Non-invasive electrical stimulation restores corneal nerve density and function in diabetic neuropathy via KCNN-dependent mechanism | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Non-invasive electrical stimulation restores corneal nerve density and function in diabetic neuropathy via KCNN-dependent mechanism Menglu Yang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7895492/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted You are reading this latest preprint version Abstract Diabetic neuropathy (DN) is the most common complication of diabetes mellitus (DM) and often involves the cornea, where progressive loss of nerve fibers contributes to impaired corneal sensitivity and wound healing defects. Current treatments are limited, underscoring the need for a regenerative therapy. Transcutaneous electrical stimulation (ES) is a neural modulating therapy that non-invasively delivers microcurrent electricity to the eye via orbital skin. ES treatment significantly restored the nerve density and sensory function in both streptozotocin-induced DM mice and in vitro isolated trigeminal ganglia (TG) neurons. Transcriptomics analysis of TGs from in vivo ES pointed to ion transport and Ca 2+ signaling alteration. Consistently, membrane potential recording in TGs showed a rapid hyperpolarization upon ES accompanied by increased [Ca 2+ ] i level. Inhibition of Ca 2+ -Induced K + Channel (KCNN) abolished the hyperpolarization and neural regeneration effect, whereas activation of KCNN channel significantly enhanced nerve regeneration in the STZ model compared with sham treatment. Overall, ES restores corneal nerve density and function in diabetes via KCNN activation, offering a novel, non-invasive, and clinically translatable therapeutic strategy for diabetic neuropathy. Health sciences/Neurology/Neurological disorders/Peripheral neuropathies Biological sciences/Neuroscience/Regeneration and repair in the nervous system Transcutaneous electrical stimulation (ES) diabetes mellitus (DM) sensory function neural regeneration Ca2+-Induced K+ Channel (KCNN) Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Diabetes mellitus (DM) is a metabolic disorder that currently affects 537 million adults worldwide 1 , making it one of the most significant challenges to global health. Diabetic neuropathy (DN), characterized by distal-to-proximal loss of nerve function, is the most common complication, estimated to affect 50% of the DM patients 2 . DN presents as numbing or burning sensation, weakness of the limbs, and often leads to skin ulceration, infection, and eventually to amputation 3 , which creates a huge burden on patient health and healthcare systems. Among various affected tissues, the cornea is the most densely innervated in the human body and is particularly susceptible to DN 4 . Notably, it is also one of the most sensitive parts of the body, as the number of free epithelial nerve endings is estimated to be 300–600 times that of the skin 5 . The intrinsic transparency of the cornea allows detailed visualization of nerve fiber architecture, making the cornea a powerful model for studying peripheral neuropathies 6 , 7 . The corneal involvement of DN is characterized by progressive damage to corneal nerves and epithelial erosion 8 - collectively referred to as diabetic keratopathy (DK). To date, therapeutic strategies to restore corneal innervation and function in DK remain poorly defined. The majority of the corneal sensory nerve fibers originate in the trigeminal ganglia (TGs) 9 . It conducts touch, pain, and temperature, induces a blink reflex, stimulates wound healing 10 , provides trophic factors to the cornea, and induces tear and mucin production and secretion 11 . Progression of DK, which correlates with the severity of DN 8 , results in delayed wound healing, persistent epithelial damage, and corneal ulceration 12 that harm vision. In addition, corneal nerve damage can lead to neuropathic corneal pain 12 , where patients suffer eye burning, stinging, and pain despite the loss of normal sensation. These conditions require prompt treatment to alleviate pain and restore vision. The current management of DN includes optimization of glucose and symptom management 3 . For cornea, recombinant human nerve growth factor offers a promising new therapeutic avenue 8 . However, the disadvantages of recombinant human nerve growth factor exist in the need for frequent applications (6 times per day), high cost, strict storage requirements, and eye discomfort 13 and consequential intolerance. Creating more accessible and efficacious therapies is an urgent need for better nerve restoration and symptom relief to benefit a wider group of patients. Transcutaneous electrical stimulation (TES) is an emerging neuromodulatory therapy that delivers micro-electrical currents non-invasively through the skin 14 , 15 . Electrical stimulation (ES) is progressively acknowledged as a clinical intervention for peripheral neuropathy 16 , 17 , 18 . However, the action of ES in DK has not yet been explored, nor did the mechanism of action behind the neuromodulation effect of ES. Herein, we demonstrate in a preclinical mouse model of DM, ES ameliorated corneal nerve loss and investigate the molecular events under ES in primary TG neuron culture. Result ES restores corneal nerve density and sensory function in STZ-induced DK models We induced type 1 DM (T1DM) in mice by STZ injection 19 , a well-established model that recapitulates the progressive metabolic and neuropathic features of human diabetes. In this model, corneal nerve loss was reported to start by 12 weeks post-STZ 20 . Mouse development of the T1DM status was validated by blood glucose ≥ 350mg/dl ( Supplemental Fig. 1 ). Starting from week 15 post-injection, when DK has already developed, a random eye was treated with ES (ramp waveform, 300µA, 20Hz) for 4 min daily, the stimulation parameters identified previously as optimal for ocular surface protection 21 . This timing allowed us to directly test the therapeutic potential of ES in reversing corneal nerve pathology. Control mice received electrodes without electrical current (Sham). Mice received ES for 14 consecutive days, and the second day after the final ES, corneal fluorescein staining (CSF) was conducted to evaluate the epithelial integrity, while the corneal whole-mount were immunolabeled with a nerve-specific marker β-III-tubulin (Fig. 1 A). At seventeen weeks post-STZ injection, the sham group demonstrated a significantly higher CSF score, indicating the loss of epithelial integrity, whereas this loss of epithelial integrity was mitigated by ES treatment (Fig. 1 B and C ). Consistently, in corneal wholemounts, the fluorescent intensity of β-III-tubulin labeling in the subbasal plexus was significantly reduced in STZ corneas compared to non-STZ controls, while ES treatment attenuated this reduction (Fig. 1 D and E ). Similarly, the total nerve length in the central cornea was significantly reduced in sham-treated STZ mice, which was again attenuated by ES treatment (Fig. 1 F and G ). Although STZ did not affect the total length of stromal nerve bundles, ES treatment resulted in a significant increase of stromal bundle length (Fig. 1 I), indicative of a robust regenerative effect. These findings demonstrate that ES protects corneal epithelial integrity and promotes nerve regeneration, providing a structural basis for potential functional recovery. We next investigated the functional benefits of ES on the corneal nerves. After 14 consecutive days of ES, the corneal sensation was evaluated in each group using a Cochet-Bonnet esthesiometer, which measures mechanical touch sensation (involving primarily mechanonociceptor excitability). At seventeen weeks post-STZ, the sham-treated group demonstrated a significant loss of sensory function, reflected by a shorter filament length needed to elicit a blink reflex; ES treatment for 14 days mitigated the sensory function reduction in STZ mice (Fig. 1 J). Upon sacrifice, we isolated the trigeminal ganglia from the same animals and directly assessed neuronal function by measuring the intracellular [Ca 2+ ] response to KCl, a widely used neuroexcitatory depolarizing stimulus (Fig. 1 K). In the sham-treated group, the neuronal [Ca 2+ ] i response to K + was reduced, although not statistically significant, likely due to the heterogeneity of TG neurons, which include multiple sensory subtypes (e.g., mechanical, thermal, and chemical) with variable excitability and susceptibility to diabetic injury. By contrast, 14 days of ES treatment significantly restored the neural [Ca 2+ ] i response (Fig. 1 L). This result indicates that ES directly modulates the neural response to improve the mechanonociceptor function and improves epithelium integrity and corneal nerve density in STZ-induced preclinical model of diabetic mice. ES directly promotes axonal growth of trigeminal ganglia neurons We next determined whether ES directly acts on the corneal nerves to stimulate their growth or protect them against hyperglycemia stress using isolated TG neurons. In normal glucose conditions, ES (ramp waveform, 300µA, 20Hz) was applied for 30 min every 24h, and sham treatment group consisted of carbon electrodes without electrical current. This condition was optimized to prolong the ES effect during the limited in vitro culture period and to compensate for the direct neuronal exposure to electrodes in the absence of surrounding tissue 22 . Neurons were fixed at 48h after the first stimulation (Fig. 2 A) and double-immunostained for antibodies against β-III-tubulin and growth-associated protein 43 (GAP43), an axonal growth marker (Fig. 2 B). The results revealed significantly higher GAP43 levels in ES-treated neurons than sham-treated controls (Fig. 2 C). Increased expression of GAP43 was also demonstrated by Western blot analysis under the same experimental setting (Fig. 2 D and E ), which further strengthens the finding that ES directly stimulates neurite outgrowth in vitro . Next, we determined if ES protects the nerve fibers against a high glucose condition in vitro . TG neurons were isolated from naive C57BL6J mice and cultured in Neurobasal A media, supplemented with excessive D-glucose (100 mM) to mimic TIDM. Control cultures were supplemented with L-glucose (100 mM), which cannot be metabolized by cells, to serve as the osmolarity control. The neurons were cultured for 24 h after the treatment. β-III-tubulin immunolabeling ( Supplemental Fig. 3A ) revealed that high D-glucose significantly decreased the neurite length, as measured by the longest neurite, compared to L-glucose control; ES promoted longer neurite outgrowth under the high glucose condition ( Supplemental Fig. 3B ). Collectively, we show that ES directly acts on TG neurons to enhance axonal growth in both normal and high D-glucose conditions. To evaluate the functionality of cultured trigeminal ganglia neurons, we conducted Fura2AM assay immediately after ES stimulation. Neuronal excitability was first evaluated using isotonic KCl as a general depolarizing stimulus. In ES-treated neurons, intracellular Ca 2+ ([Ca 2+ ] i ) responses to KCl (40 mM) were significantly elevated compared to the sham-treated group (Fig. 2 F and G ), indicating that ES directly modulates the TG neuronal responsiveness that may underlie improved corneal sensory function. Because corneal innervation is critical not only for protective reflexes but also for ocular comfort and basal tear secretion, we next studied whether ES differentially affects pain-related nociceptive and thermo-sensory signals. Stimulation using the TRPV1 agonist capsaicin (10 − 5 M), which mimics painful stimulation (Fig. 2 H) induced an increased [Ca 2+ ] i in sham-treated neurons. Remarkably, ES abolished the [Ca 2+ ] i response to capsaicin (Fig. 2 I), suggesting that ES suppresses nociceptive activity and may alleviate ocular pain. In contrast, stimulation with TRPM8 agonist icilin with a final concentration of 10 − 4 M, which reproduces normal cold-sensation of the cornea and is essential for basal tear secretion, evoked similar [Ca 2+ ] i responses in both sham and ES-treated neurons (Fig. 2 J and K ). These results suggest that ES enhances overall TG neuron excitability, selectively dampens painful nociceptive signaling without impairing physiological cold sensing while promoting mechanonociceptor function. The data highlight a balanced modulation of TG neuronal subtypes underlying improved corneal recovery and ocular surface homeostasis. Transcriptomic profiling identifies Ca signaling and ion transport pathways mediated by ES To further determine if the neural regenerative potential of ES extends to other sensory nerve conditions, we employed an acute mechanical corneal nerve injury model - the keratectomy wound. In this model, the superficial corneal nerve plexus was mechanically scrapped off in the central 1.5 mm diameter area. ES was applied 4 min daily for 14 consecutive days and the cornea was collected for wholemount immunolabeling of β-III-tubulin. The fluorescent intensity and subbasal plexus length was quantified at the wounded area. Significantly increased fluorescent intensity and plexus length was found in ES-treated corneas than sham control, indicating that ES robustly promotes reinnervation of the cornea following acute and severe nerve injury (Fig. 3 A, B and C ). These findings support the regenerative potential of ES across distinct models of both chronic (diabetic) and acute corneal nerve injury. To investigate the mechanisms underlying the regenerative effects of ES, we performed RNA sequencing on mRNA isolated from mouse TGs under four conditions: untreated (Ctrl), 2 weeks after keratectomy wound (Injury), ES-treated keratectomy for 2 weeks (ES), and ES without keratectomy wound (ES no injury). The acute keratectomy model provides a well-defined and reproducible nerve injury paradigm that allows clearer distinction of ES-induced regenerative responses, minimizing the systemic metabolic confounders present in the diabetic model. This model enabled us to specifically capture transcriptional programs associated with ES-mediated nerve repair. A total of 22,084 expressed genes were identified. Of these, 6,859 genes were differently expressed ( padj < 0.05) between untreated control and keratectomy injuries, 1,388 genes between sham-treated and ES-treated injuries, and 8,147 genes between non-treated control and ES no Injury groups (Fig. 3 D). Differentially expressed genes (DEG) between the untreated control and injury groups were identified using an adjusted p -value (padj 2.5. This threshold allowed us to focus on genes with robust alterations that are most likely to drive functional changes in TG responses. These genes were visualized in a heatmap (Fig. 3 E). Gene ontology (GO) enrichment analysis of DEG between ES and Injury group revealed upregulation of genes related to neural development, axonogenesis, axon guidance, and synaptic organization/function (Fig. 3 F, upper panel ). Notably, several Ca 2+ ion transport and signaling pathways were observed (Fig. 3 F, red ). These results suggest that ES promotes nerve growth in part by regulating membrane ion channels and activating Ca 2+ signaling. KEGG pathway analysis further demonstrated that ES regulates genes involved in synaptic function, axonogenesis, Wnt and Ca 2+ signaling, as well as PI3K signaling pathway (Fig. 3 F, lower panel ). To understand the interconnection among these pathways, we performed gene network analysis, which identified genes involving Ca 2+ signaling, namely Unc79, Cacna1s , and Casq1 being upstream of regeneration-associated genes such as Sox and Bmps ( Supplemental Fig. 4 ). These results suggest that Ca 2+ signaling plays an initial regulatory role in ES-induced neural regeneration. To validate the RNA-seq results, neurons from TG were isolated using CD90.2 magnetic beads to minimize glial contaminations, and the resultant RNAs were subjected to qPCR. We noted that the gene encoding L-type voltage gated Ca 2+ channel showed a trend of increased expression by ES treatment, although it did not reach statistical significance (Fig. 3 G), consistent with the RNA-seq data. The results further suggest that ES may act directly through modulating Ca 2+ channel activity, without altering their expression levels. As AKT activation is known to occur downstream of Ca 2+ signaling, we next asked if the AKT activation is altered. The AKT activation was confirmed using primary TG neurons, in which in vitro stimulation with ES resulted in a significant increase in AKT phosphorylation 15 minutes post-stimulation, as determined by WB analysis (Fig. 3 H and I ), indicating an activation of AKT by ES in consistent with the KEGG enrichment findings. ES induces [Ca] responses and activates KCNN channels to