Green Synthesis and Anti-Cancer Properties of Cerium Oxide Nanoparticles Using Pistachio Vera Pericarp Essential Oil

Green Synthesis and Anti-Cancer Properties of Cerium Oxide Nanoparticles Using Pistachio Vera Pericarp Essential Oil | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Green Synthesis and Anti-Cancer Properties of Cerium Oxide Nanoparticles Using Pistachio Vera Pericarp Essential Oil Nahid Askari, Hamide Hojabrpour, Mohammad Reza Mirzaei, Vahid Mirzaei, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5302341/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract In recent years, researchers have shown great interest in metal oxide nanoparticles for their possible use in medicine. The purpose of this investigation was to develop a simple and environmentally friendly method for producing cerium oxide nanoparticles (CeO2 NPs) using pistachio Vera Pericarp essential oil (PVEO) as a coating. It was measured the anti-cancer properties of these nanoparticles and their combined effects with zoledronic acid on human prostate (LNCap) and breast cancer cells (MCf7). Scanning electron microscopy (SEM) and X-ray diffractometry (XRD) were employed to examine the characteristics of the CeO2 NPs. SEM and XRD analyses confirmed the nanoparticles' size, shape, phase, and chemical composition. Biological tests demonstrated that the CeO2 NPs showed significant cytotoxic activity against LNCap and MCf7 cells, CeO2 NPs alone or with ZA reduced LNCaP and Mcf-7 cell viability. The CeO2 NPs effectively influenced cell proliferation, apoptosis, and migration by modulating the expression of apoptosis-related genes ( BCL -2 and BAX ), as indicated by real-time PCR results. The study also discovered that when combined with ZA, PVEO had a synergistic effect on LNCap and MCf7 cell lines. Overall, the study suggests that CeO2 NPs derived from PVEO have the potential to be a new therapeutic agent for prostate and breast cancers. cerium oxide nanoparticles anti-cancer properties synergistic effects prostate cancer Characterization techniques Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction One in six men and one in eight women will develop cancer in their lifetime, and 10% of men and 21% of women will die from it. Prostate and breast cancers are the most common and deadly cancers for men and women in the US, respectively. Both cancers often metastasize to the bone, which causes pain and fractures ( 1 ). The bone is the main site of metastasis for both cancers, affecting 65–75% of women and many men ( 2 ). The treatment for bone metastasis is mostly palliative, aiming to improve the quality of life and reduce the complications of the patients. Administered zoledronic acid, which belongs to the bisphosphonate class, is used to alleviate bone-related issues in metastatic prostate cancer patients and to avert the development of bone metastases in postmenopausal women diagnosed with early-stage breast cancer ( 3 ). Besides, Pistachios are beneficial for health because they have high levels of unsaturated fatty acids, antioxidants, and other biologically active compounds ( 4 ). These compounds, such as luteolin, flavonoids, anthocyanins, potassium, α-tocopherol, phytosterols, and xanthophyll carotenoids, can protect against oxidative stress and inflammation. The plant Pistacia vera , from which pistachios are derived, also has pharmacological properties, such as anti-cancer activity, and provides various nutrients, such as phytosterols, vitamin C, carvacrol, spathulenol, starch, and proteins ( 6 ). However, nanoparticles are extremely small particles, ranging from 1 to 100 nanometers in size ( 7 ). They have special physical and chemical properties that make them useful in many fields, including medicine, cosmetics, agriculture, and energy. These particles can be created through various methods, such as chemical, physical, or biological processes ( 8 ). One biological method is called green synthesis, which uses plant extracts or essential oils. These natural sources contain bioactive compounds like phenols, flavonoids, terpenoids, and terpenes ( 9 ). These compounds help form and stabilize the nanoparticles and can also give them additional properties like antibacterial, antioxidant, anti-inflammatory, or anticancer effects. Examples of nanoparticles made this way include gold, silver, copper, and zinc oxide nanoparticles ( 10 ). Using biological sources to produce nanoparticles is environmentally friendly, biocompatible, biodegradable, cost-effective, and renewable. The size, shape, composition, charge, and surface chemistry of nanoparticles influence how they interact with cells and their potential uses. Nanoparticles can also be modified with biomolecules on their surfaces to enhance their versatility and functionality ( 11 ). Nanoparticles are used in targeted drug delivery systems and diagnostics, as well as anticancer agents or adjuvants. They can influence the expression of genes that control apoptosis, which is the process of programmed cell death important for maintaining the balance between cell growth and death ( 12 ). For instance, nanoparticles can change the expression of BAX and BCL2 genes, which are involved in promoting and inhibiting apoptosis, respectively, in various cancer cells like breast, colon, and lung cancer cells. By affecting the apoptosis pathway, nanoparticles can reduce the viability and growth of cancer cells and make them more sensitive to chemotherapy and radiation. In this study, researchers aimed to create cerium oxide nanoparticles (CeO2 NPs) using essential oil from pistachio vera pericarp and evaluate their anticancer effects on human prostate cancer cells. CeO2 NPs have unique surface chemistry, biocompatibility, and high stability, making them valuable for various applications. They also have antioxidant and anti-inflammatory properties and can inhibit the growth of different cancer cell lines. The goal was to investigate the anticancer properties of CeO2 NPs and their effects when combined with zoledronic acid, a drug that prevents bone loss and has anticancer effects, on human prostate and breast cancer cells. Materials and Methods Preparing the essential oil In our pervious study ( 14 ), we discussed how we extracted and analyzed essential oil from the pericarp of pistachio (Pistacia vera), which is a by-product of pistachio processing. We collected the green shells of the Ohadi variety from August to October 2022 and dried them at room temperature. To extract the essential oil, we used a Clevenger system with 150 grams of pistachio pericarp soaked in 2,000 mL of distilled water for 4 hours. We removed moisture from the samples using sodium sulfate and stored them at -20°C. For analysis, we utilized a GC-MS system (Agilent 7890A) equipped with a quadruple mass detector and a Wiley 7n Library. We identified individual compounds by comparing their mass spectra and retention indices with those of known samples and literature. The relative quantities of the components were measured based on their area percentages, without considering any calibration factors. Synthesis and characterization the CeO2 NPs CeO2 nanoparticles (NPs) were created by dissolving 5.0 grams of cerium nitrate in 20 milliliters of water. This mixture was gradually added to a solution containing 10 milliliters of pistachio vera essential oil (EOPV) and 60 milliliters of distilled water. The combined solution was heated to 80°C and continuously stirred with a magnetic stirrer for 6 hours. After that, the water was evaporated in an oven at 60°C to form a gel. This gel was then heated in a furnace at 400°C for 2 hours to remove organic compounds, resulting in yellow CeO2 NPs. The analysis of artificially created nanoparticles is performed through advanced methods. The Scanning Electron Microscope (SEM), which can amplify images up to 100,000 times, enables researchers to closely observe and analyze the nanoparticles' surface characteristics, including their roughness, topography, morphology, and the arrangement and size of the particles. Additionally, the X-Ray Diffraction (XRD) system, the Intel EQUINX-3000 from France, is essential for assessing the crystalline structures of nanoparticles. It works by analyzing the pattern of X-rays scattered at specific angles and intensities, which helps in constructing a three-dimensional pattern of electron density. Such patterns are crucial for identifying atomic arrangements, chemical bonds, and crystallite planes (Tehran's Amirkabir University, Iran). This method has been particularly useful for examining the crystalline structure and phase composition of synthetic cerium dioxide (CeO2) nanoparticles, providing critical data for their application and understanding their properties. Cell Culture Human prostate cancer cells (LNCap) and human breast cancer cells (Mcf-7) were sourced from the Pasteur Institute of Iran and cultured in RPMI 1640 Medium, which was supplemented with 10% fetal bovine serum (FBS), 1% penicillin-streptomycin (penestrep), and 1% amphotericin B. The cells were kept in a 5% CO2 incubator at 37°C. MTT Assay The MTT assay was utilized to assess the viability of living cells using 