGAGAGAATTTCCGTCTGG [26] VP7-R GGTCACATCATACAATTCTAATCTAAG NSP4-F GGCTTTTAAAAGTTCTGTTCC [26] NSP4-R GGTCACACTAAGACCATTCC Abbreviations: F:Foward primer. R:Reverse primer. RV:rotavirus.VP7、NSP4:VP7 and NSP4 are genes for structural and nonstructural proteins of rotaviruses, respectively. Sequence alignment and genetic evolution analysis The isolate full-length VP7 and NSP4 gene were subjected to sequence comparison and a phylogenetic tree was constructed using MEGA 11 phylogenetic analysis software. Results Rotavirus detection In this study, anal swabs were obtained from sheep with clinical diarrhea in a Gansu sheep farm. The affected sheep mainly exhibited watery diarrhea. RT-PCR confirmed the presence of RV (Fig. 1), and sequencing results confirmed RV infection. Histopathology and immunohistochemistry HE staining of the duodenum, jejunum, and ileum from clinically healthy sheep revealed no obvious pathological changes. However, in diseased sheep, the duodenum exhibited disorganized tissue structure, extensive mucosal layer necrosis, and widespread necrosis and detachment of mucosal epithelial cells. Additionally, there was visible necrosis of the intestinal glands in the lamina propria, accompanied by necrotic cellular fragments. The submucosal layer showed localized connective tissue proliferation with a small amount of lymphocytic infiltration. The jejunum and ileum were disorganized, with extensive necrosis of the mucosal layer, widespread necrosis and detachment of mucosal epithelial cells, necrosis of the intestinal glands in the lamina propria, and many necrotic cell fragments; additionally, the ileum exhibited mesenteric vascular stasis (Fig. 2). Immunohistochemistry was negative in the duodenum, jejunum, and ileum of clinically healthy sheep. However, it was locally positive in both the duodenum and jejunum of diseased sheep (Fig. 3). Rotavirus isolation RV isolation on MA-104 cells involved blind passage to the 10th generation, which revealed notable cytopathic lesions (CPEs). Following cell inoculation, evident CPE emerged after 12 h of incubation. Normal MA-104 cells exhibited good translucency and clear edges, whereas virus-inoculated cells displayed crumpling, pulling, and shedding (Fig. 4). Transmission electron microscopy identification Transmission electron microscopy clearly showed typical intact RV particles with a diameter of approximately 70 nm (Fig. 5). These findings are consistent with RV characteristics. Indirect immunofluorescence virus identification After 12 h of virus inoculation, MA-104 cells were verified using immunofluorescence analysis. Inverted fluorescence microscopy revealed robust RV proliferation in the cytosol, i.e., green fluorescence, contrasting with the absence of green fluorescence in uninfected MA-104 cells (Fig. 6). Genotypic and genetic evolutionary analysis of VP7 and NSP4 genes Genetic evolutionary analyses were performed using BLAST software for each sequence comparison, selecting corresponding strains and representative strains from different hosts in GenBank The results are shown in Figs. 7 and 8, with 13-RV representing the strain from the present study. The VP7 strain, with a full sequence length of 1009 bp, exhibited the highest homology and 100% similarity to the Indian childhood G8 isolate. It occupied a relatively distinct evolutionary branch compared with other G8 strains of bovine and human origin. Conversely, the NSP4 strain, with a full sequence length of 724 bp, exhibited the most recent genetic relation to the neonatal isolate of NI55, with an amino acid similarity of 96%. Discussion RV infections present serious individual health and public health challenges, affecting >90% of infants and children worldwide before the age of 3. In the United States, annual healthcare costs associated with RV infections are $1–$352 million. RV-induced diarrhea not only affects the health of children globally but also causes a major economic burden [19] . RVs also pose a considerable threat to animals, especially young animals. In Sichuan, 98 out of 300 diarrheic piglets across 40 pig farms in 14 districts during 2017–2019 tested positive for RV, with an RV-positive rate of 32.6%. Following diarrhea outbreaks, a survey in northeastern Spain’s sheep farms revealed that 192 out of 203 lambs aged 50–60 days had sheep diarrhea syndrome, and necropsies performed on five severely symptomatic lambs indicated that all five were RV-positive, specifically G8P[1]-type A group RV, confirming this strain as a causative agent of the outbreak [10] . Hence, RVs pose a substantial risk to young animals. In China, most studies have focused on porcine and bovine RVs, leaving sheep RVs understudied. In our study, we collected anal swabs and small intestinal tissues from sheep with severe clinical diarrhea suspected of RV infection. RT-PCR confirmed the presence of RV in anal swab samples, and immunohistochemistry of the duodenum and jejunum indicated the presence of RV in the tips of intestinal villi. HE staining revealed various pathological phenomena, including intestinal mucosal epithelial cell necrosis, detachment, intestinal interstitial hemorrhage, and the presence of lymphocytes in the submucosal layer, consistent with pathological changes previously observed in the intestinal tract following RV infection in pigs [8] . Therefore, RV infection in clinically diarrheic sheep was established in the present study. In recent years, RVs have been frequently detected in bats and other animals, although virus isolation and characterization have been lacking [1,11,21] . In our study, RV isolation from anal swabs led to stable cytopathic lesions appearing by the 10th blind transmission. The observed cell alterations, including rounding, drawing, and detachment at 12 h after virus inoculation, aligned with those produced by canine RV . RV, a vesiculovirus without capsules, exhibits particle diameters of 66–75 nm [23] . In the present study, 70 nm–sized RV particles were observed using transmission electron microscopy, employing virus particle purification, sucrose density gradient centrifugation, deglycosylation centrifugation, and phosphotungstic acid negative staining. An indirect immunofluorescence test further confirmed specific fluorescence, validating the successful isolation of sheep RV. The Rotavirus Classification Working Group suggests naming corresponding gene fragments G[x]-Ix-Rx-Cx-Mx-Ax-Nx-Tx-Ex-Hx based on the RVA nucleotide homology threshold percentages of 80%, 80%, 85%, 83%, 84%, 81%, 79%, 85%, 85%, 85%, 85%, 85%, 85%, and 91% [23] . Sequencing of the genes encoding the structural protein VP7 and nonstructural protein NSP4 in RV determined genotypes G8 and E2, respectively. Genetic evolutionary analysis revealed that both VP7 and NSP4 are closely related to human RV. The reassignment of E2 has led to the emergence of new genotypes, exemplified by the identification of a novel G9P[8]-E2 RV in Japan in 2020, confirmed as a new RV strain produced by reassignment of the E2 genotype NSP4 from G9P[8] and G2P[4] strains [15] . In 2023, we detected and isolated a G9P[8]-E2 RV in China [17] . G8 sheep RVs have been reported in other countries, including the identification of G8P[1] sheep RV in Spain in 2008, G8P[1] goat RV in India in 2011, and the first report of G8P[1] sheep RV in Turkey in 2019 [24] . The lamb ORV-NT [22] strain and LLR [25] strain isolated in China were both G10P [15], whereas the sheep RV isolated in the present study was a G8-type, marking the first report of this genotype in Chinese sheep. Overall, this study provides key biological information for further in-depth research on the epidemiology, pathogenesis, prevention, and control