hyperpolarize TG neurons Given the RNA-seq results on ion transportation and Ca 2+ signaling, we investigated whether ES directly modulates membrane potential and [Ca 2+ ] i changes in TG neurons. To directly assess the electrophysiological responses to ES, isolated TG neurons from naive mice were cultured in F12 media supplemented with 10% FBS overnight to ensure cytoactivity. Neurons loaded with voltage-sensitive dye FluoVolt dye were recorded at 20 frames per second using real-time fluorescence microscopy. Demonstrated in Fig. 4 A, addition of KCl, a known stimulator of neural depolarization, significantly increased FluoVolt fluorescent intensity in TG neurons upon depolarization. Mean fluorescence intensity of each frame was quantified using ImageJ (Fig. 4 B). Following 5-10s of baseline recording, ES (ramp, 100µA, 20Hz) was applied during the image acquisition. An immediate decrease of membrane potential was observed (Fig. 4 C, yellow ). The change in mean fluorescence intensity to baseline was quantified by ImageJ and plotted in Fig. 4 D. This result shows that ES induces neuron hyperpolarization instead of depolarization. Next, we recorded the [Ca 2+ ] i activity during ES using Fura2 assay. ES induced an immediate increase of [Ca 2+ ] i (Fig. 4 E), and this ES-induced [Ca 2+ ] i surge was abolished by the Ca 2+ chelator EGTA ( 4E and F ). To further assess the relationship between Ca 2+ influx and membrane potential, we blocked [Ca 2+ ] i response with EGTA. Strikingly, the ES-induced hyperpolarization visualized using FluoVolt signals was also blocked by EGTA pre-treatment (Fig. 4 G), demonstrating that ES-induced hyperpolarization is [Ca 2+ ] i -dependent. As potassium intermediate/small conductance calcium activated channel (KCNN) is known to be activated by [Ca 2+ ] i signal and mediate membrane hyperpolarization 23 , we tested whether it is involved in this process. Repeated the recording with KCNN blocker Apamin (10 − 6 M) pre-treatment showed that Apamin altered ES-induced hyperpolarization to depolarization (Fig. 4 H). Hereto, we show that ES-induced hyperpolarization in TG neurons is Ca 2+− dependent and mediates through KCNN channels. There are three well-studied isotypes of KCNN channels, namely KCNN1, KCNN2, and KCNN3. Real-time qPCR from TG of naive mice detected expression of Kcnn1 and Kcnn3 , but not Kcnn2 (Fig. 4 I). To define the neuronal expression of Kcnn1 and 3, total RNAs were extracted from TG neurons isolated using CD90.2-conjugated magnetic beads. Results of qPCR confirmed Kcnn1 and Kcnn3 expression in TG neurons. Kcnn1 expression was significantly decreased in the injured group and stayed low regardless of ES treatment (Fig. 4 J). In contrast, Kcnn3 expression was significantly increased by ES compared to the sham-treated group (Fig. 4 J). Similarly, in STZ-induced diabetic mice, Kcnn1 expression was down-regulated by ES treatment (Fig. 4 K), while Kcnn3 expression was significantly increased by ES compared to sham-treated STZ mice (Fig. 4 K). These data indicate that ES selectively increases expression of Kcnn3 in both injury and diabetic neuropathy models, suggesting that KCNN3 may play a key role in mediating the ES-induced neuronal hyperpolarization. ES-induced nerve regeneration is KCNN-dependent To investigate the role of KCNN in ES-induced nerve regeneration, we first investigated in the in vitro model. After neuron attachment post isolation, KCNN inhibitor Apamin (MCE, HY-P0256) was added to the Neuralbasal A media 10 min before ES (100µA, 20Hz, for 30 min). Neurons receiving ES without Apamin served as positive controls, while Apamin-treated neurons without ES as vehicle controls. Forty-eight hours later, IF with GAP43 and β-III-tubulin antibody showed that Apamin treatment alone did not affect GAP43 level in TG neurons. As expected, ES significantly increased GAP43 expression, whereas this effect was markedly diminished when ES was combined with Apamin treatment (Fig. 5 A and B ). To model diabetic conditions in vitro , TG neurons were cultured in high glucose (100 mM) with L-glucose serving as osmolarity control. After neuron attachment post incubation, Apamin was added to high glucose-conditioned TG neurons 10 min prior to ES. The neurons were fixed and subjected to IF with β-III-tubulin antibody 24h later, and the length of the longest neurite was quantified. High glucose significantly reduced the neurite length compared to the osmolarity control, while ES application preserved the neurites. Apamin application abolished the effect of ES ( Supplemental Fig. 6 ). These results indicate that the KCNN activation by ES contributes to axonal growth promotion and neural protection in vitro . We next investigated the effect of KCNN blockage in vivo using the corneal keratectomy model. ES was applied for 14 consecutive days, with or without topical Apamin (10 − 6 M) treatment. Mice receiving electrodes without stimulation served as sham controls, and uninjured mice served as baseline controls. Consistent with our in vitro findings, ES significantly promoted the reinnervation of the central cornea, while this effect was significantly diminished by KCNN blockage with Apamin (Fig. 5 C and D ). Next, we evaluated the in vivo effect of KCNN in the STZ model. ES was applied for 14 consecutive days, with or without topical Apamin (10 − 6 M) treatment. Mice receiving electrodes without stimulation served as sham controls, and non-STZ mice served as baseline controls. On day fourteen of the ES treatment, corneal sensation was measured by a Cochet-Bonnet esthesiometer before tissue collection. The increased corneal sensation was observed in the ES treatment group compared to the sham-treated STZ group, and this effect was blocked by Apamin ( Supplemental Fig. 7 ). Corneal fluorescein staining revealed significantly decreased epithelial disruption in the ES-treated STZ group compared to the sham-treated group, an effect which was also abolished by Apamin (Fig. 5 E and F ). Similar results were demonstrated using the total length of central subbasal plexus as a readout in the keratectomy model, where Apamin treatment reversed the ES-induced nerve regeneration in STZ model (Fig. 5 G and H ). Together, these results indicate that activation of KCNN is essential for ES-induced nerve regeneration and sensory recovery. To determine if KCNN activation is sufficient for corneal nerve regrowth, starting from week 17 after STZ induction, KCNN agonist NS309 (10 − 4 M) was applied topically to both eyes of the STZ mice once daily for a consecutive 14 days. STZ mice receiving sham treatment with topical saline eye drops served as vehicle controls, while STZ mice receiving ES treatment served as positive controls. On day 14, the CSF was measured, and the corneas were collected for wholemount IF against β-III-tubulin and GAP43. The result showed that similar to ES treatment, NS309 significantly diminished the increased CSF score induced by STZ (Fig. 5 I and J ). GAP43 staining showed that both NS309 and ES treatment significantly increased the number of growth cones compared to sham-treated corneas (Fig. 5 K and L ). These results indicate that the activation of KCNN plays a critical role in driving the regeneration of corneal nerves in both diabetes and mechanical injuries. Discussion In the current study, we demonstrated that ES successfully promoted corneal reinnervation in DK, the corneal manifestation of DN, restoring both structural innervation and functional sensation. It enhanced corneal sensory function, restored epithelial integrity, and increased subbasal nerve density. Mechanistically, ES induced nerve regeneration by triggering a rapid Ca 2+ influx that drove membrane hyperpolarization through KCNN activation ( Fig. 7 ). Importantly, blockade of Ca 2+ influx or KCNN activity abrogated ES-induced hyperpolarization in vitro and nerve regeneration in vivo . Taken together, our findings indicate that ES promotes corneal nerve regeneration through Ca 2+ -KCNN signaling axis and contributes to overall corneal homeostasis by restoring innervation, improving sensation, and maintaining epithelial integrity. The data highlight the therapeutic potential of ES for neurodegenerative conditions such as DK. Our findings extend previous work on ES as a regenerative therapy in both the peripheral and central nervous system. ES has attracted great interest in the recent decade in the motor nervous system 17 . It has been published that ES enhanced corneal reinnervation in mechanically wounded corneas without preexisting disease background 24 , 25 , 26 , our result demonstrates broader applications for targeting disease-associated corneal nerve degeneration. The in vivo relevance of these findings was confirmed in two distinct models: corneal keratectomy and STZ-induced diabetes. The mechanical wound model is widely used in corneal nerve regeneration research, as it provides a fast and controllable corneal nerve damage. STZ-induced diabetes model better mimics the corneal nerve damage caused by diabetic neuropathy, providing insights into the therapeutic role of ES in disease-induced nerve damage. The finding that ES promoted corneal nerve regeneration and epithelial integrity highlights the functional consequences of TG neuron modulation on the ocular surface. DK as a common and vision-threatening complication of diabetes with limited treatment options, the therapeutic implications of these findings are significant. Our results provide important mechanistic insight into how ES regulates TG neuronal function. Calcium imaging and our in vitro assays revealed that ES induced a surge in intracellular Ca²⁺ and evoked membrane hyperpolarization through KCNN activation. Published works have shown that ES elevates intracellular Ca 2+ level ([Ca 2+ ] i ) 27 , activates phosphoinositide 3-kinases (PI3Ks) 2829 , and promotes Brain-Derived Neurotrophic Factor (BDNF) to promote axonal growth. Our results align with the published work with the observation of Ca 2+ elevation, AKT activation, as well as increased BDNF receptor signaling pathway, as suggested in GO analysis. In contrast to inducing nerve depolarization, as reported by others 30 , our data showed that ES hyperpolarizes the TG neurons through an involvement of potassium channels. One potential explanation is that the hyperpolarization we observed is specific to the ramp waveform we used, while other groups commonly use rectangular waveforms. It has been reported that in alpha motor neurons, the gradually changing amplitude of the stimulating current, as in ramp waveforms, decreases the amplitude of neural depolarization 31 . Work in retinal ganglion cells indicates that neural activation depends on the amplitude and frequency of stimulation 32 , indicating the membrane potential changes in response to ES are highly waveform-dependent. The hyperpolarization induced by ES was abolished by both Ca 2+ chelation and the KCNN blocker Apamin. The KCNN is a family of K + channels that is activated upon calmodulin binding regardless of the membrane potential 33 . During [Ca 2+ ] i surge, calmodulin captures Ca 2+ and binds to KCNN to induce an outflow of K + that leads to hyperpolarization. Our data suggest that KCNN directly regulates neuronal growth, which is likely due to the hyperpolarization state that has switched the neuron from a conductive to a regenerative state. Hyperpolarization has been well recognized in enhancing memory and learning activities 34 , 35 , and most recent evidence unveiled its role in promoting neurogenesis in central nerve system development 36 . By identifying KCNN-dependent Ca 2+ signaling as a key pathway linking ES to neuronal survival and regeneration, this study provides new mechanistic insights into how ES promotes functional recovery in the nervous system. An additional novel observation of this study is that ES differentially regulates TG sensory subtypes. Previous testing of corneal nerve function, which relies primarily on touch stimulation, which activates mechanonociceptors. As mentioned, corneal sensory nerves carry the sensations of touch, pain, and temperature, stimulate the blink reflex, and regulate tear production through nociceptors 10 , namely TRPV1 and TRPM8. TRPV1 expressed on the corneal nerves senses noxious stimuli and is the main contributor of neuropathic pain in DM 37,38 . TRPM8 is activated by innocuous cold temperatures 39 and maintains basal tear secretion 40 , 41 . Notably, we observed ES inhibited the neuron response to a TRPV1 agonist capsaicin but did not alter the response to TRPM8 agonist icilin in vitro . This selective modulation indicates that ES not only promotes structural regeneration but also regulates a homeostatic corneal nerve function without exacerbating pain or disrupting normal thermosensation. Future studies employing more advanced models, such as iPSC-derived sensory neurons, will be critical to clarify the mechanistic insights involved and ultimately identify novel therapeutic targets that alleviate ocular pain without impairing the normal sensory functions essential for ocular homeostasis. Together, the demonstration that our ramp waveform ES can selectively suppress nociceptive activity while enhancing mechanosensory responses distinguishes this approach from nonspecific pro-regenerative strategies and suggests therapeutic specificity. This study primarily focuses on the effect of ES on corneal nerve damage; therefore, we did not include the situation when ES is applied to DK eyes when DM is under treatment. The prolonged effect of ES on corneal nerves is also unclear. Our future scope is to address these limitations. In conclusion, non-invasive ES treatment significantly promoted corneal nerve regeneration, restored epithelial integrity, enhanced neurite outgrowth in both DK and corneal injury models. ES selectively suppressed nociceptive signaling and preserved and/or promoted physiological cold- and touch-sensing, thereby balancing distinct sensory modalities for corneal homeostasis. These findings demonstrated the potential of ES as a non-invasive therapeutic approach for diabetic keratitis, neuropathy and other neurodegenerative conditions. Materials and Method Animals : All C57BL6J mice were purchased from Jackson Lab (Bar Harbor, ME). We used a modified STZ-induced type I DM (T1DM) model on male 8-week-old C57BL/6J as we published 19 . STZ (Sigma, MO) 30mg/kg was mixed with saline and immediately injected intraperitoneal for a consecutive 5 days. Blood glucose levels were measured two weeks after the initial injection, and mice with glucose levels exceeding 350 mg/dL were considered diabetic. For mechanical injury, we used a keratectomy model on both male and female C57BL/6J mice at 8 weeks of age, following the published method 42 . Mice were anesthetized using a single intraperitoneal (IP) injection of ketamine and xylazine. Anesthetized mice were placed on heating pads to maintain body temperature while sedated and continue to be placed on a warm pad within their cage till recovery. Once sedation is confirmed, the central 1.5 mm diameter area was marked using a biopsy punch and the epithelium and the upper 1/3 of the corneal stroma of a random eye was removed using a rotating spur. All mice were kept in a 12-hour light/dark cycle with free access to food and water. All animal experiments were performed following protocols approved by the Institutional Animal Care and Use Committee of the Schepens Eye Research Institute and followed the Association for Research in Vision and Ophthalmology (ARVO) standards of using animals in research No. 2023N000038. The animal experiments adhered to the ARRIVE guidelines ( https://arriveguidelines.org ) 43 . Primary TG neuron isolation, culture, and purification C57BL/6J mice aged 8–12 weeks were used for TG neuron isolation and primary culture, following the method published by Malin, et al 44 . Fresh TG tissues were minced and enzymatically digested in a cocktail containing collagenase II and dispase II for 30 min at 37°C. The resulting cell suspension was purified by Percoll gradient centrifugation in L15 medium supplemented with 10% FBS. The cell pellet was resuspended in Neurobasal A medium and plated onto dishes precoated with laminin and poly-D-lysine. To purify neurons from glial cells, the cell pellet was resuspended in 90µl Neural Basal A media with 10µl CD90.2 magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany), and incubated at room temperature for 20 min. The mixture was then loaded into MS Columns on a magnetic separator (Miltenyi Biotec, Bergisch Gladbach, Germany). The flow-through was discarded, and the purified neurons were pushed out in autoMACS rinsing solution (Miltenyi Biotec, Bergisch Gladbach, Germany) by a plunger. The isolated neurons were then pelleted by centrifuging at 400g for 6 min and proceeded