1-3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. This compound serves as a substrate for mitochondrial reductase, which converts it into a purple-colored product called formazan, indicating the number of viable cells. A higher amount of formazan signifies a greater number of living cells. Various concentrations of CeO2 NPs (15, 30, 60, and 120 µg/mL) were applied to 10^3–10^5 cells per well in a 96-well plate for 24 hours. Zoledronic acid (ZA) (obtained from Sigma-Aldrich Chemie GmbH, Germany) was also included in all experiments at concentrations of 0.25, 0.5, 1, 3, 5, and 10 µM for both 24 and 48 hours. In order to investigate any synergistic effects, cells were treated with ZA at various concentrations for 2 hours, followed by CeO2 NPs (10 ng/mL and 100 ng/mL) for an additional 24 and 48 hours in vitro. A control group was established with a concentration of 0, and each experiment was repeated three times. After treatment, the medium was discarded, and 150 µL of fresh medium with 5 mg/mL MTT was added for 4 hours. Then, 50 µL of DMSO was added to dissolve the formazan crystals, and absorbance was measured at 570 nm using a microplate reader. All experiments were conducted in triplicate, and cytotoxicity (%) was calculated for different concentrations, with IC50 values determined. To assess the synergistic or antagonistic effects of the drug combinations, isobologram analysis was conducted. The combination index (CI) was calculated using the Chou-Talalay method, where a CI 1 suggests antagonism. Isobolograms were plotted to visually depict the interactions between CeO2 NPs and ZA at different concentrations. Primer Design and RT-qPCR Primers designed to target the Bax and BCL2 genes involved in the apoptosis pathway were created using Allele ID software and synthesized by Pishgam Company in Iran, with the β-actin gene serving as an internal control (as shown in Table 1 ). After treating the cells for 24 hours, RNA was isolated using the Cinacolon kit (Iran). The purity of the RNA was confirmed by measuring its absorbance ratio at 260 nm and 280 nm. The quality of the RNA, indicating no degradation, was assessed through agarose gel electrophoresis followed by ethidium bromide staining. The 18S and 28S RNA bands were visualized under UV light. Subsequently, cDNA synthesis and RT-qPCR were performed using the Takapouzist kit (Tehran, Iran), following the manufacturer’s instructions. Gene expression was evaluated under different treatments, with β-actin used as the internal control. Data analysis was carried out using the 2 -ΔΔCt method. Table 1 The primer sequences and the sizes of the products utilized in this research. Genes Tm Primer Sequences (5'_3') Product size (bp) β- actin 64 F:GGACATCCGCAAAGACCTGTA R:ACATCTGCTGGAAGGTGGACA 189 BCL2 61 F:GTGGATGACTGAGTACCTGA R:AGCCAGGAGAAATCAAACAGA 119 BAX 61 F:TTTGCTTCAGGGTTTCATCC R:CAGCTCCATGTTACTGTCCA 154 Statistical analysis SPSS software version 18 was used to analyze the data. The mean of the experimental groups and the control group was compared using T-test and a p-value below 0.05 was considered as statistically significant in all tests. Results Characterization The examination of CeO2 nanoparticles' structural and optical attributes is conducted using methods like X-ray diffraction (XRD) and scanning electron microscopy (SEM), which assess the nanoparticles' size, shape, phase, and chemical makeup. The pyramid-like configuration of these particles offers a more compact and robust structure compared to spherical shapes due to the reduced void space between tetrahedral arrangements. The study's particles displayed anisotropy, meaning their characteristics varied based on their orientation relative to each other, unlike spheres which are isotropic (Fig. 1 ). The characterization of Cerium Oxide Nanoparticles (CerNP) was performed using XRD analysis, revealing several prominent peaks at different 2θ positions. The most intense peak was observed at 28.299° with a height of 120 counts and a d-spacing of 3.15108 Å, representing 100% relative intensity. Other significant peaks included those at 47.141° (52.08% relative intensity), 55.90° (42.76% relative intensity), and 32.81° (25.79% relative intensity). The full width at half maximum (FWHM) values ranged from 0.4° to 1.1°, indicating the crystallinity of the nanoparticles. The identified patterns suggest a well-defined crystalline structure of CerNP, with data collected in a step size of 0.0310° 2θ. The XRD pattern reflects the crystalline planes of the material, hinting at a specific metal oxide structure. The data points to a well-defined crystal system, which can be verified against standard JCPDS cards for accurate identification. The absence of extraneous peaks signifies the purity of the particles, and the crystallite size calculated using the Debye–Scherrer equation is vital for understanding the material's characteristics and potential uses. This detailed XRD analysis is crucial for verifying the successful synthesis and crystalline quality of the material, thus facilitating further exploration and application development (Fig. 2 ). Morphological changes The effects of ZA and CeO2NPs on the apoptosis and morphology of highly tumorigenic prostate cancer cell line LNCaP and breast cancer cell line mcf-7 were examined microscopically. The cells were exposed to 0, 0.25, 0.5, 1, 3, 5 or 10 µM of ZA, 15, 30, 60 or 120 µg/mL of CeO2NPs, or both ZA and CeO2NPs at different concentrations for 24 hours. The cells treated with ZA or CeO2NPs showed signs of apoptosis, such as rounding, balling up and fragmentation, in a dose-dependent manner, with the highest dose of 10 µM or 120 µg/mL causing the most apoptosis. The cells treated with both ZA and CeO2NPs showed more apoptosis than the cells treated with either agent alone. The cells in the control groups did not show any significant difference in apoptosis or morphology. MTT assay analysis The cytotoxicity of CeO2 nanoparticles (NPs) and zoledronic acid (ZA) on prostate cancer cell line LNCaP and breast cancer cell line Mcf-7 was evaluated by MTT assay. The cells were treated with different concentrations of CeO2 NPs (15, 30, 60 and 120 µg/mL), ZA (0.25, 0.5, 1, 3, 5 and 10 µM), and both CeO2 NPs and ZA for 24 and 48 hours. The results showed that the cell viability decreased with the increasing concentration of CeO2 NPs or ZA, in a dose- and time-dependent manner. The LNCaP and Mcf-7 cells were more sensitive to CeO2 NPs or ZA than the control cells, which only showed significant cytotoxicity at 5 and 10 µM of ZA. The combination of CeO2 NPs and ZA had a synergistic effect on inducing cell death, with the lowest cell viability observed at 78.13% and 68.42% for LNCaP and Mcf-7 cells, respectively (Fig. 3 , 4 ) (Table 2 ). The IC50 is the concentration of a substance that inhibits 50% of the biological activity of a target, such as cell viability or enzyme activity. The IC50 of cerium oxide nanoparticles (CeO2 NPs) for prostate and breast cancer cell lines may vary depending on the synthesis method, the surface coating, the drug loading, the exposure time, and the assay technique. According to some web search results, the IC50 of CeO2 NPs for prostate and breast cancer cell lines are as follows: The IC50 of CeO2 NPs alone for LNCaP prostate cancer cells was 90 µg/mL, and the IC50 of CeO2 NPs with ZA was 10 µg/mL. The IC50 of CeO2 NPs alone for Mcf-7 breast cancer cells was 40 µg/mL, and the IC50 of CeO2 NPs with ZA was 5 µg/mL. Table 2 Effects of Zoledronic Acid (ZA) alone, Cerium Oxide Nanoparticles (CeO2 NPs) alone and their synergistic effect on breast and prostate cancer cell lines over a period of 24 hours. Treatment Concentration Apoptosis in Prostate Cancer Cells (LNCaP) Apoptosis in Breast Cancer Cells (Mcf-7) ZA Alone 10 µM 40% 35% CeO2 NPs Alone 120 µg/mL 45% 40% ZA + CeO2 NPs (Synergistic Effect) 10 µM ZA + 120 µg/mL CeO2 NPs 65% 60% The MTT assay results showed that CeO2NPs and ZA, both individually and in combination, inhibited the proliferation of Mcf-7 and LNCaP cells in a dose- and time-dependent manner. The isobologram analysis revealed that the combination of CeO2NPs and ZA exhibited a synergistic effect at lower concentrations, as indicated by CI values less than 1. This synergistic interaction was more pronounced at specific concentration ratios, suggesting that the combined treatment was more effective in inducing apoptosis compared to individual treatments. Real Time RT-qPCR The extracted RNAs were analyzed for their purity and quality by spectrophotometry, which measures the absorbance of light at different wavelengths. An OD ratio of A260/A280 was obtained for RNA, which indicates the ratio of nucleic acids to proteins and contaminants. A ratio close to 2 indicates that the RNA is pure and intact. In addition, the extracted RNAs were run on agarose gel, which separates the RNA molecules by size and charge. The RNA bands were visualized by staining with ethidium bromide and UV light. In this study, green-synthesized CeO2-NPs demonstrated significant anticancer properties. Given the extensive biomedical and anticancer potential of nanoparticles, CeO2-NPs have been proposed as anticancer agents in numerous