of RV in Chinese sheep. Conclusions This study is the first to find and isolate G8-type rotavirus in diarrhoeic sheep in China, and lays the foundation for research studies on the epidemiology and pathogenic mechanism of rotavirus in sheep. Abbreviations RV: rotavirus HE: hematoxylin-eosin staining Declarations Acknowledgements We are grateful to DengSuai Zhao for the English language editing of the manuscript.We appreciate Haixue Zheng and Keshan Zhang for their excel technical assistance. Authors’ contributions Ping Li, WenYan Gai:Investigation,Visualization, Methodology. DengShuai Zhao, DaJun Zhang, Xing Yang, XiQian Shi, LingLing Chen, MeiYu Zhao, SiYue Zhao, GuoHui Chen, ,Lu He, WenQian Yan, XinTian Bei:Methodology, Formal analysis. YouJun Shang, HaiXue Zheng, KeShan Zhang:Conceptualization, Management and Disposal of Funds, Writing—Review & Editing, Supervision. Founding This research was funded by the technical system of the Cashmere Sheep Industry of China, grant number CARS-38-13, CARS-39. Data Availability All sequences used in this study can be shared via email if required. All other relevant information is provided in this manuscript. Ethics approval and consent to participate All animals were handled in strict accordance with goodanimal practice according to the Animal Ethics Proceduresand Guidelines of the People's Republic of China,and thestudy was approved by the Animal Ethics Committee of LVRI of the CAAS. Consent for publication Not applicable. Competing ints The authors declare that they have no conflict of interest. References Asano KM, Gregori F, Hora AS, Scheffer KC, Fahl WO, Iamamoto K, Mori E, Silva FD, Taniwaki SA, Brandão PE. Group A rotavirus in Brazilian bats: description of novel T15 and H15 genotypes. Arch Virol. 2016;161:3225-3230. Baños DM, Lopez S, Arias CF, Esquivel FR. Identification of a T-helper cell epitope on the rotavirus VP6 protein. J Virol.1997; 71:419-426. Boxman ILA, Jansen CCC, Hägele G, Zwartkruis-Nahuis A, Tijsma,ASL, Vennema H. Monitoring of pork liver and meat products on the Dutch market for the presence of HEV RNA. Int J Food Microbiol. 2019;296:58-64. Choi AH, Basu M, McNeal MM, Flint J, VanCott JL, Clements JD, Ward RL. Functional mapping of protective domains and epitopes in the rotavirus VP6 protein. J Virol. 2000;74:11574-11580. Ciarlet M, Hoffmann C, Lorusso E, Baselga R, Cafiero MA, Bányai K, Matthijnssens J, Parreño V, de Grazia S, Buonavoglia C, Martella V. Genomic characterization of a novel group A lamb rotavirus isolated in Zaragoza, Spain. Virus Genes.2008;37:250-265. Choudhary P, Minakshi P, Ranjan K, Basanti B. Zooanthroponotic transmission of rotavirus in Haryana State of Northern India. Acta Virol.2017; 61:77-85. Estes MK, Cohen J. Rotavirus gene structure and function. Microbiol Rev. 1989;53:410-449. Estes MK, Kang G, Zeng CQ, Crawford SE, Ciarlet M. Pathogenesis of rotavirus gastroenteritis. Novartis Found Symp.2001; 238:82-96. Fujii Y, Shimoike T, Takagi H, Murakami K, Todaka-Takai R, Park Y, Katayama K.Amplification of all 11 RNA segments of group A rotaviruses based on reverse transcription polymerase chain reaction. Microbiol Immunol.2012;56:630-638. Galindo-Cardiel I, Fernández-Jiménez M, Luján L, Buesa J, Espada J, Fantova E, Blanco J, Segalés J, Badiola JJ. Novel group A rotavirus G8 P[1] as primary cause of an ovine diarrheic syndrome outbreak in weaned lambs. Vet Microbiol.2011; 149:467-471. He B, Huang X, Zhang F, Tan W, Matthijnssens J, Qin S, Xu L, Zhao Z, Yang L, Wang Q, Hu T, Bao X, Wu J, Tu C. Group A Rotaviruses in Chinese Bats: Genetic Composition, Serology, and Evidence for Bat-to-Human Transmission and Reassortment. J Virol.2017; 91:e02493-16. Kumar N, Malik YS, Sharma K, Dhama K, Ghosh S, Bányai K, Kobayashi N, Singh RK. Molecular characterization of unusual bovine rotavirus A strains having high genetic relatedness with human rotavirus: evidence for zooanthroponotic transmission. Zoonoses Public Health.2018; 65:431-442. Lijun Yang,Yue Chen,WenQing Mi,Yitong Tang,Jiubo Fang,Yuan Wang,Shiying Liao,Huanchun Chen,Qigei He,Yunbo Jiang.Genetic characterization of human rotavirus type G9P[8] in some areas of Hubei in 2019-2020.Chinese Journal of Human Veterinary Diseases . 2022;38:359-365. Lee JB, Youn SJ, Nakagomi T, Park SY, Kim TJ, Song CS, Jang HK, Kim BS, Nakagomi O. Isolation, serologic and molecular characterization of the first G3 caprine rotavirus. Arch Virol.2003; 148:643-657. Lu Y, Li H, Li W, Wang X, Tao X, Dou L, Dong Y, Wu N, Li YG.Characterization of a G9 group A rotavirus reassortant strain detected in Jinzhou, China, in 2018-2019. Arch Virol. 2020;165:977-983. Papp H, Borzák R, Farkas S, Kisfali P, Lengyel G, Molnár P, Melegh B, Matthijnssens J, Jakab F, Martella V, Bányai K. Zoonotic transmission of reassortant porcine G4P[6] rotaviruses in Hungarian pediatric patients identified sporadically over a 15 year period. Infect Genet Evol.2013;19:71-80. Peng R, Li D, Wang J, Xiong G, Wang M, Liu D, Wei Y, Pang L, Sun X, Li H, Kong X, Shahar S, Duan Z.Reassortment and genomic analysis of a G9P[8]-E2 rotavirus isolated in China. Virol J.2023; 20:135. Saif LJ, Jiang B. Nongroup A rotaviruses of humans and animals. Curr Top Microbiol Immunol.1994;185:339-371. Parashar UD, Hummelman EG, Bresee JS, Miller MA, Glass RI. Global illness and deaths caused by rotavirus disease in children. Emerg Infect Dis. 2003;9:565-572. Steyer A, Poljšak-Prijatelj M, Barlič-Maganja D, Marin J. Human, porcine and bovine rotaviruses in Slovenia: evidence of interspecies transmission and genome reassortment. J Gen Virol.2008;89:1690-1698. Simsek C, Corman VM, Everling HU, Lukashev AN, Rasche A, Maganga GD, Binger T, Jansen D, Beller L, Deboutte W, Gloza-Rausch F, Seebens-Hoyer A, Yordanov S, Sylverken A, Oppong S, Sarkodie YA, Vallo P, Leroy EM, Bourgarel M, Yinda KC, Van Ranst M, Drosten C, Drexler JF, Matthijnssens J.At Least Seven Distinct Rotavirus Genotype Constellations in Bats with Evidence of Reassortment and Zoonotic Transmissions. mBio.2021;12:e02755-20. Shen S, Burke B, Desselberger U.Nucleotide sequences of the VP4 and VP7 genes of a Chinese lamb rotavirus: evidence for a new P type in a G10 type virus. Virology. 1993;197:497-500. Tacharoenmuang R, Guntapong R, Upachai S, Singchai P, Fukuda S, Ide T, Hatazawa R, Sutthiwarakom K, Kongjorn S, Onvimala N, Luechakham T, Ruchusatsawast K, Kawamura Y, Sriwanthana B, Motomura K, Tatsumi M, Takeda, N, Yoshikawa T, Murata T, Uppapong B, Taniguchi K, Komoto S.Full genome-based characterization of G4P[6] rotavirus strains from diarrheic patients in Thailand: Evidence for independent porcine-to-human interspecies transmission events. Virus Genes. 2021;57:338-357. Timurkan MÖ, Alkan F. Identification of rotavirus A strains in small ruminants: first detection of G8P[1] genotypes in sheep in Turkey. Arch Virol.2020;165:425-431. Mao T, Wang M, Wang J, Ma Y, Liu X, Wang M, Sun X, Li L, Li H, Zhang Q, Li D, Duan Z. Phylogenetic analysis of the viral proteins VP4/VP7 of circulating human rotavirus strains in China from 2016 to 2019 and comparison of their antigenic epitopes with those of vaccine strains. Front Cell Infect Microbiol.2022; 12:927490. Zhao Q, Liu L, Huang T, Tian Y, Guo X, Liu C, Huang B, Chen Q.Complete genomic analysis of rabbit rotavirus G3P[22] in China. Arch Virol.2023; 168:129. Additional Declarations No competing interests reported. Supplementary Files DuodenumofdiseasedsheepHE1.1x.tif DuodenumofdiseasedsheepROT1.1x.tif DuodenumofhealthysheepHE2.0x.tif IleumofdiseasedsheepHE2.0x.tif IleumofhealthysheepHE2.0x.tif JejunumofdiseasedsheepHE1.7x.tif JejunumofdiseasedsheepROT2.0x.tif JejunumofhealthysheepHE0.8x.tif MOCKAntiVP6.tif MOCKDAPI.tif MOCKMerge.tif Nucleicacidelectropherogram.png RVAntiVP6.tif RVDAPI.tif RVMerge.