for future assays. Transcutaneous Electric Stimulation in vivo In vivo ES was performed as previously described 21 using the STG4000 pulse generator (Multichannel Systems, Reutlingen, Germany). Under isoflurane anesthesia, the anode electrode was positioned on the mouse's abdomen through the conductive gel (Spectral 360; Parker Laboratories, Fairfield, NJ, USA). The cathode electrode probe was applied to the skin over the orbital area through a conductive gel interface. For sham controls, electrode probes were applied to the orbital area without delivering an electrical current. A biphasic ramp waveform (300 µA, 20 Hz) was administered for 4 minutes daily over 14 days. To minimize potential confounders, mice were subjected to ES in a randomized order. Electric stimulation in vitro Electric stimulation of cell cultures was conducted using the STG4000 pulse generator (Multichannel Systems, Reutlingen, Germany) with a biphasic ramp waveform (100 µA, 20 Hz, 30 min). The electrical current was applied to the cultures via a c-dish carbon electrode plate (Ion Optix, Westwood, MA, USA). To ensure sterility, the c-dish was incubated in 70% ethanol for 15 minutes, followed by a 15-minute rinse with distilled water, and subsequently air-dried for 1 hour before reuse 21 . Corneal Fluorescein Staining (CSF) One µL of 2.5% fluorescein (Sigma-Aldrich Corp., St. Louis, MO, USA) was applied to the lateral conjunctival sac, and staining scores were recorded after eye examination using slit-lamp microscopy (Topcon SL-DC4, Tokyo, Japan) under cobalt blue light. The punctate staining of the ocular surface was evaluated in a masked fashion and graded as per the National Eye Institute Scoring System (Bethesda, MD, USA), giving a score between 0 and 3 for each of the five areas of the cornea. Each cornea was scored 3 times individually by different investigators, and the average score of each time was recorded as the final score. Corneal sensation measurement A Cochet-Bonnet esthesiometer was used for measuring corneal sensation. Mice were acclimated to the testing environment by holding scruff of the neck for several seconds before testing, by an investigator masked to the experimental group. The filament was extended to 6 cm and a gentle touch was applied to the tip of the nylon filament to the central cornea. The filament length was decreased every 0.5 cm to repeat the touch if no blink response is observed, until a consistent blink response is induced. Each length was repeated for 6 times to ensure accuracy. The length of the filament was recorded as the sensory function of the cornea. Corneal whole mount and IF : The corneal wholemount was conducted following the published method 45 . The eyes were immediately enucleated and fixed with 1.3% paraformaldehyde (VVR Life Science, Radnor, PA, USA) at room temperature for 1 h. The corneas were then dissected, and permeabilized in 1% Triton X-100 for 1 h at room temperature, followed by blocking and in 0.2% Triton X-100 1% BSA for 30 min. The samples were then incubated with a primary antibody to β-III-tubulin (1:30; R&D, NL1195R, Minneapolis, MN) for 24 h at 4°C then 2 h at room temperature and washed with PBS 3 times for 10 min. Corneas were mounted on slides under the microscope and covered with a ProLong Diamond antifade reagent (Thermo Fisher Scientific, Waltham, MA, USA). The cornea was then imaged using a Z scan with 4x4 tile scan by confocal microscopy (Leica SP8, Wetzlar, Germany). To quantify the nerve length, a central area of 400 pixel 2 was selected and transformed into a binary image. The nerve was traced, and the total length is quantified by Skeleton 3D plugin using ImageJ 1.54p as described in 45 . FluoVolt assay Isolated TG neurons from naive C57BL6J mice were cultured in F12 media with 10% fetal bovine serum (FBS) overnight to ensure cytoactivity during living cell analysis. Neurons were loaded with FluoVolt dye (ThermoFisher, MA, USA) in KRB buffer for 30min. ES was applied to the neurons during the image acquisition and the FlouVolt signal was visualized using time-lapse microscopy (Leica Dmi8, Wetzlar, Germany) at 20 frame/s. The mean fluorescence intensity was quantified by ImageJ. [Ca 2+ ] i measurement Primary TG neurons were plated onto 35-mm glass-bottom culture dishes and incubated at 37°C overnight as described previously 21 . Cells were then incubated for 1 h at 37°C with Krebs-Ringer bicarbonate buffer containing 119 mM NaCl, 4.8 mM KCl, 1.0 mM CaCl 2 , 1.2 mM MgSO 4 , and 25 mM NaHCO 3 with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) plus 0.5% bovine serum albumin containing 0.5 µM fura-2/AM (Invitrogen, Grand Island, NY, USA), 8 µM pluronic acid F127 (Sigma-Aldrich, St. Louis, MO, USA) and 250 µM sulfinpyrazone (Sigma-Aldrich, St. Louis, MO, USA) for 1 h. Before Ca 2+ measurements, cells were washed with KRB-HEPES containing sulfinpyrazone. Ca 2+ measurements were conducted using a ratio imaging system (In Cyt Im2; Intracellular Imaging, Cincinnati, OH, USA) using excitation wavelengths of 340 and 380 nm and an emission wavelength of 505 nm. Western blot : Western blotting (WB) was conducted as previously described 46 . Total protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using Mini-PROTEAN® 4–20% Precast Gels (Biorad, Hercules, CA, USA) and transferred to 0.45 µm pore-size nitrocellulose membrane. The membranes were blocked with 5% non-fat milk (Biorad, Hercules, CA, USA) at room temperature for 1 h and then incubated overnight at 4°C with the primary antibodies listed in Table 1 . After being washed with TBS-Tween 20 (TBST) buffer, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (BioRad, Hercules, CA, USA) Goat Anti-Rabbit IgG (H + L)-HRP (1:2000) or Goat Anti-Mouse IgG (H + L)-HRP (1:2000) for 1 h at room temperature. Signals were developed with enhanced chemiluminescence with a Clarity Western ECL Substrate (Biorad, Hercules, CA, USA) and detected with an iBright 1500 gel documentation system (Thermo Fisher Scientific, Waltham, MA, USA). Densitometry analysis was performed using ImageJ software (NIH, Bethesda, MD, USA). The whole uncropped and unprocessed membrane images overlayed with protein standard ladder are presented in Supplemental Figs. 2 and 6. Table 1 Primary antibodies and dilutions used in the study Target protein Produced by Product no IHC dilution WB dilution β-III-tubulin R&D, Minneapolis, MN, USA NL1195R 1:30 - GAP43 Thermo Fisher Scientific, Waltham, MA, USA 33-5000 1:100 1:2000 GAP43 Conjugated Novus Biologicals, Centennial, CO, USA NB300-143AF488 1:100 - Akt Cell Signaling, Danvers, MA, USA 9272 - 1:1000 p-Akt Cell Signaling, Danvers, MA, USA 9271 - 1:1000 β-actin Thermo Fisher Scientific, Waltham, MA, USA MA5-15739 - 1:4000 RT-qPCR Total RNA was extracted using Quick RNA miniprep kit (Zymo Research, Santa Cruze, CA); the concentration and purity of the RNA were analyzed using a NanoDrop One spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthesized from 500 ng of total RNA using the PrimeScript RT Master Mix (RR036A, Takara, San Jose, CA, USA) on an Applied Biosystems 2720 thermal cycler (Life Technologies, Waltham, MA, USA). Quantitative PCR was performed on a CFX384 Touch Real-Time PCR Detection System (BioRad, Hercules, CA) using iTaq Universal SYBR Green Supermix (BioRad, Hercules, CA) and mouse-specific primers (Table 2 ). The PCR cycling conditions were initial denaturation at 95°C for 5 minutes, followed by 40 cycles of 95°C for 30 seconds, 60°C for 30 seconds (annealing), and 72°C for 30 seconds (extension). Each sample was run in duplicates. Fluorescence was recorded at the end of each cycle. Gene expression was normalized to β-actin, and fold changes were calculated using the 2^−ΔΔCT method. Table 2 RT-PCR Primer list used in the study Target gene Primer Sequence Source cacna1 F: TCA GCA TCG TGG AAT GGA AAC IDT (Coralville, IA, USA) R: GTT CAG AGT GTT GTT GTC ATC CT kcnn1 F: TTTAAAAGCGTAAACGGCTCA IDT (Coralville, IA, USA) R: CAGAGCAAAAGAGCAGAGTGA kcnn2 F: TCCGTCGTAGGAGGAGGTG IDT (Coralville, IA, USA) R: AATTGTTGTGCTCCGGCTTAG kcnn3 F: GGTCATTGAGATTTAGCTGGCTG IDT (Coralville, IA, USA) R: CTGTTGCACTCTTCTCCCACG β-actin F: CATTGCTGACAGGATGCAGAAGG IDT (Coralville, IA, USA) R: TGCTGGAAGGTGGACAGTGAGG Bulk RNA sequencing Total RNA from trigeminal ganglia tissue was extracted using Quick RNA miniprep kit (Zymo Research, Santa Cruze, CA). Messenger RNA was purified, and quality was evaluated using an Agilent Bioanalyzer, and only samples with RNA Integrity Number (RIN) > 7 was used for RNA sequencing. RNA-seq libraries were prepared by Novogene (Sacramento, CA, USA) using poly(A) enrichment and sequenced on an Illumina NovaSeqX Plus platform to generate 150 bp paired-end reads at a depth of 30 million reads per sample. FastQC was used for quality control, Salmon 1.10.2 was used for alignment 47 , and DESeq2 was used for count normalization and statistical comparisons. Benjamini-Hochberg method was used to adjust the p- value (adj.p), and genes with adj.p < 0.05 were used for pathway analysis using The Gene Ontology (GO) knowledgebase and KEGG database. The gene network figure is made by STRING database 48 . Statistical analysis Investigators were blinded to treatment during the outcome assessment and statistical analysis. The data are presented as the fold-increase above basal or average ± standard error. The student’s t -test was used in 2 group comparisons, and One-way ANOVA with Tukey correction was used in multiple group comparisons. The p -value of less than 0.05 was considered statistically significant. Declarations Acknowledgments Funding Department of Defense (USA) HT9425-24-1-0788 (MY) National Eye Institute (USA) R56EY037692 (MY) Department of Defense (USA)HT9425-23-1-1045 (AL and DFC) Grimshaw-Gudewicz Foundation (MY) Author contribution Conceptualization: MY, DFC Methodology: MY, AL, DFC Investigation: MY, AL, LH, FE, GC, NX, KY, AL, TW Visualization: LH Supervision: MY, DFC Resources: DFC, MY Writing—original draft: MY, LH, AL Writing—review & editing: AL, DFC Competing interests MY, AL, and DFC are inventors of a pending patent US20250256100A1 Data and materials availability: All data generated or analyzed during this study are included in this published article, and its supplementary information files. Raw sequencing data are available following the anonymized link for the duration of the peer-review process; The data will switch to public upon acceptance. https://dataverse.harvard.edu/previewurl.xhtml?token=70846dd9-7a99-4f28-a65e-ddd6df6376df References Magliano, D. J., Boyko, E. J. & IDF Diabetes Atlas 10th edition scientific committee. Global picture. in IDF DIABETES ATLAS [Internet]. 10th edition (International Diabetes Federation, 2021). Boulton, A. J. M. et al. Diabetic neuropathies: a statement by the American Diabetes Association. Diabetes Care 28 , 956–962 (2005). Bodman, M. A., Dreyer, M. A. & Varacallo, M. A. Diabetic Peripheral Neuropathy. in StatPearls [Internet] (StatPearls Publishing, 2024). Markoulli, M., Flanagan, J., Tummanapalli, S. S., Wu, J. & Willcox, M. The impact of diabetes on corneal nerve morphology and ocular surface integrity. Ocul. Surf. 16 , 45–57 (2018). Rózsa, A. J. & Beuerman, R. W. Density and organization of free nerve endings in the corneal epithelium of the rabbit. Pain 14 , 105–120 (1982). Edwards, K. et al. Utility of corneal confocal microscopy for assessing mild diabetic neuropathy: baseline findings of the LANDMark study. Clin Exp Optom 95 , 348–354 (2012). Deák, E. A. et al. Longitudinal Changes in Corneal Cell and Nerve Fiber Morphology in Young Patients with Type 1 Diabetes with and without Diabetic Retinopathy: A 2-Year Follow-up Study. Invest Ophthalmol Vis Sci 60 , 830–837 (2019). Mansoor, H., Tan, H. C., Lin, M. T.-Y., Mehta, J. S. & Liu, Y.-C. Diabetic Corneal Neuropathy. J Clin Med 9 , (2020). Stepp, M. A., Tadvalkar, G., Hakh, R. & Pal-Ghosh, S. Corneal epithelial cells function as surrogate Schwann cells for their sensory nerves. Glia 65 , 851–863 (2017). Shaheen, B. S., Bakir, M. & Jain, S. Corneal nerves in health and disease. Surv Ophthalmol 59 , 263–285 (2014). Dartt, D. A. Neural regulation of lacrimal gland secretory processes: relevance in dry eye diseases. Prog Retin Eye Res 28 , 155–177 (2009). Dua, H. S. et al. Neurotrophic keratopathy. Prog Retin Eye Res 66 , 107–131 (2018). Sheha, H., Tighe, S., Hashem, O. & Hayashida, Y. Update On Cenegermin Eye Drops In The Treatment Of Neurotrophic Keratitis. Clin Ophthalmol 13 , 1973–1980 (2019). Lefevre, M. C. et al. Integrating flexible electronics for pulsed electric field delivery in a vascularized 3D glioblastoma model. npj Flexible Electronics 5 , 1–9 (2021). Sprugnoli, G. et al. Reduction of intratumoral brain perfusion by noninvasive transcranial electrical stimulation. Sci Adv 5 , eaau9309 (2019). Thakral, G. et al. Electrical stimulation as an adjunctive treatment of painful and sensory diabetic neuropathy. J Diabetes Sci Technol 7 , 1202–1209 (2013). ElAbd, R. et al. Role of Electrical Stimulation in Peripheral Nerve Regeneration: A Systematic Review. Plast Reconstr Surg Glob Open 10 , e4115 (2022). Kostopoulos, D. et al. An Open-Label Comparative Study of the Impact of Two Types of Electrical Stimulation (Direct Current Neuromuscular Electrical Stimulation and Transcutaneous Electrical Stimulation) on Physical Therapy Treatment of Diabetic Peripheral Neuropathy. J Diabetes Res 2025 , 9970124 (2025). Lennikov, A., ElZaridi, F. & Yang, M. Modified streptozotocin-induced diabetic model in rodents. Animal Models and Experimental Medicine 7 , 777–780 (2024). Cai, D., Zhu, M., Petroll, W. M., Koppaka, V. & Robertson, D. M. The impact of type 1 diabetes mellitus on corneal epithelial nerve morphology and the corneal epithelium. Am J Pathol 184 , 2662–2670 (2014). Yang, M. et al. Transcorneal but not transpalpebral electrical stimulation disrupts mucin homeostasis of the ocular surface. BMC Ophthalmology 22 , 1–14 (2022). Enayati, S. et al. Optimal transcorneal electrical stimulation parameters for preserving photoreceptors in a mouse model of retinitis pigmentosa. Neural Regen Res 19 , 2543–2552 (2024). Köhler, M. et al. Small-conductance, calcium-activated potassium channels from mammalian brain. Science 273 , 1709–1714 (1996). Ghaffariyeh, A. et al. Evaluation of transcutaneous electrical simulation to improve recovery from corneal hypoesthesia after LASIK. Graefes Arch Clin Exp Ophthalmol 247 , 1133–1138 (2009). Han, G. et al. Transcutaneous Electrical Stimulation for the Prevention of Dry Eye Disease after Photorefractive Keratectomy: Randomized Controlled Trial. Ophthalmol Sci 3 , 100242 (2023). Sivanesan, E., Levitt, R. C., Sarantopoulos, C. D., Patin, D. & Galor, A. Noninvasive Electrical Stimulation for the Treatment of Chronic Ocular Pain and Photophobia. Neuromodulation 21 , 727–734 (2018). Yan, X. et al. Electrical stimulation induces calcium-dependent neurite outgrowth and immediate early genes expressions of dorsal root ganglion neurons. Neurochem Res 39 , 129–141 (2014). Ni, L. et al. Electrical stimulation therapy for peripheral nerve injury. Front Neurol 14 , 1081458 (2023). Al-Majed, A. A., Brushart, T. M. & Gordon, T. Electrical stimulation accelerates and increases expression of BDNF and trkB mRNA in regenerating rat femoral motoneurons. Eur J Neurosci 12 , 4381–4390 (2000). Goganau, I., Sandner, B., Weidner, N., Fouad, K. & Blesch, A. Depolarization and electrical stimulation enhance in vitro and in vivo sensory axon growth after spinal cord injury. Exp Neurol 300 , 247–258 (2018). Fang, Z. P. & Mortimer, J. T. Selective activation of small motor axons by quasi-trapezoidal current pulses. IEEE Trans Biomed Eng 38 , 168–174 (1991). Kameneva, T. et al. Retinal ganglion cells: mechanisms underlying depolarization block and differential responses to high frequency electrical stimulation of ON and OFF cells. J Neural Eng 13 , 016017 (2016). Hirschberg, B., Maylie, J., Adelman, J. P. & Marrion, N. V. Gating properties of single SK channels in hippocampal CA1 pyramidal neurons. Biophys J 77 , 1905–1913 (1999). Vasilyev, D. V. & Barish, M. E. Postnatal development of the hyperpolarization-activated excitatory current Ih in mouse hippocampal pyramidal neurons. J Neurosci 22 , 8992–9004 (2002). Mehrotra, D. et al. Hyperpolarization-activated currents drive neuronal activation sequences in sleep. Curr Biol 34 , 3043–3054.e8 (2024). Vitali, I. et al. Progenitor Hyperpolarization Regulates the Sequential Generation of Neuronal Subtypes in the Developing Neocortex. Cell 174 , 1264–1276.e15 (2018). Nassini, R., Materazzi, S., Benemei, S. & Geppetti, P. The TRPA1 channel in inflammatory and neuropathic pain and migraine. Rev. Physiol. Biochem. Pharmacol. 167 , 1–43 (2014). Roa-Coria, J. E. et al. Possible involvement of peripheral TRP channels in the hydrogen sulfide-induced hyperalgesia in diabetic rats. BMC Neurosci. 