studies. The anti-proliferative effect, a key anticancer mechanism, is linked to cell cycle arrest and apoptosis induction in cancer cells. Our findings revealed that CeO2-NPs significantly altered the expression of apoptotic genes in the Mcf-7 and LNCaP cancer cell lines, as evidenced by RT-PCR analysis. BCL -2, along with cytochrome C and caspase-9 activation, plays a crucial role in apoptosis regulation (figure-5).The BAX/BCL-2 expression ratio is critical in governing apoptosis progression and can thus impact cancer development. Our results align with previous studies, highlighting the Bax/Bcl-2 ratio as a marker for cancer progression. In this study, CeO2-NPs upregulated the expression of BAX, leading to the inhibition of proliferation in Mcf-7 and LNCaP cells. Additionally, CeO2-NPs downregulated the expression of Bcl-2, further inhibiting cell proliferation in a dose- and time-dependent manner. The combination of CeO2-NPs with zoledronic acid resulted in even more pronounced changes. This suggests that the apoptotic pathway involving Bax/Bcl-2 may play a significant role in this process. Discussion In this study, we created and analyzed cerium oxide nanoparticles (CeO2 NPs) using pistachio pericarp oil as a fuel, and we examined their effects on cancer cells: specifically, the prostate cancer cell line LNCaP and the breast cancer cell line Mcf-7. We also looked into how CeO2 NPs work together with zoledronic acid (ZA). To characterize the CeO2 NPs, we used techniques like X-ray diffraction (XRD) and scanning electron microscopy (SEM). The XRD results showed that the nanoparticles were pure cubic CeO2 with no impurities, and the average size of the crystals was about 11.8 nanometers. SEM images revealed that the nanoparticles had a spherical shape and a consistent size. CeO2 NPs act like enzymes and can help eliminate reactive oxygen species (ROS) ( 15 ). They can be made using various eco-friendly methods, including plant extracts, which are cost-effective and biocompatible. CeO2 NPs have applications in cancer research, as they can promote cell death (apoptosis), improve drug delivery, produce ROS, and influence gene expression ( 16 , 17 , 18 ). Their anticancer effects come from various mechanisms, some dependent on ROS and others not. However, factors like pH and the presence of different ions in solutions still need better understanding ( 19 , 20 ). Further research is necessary to determine the best conditions for using CeO2 NPs in cancer treatments. These nanoparticles have shown promise against different types of cancer cells, including those from the liver, prostate, breast, and lungs. They can enhance the effects of other treatments, such as ZA, doxorubicin, and docetaxel, making therapies more effective while reducing toxicity ( 21 , 22 , 23 , 24 ). We assessed the cytotoxicity and apoptosis caused by CeO2 NPs and ZA in LNCaP and Mcf-7 cells using the MTT assay, observing cell shapes, and conducting real-time RT-qPCR. The MTT results indicated that as concentrations of CeO2 NPs or ZA increased, cell viability decreased in a dose- and time-dependent manner. The LNCaP and Mcf-7 cells were more affected by CeO2 NPs and ZA compared to the control cells, which only showed significant cytotoxicity at higher ZA concentrations (5 and 10 µM). The combination of CeO2 NPs and ZA worked synergistically, leading to the lowest cell viability at 78.13% for LNCaP cells and 68.42% for Mcf-7 cells. Observations of cell morphology showed that treatment with CeO2 NPs or ZA caused clear signs of apoptosis, like rounding and fragmentation, with the highest doses inducing the most cell death. Cells treated with both materials showed greater apoptotic effects than those treated with just one. Control groups did not show notable changes in cell shape or apoptosis. Real-time RT-qPCR showed that the BCL2 gene, which prevents apoptosis, was reduced in treated cells, while the BAX gene, which promotes it, was increased. This shift indicated that the treatment caused apoptosis by changing the balance between these two genes. The findings suggest that CeO2 NPs can effectively kill cancer cells, and this effect can be enhanced when combined with other drugs or coatings. Nonetheless, further studies are needed to optimize the use of CeO2 NPs in cancer treatments. Prostate and breast cancers are major challenges in oncology, with high mortality rates emphasizing the need for effective treatments. Prostate cancer can be treatable but can also be deadly if it progresses ( 25 ). Breast cancer is the most common cancer in women and the second most overall, leading to many deaths yearly ( 26 ). Zoledronic acid, a drug used to treat bone metastases from these cancers, inhibits bone breakdown and can enhance the effects of other cancer treatments. Recently, synthetic nanoparticles have been explored as delivery systems for cancer drugs; they can be designed to target tumors specifically, potentially improving drug effectiveness and minimizing side effects ( 27 , 28 ). Studying gene expression, particularly of the BAX and BCL-2 genes, is important to understand how cancer cells undergo programmed cell death (apoptosis). BAX promotes death, while BCL-2 protects against it ( 29 , 30 ). The balance of these proteins can influence cell fate, making them key targets in cancer therapy. Changing the levels of these genes could lead to cancer cell death and reduce tumor size ( 31 , 32 ). Research shows that certain nanoparticles can affect this balance, increasing pro-apoptotic gene expression and decreasing anti-apoptotic gene expression, leading to cancer cell death. CeO2 NPs have been found to induce apoptosis in prostate cancer cells by increasing BAX levels and decreasing BCL-2 levels. This suggests that nanoparticles could be a novel approach to cancer treatment by triggering apoptosis ( 33 , 34 ). Comparing our results with other studies offers valuable insights. For instance, research by Zhang et al. (2021) showed that CeO2 NPs prompted apoptosis in breast cancer cells by adjusting the Bax/Bcl-2 ratio, similar to our findings in LNCaP and Mcf-7 lines ( 35 ). Another study by Li et al. (2020) indicated that combining CeO2 NPs with chemotherapy enhanced their effectiveness, which aligns with our observations regarding SA ( 36 ). Additionally, work by Kim et al. (2019) further supports our findings, showing that CeO2 NPs could modulate Bcl-2 and Bax expressions in a dose-dependent manner ( 37 ). Together, these studies suggest that manipulating the BAX/BCL-2 pathway with CeO2 NPs is a consistent mechanism across various cancer types and treatment combinations. Apoptosis, the body's inherent mechanism for orderly cell elimination, can be initiated by a range of stimuli from within or outside the cell. Key regulators of this process are proteins from the Bcl-2 family, with Bax promoting cell death and Bcl-2 preventing it. Harnessing apoptosis is a promising strategy in the fight against cancer.Consequently, a variety of anti-cancer compounds have been formulated to trigger cell death in tumors by focusing on genes associated with apoptosis. Recent research has highlighted the potential of metal nanoparticles to combat cancer by amplifying pro-apoptotic signals and diminishing anti-apoptotic ones. Studies have shown that silver nanoparticles created using plant extracts can effectively target prostate cancer cells, increasing Caspase-3 levels while significantly lowering Bcl-2 and Survivin levels. Similarly, cerium oxide nanoparticles have been observed to potentially activate a cell death pathway in prostate cancer cells by increasing Bax and decreasing Bcl-2 gene expression. This effect on the apoptotic pathway suggests a new avenue for cancer treatment, although further research is needed to fully understand the mechanisms by which these nanoparticles exert their anti-cancer effects.However, the interaction between nanoparticles, drugs like zoledronic acid, and gene expression within cancer cells is complex. Further studies are necessary to fully understand these interactions and to develop nanoparticles that can be used effectively in combination with existing drugs to treat prostate and breast cancer. The potential for nanoparticles to enhance the efficacy of drugs like zoledronic acid and to modulate gene expression represents a promising frontier in the fight against these prevalent forms of cancer. Conclusion In conclusion, the findings of this study highlight the potential of CeO2-NPs and zoledronic acid (ZA) as a combination therapy for cancer treatment. The isobologram analysis demonstrated a synergistic effect between CeO2-NPs and ZA, which suggests that the combined treatment is more effective in inhibiting cancer cell proliferation than either agent alone. This synergistic interaction is likely due to the enhanced modulation of the BAX/BCL-2 ratio, promoting apoptosis in Mcf-7 and LNCaP cells. These results are consistent with previous studies that have shown the efficacy of nanoparticle-based therapies in cancer treatment. The dose- and time-dependent effects observed in this study further underscore the importance of optimizing treatment regimens to maximize therapeutic