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3788278","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":264351623,"identity":"65f4649d-45b1-4788-92cd-54980e3ac6af","order_by":0,"name":"Ping Li","email":"","orcid":"","institution":"Tarim University","correspondingAuthor":false,"prefix":"","firstName":"Ping","middleName":"","lastName":"Li","suffix":""},{"id":264351625,"identity":"82314f79-74a0-4bfb-bc02-32aa0da47a95","order_by":1,"name":"WenYan Gai","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"WenYan","middleName":"","lastName":"Gai","suffix":""},{"id":264351626,"identity":"93cf3d36-06e5-4809-a030-1f88900a83a7","order_by":2,"name":"DengShuai Zhao","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"DengShuai","middleName":"","lastName":"Zhao","suffix":""},{"id":264351629,"identity":"fff136b9-0de9-4b80-af02-c4cda4ec8027","order_by":3,"name":"DaJun Zhang","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"DaJun","middleName":"","lastName":"Zhang","suffix":""},{"id":264351630,"identity":"25af6963-c440-44bc-a958-e8589f1f05bd","order_by":4,"name":"Xing Yang","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Xing","middleName":"","lastName":"Yang","suffix":""},{"id":264351631,"identity":"6187188d-ca40-4782-86c6-d9288e00badd","order_by":5,"name":"XiJuan Shi","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"XiJuan","middleName":"","lastName":"Shi","suffix":""},{"id":264351633,"identity":"746633f2-878f-42d5-b95e-7b45686893fd","order_by":6,"name":"LingLing Chen","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"LingLing","middleName":"","lastName":"Chen","suffix":""},{"id":264351634,"identity":"884da4a7-fb76-4c82-9a7a-ae735fb9284a","order_by":7,"name":"MeiYu Zhao","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"MeiYu","middleName":"","lastName":"Zhao","suffix":""},{"id":264351635,"identity":"76e6ccb7-ed3c-4611-8a60-06d4df7ad809","order_by":8,"name":"SiYue Zhao","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"SiYue","middleName":"","lastName":"Zhao","suffix":""},{"id":264351636,"identity":"ec496ed8-69e2-45a1-974a-5310527f5368","order_by":9,"name":"GuoHui Chen","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"GuoHui","middleName":"","lastName":"Chen","suffix":""},{"id":264351637,"identity":"28c79142-e68a-4e9d-a3a0-952ff5cb44a6","order_by":10,"name":"Lu He","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"He","suffix":""},{"id":264351638,"identity":"253e1be2-c610-4ec6-b789-9f7936a78776","order_by":11,"name":"WenQian Yan","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"WenQian","middleName":"","lastName":"Yan","suffix":""},{"id":264351639,"identity":"60f19f11-c0c5-4923-89af-b85be708d989","order_by":12,"name":"XinTian Bei","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"XinTian","middleName":"","lastName":"Bei","suffix":""},{"id":264351640,"identity":"1783373c-f3e0-46a0-87b6-c66c883baba2","order_by":13,"name":"YouJun Shang","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"YouJun","middleName":"","lastName":"Shang","suffix":""},{"id":264351641,"identity":"7c0f5762-2fd4-4e67-bb59-6541ccbac292","order_by":14,"name":"HaiXue Zheng","email":"","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"HaiXue","middleName":"","lastName":"Zheng","suffix":""},{"id":264351642,"identity":"7de5c64b-af6b-40ac-803b-829451269ede","order_by":15,"name":"KeShan Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuElEQVRIiWNgGAWjYDACHgaGAwkVNjz87A3Ea2F88OFMmoxkzwHitTAbzmw7bGNww4FIHfI9x59J87ad52G4wcD44WMOEVoYe3vMpHnO3eZhnN3ALDlzGxFamPl52KR5ym7zMMscYGPmJUYLGz/7M2ketnM8bBIJRGrh4W0wNpzRdoCHh2gtEjxnDIGBnMwjwXOwmTi/yPekPwBGpZ29/fHmgx8+EqMFCTA2kKZ+FIyCUTAKRgFuAACEDjK1x8XznQAAAABJRU5ErkJggg==","orcid":"","institution":"Lanzhou University, Chinese Academy of Agricultural Sciences","correspondingAuthor":true,"prefix":"","firstName":"KeShan","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2023-12-21 17:59:40","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3788278/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3788278/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49052109,"identity":"ca5763ac-8686-40e5-9949-9cf623ca9fdb","added_by":"auto","created_at":"2024-01-02 10:18:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1675315,"visible":true,"origin":"","legend":"\u003cp\u003eRotavirus PT-PCR test results\u003c/p\u003e\n\u003cp\u003eM:DL 2 000 DNA Marker.1: anal swab sample from sheep with clinical diarrhea.2: negative control.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/a7c075dd869dd81aa9a692d3.png"},{"id":49052116,"identity":"f49d6224-7da4-4f86-a0d6-df6834f9906a","added_by":"auto","created_at":"2024-01-02 10:18:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3933013,"visible":true,"origin":"","legend":"\u003cp\u003eHE staining of pathological sections (20×)\u003c/p\u003e\n\u003cp\u003eA:Duodenum of healthy sheep. B:Duodenum of diseased sheep. C:Jejunum of healthy sheep. D:Jejunum of diseased sheep. E:Ileum of healthy sheep. F:Ileum of diseased sheep. The intestinal tissue is structurally disturbed, with extensive necrosis in the mucosal layer (red arrow), localised connective tissue hyperplasia in the submucosal layer with a small lymphocytic infiltrate (blue arrow), extensive necrosis of the intestinal glands in the lamina propria, with necrotic cellular debris, and interstitial vascular haemorrhage (yellow arrow).\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/86784152ae6f39810bb12d25.png"},{"id":49052315,"identity":"c216d965-7cb3-41b7-b6fd-74956d25029d","added_by":"auto","created_at":"2024-01-02 10:26:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1881581,"visible":true,"origin":"","legend":"\u003cp\u003eImmunohistochemical\u003c/p\u003e\n\u003cp\u003eA: Duodenum B: Jejunum\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/a9e43d1f14140d561d4bd939.png"},{"id":49052313,"identity":"1afaf4f0-dd85-4c92-8eae-d37f3fa0665b","added_by":"auto","created_at":"2024-01-02 10:26:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":684376,"visible":true,"origin":"","legend":"\u003cp\u003eCell lesion of MA-104 inoculated isolates\u003c/p\u003e\n\u003cp\u003eA: normal cells. B: Cells at 12h of rotavirus infection\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/fc46fb91628b4c2b0964fead.png"},{"id":49052111,"identity":"7fc90542-66d4-492b-817b-198132dd60e0","added_by":"auto","created_at":"2024-01-02 10:18:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":451866,"visible":true,"origin":"","legend":"\u003cp\u003eThe isolates were observed by projective electron microscopy\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/a3ef35ade023b7bb3bd7420e.png"},{"id":49052115,"identity":"ac8802ed-6471-4bf8-9129-34d605cf5e8a","added_by":"auto","created_at":"2024-01-02 10:18:09","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1331404,"visible":true,"origin":"","legend":"\u003cp\u003eIndirect immunofluorescence assay of isolates\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/a3ee5be9704a7f68abd3838b.png"},{"id":49052314,"identity":"66c9ac97-cf16-4408-9ef5-399eb2c290e6","added_by":"auto","created_at":"2024-01-02 10:26:09","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":754719,"visible":true,"origin":"","legend":"\u003cp\u003eEvolutionary tree analysis of VP7 gene in isolates\u003c/p\u003e\n\u003cp\u003e•:this study\u003c/p\u003e","description":"","filename":"Fig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/6411c19d27e8f6007fd98c4e.png"},{"id":49052113,"identity":"b5e3f4f9-c1c7-4204-8755-a39ff3b511eb","added_by":"auto","created_at":"2024-01-02 10:18:09","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":548926,"visible":true,"origin":"","legend":"\u003cp\u003eNSP4 gene evolutionary tree analysis of isolates\u003c/p\u003e\n\u003cp\u003e•:this study\u003c/p\u003e","description":"","filename":"Fig.8.png","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/19277daf569575732b1ab851.png"},{"id":55275609,"identity":"fdb4f407-97ec-4cac-a712-89200d3e04b7","added_by":"auto","created_at":"2024-04-25 04:39:11","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5514919,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/470e037d-93ff-479d-8491-8355eee1fd7b.pdf"},{"id":49052123,"identity":"5e2dd7f9-f4a7-4016-9829-291a776e258c","added_by":"auto","created_at":"2024-01-02 10:18:10","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":5765924,"visible":true,"origin":"","legend":"","description":"","filename":"DuodenumofdiseasedsheepHE1.1x.