20 , 1 (2019). McKemy, D. D., Neuhausser, W. M. & Julius, D. Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature 416 , 52–58 (2002). Belmonte, C., Acosta, M. C. & Gallar, J. Neural basis of sensation in intact and injured corneas. Exp. Eye Res. 78 , 513–525 (2004). Parra, A. et al. Ocular surface wetness is regulated by TRPM8-dependent cold thermoreceptors of the cornea. Nat. Med. 16 , 1396–1399 (2010). Stepp, M. A. et al. Wounding the cornea to learn how it heals. Exp Eye Res 121 , 178–193 (2014). Percie du Sert, N. et al. The ARRIVE guidelines 2.0: updated guidelines for reporting animal research. BMJ Open Sci 4 , e100115 (2020). Malin, S. A., Davis, B. M. & Molliver, D. C. Production of dissociated sensory neuron cultures and considerations for their use in studying neuronal function and plasticity. Nature Protocols 2 , 152–160 (2007). Yun, H., Lathrop, K. L. & St Leger, A. J. A whole-mount immunohistochemistry protocol for detection of mouse corneal nerves. STAR Protoc 2 , 100734 (2021). Yang, M. et al. Genomic DNA activates the AIM2 inflammasome and STING pathways to induce inflammation in lacrimal gland myoepithelial cells. Ocul Surf 30 , 263–275 (2023). Patro, R., Duggal, G., Love, M. I., Irizarry, R. A. & Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods 14 , 417–419 (2017). Szklarczyk, D. et al. The STRING database in 2025: protein networks with directionality of regulation. Nucleic Acids Res 53 , D730–D737 (2024). Additional Declarations Yes there is potential Competing Interest. MY, AL, and DFC are inventors of a pending patent US20250256100A1 Supplementary Files supplementarymaterials.pdf Supplementary Materials for Non-invasive electrical stimulation restores corneal nerve density in diabetic neuropathy by promoting axon growth in trigeminal ganglia neurons Cite Share Download PDF Status: Under Review Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7895492","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":535728365,"identity":"95f47b0b-ba22-4fcb-bd74-d5eb8110f65d","order_by":0,"name":"Menglu Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABKklEQVRIie3RMUvDQBTA8RcCyXLgGmiDn0AIHIQOYvGbXBCS5TIFgkiHg0I6addAQb+CRXAWAnEJHeWgonGRDh1SAo6tF06croib4P2HPBLej5AcgE73V6vlMLqJwPm6YwDeXkLkML1fE0su/0SOJpfFKsggmM4mTxf8/LgPvfF7i0YvLrPH946C+NUiHHQkf67SJa1CBP0Sz1CZYIbKVEk49b2OME7DZZwV4lsINnKLBMyhvpK8riW5ESSJtztBotbIt4IcrtWEI1x35JZHpRmzB0Eohk3WvQWpSUV9IAvAc07NHi3PkOXQBDZXBGcoTAYq8ljhpknBvebRW0tHJ8MDJ7oD8kHcqV3Mueovy+PYnTJA8hSs7+fq9S6zEZchgF3v39HpdLp/3SfApmaq/gIkHwAAAABJRU5ErkJggg==","orcid":"","institution":"Schepens Eye Research Institute, Massachusetts Eye and Ear, Department of Ophthalmology, Harvard Medical School","correspondingAuthor":true,"prefix":"","firstName":"Menglu","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2025-10-18 21:00:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7895492/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7895492/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":97175595,"identity":"ae9e7359-fb5f-489c-be9e-269b533a67e9","added_by":"auto","created_at":"2025-12-01 15:28:02","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":575542,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eES treatment in STZ\u003c/strong\u003e: (A) Schematic of the experimental design. Yellow X indicates the site of the ES. (B) Corneal sodium fluorescein (CSF) staining of non-DM (Vehicle), STZ with sham treatment, and STZ with ES treatment. (C) CSF score using NIH scoring system. (D) β-III-tubulin staining in non-DM, STZ with sham treatment, and ES-treated STZ group. (E) Quantification of mean gray value from subbasal plexus signal of β-III-tubulin. (F, G) Subbasal plexus of the central cornea traced using ImageJ. (H, I) β-III-tubulin signal of the stromal bundle layer and quantification. n=7. (J) Coche-Bonet esthesiometer reading of the central cornea after 2-week ES treatment. (K) [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e over time recording of neurons isolated from STZ-induced T1DM mice with or without ES treatment, along with non-DM control. (L) Quantification of the peak of [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e change to baseline. n=4. * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05; ** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; ****, \u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7895492/v1/357321f981c5245a14c32211.png"},{"id":97175561,"identity":"e10a90ea-3ad0-49e9-a607-5ac0a56a5bd5","added_by":"auto","created_at":"2025-12-01 15:27:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":202418,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eES in isolated TG neurons\u003c/strong\u003e: (A) Schematic of the experimental design. (B) IF signal of β-III-tubulin (red) and GAP43 (green) in primary TG neurons under sham treatment (left) and ES (right). (C) Quantification of the fluorescence intensity of GAP43. (D, E) GAP43 expression in primary TG culture is analyzed by WB and quantification. n=6. (F, G) Fura2 assay upon K\u003csup\u003e+\u003c/sup\u003e 40mM stimulation, showing [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e over time and the change of peak [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e to baseline. (H, I) Fura2 assay upon TRPV1 agonist Capsaicin\u003csup\u003e \u003c/sup\u003estimulation. (J, K) Fura2 assay upon TRPM8 agonist Icilin stimulation. n=3. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05; ** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; ns, no significance.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7895492/v1/77ef8b49c133fc352c235c1d.png"},{"id":97175562,"identity":"67078139-c7ba-4444-9bb0-4bb0f7f10f81","added_by":"auto","created_at":"2025-12-01 15:27:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":471993,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptomics analysis of 2-week-ES-treated TGs from keratectomy model\u003c/strong\u003e: (A) β-III-tubulin signal traced at the wounded site in non-injured control, keratectomy injury with sham and ES treatment. (B). Quantification of the mean gray scale of β-III-tubulin signal. (C) Length of the subbasal plexus within the wound site. n=4. (D) DEG compared between each group visualized by volcano plots. (E) Hierarchical clustering of DEGs from each sample visualized by heatmap. n=3. (F) Enrichment analysis of DGEs between Injury and ES-treated group using Gene Ontology (top) and KEGG (bottom) database. (G) qPCR validation of Cacna1s. (H and I) WB validation of p-AKT and AKT in primary TG neuron treated with \u003cem\u003ein vitro\u003c/em\u003e ES, and quantification of p-AKT/AKT ratio. Raw western blot shown in Supplementary Fig 5. n=4. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05; ** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; ****, \u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7895492/v1/74653d08f7871f2039bb479d.png"},{"id":97175564,"identity":"b3d68ee3-9810-496c-860c-4613b88dba23","added_by":"auto","created_at":"2025-12-01 15:27:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":273225,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMembrane potential change of isolated TG neurons under continuous ES\u003c/strong\u003e: (A) Representative image of TG neurons loaded with FluoVolt before and after KCl stimulation. Mean Fluorescence Intensity (MFI) over time is quantified in (B). MFI over time in neurons under ES (yellow) and control (black). The change in peak MFI to baseline is quantified in (D). n=5. (E) Fura 2 assay in isolated TG neurons under ES (yellow), with the presence of EGTA (orange), and control. Change in peak [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e to basal is quantified in (F). (G) MFI over time in neurons in response to ES with the presence of EGTA. (G) MFI over time in neurons in response to ES with the presence of KCNN inhibitor Apamin 10\u003csup\u003e-6\u003c/sup\u003eM. (I) Relative expression of Kcnn1-3 to β-actin in RNA extracted from naïve TGs. (J,K) Expression levels of \u003cem\u003eKcnn\u003c/em\u003e 1 and 3 in purified TG neurons in the keratectomy model (J) and STZ model (K) after 2-week-ES treatment.\u0026nbsp; n=5. * \u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05; ** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01. MFI, Mean Fluorescent Intensity.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7895492/v1/eb43085756e3bb08c71b9bd2.png"},{"id":97175563,"identity":"bcaad977-099e-438c-9d77-5a1764e638b8","added_by":"auto","created_at":"2025-12-01 15:27:51","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":990128,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eES treatment with the presence of KCNN antagonist and agonist\u003c/strong\u003e: (A) Representative images of IF labeling for β-III-tubulin (red) and GAP43 (green) in primary TG neurons under sham treatment, Apamin, \u003cem\u003ein vitro\u003c/em\u003e ES, and ES combined with Apamin. (B) Quantification of the fluorescence intensity of GAP43. (C) Corneal wholemount with β-III-tubulin staining of the corneal nerve in non-injured control, keratectomy injury with sham treatment, ES-treated injury, and ES-treated injury with Apamin groups. (D) Quantification of the total length of central corneal plexus. (E, F) Corneal sodium fluorescein staining image of non-DM control, STZ with sham treatment, ES-treated STZ, and ES-treated STZ with Apamin, and quantification. (G, H) Corneal wholemount with β-III-tubulin immunolabeling in STZ model, and the total length of central corneal plexus was quantified. n=5 (I, J) Corneal images of sodium fluorescein staining taken from non-DM control, STZ with sham treatment, and KCNN agonist NS309-treated STZ groups, the NIH score is quantified. (K, L) The corneal wholemount with β-III-tubulin and GAP43 staining are shown, and the average numbers of growth cones are provided. n=4. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05; ** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01; ****, \u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7895492/v1/2c34e08d6fbb4a72bc50af51.png"},{"id":97248996,"identity":"0f6a10b8-8508-40fb-93ce-3369371eb901","added_by":"auto","created_at":"2025-12-02 13:09:23","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":139495,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematics of the molecular action by ES in peripheral sensory neurons. \u003c/strong\u003e(A) KCNN channel at resting state without ES; (B) KCNN activation upon ES application.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7895492/v1/bae42002733ddb67bc3b4bff.png"},{"id":97664570,"identity":"bff34d74-9b73-4564-9ccb-7f81c8940a98","added_by":"auto","created_at":"2025-12-08 09:10:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3617365,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7895492/v1/56d634cb-8a33-4866-a1a8-88e3fac24062.pdf"},{"id":97175566,"identity":"ba3759c8-bb38-48b3-a574-4dd400044e87","added_by":"auto","created_at":"2025-12-01 15:27:51","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2399737,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Materials for Non-invasive electrical stimulation restores corneal nerve density in diabetic neuropathy by promoting axon growth in trigeminal ganglia neurons\u003c/p\u003e","description":"","filename":"supplementarymaterials.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7895492/v1/3535a3191e01b407d72818c9.pdf"}],"financialInterests":"\u003cb\u003eYes\u003c/b\u003e there is potential Competing Interest.\nMY, AL, and DFC are inventors of a pending patent US20250256100A1","formattedTitle":"Non-invasive electrical stimulation restores corneal nerve density and function in diabetic neuropathy via KCNN-dependent mechanism","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDiabetes mellitus (DM) is a metabolic disorder that currently affects 537\u0026nbsp;million adults worldwide \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e, making it one of the most significant challenges to global health. Diabetic neuropathy (DN), characterized by distal-to-proximal loss of nerve function, is the most common complication, estimated to affect 50% of the DM patients \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. DN presents as numbing or burning sensation, weakness of the limbs, and often leads to skin ulceration, infection, and eventually to amputation \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e, which creates a huge burden on patient health and healthcare systems. Among various affected tissues, the cornea is the most densely innervated in the human body and is particularly susceptible to DN \u003csup\u003e4\u003c/sup\u003e. Notably, it is also one of the most sensitive parts of the body, as the number of free epithelial nerve endings is estimated to be 300\u0026ndash;600 times that of the skin \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. The intrinsic transparency of the cornea allows detailed visualization of nerve fiber architecture, making the cornea a powerful model for studying peripheral neuropathies \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. The corneal involvement of DN is characterized by progressive damage to corneal nerves and epithelial erosion \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e - collectively referred to as diabetic keratopathy (DK). To date, therapeutic strategies to restore corneal innervation and function in DK remain poorly defined.\u003c/p\u003e\u003cp\u003eThe majority of the corneal sensory nerve fibers originate in the trigeminal ganglia (TGs)\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. It conducts touch, pain, and temperature, induces a blink reflex, stimulates wound healing\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, provides trophic factors to the cornea, and induces tear and mucin production and secretion \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Progression of DK, which correlates with the severity of DN \u003csup\u003e8\u003c/sup\u003e, results in delayed wound healing, persistent epithelial damage, and corneal ulceration \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e that harm vision. In addition, corneal nerve damage can lead to neuropathic corneal pain \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e, where patients suffer eye burning, stinging, and pain despite the loss of normal sensation. These conditions require prompt treatment to alleviate pain and restore vision. The current management of DN includes optimization of glucose and symptom management \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. For cornea, recombinant human nerve growth factor offers a promising new therapeutic avenue \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. However, the disadvantages of recombinant human nerve growth factor exist in the need for frequent applications (6 times per day), high cost, strict storage requirements, and eye discomfort \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e and consequential intolerance. Creating more accessible and efficacious therapies is an urgent need for better nerve restoration and symptom relief to benefit a wider group of patients.\u003c/p\u003e\u003cp\u003eTranscutaneous electrical stimulation (TES) is an emerging neuromodulatory therapy that delivers micro-electrical currents non-invasively through the skin \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Electrical stimulation (ES) is progressively acknowledged as a clinical intervention for peripheral neuropathy \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. However, the action of ES in DK has not yet been explored, nor did the mechanism of action behind the neuromodulation effect of ES. Herein, we demonstrate in a preclinical mouse model of DM, ES ameliorated corneal nerve loss and investigate the molecular events under ES in primary TG neuron culture.\u003c/p\u003e"},{"header":"Result","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eES restores corneal nerve density and sensory function in STZ-induced DK models\u003c/h2\u003e\u003cp\u003eWe induced type 1 DM (T1DM) in mice by STZ injection \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, a well-established model that recapitulates the progressive metabolic and neuropathic features of human diabetes. In this model, corneal nerve loss was reported to start by 12 weeks post-STZ \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Mouse development of the T1DM status was validated by blood glucose\u0026thinsp;\u0026ge;\u0026thinsp;350mg/dl (\u003cb\u003eSupplemental Fig.