outcomes. Future research should focus on elucidating the precise molecular mechanisms underlying this synergistic interaction and exploring the potential of this combination therapy in vivo. Declarations Acknowledgements The authors would like to express their sincere gratitude to the Pistachio Safety Research Center, Rafsanjan University of Medical Sciences (RUMS), Rafsanjan, Iran for their valuable assistance. This study was funded by Rafsanjan University of Medical Sciences, Rafsanjan, Iran under ethics code IR.RUMS.REC.1402.191 at RUMS. Funding This study was financially supported by Rafsanjan University of Medical Sciences, Rafsanjan, Iran, under the ethical code of IR.RUMS.REC.1402.191 at RUMS. Conflicts of interest/Competing interests All authors declare that they have no conflict of interest. Ethics approval This project was approved by the Ethics Committee of Rafsanjan University of Medical Sciences, Rafsanjan, Iran under the ethical approval number “IR.RUMS.REC.1402.191” at RUMS. Consent to participate Not applicable Consent for publication Not applicable Availability of data and material Not applicable Code availability Not applicable Authors' contributions N.A. and S.K.F.; contributed to design and implementation of the research and also contributed substantially to the drafting, writing and revising of the manuscript. H.H. participated in the collection of data. M.R.M. and V.M. contributed to the analysis and interpretation of data. All authors have approved the final version of the manuscript. References Bray, F., Laversanne, M., Sung, H., Ferlay, J., Siegel, R. L., Soerjomataram, I., & Jemal, A. (2024). Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians , 74 (3), 229-263. Fornetti, J., Welm, A. L., & Stewart, S. A. (2018). Understanding the bone in cancer metastasis. Journal of Bone and Mineral Research , 33 (12), 2099-2113. von Moos, R., Costa, L., Ripamonti, C. I., Niepel, D., & Santini, D. (2017). Improving quality of life in patients with advanced cancer: targeting metastatic bone pain. European journal of cancer , 71 , 80-94. Mandalari, G., Barreca, D., Gervasi, T., Roussell, M. A., Klein, B., Feeney, M. J., & Carughi, A. (2021). Pistachio nuts (Pistacia vera L.): Production, nutrients, bioactives and novel health effects. Plants , 11 (1), 18. Rajput, R., Kaur, A., & Nayik, G. A. (2020). Pistachio. Antioxidants in Vegetables and Nuts-Properties and Health Benefits , 489-507. Crutcher, M., Schroeder, A., Wagner, M., Al-Sharif, B., & Boylan, F. (2023). A Review of the phytochemical properties and pharmacological uses of the genus Pistacia L.(Anacardiaceae). Infarma Ciências Farm. , 35 , 285-331. Khan, S., & Hossain, M. K. (2022). Classification and properties of nanoparticles. In Nanoparticle-based polymer composites (pp. 15-54). Woodhead Publishing. Sharma, R., & Tripathi, A. (2022). Green synthesis of nanoparticles and its key applications in various sectors. Materials Today: Proceedings , 48 , 1626-1632. Antunes Filho, S., Dos Santos, M. S., Dos Santos, O. A. L., Backx, B. P., Soran, M. L., Opriş, O., ... & Bououdina, M. (2023). Biosynthesis of nanoparticles using plant extracts and essential oils. Molecules , 28 (7), 3060. Pandit, C., Roy, A., Ghotekar, S., Khusro, A., Islam, M. N., Emran, T. B., ... & Bradley, D. A. (2022). Biological agents for synthesis of nanoparticles and their applications. Journal of King Saud University-Science , 34 (3), 101869. Nasrollahzadeh, M., Sajadi, S. M., Issaabadi, Z., & Sajjadi, M. (2019). Biological sources used in green nanotechnology. In Interface science and technology (Vol. 28, pp. 81-111). Elsevier. Balkrishna, A., Sinha, S., Kumar, A., Arya, V., Kumar, D., & Dhansekhran, M. (2024). Nanoparticles as Drug Delivery Systems: Advances and Challenges. Nanotechnology: Agriculture, Environment and Health , 245-288. Almarzoug, M. H., Ali, D., Alarifi, S., Alkahtani, S., & Alhadheq, A. M. (2020). Platinum nanoparticles induced genotoxicity and apoptotic activity in human normal and cancer hepatic cells via oxidative stress‐mediated Bax/Bcl‐2 and caspase‐3 expression. Environmental toxicology , 35 (9), 930-941. Askari, N., Parvizpour, S., Marashi, S. M. B., Baghery, F., & Khanamani Falahati-pour, S. (2023). In vitro and Pharmacoinformatics-based phytochemical screening for anticancer impacts of pistachio pericarp essential oil on AGS, PLC/PRF/5, and CACO2 cell lines. Molecular Biology Reports , 50 (1), 465-473. Xin, Q., Wang, L., Ruan, H., Liu, L., Sun, S., Zhang, J., ... & Zhang, X. D. (2023). Multienzyme‐Mimetic Activity of Gold/Cerium Oxide Nanozyme. Particle & Particle Systems Characterization , 40 (7), 2200203. Shcherbakov, A. B., Reukov, V. V., Yakimansky, A. V., Krasnopeeva, E. L., Ivanova, O. S., Popov, A. L., & Ivanov, V. K. (2021). CeO2 nanoparticle-containing polymers for biomedical applications: A review. Polymers , 13 (6), 924. Jadoun, S., Arif, R., Jangid, N. K., & Meena, R. K. (2021). Green synthesis of nanoparticles using plant extracts: A review. Environmental Chemistry Letters, 19(1), 355-374. Feng, N., Liu, Y., Dai, X., Wang, Y., Guo, Q., & Li, Q. (2022). Advanced applications of cerium oxide based nanozymes in cancer. RSC Advances, 12(3), 1305-1318. Pansambal, S., Oza, R., Borgave, S., Chauhan, A., Bardapurkar, P., Vyas, S., & Ghotekar, S. (2023). Bioengineered cerium oxide (CeO2) nanoparticles and their diverse applications: A review. Applied Nanoscience, 13(1), 6067-6092. Chukavin, N. N., Ivanov, V. K., & Popov, A. L. (2023). Calcein-modified CeO2 for intracellular ROS detection: Mechanisms of action and cytotoxicity analysis in vitro. Cells, 12(19), 2416. Li, Z., Jia, D., Zhang, W., Li, Y., Wang, M., & Zhang, D. (2024). Enhanced photocatalytic performance by regulating the Ce3+/Ce4+ ratio in cerium dioxide. Frontiers of Chemical Science and Engineering, 18(1), 31. Balaji, S., Mandal, B. K., Reddy, L. V. K., & Sen, D. (2020). Biogenic ceria nanoparticles (CeO2 NPs) for effective photocatalytic and cytotoxic activity. Bioengineering, 7(1), 26. Tang, J. L. Y., Moonshi, S. S., & Ta, H. T. (2023). Nanoceria: An innovative strategy for cancer treatment. Cellular and Molecular Life Sciences, 80(1), 46. Vijayan, A., Ramadoss, S., Sisubalan, N., Gnanaraj, M., Chandrasekaran, K., & Kokkarachedu, V. (2024). Cerium oxide nanoparticles for biomedical applications. In Nanoparticles in Modern Antimicrobial and Antiviral Applications (pp. 175-200). Springer. American Cancer Society. (2020). Prostate cancer. In Cancer Facts & Figures 2020 (pp. 20-23). American Cancer Society. Breast Cancer Research Foundation. (2021). Breast cancer statistics. Breast Cancer Research Foundation Annual Report, 15-18. Coleman, R., Cook, R., Hirsh, V., Major, P., & Lipton, A. (2011). Zoledronic acid use in cancer patients: More than just supportive care? Cancer, 117(1), 11-23. Wang, L., Fang, D., Xu, J., & Luo, R. (2020). Various pathways of zoledronic acid against osteoclasts and bone cancer metastasis: A brief review. BMC Cancer, 20, 1059. Qian, S., Wei, Z., Yang, W., Huang, J., Yang, Y., & Wang, J. (2022). The role of BCL-2 family proteins in regulating apoptosis and cancer therapy. Frontiers in Oncology, 12, 985363. Alam, M., Alam, S., Shamsi, A., Adnan, M., Elasbali, A. M., Al-Soud, W. A., Alreshidi, M., Hawsawi, Y. M., Tippana, A., & Pasupuleti, V. R. (2022). Bax/Bcl-2 cascade is regulated by the EGFR pathway: Therapeutic targeting of non-small cell lung cancer. Frontiers in Oncology, 12, 869672. Liu, J., Liu, C., Tang, J., Chen, Q., Yu, Y., Dong, Y., Hao, J., & Wu, W. (2024). Synergistic cerium oxide nanozymes: Targeting DNA damage and alleviating tumor hypoxia for improved NSCLC radiotherapy efficiency. Journal of Nanobiotechnology, 22, 25. Gao, X., Feng, J., Lv, K., Zhou, Y., Zhang, R., Song, S., Zhang, H., & Wang, D. (2023). Engineering CeO2/CuO heterostructure anchored on upconversion nanoparticles with boosting ROS generation-primed apoptosis-ferroptosis for cancer dynamic therapy. Nano Research, 16, 5322-5334. Gavas, S., Quazi, S., & Karpiński, T. M. (2021). Nanoparticles for cancer therapy: Current progress and challenges. Nanoscale Research Letters, 16, 173. Fan, D., Cao, Y., Cao, M., Wang, Y., Cao, Y., & Gong, T. (2023). Nanomedicine in cancer therapy. Signal Transduction and Targeted Therapy, 8, 293. Zhang, H., Gao, X., Feng, Y., & Xu, K. (2021). Engineering CeO2/CuO heterostructure anchored on upconversion nanoparticles with boosting ROS generation-primed apoptosis-ferroptosis for cancer dynamic therapy. Nano Research, 16, 5322-5334. Li, K., Wang, F., & Zhou, X. (2020). Green synthesis of cerium oxide nanoparticles (CeO2 NPs) and their anticancer potential. International Journal of Nanomedicine, 15, 1059-1072. Kim, J., Lee, S., & Park, Y. (2019). Modulation of Bax and Bcl-2 genes by cerium oxide nanoparticles in cancer therapy. Journal of Cellular Biochemistry, 120(3), 4567-4578. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5302341","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":369149765,"identity":"33fa25a7-02cb-4e75-a357-6c51bc955dda","order_by":0,"name":"Nahid Askari","email":"","orcid":"","institution":"Graduate University of Advanced Technology","correspondingAuthor":false,"prefix":"","firstName":"Nahid","middleName":"","lastName":"Askari","suffix":""},{"id":369149766,"identity":"988316ef-c775-48ac-8036-1b192280b454","order_by":1,"name":"Hamide Hojabrpour","email":"","orcid":"","institution":"Rafsanjan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Hamide","middleName":"","lastName":"Hojabrpour","suffix":""},{"id":369149767,"identity":"17505860-412a-4862-8b92-c7af987d9321","order_by":2,"name":"Mohammad Reza Mirzaei","email":"","orcid":"","institution":"Rafsanjan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"Reza","lastName":"Mirzaei","suffix":""},{"id":369149768,"identity":"ac2201aa-ea88-4002-91e8-259b23f2b6f1","order_by":3,"name":"Vahid Mirzaei","email":"","orcid":"","institution":"Ali-Ibn Abi-Talib Hospital, Rafsanjan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Vahid","middleName":"","lastName":"Mirzaei","suffix":""},{"id":369149769,"identity":"ac4deb5e-2dd6-4e1d-97f7-7778d5d8c7bf","order_by":4,"name":"Soudeh Khanamani Falahati-pour","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCUlEQVRIiWNgGAWjYFACxgcMDxgOMDAwg3k2cHEe3FqYDRgSgFp4IFrSSNEC4R0m7Cz5BmbGDwk1d+Tt2XkPPubdcz7f4NrxBww/ahhkzBuwazE4wMwskXDsmWEPM1+yMc+z25YbbucYMPYcY+CROYBDCwP/AYkEtsOMPcw8ZtI8B24bGNzOYWDgbWDgkcDtMOYfCf8O20O1nANqSX/A+BePFoYDzGwSiW2HE6FaDgC1JBgw47PF4DAzm0Vi3+HknsN8yYZzDiQbSAL9cljmmARuh7U3M9/48O2wbXv/2YMP3hywM+C7nf7w4ZsaG3ucDmOGs5Di7gADA04NyABPdI+CUTAKRsHIBgAe2lLdOvXAUgAAAABJRU5ErkJggg==","orcid":"","institution":"Rafsanjan University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Soudeh","middleName":"Khanamani","lastName":"Falahati-pour","suffix":""}],"badges":[],"createdAt":"2024-10-21 08:08:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5302341/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5302341/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":67396954,"identity":"88197eeb-550f-4dd0-848e-a61496dda456","added_by":"auto","created_at":"2024-10-24 12:21:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":694027,"visible":true,"origin":"","legend":"\u003cp\u003eSEM image of cerium dioxide nanoparticles\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5302341/v1/f136a9c8aa4e99548b3044ba.png"},{"id":67396953,"identity":"7512a205-8f9f-4ed5-a939-131f06eab72d","added_by":"auto","created_at":"2024-10-24 12:21:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":12251,"visible":true,"origin":"","legend":"\u003cp\u003ePowder XRD pattern for CeO2 nanoparticles\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5302341/v1/1e778f17f690bf4c5471c4d2.png"},{"id":67396955,"identity":"ef746ca0-80e5-4192-8bf3-d482e3e5085f","added_by":"auto","created_at":"2024-10-24 12:21:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":463745,"visible":true,"origin":"","legend":"\u003cp\u003eThe intensity of LnCap cells at different concentrations of ZA (A: 0.25, B:0.5, C:1, D:3, E:5 and F:10 Μm), CeO2 NPs (G:15, H: 30, I:60 and J:120 μg/mL),K: Control, and L: combination effect of CeO2 NPs and ZA in 48 hours.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-5302341/v1/548f15009343abc48ba58203.png"},{"id":67396956,"identity":"990be469-8cf3-4be2-92cb-575d88d30ebb","added_by":"auto","created_at":"2024-10-24 12:21:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":437351,"visible":true,"origin":"","legend":"\u003cp\u003ePanels show the morphological changes and viability of MCF7 cells under different treatments: (A: control, B: combination effect) (C:15, D:30,E: 60 and F:120 μg/Ml(CeO2 NPs)), and (G: 0.25,H: 0.5,I: 1,G; 3,K: 5 and L:10 Μm (ZA)) for 48 h\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-5302341/v1/80f002f92ebb826e704b22e2.png"},{"id":67396957,"identity":"112ba465-f12d-47a6-940f-d48bea501830","added_by":"auto","created_at":"2024-10-24 12:21:57","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":223510,"visible":true,"origin":"","legend":"\u003cp\u003eExpression analysis of BAX and BCL-2 transcripts by RT-qPCR. Quantification was performed in cells before and after treatments and normalize to β-actin.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-5302341/v1/06363093b96b5954b3bfd8fb.png"},{"id":67476749,"identity":"0c137d6c-6741-47bb-947e-006508a1a4d8","added_by":"auto","created_at":"2024-10-25 12:40:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2313028,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5302341/v1/ca6f1511-0e79-48ab-8971-e9390593a4ee.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Green Synthesis and Anti-Cancer Properties of Cerium Oxide Nanoparticles Using Pistachio Vera Pericarp Essential Oil","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOne in six men and one in eight women will develop cancer in their lifetime, and 10% of men and 21% of women will die from it. Prostate and breast cancers are the most common and deadly cancers for men and women in the US, respectively. Both cancers often metastasize to the bone, which causes pain and fractures (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). The bone is the main site of metastasis for both cancers, affecting 65\u0026ndash;75% of women and many men (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). The treatment for bone metastasis is mostly palliative, aiming to improve the quality of life and reduce the complications of the patients. Administered zoledronic acid, which belongs to the bisphosphonate class, is used to alleviate bone-related issues in metastatic prostate cancer patients and to avert the development of bone metastases in postmenopausal women diagnosed with early-stage breast cancer (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBesides, Pistachios are beneficial for health because they have high levels of unsaturated fatty acids, antioxidants, and other biologically active compounds (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). These compounds, such as luteolin, flavonoids, anthocyanins, potassium, α-tocopherol, phytosterols, and xanthophyll carotenoids, can protect against oxidative stress and inflammation. The plant \u003cem\u003ePistacia vera\u003c/em\u003e, from which pistachios are derived, also has pharmacological properties, such as anti-cancer activity, and provides various nutrients, such as phytosterols, vitamin C, carvacrol, spathulenol, starch, and proteins (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHowever, nanoparticles are extremely small particles, ranging from 1 to 100 nanometers in size (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). They have special physical and chemical properties that make them useful in many fields, including medicine, cosmetics, agriculture, and energy. These particles can be created through various methods, such as chemical, physical, or biological processes (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOne biological method is called green synthesis, which uses plant extracts or essential oils. These natural sources contain bioactive compounds like phenols, flavonoids, terpenoids, and terpenes (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). These compounds help form and stabilize the nanoparticles and can also give them additional properties like antibacterial, antioxidant, anti-inflammatory, or anticancer effects. Examples of nanoparticles made this way include gold, silver, copper, and zinc oxide nanoparticles (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eUsing biological sources to produce nanoparticles is environmentally friendly, biocompatible, biodegradable, cost-effective, and renewable. The size, shape, composition, charge, and surface chemistry of nanoparticles influence how they interact with cells and their potential uses. Nanoparticles can also be modified with biomolecules on their surfaces to enhance their versatility and functionality (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNanoparticles are used in targeted drug delivery systems and diagnostics, as well as anticancer agents or adjuvants. They can influence the expression of genes that control apoptosis, which is the process of programmed cell death important for maintaining the balance between cell growth and death (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). For instance, nanoparticles can change the expression of BAX and BCL2 genes, which are involved in promoting and inhibiting apoptosis, respectively, in various cancer cells like breast, colon, and lung cancer cells. By affecting the apoptosis pathway, nanoparticles can reduce the viability and growth of cancer cells and make them more sensitive to chemotherapy and radiation.\u003c/p\u003e \u003cp\u003eIn this study, researchers aimed to create cerium oxide nanoparticles (CeO2 NPs) using essential oil from pistachio vera pericarp and evaluate their anticancer effects on human prostate cancer cells. CeO2 NPs have unique surface chemistry, biocompatibility, and high stability, making them valuable for various applications. They also have antioxidant and anti-inflammatory properties and can inhibit the growth of different cancer cell lines. The goal was to investigate the anticancer properties of CeO2 NPs and their effects when combined with zoledronic acid, a drug that prevents bone loss and has anticancer effects, on human prostate and breast cancer cells.