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/15a2ce820c377ce895178e1b.tif"},{"id":49052128,"identity":"167a0d82-00dc-40d6-b52e-118b34a9b9e7","added_by":"auto","created_at":"2024-01-02 10:18:10","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":5765924,"visible":true,"origin":"","legend":"","description":"","filename":"DuodenumofdiseasedsheepROT1.1x.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/da1f155a8cfe303a7f8bfd47.tif"},{"id":49052118,"identity":"d6887416-e87d-4a8b-ab1c-a0d6b88bd0a9","added_by":"auto","created_at":"2024-01-02 10:18:10","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":5765924,"visible":true,"origin":"","legend":"","description":"","filename":"DuodenumofhealthysheepHE2.0x.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/acf182e0a619cd2608439b5b.tif"},{"id":49052319,"identity":"42fdfa72-e4d0-4934-be37-7c4368e3eefc","added_by":"auto","created_at":"2024-01-02 10:26:10","extension":"tif","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":5765924,"visible":true,"origin":"","legend":"","description":"","filename":"IleumofdiseasedsheepHE2.0x.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/8719ce5fed2583171a0afcb8.tif"},{"id":49052125,"identity":"11bbc7ad-c984-4540-b77a-10a207dc59a6","added_by":"auto","created_at":"2024-01-02 10:18:10","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"supplement","size":5765924,"visible":true,"origin":"","legend":"","description":"","filename":"IleumofhealthysheepHE2.0x.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/967cc76648cf434ccd5a7a19.tif"},{"id":49052126,"identity":"7343a558-a0ac-43d5-8e2c-34eb0f9bafb9","added_by":"auto","created_at":"2024-01-02 10:18:10","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"supplement","size":5765924,"visible":true,"origin":"","legend":"","description":"","filename":"JejunumofdiseasedsheepHE1.7x.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/5aeda0a0a64cdc20914f77d8.tif"},{"id":49052559,"identity":"9cc8eaed-4e82-4899-99e3-5ac6b42930e9","added_by":"auto","created_at":"2024-01-02 10:34:10","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"supplement","size":5765924,"visible":true,"origin":"","legend":"","description":"","filename":"JejunumofdiseasedsheepROT2.0x.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/bb1968f724bf7cb04983e9ba.tif"},{"id":49052317,"identity":"640f60d7-0dbb-4730-bbf2-4b7df81be562","added_by":"auto","created_at":"2024-01-02 10:26:10","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"supplement","size":5765924,"visible":true,"origin":"","legend":"","description":"","filename":"JejunumofhealthysheepHE0.8x.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/a74f92948e3da7b03d731b89.tif"},{"id":49052320,"identity":"8050963d-c3fe-4a47-8aa7-700274c57481","added_by":"auto","created_at":"2024-01-02 10:26:10","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"supplement","size":3158361,"visible":true,"origin":"","legend":"","description":"","filename":"MOCKAntiVP6.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/cccc45b664956c26de16f891.tif"},{"id":49052117,"identity":"33a03066-14c9-40d9-aaea-804a4affe223","added_by":"auto","created_at":"2024-01-02 10:18:10","extension":"tif","order_by":20,"title":"","display":"","copyAsset":false,"role":"supplement","size":3158370,"visible":true,"origin":"","legend":"","description":"","filename":"MOCKDAPI.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/2febad2fdea955f9b31cf88a.tif"},{"id":49052130,"identity":"fd13c8fd-074c-451a-9ce2-af239cadb00e","added_by":"auto","created_at":"2024-01-02 10:18:10","extension":"tif","order_by":21,"title":"","display":"","copyAsset":false,"role":"supplement","size":9479083,"visible":true,"origin":"","legend":"","description":"","filename":"MOCKMerge.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/e9fc5d8fbda4aad29b42375d.tif"},{"id":49052316,"identity":"05d968f2-b059-4b13-849c-25205bf1343e","added_by":"auto","created_at":"2024-01-02 10:26:10","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"supplement","size":672442,"visible":true,"origin":"","legend":"","description":"","filename":"Nucleicacidelectropherogram.png","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/5d64cefd72dbfb7ce46d4ad3.png"},{"id":49052120,"identity":"18edc816-3253-4b7c-9d23-1cefff6baf74","added_by":"auto","created_at":"2024-01-02 10:18:10","extension":"tif","order_by":23,"title":"","display":"","copyAsset":false,"role":"supplement","size":3158373,"visible":true,"origin":"","legend":"","description":"","filename":"RVAntiVP6.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/b3bf0ff66a95c3f70c762c39.tif"},{"id":49052119,"identity":"d97593bd-f9a7-467e-bb8a-e9527314f364","added_by":"auto","created_at":"2024-01-02 10:18:10","extension":"tif","order_by":24,"title":"","display":"","copyAsset":false,"role":"supplement","size":3158382,"visible":true,"origin":"","legend":"","description":"","filename":"RVDAPI.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/ee9ffd97a88dc15e83d2289a.tif"},{"id":49052131,"identity":"5ac9a1f9-459b-43ea-96de-7696e311b63b","added_by":"auto","created_at":"2024-01-02 10:18:10","extension":"tif","order_by":25,"title":"","display":"","copyAsset":false,"role":"supplement","size":9479121,"visible":true,"origin":"","legend":"","description":"","filename":"RVMerge.tif","url":"https://assets-eu.researchsquare.com/files/rs-3788278/v1/5c0cf8481e1144adc65b3d54.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Isolation and molecular characterization of the first G8-type sheep rotavirus identified in China","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRotavirus (RV), a common enteric pathogen causing acute watery diarrhea in humans, other mammals, and birds, is an major zoonotic threat. RV is a leading cause of severe gastroenteritis globally in infants and young children, resulting in more than 500,000 annual deaths, particularly in developing countries\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Similarly, RV-associated enteritis poses a notable health risk to young cattle, horses, sheep, and piglets. Previous studies have indicated that RV infection is a leading cause of diarrhea in lambs, markedly impacting sheep farms.\u003c/p\u003e\n\u003cp\u003eRV, characterized as a double-stranded RNA virus, in the \u003cem\u003eRotavirus\u003c/em\u003e genus of the family \u003cem\u003eReoviridae\u003c/em\u003e, presents as an icosahedron lacking a capsid, with particles meausring 66\u0026ndash;75 nm in diameter. Its genome, approximately 18,522 bp long, comperises 11 segments of double-stranded RNA\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. These segments encode six types of structural proteins (VP1-VP4, VP6, and VP7) and five nonstructural proteins (NSP1-NSP5)\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. VP6, as the intermediate capsid layer, is an important immunogenic viral protein. Classification based on VP6 categorizes RVs into seven serogroups (types: A-G) and two subgroups (Ⅰ and Ⅱ)\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Among these, subgroup A RVs are the primary contributors gastrointestinal diseases in humans and animals. Surface coat proteins, VP4 and VP7, play pivotal roles in viral replication, inducing protective immunity neutralizing antibody production and adsorption and invasion regulation in the early stages of replication.