\u0026nbsp;1\u003c/b\u003e). Starting from week 15 post-injection, when DK has already developed, a random eye was treated with ES (ramp waveform, 300\u0026micro;A, 20Hz) for 4 min daily, the stimulation parameters identified previously as optimal for ocular surface protection \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. This timing allowed us to directly test the therapeutic potential of ES in reversing corneal nerve pathology. Control mice received electrodes without electrical current (Sham). Mice received ES for 14 consecutive days, and the second day after the final ES, corneal fluorescein staining (CSF) was conducted to evaluate the epithelial integrity, while the corneal whole-mount were immunolabeled with a nerve-specific marker β-III-tubulin (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). At seventeen weeks post-STZ injection, the sham group demonstrated a significantly higher CSF score, indicating the loss of epithelial integrity, whereas this loss of epithelial integrity was mitigated by ES treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB \u003cb\u003eand C\u003c/b\u003e). Consistently, in corneal wholemounts, the fluorescent intensity of β-III-tubulin labeling in the subbasal plexus was significantly reduced in STZ corneas compared to non-STZ controls, while ES treatment attenuated this reduction (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD \u003cb\u003eand E\u003c/b\u003e). Similarly, the total nerve length in the central cornea was significantly reduced in sham-treated STZ mice, which was again attenuated by ES treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF \u003cb\u003eand G\u003c/b\u003e). Although STZ did not affect the total length of stromal nerve bundles, ES treatment resulted in a significant increase of stromal bundle length (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI), indicative of a robust regenerative effect. These findings demonstrate that ES protects corneal epithelial integrity and promotes nerve regeneration, providing a structural basis for potential functional recovery.\u003c/p\u003e\u003cp\u003eWe next investigated the functional benefits of ES on the corneal nerves. After 14 consecutive days of ES, the corneal sensation was evaluated in each group using a Cochet-Bonnet esthesiometer, which measures mechanical touch sensation (involving primarily mechanonociceptor excitability). At seventeen weeks post-STZ, the sham-treated group demonstrated a significant loss of sensory function, reflected by a shorter filament length needed to elicit a blink reflex; ES treatment for 14 days mitigated the sensory function reduction in STZ mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ). Upon sacrifice, we isolated the trigeminal ganglia from the same animals and directly assessed neuronal function by measuring the intracellular [Ca\u003csup\u003e2+\u003c/sup\u003e] response to KCl, a widely used neuroexcitatory depolarizing stimulus (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eK). In the sham-treated group, the neuronal [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e response to K\u003csup\u003e+\u003c/sup\u003e was reduced, although not statistically significant, likely due to the heterogeneity of TG neurons, which include multiple sensory subtypes (e.g., mechanical, thermal, and chemical) with variable excitability and susceptibility to diabetic injury. By contrast, 14 days of ES treatment significantly restored the neural [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e response (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eL). This result indicates that ES directly modulates the neural response to improve the mechanonociceptor function and improves epithelium integrity and corneal nerve density in STZ-induced preclinical model of diabetic mice.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eES directly promotes axonal growth of trigeminal ganglia neurons\u003c/h3\u003e\n\u003cp\u003eWe next determined whether ES directly acts on the corneal nerves to stimulate their growth or protect them against hyperglycemia stress using isolated TG neurons. In normal glucose conditions, ES (ramp waveform, 300\u0026micro;A, 20Hz) was applied for 30 min every 24h, and sham treatment group consisted of carbon electrodes without electrical current. This condition was optimized to prolong the ES effect during the limited in vitro culture period and to compensate for the direct neuronal exposure to electrodes in the absence of surrounding tissue \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Neurons were fixed at 48h after the first stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) and double-immunostained for antibodies against β-III-tubulin and growth-associated protein 43 (GAP43), an axonal growth marker (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The results revealed significantly higher GAP43 levels in ES-treated neurons than sham-treated controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Increased expression of GAP43 was also demonstrated by Western blot analysis under the same experimental setting (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD \u003cb\u003eand E\u003c/b\u003e), which further strengthens the finding that ES directly stimulates neurite outgrowth \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eNext, we determined if ES protects the nerve fibers against a high glucose condition \u003cem\u003ein vitro\u003c/em\u003e. TG neurons were isolated from naive C57BL6J mice and cultured in Neurobasal A media, supplemented with excessive D-glucose (100 mM) to mimic TIDM. Control cultures were supplemented with L-glucose (100 mM), which cannot be metabolized by cells, to serve as the osmolarity control. The neurons were cultured for 24 h after the treatment. β-III-tubulin immunolabeling (\u003cb\u003eSupplemental Fig.\u0026nbsp;3A\u003c/b\u003e) revealed that high D-glucose significantly decreased the neurite length, as measured by the longest neurite, compared to L-glucose control; ES promoted longer neurite outgrowth under the high glucose condition (\u003cb\u003eSupplemental Fig.\u0026nbsp;3B\u003c/b\u003e). Collectively, we show that ES directly acts on TG neurons to enhance axonal growth in both normal and high D-glucose conditions.\u003c/p\u003e\u003cp\u003eTo evaluate the functionality of cultured trigeminal ganglia neurons, we conducted Fura2AM assay immediately after ES stimulation. Neuronal excitability was first evaluated using isotonic KCl as a general depolarizing stimulus. In ES-treated neurons, intracellular Ca\u003csup\u003e2+\u003c/sup\u003e ([Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e) responses to KCl (40 mM) were significantly elevated compared to the sham-treated group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF \u003cb\u003eand G\u003c/b\u003e), indicating that ES directly modulates the TG neuronal responsiveness that may underlie improved corneal sensory function. Because corneal innervation is critical not only for protective reflexes but also for ocular comfort and basal tear secretion, we next studied whether ES differentially affects pain-related nociceptive and thermo-sensory signals. Stimulation using the TRPV1 agonist capsaicin (10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003eM), which mimics painful stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH) induced an increased [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e in sham-treated neurons. Remarkably, ES abolished the [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e response to capsaicin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI), suggesting that ES suppresses nociceptive activity and may alleviate ocular pain. In contrast, stimulation with TRPM8 agonist icilin with a final concentration of 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003eM, which reproduces normal cold-sensation of the cornea and is essential for basal tear secretion, evoked similar [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e responses in both sham and ES-treated neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ \u003cb\u003eand K\u003c/b\u003e). These results suggest that ES enhances overall TG neuron excitability, selectively dampens painful nociceptive signaling without impairing physiological cold sensing while promoting mechanonociceptor function. The data highlight a balanced modulation of TG neuronal subtypes underlying improved corneal recovery and ocular surface homeostasis.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eTranscriptomic profiling identifies Ca signaling and ion transport pathways mediated by ES\u003c/h3\u003e\n\u003cp\u003eTo further determine if the neural regenerative potential of ES extends to other sensory nerve conditions, we employed an acute mechanical corneal nerve injury model - the keratectomy wound. In this model, the superficial corneal nerve plexus was mechanically scrapped off in the central 1.5 mm diameter area. ES was applied 4 min daily for 14 consecutive days and the cornea was collected for wholemount immunolabeling of β-III-tubulin. The fluorescent intensity and subbasal plexus length was quantified at the wounded area. Significantly increased fluorescent intensity and plexus length was found in ES-treated corneas than sham control, indicating that ES robustly promotes reinnervation of the cornea following acute and severe nerve injury (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B \u003cb\u003eand C\u003c/b\u003e). These findings support the regenerative potential of ES across distinct models of both chronic (diabetic) and acute corneal nerve injury.\u003c/p\u003e\u003cp\u003eTo investigate the mechanisms underlying the regenerative effects of ES, we performed RNA sequencing on mRNA isolated from mouse TGs under four conditions: untreated (Ctrl), 2 weeks after keratectomy wound (Injury), ES-treated keratectomy for 2 weeks (ES), and ES without keratectomy wound (ES no injury). The acute keratectomy model provides a well-defined and reproducible nerve injury paradigm that allows clearer distinction of ES-induced regenerative responses, minimizing the systemic metabolic confounders present in the diabetic model. This model enabled us to specifically capture transcriptional programs associated with ES-mediated nerve repair. A total of 22,084 expressed genes were identified. Of these, 6,859 genes were differently expressed (\u003cem\u003epadj\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) between untreated control and keratectomy injuries, 1,388 genes between sham-treated and ES-treated injuries, and 8,147 genes between non-treated control and ES no Injury groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003eDifferentially expressed genes (DEG) between the untreated control and injury groups were identified using an adjusted \u003cem\u003ep\u003c/em\u003e-value (padj\u0026thinsp;\u0026lt;\u0026thinsp;0.05). To highlight the most biologically meaningful changes and minimize noise from modest expression shifts, we further applied a stringent cutoff of absolute log₂(Fold Change)\u0026thinsp;\u0026gt;\u0026thinsp;2.5. This threshold allowed us to focus on genes with robust alterations that are most likely to drive functional changes in TG responses. These genes were visualized in a heatmap (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Gene ontology (GO) enrichment analysis of DEG between ES and Injury group revealed upregulation of genes related to neural development, axonogenesis, axon guidance, and synaptic organization/function (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, \u003cb\u003eupper panel\u003c/b\u003e). Notably, several Ca\u003csup\u003e2+\u003c/sup\u003e ion transport and signaling pathways were observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, \u003cb\u003ered\u003c/b\u003e). These results suggest that ES promotes nerve growth in part by regulating membrane ion channels and activating Ca\u003csup\u003e2+\u003c/sup\u003e signaling. KEGG pathway analysis further demonstrated that ES regulates genes involved in synaptic function, axonogenesis, Wnt and Ca\u003csup\u003e2+\u003c/sup\u003e signaling, as well as PI3K signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, \u003cb\u003elower panel\u003c/b\u003e). To understand the interconnection among these pathways, we performed gene network analysis, which identified genes involving Ca\u003csup\u003e2+\u003c/sup\u003e signaling, namely \u003cem\u003eUnc79, Cacna1s\u003c/em\u003e, and \u003cem\u003eCasq1\u003c/em\u003e being upstream of regeneration-associated genes such as \u003cem\u003eSox\u003c/em\u003e and \u003cem\u003eBmps\u003c/em\u003e (\u003cb\u003eSupplemental Fig.\u0026nbsp;4\u003c/b\u003e). These results suggest that Ca\u003csup\u003e2+\u003c/sup\u003e signaling plays an initial regulatory role in ES-induced neural regeneration.\u003c/p\u003e\u003cp\u003eTo validate the RNA-seq results, neurons from TG were isolated using CD90.2 magnetic beads to minimize glial contaminations, and the resultant RNAs were subjected to qPCR. We noted that the gene encoding L-type voltage gated Ca\u003csup\u003e2+\u003c/sup\u003e channel showed a trend of increased expression by ES treatment, although it did not reach statistical significance (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG), consistent with the RNA-seq data. The results further suggest that ES may act directly through modulating Ca\u003csup\u003e2+\u003c/sup\u003e channel activity, without altering their expression levels. As AKT activation is known to occur downstream of Ca\u003csup\u003e2+\u003c/sup\u003e signaling, we next asked if the AKT activation is altered. The AKT activation was confirmed using primary TG neurons, in which \u003cem\u003ein vitro\u003c/em\u003e stimulation with ES resulted in a significant increase in AKT phosphorylation 15 minutes post-stimulation, as determined by WB analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH \u003cb\u003eand I\u003c/b\u003e), indicating an activation of AKT by ES in consistent with the KEGG enrichment findings.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eES induces [Ca] responses and activates KCNN channels to hyperpolarize TG neurons\u003c/h3\u003e\n\u003cp\u003eGiven the RNA-seq results on ion transportation and Ca\u003csup\u003e2+\u003c/sup\u003e signaling, we investigated whether ES directly modulates membrane potential and [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e changes in TG neurons. To directly assess the electrophysiological responses to ES, isolated TG neurons from naive mice were cultured in F12 media supplemented with 10% FBS overnight to ensure cytoactivity. Neurons loaded with voltage-sensitive dye FluoVolt dye were recorded at 20 frames per second using real-time fluorescence microscopy. Demonstrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, addition of KCl, a known stimulator of neural depolarization, significantly increased FluoVolt fluorescent intensity in TG neurons upon depolarization. Mean fluorescence intensity of each frame was quantified using ImageJ (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Following 5-10s of baseline recording, ES (ramp, 100\u0026micro;A, 20Hz) was applied during the image acquisition. An immediate decrease of membrane potential was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, \u003cb\u003eyellow\u003c/b\u003e). The change in mean fluorescence intensity to baseline was quantified by ImageJ and plotted in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD. This result shows that ES induces neuron hyperpolarization instead of depolarization.\u003c/p\u003e\u003cp\u003eNext, we recorded the [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e activity during ES using Fura2 assay. ES induced an immediate increase of [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE), and this ES-induced [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e surge was abolished by the Ca\u003csup\u003e2+\u003c/sup\u003e chelator EGTA (\u003cb\u003e4E and F\u003c/b\u003e). To further assess the relationship between Ca\u003csup\u003e2+\u003c/sup\u003e influx and membrane potential, we blocked [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e response with EGTA. Strikingly, the ES-induced hyperpolarization visualized using FluoVolt signals was also blocked by EGTA pre-treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG), demonstrating that ES-induced hyperpolarization is [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e-dependent. As potassium intermediate/small conductance calcium activated channel (KCNN) is known to be activated by [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e signal and mediate membrane hyperpolarization \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e, we tested whether it is involved in this process. Repeated the recording with KCNN blocker Apamin (10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003eM) pre-treatment showed that Apamin altered ES-induced hyperpolarization to depolarization (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). Hereto, we show that ES-induced hyperpolarization in TG neurons is Ca\u003csup\u003e2+\u0026minus;\u003c/sup\u003edependent and mediates through KCNN channels.