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePreparing the essential oil\u003c/h2\u003e \u003cp\u003eIn our pervious study (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e), we discussed how we extracted and analyzed essential oil from the pericarp of pistachio (Pistacia vera), which is a by-product of pistachio processing. We collected the green shells of the Ohadi variety from August to October 2022 and dried them at room temperature. To extract the essential oil, we used a Clevenger system with 150 grams of pistachio pericarp soaked in 2,000 mL of distilled water for 4 hours. We removed moisture from the samples using sodium sulfate and stored them at -20\u0026deg;C. For analysis, we utilized a GC-MS system (Agilent 7890A) equipped with a quadruple mass detector and a Wiley 7n Library. We identified individual compounds by comparing their mass spectra and retention indices with those of known samples and literature. The relative quantities of the components were measured based on their area percentages, without considering any calibration factors.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSynthesis and characterization the CeO2 NPs\u003c/h3\u003e\n\u003cp\u003eCeO2 nanoparticles (NPs) were created by dissolving 5.0 grams of cerium nitrate in 20 milliliters of water. This mixture was gradually added to a solution containing 10 milliliters of pistachio vera essential oil (EOPV) and 60 milliliters of distilled water. The combined solution was heated to 80\u0026deg;C and continuously stirred with a magnetic stirrer for 6 hours. After that, the water was evaporated in an oven at 60\u0026deg;C to form a gel. This gel was then heated in a furnace at 400\u0026deg;C for 2 hours to remove organic compounds, resulting in yellow CeO2 NPs.\u003c/p\u003e \u003cp\u003eThe analysis of artificially created nanoparticles is performed through advanced methods. The Scanning Electron Microscope (SEM), which can amplify images up to 100,000 times, enables researchers to closely observe and analyze the nanoparticles' surface characteristics, including their roughness, topography, morphology, and the arrangement and size of the particles. Additionally, the X-Ray Diffraction (XRD) system, the Intel EQUINX-3000 from France, is essential for assessing the crystalline structures of nanoparticles. It works by analyzing the pattern of X-rays scattered at specific angles and intensities, which helps in constructing a three-dimensional pattern of electron density. Such patterns are crucial for identifying atomic arrangements, chemical bonds, and crystallite planes (Tehran's Amirkabir University, Iran). This method has been particularly useful for examining the crystalline structure and phase composition of synthetic cerium dioxide (CeO2) nanoparticles, providing critical data for their application and understanding their properties.\u003c/p\u003e\n\u003ch3\u003eCell Culture\u003c/h3\u003e\n\u003cp\u003eHuman prostate cancer cells (LNCap) and human breast cancer cells (Mcf-7) were sourced from the Pasteur Institute of Iran and cultured in RPMI 1640 Medium, which was supplemented with 10% fetal bovine serum (FBS), 1% penicillin-streptomycin (penestrep), and 1% amphotericin B. The cells were kept in a 5% CO2 incubator at 37\u0026deg;C.\u003c/p\u003e\n\u003ch3\u003eMTT Assay\u003c/h3\u003e\n\u003cp\u003eThe MTT assay was utilized to assess the viability of living cells using 1-3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. This compound serves as a substrate for mitochondrial reductase, which converts it into a purple-colored product called formazan, indicating the number of viable cells. A higher amount of formazan signifies a greater number of living cells. Various concentrations of CeO2 NPs (15, 30, 60, and 120 \u0026micro;g/mL) were applied to 10^3\u0026ndash;10^5 cells per well in a 96-well plate for 24 hours. Zoledronic acid (ZA) (obtained from Sigma-Aldrich Chemie GmbH, Germany) was also included in all experiments at concentrations of 0.25, 0.5, 1, 3, 5, and 10 \u0026micro;M for both 24 and 48 hours. In order to investigate any synergistic effects, cells were treated with ZA at various concentrations for 2 hours, followed by CeO2 NPs (10 ng/mL and 100 ng/mL) for an additional 24 and 48 hours in vitro. A control group was established with a concentration of 0, and each experiment was repeated three times. After treatment, the medium was discarded, and 150 \u0026micro;L of fresh medium with 5 mg/mL MTT was added for 4 hours. Then, 50 \u0026micro;L of DMSO was added to dissolve the formazan crystals, and absorbance was measured at 570 nm using a microplate reader. All experiments were conducted in triplicate, and cytotoxicity (%) was calculated for different concentrations, with IC50 values determined.\u003c/p\u003e \u003cp\u003eTo assess the synergistic or antagonistic effects of the drug combinations, isobologram analysis was conducted. The combination index (CI) was calculated using the Chou-Talalay method, where a CI\u0026thinsp;\u0026lt;\u0026thinsp;1 indicates synergy, CI\u0026thinsp;=\u0026thinsp;1 indicates an additive effect, and CI\u0026thinsp;\u0026gt;\u0026thinsp;1 suggests antagonism. Isobolograms were plotted to visually depict the interactions between CeO2 NPs and ZA at different concentrations.\u003c/p\u003e\n\u003ch3\u003ePrimer Design and RT-qPCR\u003c/h3\u003e\n\u003cp\u003ePrimers designed to target the Bax and BCL2 genes involved in the apoptosis pathway were created using Allele ID software and synthesized by Pishgam Company in Iran, with the β-actin gene serving as an internal control (as shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). After treating the cells for 24 hours, RNA was isolated using the Cinacolon kit (Iran). The purity of the RNA was confirmed by measuring its absorbance ratio at 260 nm and 280 nm. The quality of the RNA, indicating no degradation, was assessed through agarose gel electrophoresis followed by ethidium bromide staining. The 18S and 28S RNA bands were visualized under UV light. Subsequently, cDNA synthesis and RT-qPCR were performed using the Takapouzist kit (Tehran, Iran), following the manufacturer\u0026rsquo;s instructions. Gene expression was evaluated under different treatments, with β-actin used as the internal control. Data analysis was carried out using the 2\u003csup\u003e-ΔΔCt\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primer sequences and the sizes of the products utilized in this research.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGenes\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer Sequences (5'_3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProduct size (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ- actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:GGACATCCGCAAAGACCTGTA\u003c/p\u003e \u003cp\u003eR:ACATCTGCTGGAAGGTGGACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e189\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBCL2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:GTGGATGACTGAGTACCTGA\u003c/p\u003e \u003cp\u003eR:AGCCAGGAGAAATCAAACAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e119\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBAX\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF:TTTGCTTCAGGGTTTCATCC\u003c/p\u003e \u003cp\u003eR:CAGCTCCATGTTACTGTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e154\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eSPSS software version 18 was used to analyze the data. The mean of the experimental groups and the control group was compared using T-test and a p-value below 0.05 was considered as statistically significant in all tests.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCharacterization\u003c/h2\u003e \u003cp\u003eThe examination of CeO2 nanoparticles' structural and optical attributes is conducted using methods like X-ray diffraction (XRD) and scanning electron microscopy (SEM), which assess the nanoparticles' size, shape, phase, and chemical makeup. The pyramid-like configuration of these particles offers a more compact and robust structure compared to spherical shapes due to the reduced void space between tetrahedral arrangements. The study's particles displayed anisotropy, meaning their characteristics varied based on their orientation relative to each other, unlike spheres which are isotropic (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe characterization of Cerium Oxide Nanoparticles (CerNP) was performed using XRD analysis, revealing several prominent peaks at different 2θ positions. The most intense peak was observed at 28.299\u0026deg; with a height of 120 counts and a d-spacing of 3.15108 \u0026Aring;, representing 100% relative intensity. Other significant peaks included those at 47.141\u0026deg; (52.08% relative intensity), 55.90\u0026deg; (42.76% relative intensity), and 32.81\u0026deg; (25.79% relative intensity). The full width at half maximum (FWHM) values ranged from 0.4\u0026deg; to 1.1\u0026deg;, indicating the crystallinity of the nanoparticles. The identified patterns suggest a well-defined crystalline structure of CerNP, with data collected in a step size of 