\u003c/p\u003e\n\u003cp\u003eStudies have shown that RV-type A from porcine and bovine sources can be transmitted to humans\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. This transmission is related to RVs\u0026rsquo; rapid mutation rate, genotypic complexity, and the ability of both heterologous and homologous strains to reassort and rearrange, creating new strains and expanding their host range. Evidence of recombination with human RV genes has been observed in RVs, such as Spanish sheep 762 strain G8P[14] type\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e, Korean goat GRV strain G3P[5] type\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e,and Indian goat strain G1P[8] type\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. This phenomenon not only poses a challenge for RV prevention and control in sheep but also represents a threat to public health safety. Therefore, the present study, we conducted pathogen detection, virus isolation and identification, and genetic evolution analyses of sheep with clinical diarrhea from a Gansu sheep farm, with the objective of providing key biological materials for understanding the genetic evolution of sheep RVs, enhancing epidemic prevention and control, and developing prevention and control products.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eMaterials\u003c/p\u003e\n\u003cp\u003eSample collection\u003c/p\u003e\n\u003cp\u003eIn 2023, anal swabs were collected from clinically diarrheic and clinically healthy sheep at a Gansu sheep farm. Following dissection, the duodenum, jejunum, and ileum were collected and individually preserved in 4% general-purpose tissue fixative.\u003c/p\u003e\n\u003cp\u003eReagents and cells\u003c/p\u003e\n\u003cp\u003eRNA reverse transcription reagents, including 5\u0026times; PrimeScript RT Master Mix, TB Green Premix Ex Taq\u0026trade; II, 0.25% EDTA trypsin, and fetal bovine serum, were purchased from Shanghai Bioscience Biotechnology Company Limited. RNA extraction reagents, including Trizol, 0.25% EDTA trypsin, and Dulbecco\u0026rsquo;s Modified Eagle Medium, were obtained from Lanzhou Lihe Biotechnology Company. In addition, 2\u0026times;Taq Master Mix and DL2000 Plus DNA Marker were purchased from Nanjing Novozymes Bio-technology Company. Anhydrous ethanol, chloroform, and isopropanol were obtained from Kangwei Century Bio-technology Company. Tissue fixative was purchased from Beijing Solabao Technology Company, and anti-RV-VP6 protein monoclonal antibody (2B4) was obtained from Santa Cruz Biotechnology Company. MA-104 cells were provided by Lanzhou Institute of Veterinary Medicine, Chinese Academy of Agricultural Sciences.\u003c/p\u003e\n\u003cp\u003eMethods\u003c/p\u003e\n\u003cp\u003eRV testing\u003c/p\u003e\n\u003cp\u003eAnal swabs were placed into 1 mL of precooled phosphate-buffered saline (PBS), thoroughly vortexed, and processed. Following three cycles of freezing and thawing, the samples underwent centrifugation at 4℃ and 12,000 rpm for 10 min. Subsequentiy, and 200 \u0026micro;L of the supernatant was used for total RNA extraction with TRIzol reagent. The remaining supernatant was stored at \u0026minus;\u0026thinsp;80℃ for future use. Extracted extracted RNA was reverse-transcribed at 37℃ for 15 min, 85℃ for 5 s and 4℃ for extension. RV was detected using the specific primers RV-F and RV-R(Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The amplified fragment size was 160 bp. The PCR reaction system (50 \u0026micro;L) comprised 25 \u0026micro;L of 2\u0026times;Taq Master Mix, 1 \u0026micro;L of upstream primer VP6-F, 1 \u0026micro;L of downstream primer VP6-R, 2 \u0026micro;L of cDNA template, and 50 \u0026micro;L of H\u003csub\u003e2\u003c/sub\u003eO added to the final volume. The PCR reaction conditions were as follows: denaturation at 95℃ for 3 min; cycling at 95℃ for 30 s, 50℃ for 30 s, 72℃ for 1 min, for 35 cycles; and extension at 72℃ for 10 min, with a final extension at 4℃.The PCR products were subjected to 1.5% agarose gel electrophoresis to detect amplified fragments sizes, after which they sequenced by Xi\u0026apos;an Prime Jersey Biotechnology.\u003c/p\u003e\n\u003cp\u003eHistopathology and immunohistochemistry\u003c/p\u003e\n\u003cp\u003ePathological sections of the duodenum, jejunum and ileum both clinically diarrheic and clinically healthy sheep were subjected to hematoxylin and eosin (HE) staining and immunohistochemistry, with analysis conducted by Wuhan Xavier Biotechnology Company.\u003c/p\u003e\n\u003cp\u003eVirus isolation workflow\u003c/p\u003e\n\u003cp\u003eFor improved virus invasion into the cells, trypsin at a final concentration of 15 \u0026micro;g/mL and 1% of double antibody (100 U/mL penicillin and 100 \u0026micro;g/mL streptomycin) were added to the supernatant of pretreated positive samples. After a 1 hand activation in a 37℃ water bath, MA-104 cells, grown into a monolayer, were separated from the culture medium, rinsed with PBS for three times, and treated with trypsin-activated RV solution. The cells were then incubated at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e, with the virus solution gently shaken every 30 min to ensure sufficient and uniform virus absorption into the cells. After 2 h, the virus solution, was discarded, the cells were rinsed with PBS for 2\u0026ndash;3 times, and cell maintenance solution was added with a final trypsin concentration of 4 \u0026micro;g/mL. A negative control group without trypsin was established.Cell lesions were observed for approximately 3 days in an incubator at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e. After obvious lesions appeared in the inoculated cells, they were stored at \u0026minus;\u0026thinsp;80\u0026deg;C, frozen and thawed three times, centrifuged at 4\u0026deg;C and 12,000 rpm for 10 min to remove large cellular debris and other components, and the supernatant (viral liquid) was collected and stored at \u0026minus;\u0026thinsp;80\u0026deg;C for the next inoculation. Subsequently, the virus was passed blindly to the 10th generation.\u003c/p\u003e\n\u003cp\u003eTransmission electron microscopy\u003c/p\u003e\n\u003cp\u003eA 150 mL portion of the 10th generation virus was added to a 20% sucrose-bottomed ultracentrifuge tube and centrifuged at 170,000 g/min, 4℃ for 4 h. The supernatant was slowly discarded, and the virus was resuspended in an EP tube with 1 mL of PBS and spun at 4℃ overnight. On the following day, the virus was centrifuged in a sucrose density gradient at 220,000 g/min, and 4℃ for 4 h. The virus was then resuspended in the bottom of the tube with 500 ul PBS and subjected to desugarization centrifugation at 220 000 g/min, 4 ℃ for 2 h. The virus was then resuspended with 500 \u0026micro;L PBS in a 2% phosphotungstic acid negative staining solution, followed by observation under a transmission electron microscope.