\u003c/p\u003e\u003cp\u003eThere are three well-studied isotypes of KCNN channels, namely KCNN1, KCNN2, and KCNN3. Real-time qPCR from TG of naive mice detected expression of \u003cem\u003eKcnn1\u003c/em\u003e and \u003cem\u003eKcnn3\u003c/em\u003e, but not \u003cem\u003eKcnn2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI). To define the neuronal expression of \u003cem\u003eKcnn1\u003c/em\u003e and 3, total RNAs were extracted from TG neurons isolated using CD90.2-conjugated magnetic beads. Results of qPCR confirmed \u003cem\u003eKcnn1\u003c/em\u003e and \u003cem\u003eKcnn3\u003c/em\u003e expression in TG neurons. \u003cem\u003eKcnn1\u003c/em\u003e expression was significantly decreased in the injured group and stayed low regardless of ES treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ). In contrast, \u003cem\u003eKcnn3\u003c/em\u003e expression was significantly increased by ES compared to the sham-treated group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ). Similarly, in STZ-induced diabetic mice, \u003cem\u003eKcnn1\u003c/em\u003e expression was down-regulated by ES treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK), while \u003cem\u003eKcnn3\u003c/em\u003e expression was significantly increased by ES compared to sham-treated STZ mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK). These data indicate that ES selectively increases expression of \u003cem\u003eKcnn3\u003c/em\u003e in both injury and diabetic neuropathy models, suggesting that KCNN3 may play a key role in mediating the ES-induced neuronal hyperpolarization.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eES-induced nerve regeneration is KCNN-dependent\u003c/h3\u003e\n\u003cp\u003eTo investigate the role of KCNN in ES-induced nerve regeneration, we first investigated in the \u003cem\u003ein vitro\u003c/em\u003e model. After neuron attachment post isolation, KCNN inhibitor Apamin (MCE, HY-P0256) was added to the Neuralbasal A media 10 min before ES (100\u0026micro;A, 20Hz, for 30 min). Neurons receiving ES without Apamin served as positive controls, while Apamin-treated neurons without ES as vehicle controls. Forty-eight hours later, IF with GAP43 and β-III-tubulin antibody showed that Apamin treatment alone did not affect GAP43 level in TG neurons. As expected, ES significantly increased GAP43 expression, whereas this effect was markedly diminished when ES was combined with Apamin treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA \u003cb\u003eand B\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eTo model diabetic conditions \u003cem\u003ein vitro\u003c/em\u003e, TG neurons were cultured in high glucose (100 mM) with L-glucose serving as osmolarity control. After neuron attachment post incubation, Apamin was added to high glucose-conditioned TG neurons 10 min prior to ES. The neurons were fixed and subjected to IF with β-III-tubulin antibody 24h later, and the length of the longest neurite was quantified. High glucose significantly reduced the neurite length compared to the osmolarity control, while ES application preserved the neurites. Apamin application abolished the effect of ES (\u003cb\u003eSupplemental Fig.\u0026nbsp;6\u003c/b\u003e). These results indicate that the KCNN activation by ES contributes to axonal growth promotion and neural protection \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eWe next investigated the effect of KCNN blockage \u003cem\u003ein vivo\u003c/em\u003e using the corneal keratectomy model. ES was applied for 14 consecutive days, with or without topical Apamin (10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003eM) treatment. Mice receiving electrodes without stimulation served as sham controls, and uninjured mice served as baseline controls. Consistent with our \u003cem\u003ein vitro\u003c/em\u003e findings, ES significantly promoted the reinnervation of the central cornea, while this effect was significantly diminished by KCNN blockage with Apamin (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC \u003cb\u003eand D\u003c/b\u003e). Next, we evaluated the \u003cem\u003ein vivo\u003c/em\u003e effect of KCNN in the STZ model. ES was applied for 14 consecutive days, with or without topical Apamin (10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003eM) treatment. Mice receiving electrodes without stimulation served as sham controls, and non-STZ mice served as baseline controls. On day fourteen of the ES treatment, corneal sensation was measured by a Cochet-Bonnet esthesiometer before tissue collection. The increased corneal sensation was observed in the ES treatment group compared to the sham-treated STZ group, and this effect was blocked by Apamin (\u003cb\u003eSupplemental Fig.\u0026nbsp;7\u003c/b\u003e). Corneal fluorescein staining revealed significantly decreased epithelial disruption in the ES-treated STZ group compared to the sham-treated group, an effect which was also abolished by Apamin (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE \u003cb\u003eand F\u003c/b\u003e). Similar results were demonstrated using the total length of central subbasal plexus as a readout in the keratectomy model, where Apamin treatment reversed the ES-induced nerve regeneration in STZ model (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG \u003cb\u003eand H\u003c/b\u003e). Together, these results indicate that activation of KCNN is essential for ES-induced nerve regeneration and sensory recovery.\u003c/p\u003e\u003cp\u003eTo determine if KCNN activation is sufficient for corneal nerve regrowth, starting from week 17 after STZ induction, KCNN agonist NS309 (10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003eM) was applied topically to both eyes of the STZ mice once daily for a consecutive 14 days. STZ mice receiving sham treatment with topical saline eye drops served as vehicle controls, while STZ mice receiving ES treatment served as positive controls. On day 14, the CSF was measured, and the corneas were collected for wholemount IF against β-III-tubulin and GAP43. The result showed that similar to ES treatment, NS309 significantly diminished the increased CSF score induced by STZ (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI \u003cb\u003eand J\u003c/b\u003e). GAP43 staining showed that both NS309 and ES treatment significantly increased the number of growth cones compared to sham-treated corneas (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eK \u003cb\u003eand L\u003c/b\u003e). These results indicate that the activation of KCNN plays a critical role in driving the regeneration of corneal nerves in both diabetes and mechanical injuries.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the current study, we demonstrated that ES successfully promoted corneal reinnervation in DK, the corneal manifestation of DN, restoring both structural innervation and functional sensation. It enhanced corneal sensory function, restored epithelial integrity, and increased subbasal nerve density. Mechanistically, ES induced nerve regeneration by triggering a rapid Ca\u003csup\u003e2+\u003c/sup\u003e influx that drove membrane hyperpolarization through KCNN activation (\u003cb\u003eFig.\u0026nbsp;7\u003c/b\u003e). Importantly, blockade of Ca\u003csup\u003e2+\u003c/sup\u003e influx or KCNN activity abrogated ES-induced hyperpolarization \u003cem\u003ein vitro\u003c/em\u003e and nerve regeneration \u003cem\u003ein vivo\u003c/em\u003e. Taken together, our findings indicate that ES promotes corneal nerve regeneration through Ca\u003csup\u003e2+\u003c/sup\u003e-KCNN signaling axis and contributes to overall corneal homeostasis by restoring innervation, improving sensation, and maintaining epithelial integrity. The data highlight the therapeutic potential of ES for neurodegenerative conditions such as DK.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eOur findings extend previous work on ES as a regenerative therapy in both the peripheral and central nervous system. ES has attracted great interest in the recent decade in the motor nervous system \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. It has been published that ES enhanced corneal reinnervation in mechanically wounded corneas without preexisting disease background \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e, our result demonstrates broader applications for targeting disease-associated corneal nerve degeneration. The \u003cem\u003ein vivo\u003c/em\u003e relevance of these findings was confirmed in two distinct models: corneal keratectomy and STZ-induced diabetes. The mechanical wound model is widely used in corneal nerve regeneration research, as it provides a fast and controllable corneal nerve damage. STZ-induced diabetes model better mimics the corneal nerve damage caused by diabetic neuropathy, providing insights into the therapeutic role of ES in disease-induced nerve damage. The finding that ES promoted corneal nerve regeneration and epithelial integrity highlights the functional consequences of TG neuron modulation on the ocular surface. DK as a common and vision-threatening complication of diabetes with limited treatment options, the therapeutic implications of these findings are significant.\u003c/p\u003e\u003cp\u003eOur results provide important mechanistic insight into how ES regulates TG neuronal function. Calcium imaging and our \u003cem\u003ein vitro\u003c/em\u003e assays revealed that ES induced a surge in intracellular Ca\u0026sup2;⁺ and evoked membrane hyperpolarization through KCNN activation. Published works have shown that ES elevates intracellular Ca\u003csup\u003e2+\u003c/sup\u003e level ([Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e)\u003csup\u003e27\u003c/sup\u003e, activates phosphoinositide 3-kinases (PI3Ks) \u003csup\u003e2829\u003c/sup\u003e, and promotes Brain-Derived Neurotrophic Factor (BDNF) to promote axonal growth. Our results align with the published work with the observation of Ca\u003csup\u003e2+\u003c/sup\u003e elevation, AKT activation, as well as increased BDNF receptor signaling pathway, as suggested in GO analysis. In contrast to inducing nerve depolarization, as reported by others\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e, our data showed that ES hyperpolarizes the TG neurons through an involvement of potassium channels. One potential explanation is that the hyperpolarization we observed is specific to the ramp waveform we used, while other groups commonly use rectangular waveforms. It has been reported that in alpha motor neurons, the gradually changing amplitude of the stimulating current, as in ramp waveforms, decreases the amplitude of neural depolarization \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Work in retinal ganglion cells indicates that neural activation depends on the amplitude and frequency of stimulation \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e, indicating the membrane potential changes in response to ES are highly waveform-dependent.\u003c/p\u003e\u003cp\u003eThe hyperpolarization induced by ES was abolished by both Ca\u003csup\u003e2+\u003c/sup\u003e chelation and the KCNN blocker Apamin. The KCNN is a family of K\u003csup\u003e+\u003c/sup\u003e channels that is activated upon calmodulin binding regardless of the membrane potential \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. During [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e surge, calmodulin captures Ca\u003csup\u003e2+\u003c/sup\u003e and binds to KCNN to induce an outflow of K\u003csup\u003e+\u003c/sup\u003e that leads to hyperpolarization. Our data suggest that KCNN directly regulates neuronal growth, which is likely due to the hyperpolarization state that has switched the neuron from a conductive to a regenerative state. Hyperpolarization has been well recognized in enhancing memory and learning activities \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e, and most recent evidence unveiled its role in promoting neurogenesis in central nerve system development \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. By identifying KCNN-dependent Ca\u003csup\u003e2+\u003c/sup\u003e signaling as a key pathway linking ES to neuronal survival and regeneration, this study provides new mechanistic insights into how ES promotes functional recovery in the nervous system.\u003c/p\u003e\u003cp\u003eAn additional novel observation of this study is that ES differentially regulates TG sensory subtypes. Previous testing of corneal nerve function, which relies primarily on touch stimulation, which activates mechanonociceptors. As mentioned, corneal sensory nerves carry the sensations of touch, pain, and temperature, stimulate the blink reflex, and regulate tear production through nociceptors \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, namely TRPV1 and TRPM8. TRPV1 expressed on the corneal nerves senses noxious stimuli and is the main contributor of neuropathic pain in DM \u003csup\u003e37,38\u003c/sup\u003e. TRPM8 is activated by innocuous cold temperatures \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e and maintains basal tear secretion \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. Notably, we observed ES inhibited the neuron response to a TRPV1 agonist capsaicin but did not alter the response to TRPM8 agonist icilin \u003cem\u003ein vitro\u003c/em\u003e. This selective modulation indicates that ES not only promotes structural regeneration but also regulates a homeostatic corneal nerve function without exacerbating pain or disrupting normal thermosensation. Future studies employing more advanced models, such as iPSC-derived sensory neurons, will be critical to clarify the mechanistic insights involved and ultimately identify novel therapeutic targets that alleviate ocular pain without impairing the normal sensory functions essential for ocular homeostasis. Together, the demonstration that our ramp waveform ES can selectively suppress nociceptive activity while enhancing mechanosensory responses distinguishes this approach from nonspecific pro-regenerative strategies and suggests therapeutic specificity.\u003c/p\u003e\u003cp\u003eThis study primarily focuses on the effect of ES on corneal nerve damage; therefore, we did not include the situation when ES is applied to DK eyes when DM is under treatment. The prolonged effect of ES on corneal nerves is also unclear. Our future scope is to address these limitations.\u003c/p\u003e\u003cp\u003eIn conclusion, non-invasive ES treatment significantly promoted corneal nerve regeneration, restored epithelial integrity, enhanced neurite outgrowth in both DK and corneal injury models. ES selectively suppressed nociceptive signaling and preserved and/or promoted physiological cold- and touch-sensing, thereby balancing distinct sensory modalities for corneal homeostasis. These findings demonstrated the potential of ES as a non-invasive therapeutic approach for diabetic keratitis, neuropathy and other neurodegenerative conditions.\u003c/p\u003e"},{"header":"Materials and Method","content":"\u003cp\u003e\u003cb\u003eAnimals\u003c/b\u003e: All C57BL6J mice were purchased from Jackson Lab (Bar Harbor, ME). We used a modified STZ-induced type I DM (T1DM) model on male 8-week-old C57BL/6J as we published \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. STZ (Sigma, MO) 30mg/kg was mixed with saline and immediately injected intraperitoneal for a consecutive 5 days. Blood glucose levels were measured two weeks after the initial injection, and mice with glucose levels exceeding 350 mg/dL were considered diabetic. For mechanical injury, we used a keratectomy model on both male and female C57BL/6J mice at 8 weeks of age, following the published method\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Mice were anesthetized using a single intraperitoneal (IP) injection of ketamine and xylazine. Anesthetized mice were placed on heating pads to maintain body temperature while sedated and continue to be placed on a warm pad within their cage till recovery. Once sedation is confirmed, the central 1.5 mm diameter area was marked using a biopsy punch and the epithelium and the upper 1/3 of the corneal stroma of a random eye was removed using a rotating spur. All mice were kept in a 12-hour light/dark cycle with free access to food and water. All animal experiments were performed following protocols approved by the Institutional Animal Care and Use Committee of the Schepens Eye Research Institute and followed the Association for Research in Vision and Ophthalmology (ARVO) standards of using animals in research No. 2023N000038. The animal experiments adhered to the ARRIVE guidelines (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://arriveguidelines.org\u003c/span\u003e\u003cspan address=\"https://arriveguidelines.