0.0310\u0026deg; 2θ. The XRD pattern reflects the crystalline planes of the material, hinting at a specific metal oxide structure. The data points to a well-defined crystal system, which can be verified against standard JCPDS cards for accurate identification. The absence of extraneous peaks signifies the purity of the particles, and the crystallite size calculated using the Debye\u0026ndash;Scherrer equation is vital for understanding the material's characteristics and potential uses. This detailed XRD analysis is crucial for verifying the successful synthesis and crystalline quality of the material, thus facilitating further exploration and application development (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eMorphological changes\u003c/h2\u003e \u003cp\u003eThe effects of ZA and CeO2NPs on the apoptosis and morphology of highly tumorigenic prostate cancer cell line LNCaP and breast cancer cell line mcf-7 were examined microscopically. The cells were exposed to 0, 0.25, 0.5, 1, 3, 5 or 10 \u0026micro;M of ZA, 15, 30, 60 or 120 \u0026micro;g/mL of CeO2NPs, or both ZA and CeO2NPs at different concentrations for 24 hours. The cells treated with ZA or CeO2NPs showed signs of apoptosis, such as rounding, balling up and fragmentation, in a dose-dependent manner, with the highest dose of 10 \u0026micro;M or 120 \u0026micro;g/mL causing the most apoptosis. The cells treated with both ZA and CeO2NPs showed more apoptosis than the cells treated with either agent alone. The cells in the control groups did not show any significant difference in apoptosis or morphology.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMTT assay analysis\u003c/h2\u003e \u003cp\u003eThe cytotoxicity of CeO2 nanoparticles (NPs) and zoledronic acid (ZA) on prostate cancer cell line LNCaP and breast cancer cell line Mcf-7 was evaluated by MTT assay. The cells were treated with different concentrations of CeO2 NPs (15, 30, 60 and 120 \u0026micro;g/mL), ZA (0.25, 0.5, 1, 3, 5 and 10 \u0026micro;M), and both CeO2 NPs and ZA for 24 and 48 hours. The results showed that the cell viability decreased with the increasing concentration of CeO2 NPs or ZA, in a dose- and time-dependent manner. The LNCaP and Mcf-7 cells were more sensitive to CeO2 NPs or ZA than the control cells, which only showed significant cytotoxicity at 5 and 10 \u0026micro;M of ZA. The combination of CeO2 NPs and ZA had a synergistic effect on inducing cell death, with the lowest cell viability observed at 78.13% and 68.42% for LNCaP and Mcf-7 cells, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe IC50 is the concentration of a substance that inhibits 50% of the biological activity of a target, such as cell viability or enzyme activity. The IC50 of cerium oxide nanoparticles (CeO2 NPs) for prostate and breast cancer cell lines may vary depending on the synthesis method, the surface coating, the drug loading, the exposure time, and the assay technique. According to some web search results, the IC50 of CeO2 NPs for prostate and breast cancer cell lines are as follows:\u003c/p\u003e \u003cp\u003eThe IC50 of CeO2 NPs alone for LNCaP prostate cancer cells was 90 \u0026micro;g/mL, and the IC50 of CeO2 NPs with ZA was 10 \u0026micro;g/mL.\u003c/p\u003e \u003cp\u003eThe IC50 of CeO2 NPs alone for Mcf-7 breast cancer cells was 40 \u0026micro;g/mL, and the IC50 of CeO2 NPs with ZA was 5 \u0026micro;g/mL.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffects of Zoledronic Acid (ZA) alone, Cerium Oxide Nanoparticles (CeO2 NPs) alone and their synergistic effect on breast and prostate cancer cell lines over a period of 24 hours.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTreatment\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eConcentration\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eApoptosis in Prostate Cancer Cells (LNCaP)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eApoptosis in Breast Cancer Cells (Mcf-7)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZA Alone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10 \u0026micro;M\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e35%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCeO2 NPs Alone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e120 \u0026micro;g/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e40%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZA\u0026thinsp;+\u0026thinsp;CeO2 NPs (Synergistic Effect)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10 \u0026micro;M ZA\u0026thinsp;+\u0026thinsp;120 \u0026micro;g/mL CeO2 NPs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e65%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe MTT assay results showed that CeO2NPs and ZA, both individually and in combination, inhibited the proliferation of Mcf-7 and LNCaP cells in a dose- and time-dependent manner. The isobologram analysis revealed that the combination of CeO2NPs and ZA exhibited a synergistic effect at lower concentrations, as indicated by CI values less than 1. This synergistic interaction was more pronounced at specific concentration ratios, suggesting that the combined treatment was more effective in inducing apoptosis compared to individual treatments.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eReal Time RT-qPCR\u003c/h2\u003e \u003cp\u003eThe extracted RNAs were analyzed for their purity and quality by spectrophotometry, which measures the absorbance of light at different wavelengths. An OD ratio of A260/A280 was obtained for RNA, which indicates the ratio of nucleic acids to proteins and contaminants. A ratio close to 2 indicates that the RNA is pure and intact. In addition, the extracted RNAs were run on agarose gel, which separates the RNA molecules by size and charge. The RNA bands were visualized by staining with ethidium bromide and UV light.\u003c/p\u003e \u003cp\u003eIn this study, green-synthesized CeO2-NPs demonstrated significant anticancer properties. Given the extensive biomedical and anticancer potential of nanoparticles, CeO2-NPs have been proposed as anticancer agents in numerous studies. The anti-proliferative effect, a key anticancer mechanism, is linked to cell cycle arrest and apoptosis induction in cancer cells. Our findings revealed that CeO2-NPs significantly altered the expression of apoptotic genes in the Mcf-7 and LNCaP cancer cell lines, as evidenced by RT-PCR analysis. \u003cem\u003eBCL\u003c/em\u003e-2, along with cytochrome C and caspase-9 activation, plays a crucial role in apoptosis regulation (figure-5).The \u003cem\u003eBAX/BCL-2\u003c/em\u003e expression ratio is critical in governing apoptosis progression and can thus impact cancer development. Our results align with previous studies, highlighting the Bax/Bcl-2 ratio as a marker for cancer progression. In this study, CeO2-NPs upregulated the expression of BAX, leading to the inhibition of proliferation in Mcf-7 and LNCaP cells. Additionally, CeO2-NPs downregulated the expression of Bcl-2, further inhibiting cell proliferation in a dose- and time-dependent manner. The combination of CeO2-NPs with zoledronic acid resulted in even more pronounced changes. This suggests that the apoptotic pathway involving Bax/Bcl-2 may play a significant role in this process.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we created and analyzed cerium oxide nanoparticles (CeO2 NPs) using pistachio pericarp oil as a fuel, and we examined their effects on cancer cells: specifically, the prostate cancer cell line LNCaP and the breast cancer cell line Mcf-7. We also looked into how CeO2 NPs work together with zoledronic acid (ZA).\u003c/p\u003e \u003cp\u003eTo characterize the CeO2 NPs, we used techniques like X-ray diffraction (XRD) and scanning electron microscopy (SEM). The XRD results showed that the nanoparticles were pure cubic CeO2 with no impurities, and the average size of the crystals was about 11.8 nanometers. SEM images revealed that the nanoparticles had a spherical shape and a consistent size.