\u003c/p\u003e\n\u003cp\u003eIndirect immunofluorescence assay\u003c/p\u003e\n\u003cp\u003eMA-104 cells were inoculated into 24-well plates. When cells covered about 80% of the well bottoms, they were inoculated with virus solution. Negative control wells were established without the virus. After the inoculated cells displayed lesions, the medium was discarded, and the cells were washed with precooled PBS for once or twice for 5 min per wash. Fixation was performed using 4% paraformaldehyde for 1 h at room temperature, after which the liquid was discarded and the cells were washed three times with precooled PBS for 5 min per wash. For transfiltration, 0.1% Triton-X-100 was added to the cells, which were then allowed to stand for 30 min at room temperature. Subsequently, the liquid was discarded, and the cells were washed with precooled PBS for three times for 5 min per wash. For the closure step, 5% bovine serum albumin was added, and the cells were closed for 1 h at room temperature, followed by inoculation with virus solution. DAPI (1:3000 dilution) was added, and after 7 min in the dark, the cells were rinsed three times with precooled PBST at room temperature for 5 min per wash. Finally, the cells were observed under an inverted fluorescence microscope.\u003c/p\u003e\n\u003cp\u003eRT-PCR and sequencing\u003c/p\u003e\n\u003cp\u003eViral RNA was extracted from the supernatant using TRIzol reagent (Takara, Dalian, China) according to the manufacturer\u0026rsquo;s instructions. Viral cDNA was obtained through reverse transcription using the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China) following the manufacturer\u0026rsquo;s instructions. For VP7 and VP4 amplification, primers targeting \u003cem\u003eVP7\u003c/em\u003e and \u003cem\u003eNSP4\u003c/em\u003e were used (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Conventional RT-PCR was used to amplify the complete \u003cem\u003eVP7\u003c/em\u003e and \u003cem\u003eNSP4\u003c/em\u003e genes. After purification, the products were cloned into the pMD-18T vector (TaKaRa, Dalian, China) for sequencing.\u003c/p\u003e\n\u003cp\u003eTable 1 Primers for detection of rotavirus(RV-F and RV-R) and amplification of VP7 and NSP4 genes\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence(5\u0026rsquo;\u0026minus;3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRV-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGATGTCCTGTACTCCTTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" align=\"left\"\u003e\n \u003cp\u003e[3]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRV-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGTAGATTACCAATTCCTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVP7-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCTTTAAAAGAGAGAATTTCCGTCTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" align=\"left\"\u003e\n \u003cp\u003e[26]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVP7-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGTCACATCATACAATTCTAATCTAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNSP4-F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCTTTTAAAAGTTCTGTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" align=\"left\"\u003e\n \u003cp\u003e[26]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNSP4-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGTCACACTAAGACCATTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\"\u003eAbbreviations: F:Foward primer. R:Reverse primer. RV:rotavirus.VP7、NSP4:VP7 and NSP4 are genes for structural and nonstructural proteins of rotaviruses, respectively.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eSequence alignment and genetic evolution analysis\u003c/p\u003e\n\u003cp\u003eThe isolate full-length \u003cem\u003eVP7\u003c/em\u003e and \u003cem\u003eNSP4\u003c/em\u003e gene were subjected to sequence comparison and a phylogenetic tree was constructed using MEGA 11 phylogenetic analysis software.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eRotavirus detection\u003c/p\u003e\n\u003cp\u003eIn this study, anal swabs were obtained from sheep with clinical diarrhea in a Gansu sheep farm. The affected sheep mainly exhibited watery diarrhea. RT-PCR confirmed the presence of RV (Fig. 1), and sequencing results confirmed RV infection.\u003c/p\u003e\n\u003cp\u003eHistopathology and immunohistochemistry\u003c/p\u003e\n\u003cp\u003eHE staining of the duodenum, jejunum, and ileum from clinically healthy sheep revealed no obvious pathological changes. However, in diseased sheep, the duodenum exhibited disorganized tissue structure, extensive mucosal layer necrosis, and widespread necrosis and detachment of mucosal epithelial cells. Additionally, there was visible necrosis of the intestinal glands in the lamina propria, accompanied by necrotic cellular fragments. The submucosal layer showed localized connective tissue proliferation with a small amount of lymphocytic infiltration. The jejunum and ileum were disorganized, with extensive necrosis of the mucosal layer, widespread necrosis and detachment of mucosal epithelial cells, necrosis of the intestinal glands in the lamina propria, and many necrotic cell fragments; additionally, the ileum exhibited mesenteric vascular stasis (Fig. 2).\u003c/p\u003e\n\u003cp\u003eImmunohistochemistry was negative in the duodenum, jejunum, and ileum of clinically healthy sheep. However, it was locally positive in both the duodenum and jejunum of diseased sheep (Fig. 3).\u003c/p\u003e\n\u003cp\u003eRotavirus isolation\u003c/p\u003e\n\u003cp\u003eRV isolation on MA-104 cells involved blind passage to the 10th generation, which revealed notable cytopathic lesions (CPEs). Following cell inoculation, evident CPE emerged after 12 h of incubation. Normal MA-104 cells exhibited good translucency and clear edges, whereas virus-inoculated cells displayed crumpling, pulling, and shedding (Fig. 4).\u003c/p\u003e\n\u003cp\u003eTransmission electron microscopy identification\u003c/p\u003e\n\u003cp\u003eTransmission electron microscopy clearly showed typical intact RV particles with a diameter of approximately 70 nm (Fig. 5). These findings are consistent with RV characteristics.\u003c/p\u003e\n\u003cp\u003eIndirect immunofluorescence virus identification\u003c/p\u003e\n\u003cp\u003eAfter 12 h of virus inoculation, MA-104 cells were verified using immunofluorescence analysis. Inverted fluorescence microscopy revealed robust RV proliferation in the cytosol, i.e., green fluorescence, contrasting with the absence of green fluorescence in uninfected MA-104 cells (Fig. 6).\u003c/p\u003e\n\u003cp\u003eGenotypic and genetic evolutionary analysis of \u003cem\u003eVP7\u003c/em\u003e and \u003cem\u003eNSP4\u003c/em\u003e genes\u003c/p\u003e\n\u003cp\u003eGenetic evolutionary analyses were performed using BLAST software for each sequence comparison, selecting corresponding strains and representative strains from different hosts in GenBank The results are shown in Figs. 7 and 8, with 13-RV representing the strain from the present study.\u003c/p\u003e\n\u003cp\u003eThe VP7 strain, with a full sequence length of 1009 bp, exhibited the highest homology and 100% similarity to the Indian childhood G8 isolate. It occupied a relatively distinct evolutionary branch compared with other G8 strains of bovine and human origin. Conversely, the NSP4 strain, with a full sequence length of 724 bp, exhibited the most recent genetic relation to the neonatal isolate of NI55, with an amino acid similarity of 96%.