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)\u003csup\u003e43\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003ePrimary TG neuron isolation, culture, and purification\u003c/strong\u003e\u003cp\u003eC57BL/6J mice aged 8\u0026ndash;12 weeks were used for TG neuron isolation and primary culture, following the method published by Malin, et al\u003csup\u003e44\u003c/sup\u003e. Fresh TG tissues were minced and enzymatically digested in a cocktail containing collagenase II and dispase II for 30 min at 37\u0026deg;C. The resulting cell suspension was purified by Percoll gradient centrifugation in L15 medium supplemented with 10% FBS. The cell pellet was resuspended in Neurobasal A medium and plated onto dishes precoated with laminin and poly-D-lysine. To purify neurons from glial cells, the cell pellet was resuspended in 90\u0026micro;l Neural Basal A media with 10\u0026micro;l CD90.2 magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany), and incubated at room temperature for 20 min. The mixture was then loaded into MS Columns on a magnetic separator (Miltenyi Biotec, Bergisch Gladbach, Germany). The flow-through was discarded, and the purified neurons were pushed out in autoMACS rinsing solution (Miltenyi Biotec, Bergisch Gladbach, Germany) by a plunger. The isolated neurons were then pelleted by centrifuging at 400g for 6 min and proceeded for future assays.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eTranscutaneous Electric Stimulation \u003cem\u003ein vivo\u003c/em\u003e\u003c/strong\u003e\u003cp\u003e\u003cem\u003eIn vivo\u003c/em\u003e ES was performed as previously described\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e using the STG4000 pulse generator (Multichannel Systems, Reutlingen, Germany). Under isoflurane anesthesia, the anode electrode was positioned on the mouse's abdomen through the conductive gel (Spectral 360; Parker Laboratories, Fairfield, NJ, USA). The cathode electrode probe was applied to the skin over the orbital area through a conductive gel interface. For sham controls, electrode probes were applied to the orbital area without delivering an electrical current. A biphasic ramp waveform (300 \u0026micro;A, 20 Hz) was administered for 4 minutes daily over 14 days. To minimize potential confounders, mice were subjected to ES in a randomized order.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eElectric stimulation \u003cem\u003ein vitro\u003c/em\u003e\u003c/strong\u003e\u003cp\u003eElectric stimulation of cell cultures was conducted using the STG4000 pulse generator (Multichannel Systems, Reutlingen, Germany) with a biphasic ramp waveform (100 \u0026micro;A, 20 Hz, 30 min). The electrical current was applied to the cultures via a c-dish carbon electrode plate (Ion Optix, Westwood, MA, USA). To ensure sterility, the c-dish was incubated in 70% ethanol for 15 minutes, followed by a 15-minute rinse with distilled water, and subsequently air-dried for 1 hour before reuse\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCorneal Fluorescein Staining (CSF)\u003c/strong\u003e\u003cp\u003eOne \u0026micro;L of 2.5% fluorescein (Sigma-Aldrich Corp., St. Louis, MO, USA) was applied to the lateral conjunctival sac, and staining scores were recorded after eye examination using slit-lamp microscopy (Topcon SL-DC4, Tokyo, Japan) under cobalt blue light. The punctate staining of the ocular surface was evaluated in a masked fashion and graded as per the National Eye Institute Scoring System (Bethesda, MD, USA), giving a score between 0 and 3 for each of the five areas of the cornea. Each cornea was scored 3 times individually by different investigators, and the average score of each time was recorded as the final score.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCorneal sensation measurement\u003c/strong\u003e\u003cp\u003eA Cochet-Bonnet esthesiometer was used for measuring corneal sensation. Mice were acclimated to the testing environment by holding scruff of the neck for several seconds before testing, by an investigator masked to the experimental group. The filament was extended to 6 cm and a gentle touch was applied to the tip of the nylon filament to the central cornea. The filament length was decreased every 0.5 cm to repeat the touch if no blink response is observed, until a consistent blink response is induced. Each length was repeated for 6 times to ensure accuracy. The length of the filament was recorded as the sensory function of the cornea.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eCorneal whole mount and IF\u003c/b\u003e: The corneal wholemount was conducted following the published method\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. The eyes were immediately enucleated and fixed with 1.3% paraformaldehyde (VVR Life Science, Radnor, PA, USA) at room temperature for 1 h. The corneas were then dissected, and permeabilized in 1% Triton X-100 for 1 h at room temperature, followed by blocking and in 0.2% Triton X-100 1% BSA for 30 min. The samples were then incubated with a primary antibody to β-III-tubulin (1:30; R\u0026amp;D, NL1195R, Minneapolis, MN) for 24 h at 4\u0026deg;C then 2 h at room temperature and washed with PBS 3 times for 10 min. Corneas were mounted on slides under the microscope and covered with a ProLong Diamond antifade reagent (Thermo Fisher Scientific, Waltham, MA, USA). The cornea was then imaged using a Z scan with 4x4 tile scan by confocal microscopy (Leica SP8, Wetzlar, Germany). To quantify the nerve length, a central area of 400 pixel\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e was selected and transformed into a binary image. The nerve was traced, and the total length is quantified by Skeleton 3D plugin using ImageJ 1.54p as described in \u003csup\u003e45\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eFluoVolt assay\u003c/strong\u003e\u003cp\u003eIsolated TG neurons from naive C57BL6J mice were cultured in F12 media with 10% fetal bovine serum (FBS) overnight to ensure cytoactivity during living cell analysis. Neurons were loaded with FluoVolt dye (ThermoFisher, MA, USA) in KRB buffer for 30min. ES was applied to the neurons during the image acquisition and the FlouVolt signal was visualized using time-lapse microscopy (Leica Dmi8, Wetzlar, Germany) at 20 frame/s. The mean fluorescence intensity was quantified by ImageJ.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003e[Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e measurement\u003c/strong\u003e\u003cp\u003ePrimary TG neurons were plated onto 35-mm glass-bottom culture dishes and incubated at 37\u0026deg;C overnight as described previously \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Cells were then incubated for 1 h at 37\u0026deg;C with Krebs-Ringer bicarbonate buffer containing 119 mM NaCl, 4.8 mM KCl, 1.0 mM CaCl\u003csub\u003e2\u003c/sub\u003e, 1.2 mM MgSO\u003csub\u003e4\u003c/sub\u003e, and 25 mM NaHCO\u003csub\u003e3\u003c/sub\u003e with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) plus 0.5% bovine serum albumin containing 0.5 \u0026micro;M fura-2/AM (Invitrogen, Grand Island, NY, USA), 8 \u0026micro;M pluronic acid F127 (Sigma-Aldrich, St. Louis, MO, USA) and 250 \u0026micro;M sulfinpyrazone (Sigma-Aldrich, St. Louis, MO, USA) for 1 h. Before Ca\u003csup\u003e2+\u003c/sup\u003e measurements, cells were washed with KRB-HEPES containing sulfinpyrazone. Ca\u003csup\u003e2+\u003c/sup\u003e measurements were conducted using a ratio imaging system (In Cyt Im2; Intracellular Imaging, Cincinnati, OH, USA) using excitation wavelengths of 340 and 380 nm and an emission wavelength of 505 nm.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eWestern blot\u003c/b\u003e: Western blotting (WB) was conducted as previously described\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Total protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using Mini-PROTEAN\u0026reg; 4\u0026ndash;20% Precast Gels (Biorad, Hercules, CA, USA) and transferred to 0.45 \u0026micro;m pore-size nitrocellulose membrane. The membranes were blocked with 5% non-fat milk (Biorad, Hercules, CA, USA) at room temperature for 1 h and then incubated overnight at 4\u0026deg;C with the primary antibodies listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. After being washed with TBS-Tween 20 (TBST) buffer, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (BioRad, Hercules, CA, USA) Goat Anti-Rabbit IgG (H\u0026thinsp;+\u0026thinsp;L)-HRP (1:2000) or Goat Anti-Mouse IgG (H\u0026thinsp;+\u0026thinsp;L)-HRP (1:2000) for 1 h at room temperature. Signals were developed with enhanced chemiluminescence with a Clarity Western ECL Substrate (Biorad, Hercules, CA, USA) and detected with an iBright 1500 gel documentation system (Thermo Fisher Scientific, Waltham, MA, USA). Densitometry analysis was performed using ImageJ software (NIH, Bethesda, MD, USA). The whole uncropped and unprocessed membrane images overlayed with protein standard ladder are presented in Supplemental Figs.\u0026nbsp;2 and 6.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimary antibodies and dilutions used in the study\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTarget protein\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eProduced by\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eProduct no\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eIHC dilution\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWB dilution\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eβ-III-tubulin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u0026amp;D, Minneapolis, MN, USA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNL1195R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAP43\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eThermo Fisher Scientific, Waltham, MA, USA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e33-5000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:2000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAP43 Conjugated\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNovus Biologicals, Centennial, CO, USA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNB300-143AF488\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAkt\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCell Signaling, Danvers, MA, USA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9272\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ep-Akt\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCell Signaling, Danvers, MA, USA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e9271\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eβ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eThermo Fisher Scientific, Waltham, MA, USA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMA5-15739\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1:4000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eRT-qPCR\u003c/strong\u003e\u003cp\u003eTotal RNA was extracted using Quick RNA miniprep kit (Zymo Research, Santa Cruze, CA); the concentration and purity of the RNA were analyzed using a NanoDrop One spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthesized from 500 ng of total RNA using the PrimeScript RT Master Mix (RR036A, Takara, San Jose, CA, USA) on an Applied Biosystems 2720 thermal cycler (Life Technologies, Waltham, MA, USA). Quantitative PCR was performed on a CFX384 Touch Real-Time PCR Detection System (BioRad, Hercules, CA) using iTaq Universal SYBR Green Supermix (BioRad, Hercules, CA) and mouse-specific primers (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The PCR cycling conditions were initial denaturation at 95\u0026deg;C for 5 minutes, followed by 40 cycles of 95\u0026deg;C for 30 seconds, 60\u0026deg;C for 30 seconds (annealing), and 72\u0026deg;C for 30 seconds (extension). Each sample was run in duplicates. Fluorescence was recorded at the end of each cycle. Gene expression was normalized to β-actin, and fold changes were calculated using the 2^\u0026minus;ΔΔCT method.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eRT-PCR Primer list used in the study\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTarget gene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer Sequence\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSource\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ecacna1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TCA GCA TCG TGG AAT GGA AAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eIDT (Coralville, IA, USA)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: GTT CAG AGT GTT GTT GTC ATC CT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ekcnn1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TTTAAAAGCGTAAACGGCTCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eIDT (Coralville, IA, USA)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: CAGAGCAAAAGAGCAGAGTGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ekcnn2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: TCCGTCGTAGGAGGAGGTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eIDT (Coralville, IA, USA)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: AATTGTTGTGCTCCGGCTTAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ekcnn3\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: GGTCATTGAGATTTAGCTGGCTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eIDT (Coralville, IA, USA)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: CTGTTGCACTCTTCTCCCACG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF: CATTGCTGACAGGATGCAGAAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eIDT (Coralville, IA, USA)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR: TGCTGGAAGGTGGACAGTGAGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eBulk RNA sequencing\u003c/strong\u003e\u003cp\u003eTotal RNA from trigeminal ganglia tissue was extracted using Quick RNA miniprep kit (Zymo Research, Santa Cruze, CA). Messenger RNA was purified, and quality was evaluated using an Agilent Bioanalyzer, and only samples with RNA Integrity Number (RIN)\u0026thinsp;\u0026gt;\u0026thinsp;7 was used for RNA sequencing. RNA-seq libraries were prepared by Novogene (Sacramento, CA, USA) using poly(A) enrichment and sequenced on an Illumina NovaSeqX Plus platform to generate 150 bp paired-end reads at a depth of 30\u0026nbsp;million reads per sample. FastQC was used for quality control, Salmon 1.10.2 was used for alignment\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e, and DESeq2 was used for count normalization and statistical comparisons. Benjamini-Hochberg method was used to adjust the \u003cem\u003ep-\u003c/em\u003evalue (adj.p), and genes with adj.p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were used for pathway analysis using The Gene Ontology (GO) knowledgebase and KEGG database. The gene network figure is made by STRING database\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003cp\u003eInvestigators were blinded to treatment during the outcome assessment and statistical analysis. The data are presented as the fold-increase above basal or average\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error. The student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test was used in 2 group comparisons, and One-way ANOVA with Tukey correction was used in multiple group comparisons. The \u003cem\u003ep\u003c/em\u003e-value of less than 0.05 was considered statistically significant.\u003c/p\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDepartment of Defense (USA)\u0026nbsp;HT9425-24-1-0788 (MY)\u003c/p\u003e\n\u003cp\u003eNational Eye Institute (USA)\u0026nbsp;R56EY037692 (MY)\u003c/p\u003e\n\u003cp\u003eDepartment of Defense (USA)HT9425-23-1-1045 (AL and DFC)\u003c/p\u003e\n\u003cp\u003eGrimshaw-Gudewicz Foundation (MY)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: MY, DFC\u003c/p\u003e\n\u003cp\u003eMethodology: MY, AL, DFC\u003c/p\u003e\n\u003cp\u003eInvestigation: MY, AL, LH, FE, GC, NX, KY, AL, TW\u003c/p\u003e\n\u003cp\u003eVisualization: LH\u003c/p\u003e\n\u003cp\u003eSupervision: MY, DFC\u003c/p\u003e\n\u003cp\u003eResources: DFC, MY\u003c/p\u003e\n\u003cp\u003eWriting—original draft: MY, LH, AL\u003c/p\u003e\n\u003cp\u003eWriting—review \u0026amp; editing: AL, DFC\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMY, AL, and DFC are inventors of a pending patent US20250256100A1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData and materials availability:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article, and its supplementary information files. Raw sequencing data\u0026nbsp;are available following the anonymized link for the duration of the peer-review process; The data will switch to public upon acceptance. https://dataverse.harvard.edu/previewurl.xhtml?token=70846dd9-7a99-4f28-a65e-ddd6df6376df\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eMagliano, D. J., Boyko, E. J. \u0026amp; IDF Diabetes Atlas 10th edition scientific committee. Global picture. in \u003cem\u003eIDF DIABETES ATLAS [Internet]. 