\u003c/p\u003e"},{"header":"Discussion ","content":"\u003cp\u003eRV infections present serious individual health and public health challenges, affecting \u0026gt;90% of infants and children worldwide before the age of 3. In the United States, annual healthcare costs associated with RV infections are $1\u0026ndash;$352 million. RV-induced diarrhea not only affects the health of children globally but also causes a major economic burden\u003csup\u003e[19]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eRVs also pose a considerable threat to animals, especially young animals. In Sichuan, 98 out of 300 diarrheic piglets across 40 pig farms in 14 districts during 2017\u0026ndash;2019 tested positive for RV, with an RV-positive rate of 32.6%. Following diarrhea outbreaks, a survey in northeastern Spain\u0026rsquo;s sheep farms revealed that 192 out of 203 lambs aged 50\u0026ndash;60 days had sheep diarrhea syndrome, and necropsies performed on five severely symptomatic lambs indicated that all five were RV-positive, specifically G8P[1]-type A group RV, confirming this strain as a causative agent of the outbreak\u003csup\u003e[10]\u003c/sup\u003e. Hence, RVs pose a substantial risk to young animals.\u003c/p\u003e\n\u003cp\u003eIn China, most studies have focused on porcine and bovine RVs, leaving sheep RVs understudied. In our study, we collected anal swabs and small intestinal tissues from sheep with severe clinical diarrhea suspected of RV infection. RT-PCR confirmed the presence of RV in anal swab samples, and immunohistochemistry of the duodenum and jejunum indicated the presence of RV in the tips of intestinal villi. HE staining revealed various pathological phenomena, including intestinal mucosal epithelial cell necrosis, detachment, intestinal interstitial hemorrhage, and the presence of lymphocytes in the submucosal layer, consistent with pathological changes previously observed in the intestinal tract following RV infection in pigs\u003csup\u003e[8]\u003c/sup\u003e. Therefore, RV infection in clinically diarrheic sheep was established in the present study.\u003c/p\u003e\n\u003cp\u003eIn recent years, RVs have been frequently detected in bats and other animals, although virus isolation and characterization have been lacking\u003csup\u003e[1,11,21]\u003c/sup\u003e. In our study, RV isolation from anal swabs led to stable cytopathic lesions appearing by the 10th blind transmission. The observed cell alterations, including rounding, drawing, and detachment at 12 h after virus inoculation, aligned with those produced by canine RV . RV, a vesiculovirus without capsules, exhibits particle diameters of 66\u0026ndash;75 nm\u003csup\u003e[23]\u003c/sup\u003e. In the present study, 70 nm\u0026ndash;sized RV particles were observed using transmission electron microscopy, employing virus particle purification, sucrose density gradient centrifugation, deglycosylation centrifugation, and phosphotungstic acid negative staining. An indirect immunofluorescence test further confirmed specific fluorescence, validating the successful isolation of sheep RV.\u003c/p\u003e\n\u003cp\u003eThe Rotavirus Classification Working Group suggests naming corresponding gene fragments G[x]-Ix-Rx-Cx-Mx-Ax-Nx-Tx-Ex-Hx based on the RVA nucleotide homology threshold percentages of 80%, 80%, 85%, 83%, 84%, 81%, 79%, 85%, 85%, 85%, 85%, 85%, 85%, and 91%\u003csup\u003e[23]\u003c/sup\u003e. Sequencing of the genes encoding the structural protein VP7 and nonstructural protein NSP4 in RV determined genotypes G8 and E2, respectively. Genetic evolutionary analysis revealed that both VP7 and NSP4 are closely related to human RV. The reassignment of \u003cem\u003eE2\u003c/em\u003e has led to the emergence of new genotypes, exemplified by the identification of a novel G9P[8]-E2 RV in Japan in 2020, confirmed as a new RV strain produced by reassignment of the E2 genotype NSP4 from G9P[8] and G2P[4] strains\u003csup\u003e[15]\u003c/sup\u003e. In 2023, we detected and isolated a G9P[8]-E2 RV in China\u003csup\u003e[17]\u003c/sup\u003e. G8 sheep RVs have been reported in other countries, including the identification of G8P[1] sheep RV in Spain in 2008, G8P[1] goat RV in India in 2011, and the first report of G8P[1] sheep RV in Turkey in 2019\u003csup\u003e[24]\u003c/sup\u003e. The lamb ORV-NT\u003csup\u003e[22]\u003c/sup\u003e strain and LLR\u003csup\u003e[25]\u003c/sup\u003e strain isolated in China were both G10P [15], whereas the sheep RV isolated in the present study was a G8-type, marking the first report of this genotype in Chinese sheep. Overall, this study provides key biological information for further in-depth research on the epidemiology, pathogenesis, prevention, and control of RV in Chinese sheep.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis study is the first to find and isolate G8-type rotavirus in diarrhoeic sheep in China, and lays the foundation for research studies on the epidemiology and pathogenic mechanism of rotavirus in sheep.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eRV: rotavirus\u003c/p\u003e\n\u003cp\u003eHE: hematoxylin-eosin staining\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eWe are grateful to DengSuai Zhao for the English language editing of the manuscript.We appreciate Haixue Zheng and Keshan Zhang for their excel technical assistance.\u003c/p\u003e\n\u003cp\u003eAuthors\u0026rsquo; contributions\u003c/p\u003e\n\u003cp\u003ePing Li, WenYan Gai:Investigation,Visualization, Methodology. DengShuai Zhao, DaJun Zhang, Xing Yang, XiQian Shi, LingLing Chen, MeiYu Zhao, SiYue Zhao, GuoHui Chen, ,Lu He, WenQian Yan, XinTian Bei:Methodology, Formal analysis. YouJun Shang, HaiXue Zheng, KeShan Zhang:Conceptualization, Management and Disposal of Funds, Writing\u0026mdash;Review \u0026amp; Editing, Supervision.\u003c/p\u003e\n\u003cp\u003eFounding\u003c/p\u003e\n\u003cp\u003eThis research was funded by the technical system of the Cashmere Sheep Industry of China, grant number CARS-38-13, CARS-39.\u003c/p\u003e\n\u003cp\u003eData Availability\u003c/p\u003e\n\u003cp\u003eAll sequences used in this study can be shared via email if required. All other relevant information is provided in this manuscript.\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eAll animals were handled in strict accordance with goodanimal practice according to the Animal Ethics Proceduresand Guidelines of the People\u0026apos;s Republic of China,and thestudy was approved by the Animal Ethics Committee of LVRI of the CAAS.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eCompeting ints\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAsano KM, Gregori F, Hora AS, Scheffer KC, Fahl WO, Iamamoto K, Mori E, Silva FD, Taniwaki SA, Brand\u0026atilde;o PE. Group A rotavirus in Brazilian bats: description of novel T15 and H15 genotypes. Arch Virol. 2016;161:3225-3230.\u003c/li\u003e\n\u003cli\u003eBa\u0026ntilde;os DM, Lopez S, Arias CF, Esquivel FR. Identification of a T-helper cell epitope on the rotavirus VP6 protein. J Virol.1997; 71:419-426.\u003c/li\u003e\n\u003cli\u003eBoxman ILA, Jansen CCC, H\u0026auml;gele G, Zwartkruis-Nahuis A, Tijsma,ASL, Vennema H. Monitoring of pork liver and meat products on the Dutch market for the presence of HEV RNA. Int J Food Microbiol. 2019;296:58-64.\u003c/li\u003e\n\u003cli\u003eChoi AH, Basu M, McNeal MM, Flint J, VanCott JL, Clements JD, Ward RL. Functional mapping of protective domains and epitopes in the rotavirus VP6 protein. J Virol. 2000;74:11574-11580.\u003c/li\u003e\n\u003cli\u003eCiarlet M, Hoffmann C, Lorusso E, Baselga R, Cafiero MA, B\u0026aacute;nyai K, Matthijnssens J, Parre\u0026ntilde;o V, de Grazia S, Buonavoglia C, Martella V. Genomic characterization of a novel group A lamb rotavirus isolated in Zaragoza, Spain. Virus Genes.2008;37:250-265.\u003c/li\u003e\n\u003cli\u003eChoudhary P, Minakshi P, Ranjan K, Basanti B. Zooanthroponotic transmission of rotavirus in Haryana State of Northern India. Acta Virol.2017; 61:77-85.\u003c/li\u003e\n\u003cli\u003eEstes MK, Cohen J. Rotavirus gene structure and function. Microbiol Rev. 1989;53:410-449.\u003c/li\u003e\n\u003cli\u003eEstes MK, Kang G, Zeng CQ, Crawford SE, Ciarlet M. Pathogenesis of rotavirus gastroenteritis. Novartis Found Symp.2001; 238:82-96.