10th edition\u003c/em\u003e (International Diabetes Federation, 2021).\u003c/li\u003e\n \u003cli\u003eBoulton, A. J. M. \u003cem\u003eet al.\u003c/em\u003e Diabetic neuropathies: a statement by the American Diabetes Association. \u003cem\u003eDiabetes Care\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 956\u0026ndash;962 (2005).\u003c/li\u003e\n \u003cli\u003eBodman, M. A., Dreyer, M. A. \u0026amp; Varacallo, M. A. Diabetic Peripheral Neuropathy. in \u003cem\u003eStatPearls [Internet]\u003c/em\u003e (StatPearls Publishing, 2024).\u003c/li\u003e\n \u003cli\u003eMarkoulli, M., Flanagan, J., Tummanapalli, S. S., Wu, J. \u0026amp; Willcox, M. The impact of diabetes on corneal nerve morphology and ocular surface integrity. \u003cem\u003eOcul. Surf.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 45\u0026ndash;57 (2018).\u003c/li\u003e\n \u003cli\u003eR\u0026oacute;zsa, A. J. \u0026amp; Beuerman, R. W. Density and organization of free nerve endings in the corneal epithelium of the rabbit. \u003cem\u003ePain\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 105\u0026ndash;120 (1982).\u003c/li\u003e\n \u003cli\u003eEdwards, K. \u003cem\u003eet al.\u003c/em\u003e Utility of corneal confocal microscopy for assessing mild diabetic neuropathy: baseline findings of the LANDMark study. \u003cem\u003eClin Exp Optom\u003c/em\u003e \u003cstrong\u003e95\u003c/strong\u003e, 348\u0026ndash;354 (2012).\u003c/li\u003e\n \u003cli\u003eDe\u0026aacute;k, E. A. \u003cem\u003eet al.\u003c/em\u003e Longitudinal Changes in Corneal Cell and Nerve Fiber Morphology in Young Patients with Type 1 Diabetes with and without Diabetic Retinopathy: A 2-Year Follow-up Study. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e \u003cstrong\u003e60\u003c/strong\u003e, 830\u0026ndash;837 (2019).\u003c/li\u003e\n \u003cli\u003eMansoor, H., Tan, H. C., Lin, M. T.-Y., Mehta, J. S. \u0026amp; Liu, Y.-C. Diabetic Corneal Neuropathy. \u003cem\u003eJ Clin Med\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, (2020).\u003c/li\u003e\n \u003cli\u003eStepp, M. A., Tadvalkar, G., Hakh, R. \u0026amp; Pal-Ghosh, S. Corneal epithelial cells function as surrogate Schwann cells for their sensory nerves. \u003cem\u003eGlia\u003c/em\u003e \u003cstrong\u003e65\u003c/strong\u003e, 851\u0026ndash;863 (2017).\u003c/li\u003e\n \u003cli\u003eShaheen, B. S., Bakir, M. \u0026amp; Jain, S. Corneal nerves in health and disease. \u003cem\u003eSurv Ophthalmol\u003c/em\u003e \u003cstrong\u003e59\u003c/strong\u003e, 263\u0026ndash;285 (2014).\u003c/li\u003e\n \u003cli\u003eDartt, D. A. Neural regulation of lacrimal gland secretory processes: relevance in dry eye diseases. \u003cem\u003eProg Retin Eye Res\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 155\u0026ndash;177 (2009).\u003c/li\u003e\n \u003cli\u003eDua, H. S. \u003cem\u003eet al.\u003c/em\u003e Neurotrophic keratopathy. \u003cem\u003eProg Retin Eye Res\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, 107\u0026ndash;131 (2018).\u003c/li\u003e\n \u003cli\u003eSheha, H., Tighe, S., Hashem, O. \u0026amp; Hayashida, Y. Update On Cenegermin Eye Drops In The Treatment Of Neurotrophic Keratitis. \u003cem\u003eClin Ophthalmol\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1973\u0026ndash;1980 (2019).\u003c/li\u003e\n \u003cli\u003eLefevre, M. C. \u003cem\u003eet al.\u003c/em\u003e Integrating flexible electronics for pulsed electric field delivery in a vascularized 3D glioblastoma model. \u003cem\u003enpj Flexible Electronics\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 1\u0026ndash;9 (2021).\u003c/li\u003e\n \u003cli\u003eSprugnoli, G. \u003cem\u003eet al.\u003c/em\u003e Reduction of intratumoral brain perfusion by noninvasive transcranial electrical stimulation. \u003cem\u003eSci Adv\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, eaau9309 (2019).\u003c/li\u003e\n \u003cli\u003eThakral, G. \u003cem\u003eet al.\u003c/em\u003e Electrical stimulation as an adjunctive treatment of painful and sensory diabetic neuropathy. \u003cem\u003eJ Diabetes Sci Technol\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1202\u0026ndash;1209 (2013).\u003c/li\u003e\n \u003cli\u003eElAbd, R. \u003cem\u003eet al.\u003c/em\u003e Role of Electrical Stimulation in Peripheral Nerve Regeneration: A Systematic Review. \u003cem\u003ePlast Reconstr Surg Glob Open\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, e4115 (2022).\u003c/li\u003e\n \u003cli\u003eKostopoulos, D. \u003cem\u003eet al.\u003c/em\u003e An Open-Label Comparative Study of the Impact of Two Types of Electrical Stimulation (Direct Current Neuromuscular Electrical Stimulation and Transcutaneous Electrical Stimulation) on Physical Therapy Treatment of Diabetic Peripheral Neuropathy. \u003cem\u003eJ Diabetes Res\u003c/em\u003e \u003cstrong\u003e2025\u003c/strong\u003e, 9970124 (2025).\u003c/li\u003e\n \u003cli\u003eLennikov, A., ElZaridi, F. \u0026amp; Yang, M. Modified streptozotocin-induced diabetic model in rodents. \u003cem\u003eAnimal Models and Experimental Medicine\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 777\u0026ndash;780 (2024).\u003c/li\u003e\n \u003cli\u003eCai, D., Zhu, M., Petroll, W. M., Koppaka, V. \u0026amp; Robertson, D. M. The impact of type 1 diabetes mellitus on corneal epithelial nerve morphology and the corneal epithelium. \u003cem\u003eAm J Pathol\u003c/em\u003e \u003cstrong\u003e184\u003c/strong\u003e, 2662\u0026ndash;2670 (2014).\u003c/li\u003e\n \u003cli\u003eYang, M. \u003cem\u003eet al.\u003c/em\u003e Transcorneal but not transpalpebral electrical stimulation disrupts mucin homeostasis of the ocular surface. \u003cem\u003eBMC Ophthalmology\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 1\u0026ndash;14 (2022).\u003c/li\u003e\n \u003cli\u003eEnayati, S. \u003cem\u003eet al.\u003c/em\u003e Optimal transcorneal electrical stimulation parameters for preserving photoreceptors in a mouse model of retinitis pigmentosa. \u003cem\u003eNeural Regen Res\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 2543\u0026ndash;2552 (2024).\u003c/li\u003e\n \u003cli\u003eK\u0026ouml;hler, M. \u003cem\u003eet al.\u003c/em\u003e Small-conductance, calcium-activated potassium channels from mammalian brain. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e273\u003c/strong\u003e, 1709\u0026ndash;1714 (1996).\u003c/li\u003e\n \u003cli\u003eGhaffariyeh, A. \u003cem\u003eet al.\u003c/em\u003e Evaluation of transcutaneous electrical simulation to improve recovery from corneal hypoesthesia after LASIK. \u003cem\u003eGraefes Arch Clin Exp Ophthalmol\u003c/em\u003e \u003cstrong\u003e247\u003c/strong\u003e, 1133\u0026ndash;1138 (2009).\u003c/li\u003e\n \u003cli\u003eHan, G. \u003cem\u003eet al.\u003c/em\u003e Transcutaneous Electrical Stimulation for the Prevention of Dry Eye Disease after Photorefractive Keratectomy: Randomized Controlled Trial. \u003cem\u003eOphthalmol Sci\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 100242 (2023).\u003c/li\u003e\n \u003cli\u003eSivanesan, E., Levitt, R. C., Sarantopoulos, C. D., Patin, D. \u0026amp; Galor, A. Noninvasive Electrical Stimulation for the Treatment of Chronic Ocular Pain and Photophobia. \u003cem\u003eNeuromodulation\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 727\u0026ndash;734 (2018).\u003c/li\u003e\n \u003cli\u003eYan, X. \u003cem\u003eet al.\u003c/em\u003e Electrical stimulation induces calcium-dependent neurite outgrowth and immediate early genes expressions of dorsal root ganglion neurons. \u003cem\u003eNeurochem Res\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 129\u0026ndash;141 (2014).\u003c/li\u003e\n \u003cli\u003eNi, L. \u003cem\u003eet al.\u003c/em\u003e Electrical stimulation therapy for peripheral nerve injury. \u003cem\u003eFront Neurol\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 1081458 (2023).\u003c/li\u003e\n \u003cli\u003eAl-Majed, A. A., Brushart, T. M. \u0026amp; Gordon, T. Electrical stimulation accelerates and increases expression of BDNF and trkB mRNA in regenerating rat femoral motoneurons. \u003cem\u003eEur J Neurosci\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 4381\u0026ndash;4390 (2000).\u003c/li\u003e\n \u003cli\u003eGoganau, I., Sandner, B., Weidner, N., Fouad, K. \u0026amp; Blesch, A. Depolarization and electrical stimulation enhance in vitro and in vivo sensory axon growth after spinal cord injury. \u003cem\u003eExp Neurol\u003c/em\u003e \u003cstrong\u003e300\u003c/strong\u003e, 247\u0026ndash;258 (2018).\u003c/li\u003e\n \u003cli\u003eFang, Z. P. \u0026amp; Mortimer, J. T. Selective activation of small motor axons by quasi-trapezoidal current pulses. \u003cem\u003eIEEE Trans Biomed Eng\u003c/em\u003e \u003cstrong\u003e38\u003c/strong\u003e, 168\u0026ndash;174 (1991).\u003c/li\u003e\n \u003cli\u003eKameneva, T. \u003cem\u003eet al.\u003c/em\u003e Retinal ganglion cells: mechanisms underlying depolarization block and differential responses to high frequency electrical stimulation of ON and OFF cells. \u003cem\u003eJ Neural Eng\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 016017 (2016).\u003c/li\u003e\n \u003cli\u003eHirschberg, B., Maylie, J., Adelman, J. P. \u0026amp; Marrion, N. V. Gating properties of single SK channels in hippocampal CA1 pyramidal neurons. \u003cem\u003eBiophys J\u003c/em\u003e \u003cstrong\u003e77\u003c/strong\u003e, 1905\u0026ndash;1913 (1999).\u003c/li\u003e\n \u003cli\u003eVasilyev, D. V. \u0026amp; Barish, M. E. Postnatal development of the hyperpolarization-activated excitatory current Ih in mouse hippocampal pyramidal neurons. \u003cem\u003eJ Neurosci\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 8992\u0026ndash;9004 (2002).\u003c/li\u003e\n \u003cli\u003eMehrotra, D. \u003cem\u003eet al.\u003c/em\u003e Hyperpolarization-activated currents drive neuronal activation sequences in sleep. \u003cem\u003eCurr Biol\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 3043\u0026ndash;3054.e8 (2024).\u003c/li\u003e\n \u003cli\u003eVitali, I. \u003cem\u003eet al.\u003c/em\u003e Progenitor Hyperpolarization Regulates the Sequential Generation of Neuronal Subtypes in the Developing Neocortex. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e174\u003c/strong\u003e, 1264\u0026ndash;1276.e15 (2018).\u003c/li\u003e\n \u003cli\u003eNassini, R., Materazzi, S., Benemei, S. \u0026amp; Geppetti, P. The TRPA1 channel in inflammatory and neuropathic pain and migraine. \u003cem\u003eRev. Physiol. Biochem. Pharmacol.\u003c/em\u003e \u003cstrong\u003e167\u003c/strong\u003e, 1\u0026ndash;43 (2014).\u003c/li\u003e\n \u003cli\u003eRoa-Coria, J. E. \u003cem\u003eet al.\u003c/em\u003e Possible involvement of peripheral TRP channels in the hydrogen sulfide-induced hyperalgesia in diabetic rats. \u003cem\u003eBMC Neurosci.\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 1 (2019).\u003c/li\u003e\n \u003cli\u003eMcKemy, D. D., Neuhausser, W. M. \u0026amp; Julius, D. Identification of a cold receptor reveals a general role for TRP channels in thermosensation. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e416\u003c/strong\u003e, 52\u0026ndash;58 (2002).\u003c/li\u003e\n \u003cli\u003eBelmonte, C., Acosta, M. C. \u0026amp; Gallar, J. Neural basis of sensation in intact and injured corneas. \u003cem\u003eExp. Eye Res.\u003c/em\u003e \u003cstrong\u003e78\u003c/strong\u003e, 513\u0026ndash;525 (2004).\u003c/li\u003e\n \u003cli\u003eParra, A. \u003cem\u003eet al.\u003c/em\u003e Ocular surface wetness is regulated by TRPM8-dependent cold thermoreceptors of the cornea. \u003cem\u003eNat. Med.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 1396\u0026ndash;1399 (2010).\u003c/li\u003e\n \u003cli\u003eStepp, M. A. \u003cem\u003eet al.\u003c/em\u003e Wounding the cornea to learn how it heals. \u003cem\u003eExp Eye Res\u003c/em\u003e \u003cstrong\u003e121\u003c/strong\u003e, 178\u0026ndash;193 (2014).\u003c/li\u003e\n \u003cli\u003ePercie du Sert, N. \u003cem\u003eet al.\u003c/em\u003e The ARRIVE guidelines 2.0: updated guidelines for reporting animal research. \u003cem\u003eBMJ Open Sci\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, e100115 (2020).\u003c/li\u003e\n \u003cli\u003eMalin, S. A., Davis, B. M. \u0026amp; Molliver, D. C. Production of dissociated sensory neuron cultures and considerations for their use in studying neuronal function and plasticity. \u003cem\u003eNature Protocols\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 152\u0026ndash;160 (2007).\u003c/li\u003e\n \u003cli\u003eYun, H., Lathrop, K. L. \u0026amp; St Leger, A. J. A whole-mount immunohistochemistry protocol for detection of mouse corneal nerves. \u003cem\u003eSTAR Protoc\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 100734 (2021).\u003c/li\u003e\n \u003cli\u003eYang, M. \u003cem\u003eet al.\u003c/em\u003e Genomic DNA activates the AIM2 inflammasome and STING pathways to induce inflammation in lacrimal gland myoepithelial cells. \u003cem\u003eOcul Surf\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 263\u0026ndash;275 (2023).\u003c/li\u003e\n \u003cli\u003ePatro, R., Duggal, G., Love, M. I., Irizarry, R. A. \u0026amp; Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. \u003cem\u003eNat Methods\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 417\u0026ndash;419 (2017).\u003c/li\u003e\n \u003cli\u003eSzklarczyk, D. \u003cem\u003eet al.\u003c/em\u003e The STRING database in 2025: protein networks with directionality of regulation. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, D730\u0026ndash;D737 (2024).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Transcutaneous electrical stimulation (ES), diabetes mellitus (DM), sensory function, neural regeneration, Ca2+-Induced K+ Channel (KCNN)","lastPublishedDoi":"10.21203/rs.3.rs-7895492/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7895492/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDiabetic neuropathy (DN) is the most common complication of diabetes mellitus (DM) and often involves the cornea, where progressive loss of nerve fibers contributes to impaired corneal sensitivity and wound healing defects. Current treatments are limited, underscoring the need for a regenerative therapy. Transcutaneous electrical stimulation (ES) is a neural modulating therapy that non-invasively delivers microcurrent electricity to the eye via orbital skin. ES treatment significantly restored the nerve density and sensory function in both streptozotocin-induced DM mice and \u003cem\u003ein vitro\u003c/em\u003e isolated trigeminal ganglia (TG) neurons. Transcriptomics analysis of TGs from \u003cem\u003ein vivo\u003c/em\u003e ES pointed to ion transport and Ca\u003csup\u003e2+\u003c/sup\u003e signaling alteration. Consistently, membrane potential recording in TGs showed a rapid hyperpolarization upon ES accompanied by increased [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e level. Inhibition of Ca\u003csup\u003e2+\u003c/sup\u003e-Induced K\u003csup\u003e+\u003c/sup\u003e Channel (KCNN) abolished the hyperpolarization and neural regeneration effect, whereas activation of KCNN channel significantly enhanced nerve regeneration in the STZ model compared with sham treatment. Overall, ES restores corneal nerve density and function in diabetes via KCNN activation, offering a novel, non-invasive, and clinically translatable therapeutic strategy for diabetic neuropathy.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Non-invasive electrical stimulation restores corneal nerve density and function in diabetic neuropathy via KCNN-dependent mechanism","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-01 15:27:46","doi":"10.21203/rs.3.rs-7895492/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"communications-biology","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"commsbio","sideBox":"Learn more about [Communications Biology](http://www.nature.com/commsbio/)","snPcode":"","submissionUrl":"","title":"Communications Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Communications Series","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"e9534d67-4483-4f1c-8f15-3f4174fd3b29","owner":[],"postedDate":"December 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":56959082,"name":"Health sciences/Neurology/Neurological disorders/Peripheral neuropathies"},{"id":56959083,"name":"Biological sciences/Neuroscience/Regeneration and repair in the nervous system"}],"tags":[],"updatedAt":"2026-03-03T01:20:54+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-01 15:27:46","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7895492","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7895492","identity":"rs-7895492","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.