\u003c/li\u003e\n\u003cli\u003eFujii Y, Shimoike T, Takagi H, Murakami K, Todaka-Takai R, Park Y, Katayama K.Amplification of all 11 RNA segments of group A rotaviruses based on reverse transcription polymerase chain reaction. Microbiol Immunol.2012;56:630-638.\u003c/li\u003e\n\u003cli\u003eGalindo-Cardiel I, Fern\u0026aacute;ndez-Jim\u0026eacute;nez M, Luj\u0026aacute;n L, Buesa J, Espada J, Fantova E, Blanco J, Segal\u0026eacute;s J, Badiola JJ. Novel group A rotavirus G8 P[1] as primary cause of an ovine diarrheic syndrome outbreak in weaned lambs. Vet Microbiol.2011; 149:467-471.\u003c/li\u003e\n\u003cli\u003eHe B, Huang X, Zhang F, Tan W, Matthijnssens J, Qin S, Xu L, Zhao Z, Yang L, Wang Q, Hu T, Bao X, Wu J, Tu C. Group A Rotaviruses in Chinese Bats: Genetic Composition, Serology, and Evidence for Bat-to-Human Transmission and Reassortment. J Virol.2017; 91:e02493-16.\u003c/li\u003e\n\u003cli\u003eKumar N, Malik YS, Sharma K, Dhama K, Ghosh S, B\u0026aacute;nyai K, Kobayashi N, Singh RK. Molecular characterization of unusual bovine rotavirus A strains having high genetic relatedness with human rotavirus: evidence for zooanthroponotic transmission. Zoonoses Public Health.2018; 65:431-442. \u003c/li\u003e\n\u003cli\u003eLijun Yang,Yue Chen,WenQing Mi,Yitong Tang,Jiubo Fang,Yuan Wang,Shiying Liao,Huanchun Chen,Qigei He,Yunbo Jiang.Genetic characterization of human rotavirus type G9P[8] in some areas of Hubei in 2019-2020.Chinese Journal of Human Veterinary Diseases\u003cem\u003e.\u003c/em\u003e2022;38:359-365.\u003c/li\u003e\n\u003cli\u003eLee JB, Youn SJ, Nakagomi T, Park SY, Kim TJ, Song CS, Jang HK, Kim BS, Nakagomi O. Isolation, serologic and molecular characterization of the first G3 caprine rotavirus. Arch Virol.2003; 148:643-657.\u003c/li\u003e\n\u003cli\u003eLu Y, Li H, Li W, Wang X, Tao X, Dou L, Dong Y, Wu N, Li YG.Characterization of a G9 group A rotavirus reassortant strain detected in Jinzhou, China, in 2018-2019. Arch Virol. 2020;165:977-983.\u003c/li\u003e\n\u003cli\u003ePapp H, Borz\u0026aacute;k R, Farkas S, Kisfali P, Lengyel G, Moln\u0026aacute;r P, Melegh B, Matthijnssens J, Jakab F, Martella V, B\u0026aacute;nyai K. Zoonotic transmission of reassortant porcine G4P[6] rotaviruses in Hungarian pediatric patients identified sporadically over a 15 year period. Infect Genet Evol.2013;19:71-80.\u003c/li\u003e\n\u003cli\u003ePeng R, Li D, Wang J, Xiong G, Wang M, Liu D, Wei Y, Pang L, Sun X, Li H, Kong X, Shahar S, Duan Z.Reassortment and genomic analysis of a G9P[8]-E2 rotavirus isolated in China. Virol J.2023; 20:135.\u003c/li\u003e\n\u003cli\u003eSaif LJ, Jiang B. Nongroup A rotaviruses of humans and animals. Curr Top Microbiol Immunol.1994;185:339-371.\u003c/li\u003e\n\u003cli\u003eParashar UD, Hummelman EG, Bresee JS, Miller MA, Glass RI. Global illness and deaths caused by rotavirus disease in children. Emerg Infect Dis. 2003;9:565-572.\u003c/li\u003e\n\u003cli\u003eSteyer A, Polj\u0026scaron;ak-Prijatelj M, Barlič-Maganja D, Marin J. Human, porcine and bovine rotaviruses in Slovenia: evidence of interspecies transmission and genome reassortment. J Gen Virol.2008;89:1690-1698.\u003c/li\u003e\n\u003cli\u003eSimsek C, Corman VM, Everling HU, Lukashev AN, Rasche A, Maganga GD, Binger T, Jansen D, Beller L, Deboutte W, Gloza-Rausch F, Seebens-Hoyer A, Yordanov S, Sylverken A, Oppong S, Sarkodie YA, Vallo P, Leroy EM, Bourgarel M, Yinda KC, Van Ranst M, Drosten C, Drexler JF, Matthijnssens J.At Least Seven Distinct Rotavirus Genotype Constellations in Bats with Evidence of Reassortment and Zoonotic Transmissions. mBio.2021;12:e02755-20.\u003c/li\u003e\n\u003cli\u003eShen S, Burke B, Desselberger U.Nucleotide sequences of the VP4 and VP7 genes of a Chinese lamb rotavirus: evidence for a new P type in a G10 type virus. Virology. 1993;197:497-500.\u003c/li\u003e\n\u003cli\u003eTacharoenmuang R, Guntapong R, Upachai S, Singchai P, Fukuda S, Ide T, Hatazawa R, Sutthiwarakom K, Kongjorn S, Onvimala N, Luechakham T, Ruchusatsawast K, Kawamura Y, Sriwanthana B, Motomura K, Tatsumi M, Takeda, N, Yoshikawa T, Murata T, Uppapong B, Taniguchi K, Komoto S.Full genome-based characterization of G4P[6] rotavirus strains from diarrheic patients in Thailand: Evidence for independent porcine-to-human interspecies transmission events. Virus Genes. 2021;57:338-357.\u003c/li\u003e\n\u003cli\u003eTimurkan M\u0026Ouml;, Alkan F. Identification of rotavirus A strains in small ruminants: first detection of G8P[1] genotypes in sheep in Turkey. Arch Virol.2020;165:425-431.\u003c/li\u003e\n\u003cli\u003eMao T, Wang M, Wang J, Ma Y, Liu X, Wang M, Sun X, Li L, Li H, Zhang Q, Li D, Duan Z. Phylogenetic analysis of the viral proteins VP4/VP7 of circulating human rotavirus strains in China from 2016 to 2019 and comparison of their antigenic epitopes with those of vaccine strains. Front Cell Infect Microbiol.2022; 12:927490.\u003c/li\u003e\n\u003cli\u003eZhao Q, Liu L, Huang T, Tian Y, Guo X, Liu C, Huang B, Chen Q.Complete genomic analysis of rabbit rotavirus G3P[22] in China. Arch Virol.2023; 168:129.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Rotavirus, Sheep, Isolation and identification, Genetic evolutionary analysis","lastPublishedDoi":"10.21203/rs.3.rs-3788278/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3788278/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cb\u003eObjective\u003c/b\u003e The objectives were to isolate the Chinese G8 sheep rotavirus and to study some of its genotypic characteristics, to provide basic information for the epidemiological pathology of sheep rotavirus and to provide key biological materials for the study of its pathogenic mechanism.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMethods\u003c/b\u003e In 2023, anal swabs and small intestinal samples were collected from sheep with clinical manifestations of diarrhea at a Gansu sheep farm. Using RT-PCR, tissue sections, and virus isolation and identification methods, viral infections were investigated in sheep.\u003c/p\u003e \u003cp\u003e \u003cb\u003eResults\u003c/b\u003e RT-PCR and small intestinal immunohistochemistry confirmed rotavirus infection in the sheep. Rotavirus isolation in MA-104 cells revealed typical cytopathic lesions by the 10th blind transmission generation. Positively identification through indirect immunofluorescence and observation of characteristic 70 nm-sized rotavirus particles in transmission electron microscopy further supported the findings. The capsid protein VP7 and nonstructural protein NSP4 genotypes were identified as G8 and E2, respectively, making the first detection of the G8-type rotavirus in sheep in China.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConclusion\u003c/b\u003e This study successfully isolated G8-type sheep rotavirus for the first time in China, contributing valuable date for molecular epidemiological research on sheep rotavirus and providing essential biological materials for further investigations on its pathogenic mechanisms.\u003c/p\u003e","manuscriptTitle":"Isolation and molecular characterization of the first G8-type sheep rotavirus identified in China","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-02 10:18:04","doi":"10.21203/rs.3.rs-3788278/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"759ce0c1-eb6f-45c7-bbf6-5605092b8ff3","owner":[],"postedDate":"January 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-25T04:30:58+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-02 10:18:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3788278","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3788278","identity":"rs-3788278","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00