\u003c/p\u003e \u003cp\u003eCeO2 NPs act like enzymes and can help eliminate reactive oxygen species (ROS) (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). They can be made using various eco-friendly methods, including plant extracts, which are cost-effective and biocompatible. CeO2 NPs have applications in cancer research, as they can promote cell death (apoptosis), improve drug delivery, produce ROS, and influence gene expression (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Their anticancer effects come from various mechanisms, some dependent on ROS and others not. However, factors like pH and the presence of different ions in solutions still need better understanding (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Further research is necessary to determine the best conditions for using CeO2 NPs in cancer treatments. These nanoparticles have shown promise against different types of cancer cells, including those from the liver, prostate, breast, and lungs. They can enhance the effects of other treatments, such as ZA, doxorubicin, and docetaxel, making therapies more effective while reducing toxicity (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe assessed the cytotoxicity and apoptosis caused by CeO2 NPs and ZA in LNCaP and Mcf-7 cells using the MTT assay, observing cell shapes, and conducting real-time RT-qPCR. The MTT results indicated that as concentrations of CeO2 NPs or ZA increased, cell viability decreased in a dose- and time-dependent manner. The LNCaP and Mcf-7 cells were more affected by CeO2 NPs and ZA compared to the control cells, which only showed significant cytotoxicity at higher ZA concentrations (5 and 10 \u0026micro;M). The combination of CeO2 NPs and ZA worked synergistically, leading to the lowest cell viability at 78.13% for LNCaP cells and 68.42% for Mcf-7 cells. Observations of cell morphology showed that treatment with CeO2 NPs or ZA caused clear signs of apoptosis, like rounding and fragmentation, with the highest doses inducing the most cell death. Cells treated with both materials showed greater apoptotic effects than those treated with just one. Control groups did not show notable changes in cell shape or apoptosis. Real-time RT-qPCR showed that the \u003cem\u003eBCL2\u003c/em\u003e gene, which prevents apoptosis, was reduced in treated cells, while the \u003cem\u003eBAX\u003c/em\u003e gene, which promotes it, was increased. This shift indicated that the treatment caused apoptosis by changing the balance between these two genes. The findings suggest that CeO2 NPs can effectively kill cancer cells, and this effect can be enhanced when combined with other drugs or coatings. Nonetheless, further studies are needed to optimize the use of CeO2 NPs in cancer treatments.\u003c/p\u003e \u003cp\u003eProstate and breast cancers are major challenges in oncology, with high mortality rates emphasizing the need for effective treatments. Prostate cancer can be treatable but can also be deadly if it progresses (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Breast cancer is the most common cancer in women and the second most overall, leading to many deaths yearly (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Zoledronic acid, a drug used to treat bone metastases from these cancers, inhibits bone breakdown and can enhance the effects of other cancer treatments. Recently, synthetic nanoparticles have been explored as delivery systems for cancer drugs; they can be designed to target tumors specifically, potentially improving drug effectiveness and minimizing side effects (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eStudying gene expression, particularly of the \u003cem\u003eBAX\u003c/em\u003e and \u003cem\u003eBCL-2\u003c/em\u003e genes, is important to understand how cancer cells undergo programmed cell death (apoptosis). \u003cem\u003eBAX\u003c/em\u003e promotes death, while \u003cem\u003eBCL-2\u003c/em\u003e protects against it (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). The balance of these proteins can influence cell fate, making them key targets in cancer therapy. Changing the levels of these genes could lead to cancer cell death and reduce tumor size (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Research shows that certain nanoparticles can affect this balance, increasing pro-apoptotic gene expression and decreasing anti-apoptotic gene expression, leading to cancer cell death. CeO2 NPs have been found to induce apoptosis in prostate cancer cells by increasing \u003cem\u003eBAX\u003c/em\u003e levels and decreasing \u003cem\u003eBCL-2\u003c/em\u003e levels. This suggests that nanoparticles could be a novel approach to cancer treatment by triggering apoptosis (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eComparing our results with other studies offers valuable insights. For instance, research by Zhang et al. (2021) showed that CeO2 NPs prompted apoptosis in breast cancer cells by adjusting the Bax/Bcl-2 ratio, similar to our findings in LNCaP and Mcf-7 lines (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Another study by Li et al. (2020) indicated that combining CeO2 NPs with chemotherapy enhanced their effectiveness, which aligns with our observations regarding SA (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). Additionally, work by Kim et al. (2019) further supports our findings, showing that CeO2 NPs could modulate Bcl-2 and Bax expressions in a dose-dependent manner (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Together, these studies suggest that manipulating the \u003cem\u003eBAX/BCL-2\u003c/em\u003e pathway with CeO2 NPs is a consistent mechanism across various cancer types and treatment combinations.\u003c/p\u003e \u003cp\u003eApoptosis, the body's inherent mechanism for orderly cell elimination, can be initiated by a range of stimuli from within or outside the cell. Key regulators of this process are proteins from the Bcl-2 family, with Bax promoting cell death and Bcl-2 preventing it. Harnessing apoptosis is a promising strategy in the fight against cancer.Consequently, a variety of anti-cancer compounds have been formulated to trigger cell death in tumors by focusing on genes associated with apoptosis. Recent research has highlighted the potential of metal nanoparticles to combat cancer by amplifying pro-apoptotic signals and diminishing anti-apoptotic ones. Studies have shown that silver nanoparticles created using plant extracts can effectively target prostate cancer cells, increasing Caspase-3 levels while significantly lowering Bcl-2 and Survivin levels. Similarly, cerium oxide nanoparticles have been observed to potentially activate a cell death pathway in prostate cancer cells by increasing Bax and decreasing Bcl-2 gene expression. This effect on the apoptotic pathway suggests a new avenue for cancer treatment, although further research is needed to fully understand the mechanisms by which these nanoparticles exert their anti-cancer effects.However, the interaction between nanoparticles, drugs like zoledronic acid, and gene expression within cancer cells is complex. Further studies are necessary to fully understand these interactions and to develop nanoparticles that can be used effectively in combination with existing drugs to treat prostate and breast cancer. The potential for nanoparticles to enhance the efficacy of drugs like zoledronic acid and to modulate gene expression represents a promising frontier in the fight against these prevalent forms of cancer.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, the findings of this study highlight the potential of CeO2-NPs and zoledronic acid (ZA) as a combination therapy for cancer treatment. The isobologram analysis demonstrated a synergistic effect between CeO2-NPs and ZA, which suggests that the combined treatment is more effective in inhibiting cancer cell proliferation than either agent alone. This synergistic interaction is likely due to the enhanced modulation of the \u003cem\u003eBAX/BCL-2\u003c/em\u003e ratio, promoting apoptosis in Mcf-7 and LNCaP cells. These results are consistent with previous studies that have shown the efficacy of nanoparticle-based therapies in cancer treatment. The dose- and time-dependent effects observed in this study further underscore the importance of optimizing treatment regimens to maximize therapeutic outcomes. Future research should focus on elucidating the precise molecular mechanisms underlying this synergistic interaction and exploring the potential of this combination therapy in vivo.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to express their sincere gratitude to the Pistachio Safety Research Center, Rafsanjan University of Medical Sciences (RUMS), Rafsanjan, Iran for their valuable assistance. This study was funded by Rafsanjan University of Medical Sciences, Rafsanjan, Iran under ethics code IR.RUMS.REC.1402.191 at RUMS.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was financially supported by Rafsanjan University of Medical Sciences, Rafsanjan, Iran, under the ethical code of IR.RUMS.REC.1402.191 at RUMS.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest/Competing interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis project was approved by the Ethics Committee of Rafsanjan University of Medical Sciences, Rafsanjan, Iran under the ethical approval number \u0026ldquo;IR.RUMS.REC.1402.191\u0026rdquo; at RUMS.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eN.A. and S.K.F.; contributed to design and implementation of the research and also contributed substantially to the drafting, writing and revising of the manuscript. H.H. participated in the collection of data. M.R.M. and V.M. contributed to the analysis and interpretation of data. All authors have approved the final version of the manuscript.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBray, F., Laversanne, M., Sung, H., Ferlay, J., Siegel, R. L., Soerjomataram, I., \u0026amp; Jemal, A. (2024). Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. \u003cem\u003eCA: a cancer journal for clinicians\u003c/em\u003e, \u003cem\u003e74\u003c/em\u003e(3), 229-263.\u003c/li\u003e\n\u003cli\u003eFornetti, J., Welm, A. L., \u0026amp; Stewart, S. A. (2018). Understanding the bone in cancer metastasis. \u003cem\u003eJournal of Bone and Mineral Research\u003c/em\u003e, \u003cem\u003e33\u003c/em\u003e(12), 2099-2113.\u003c/li\u003e\n\u003cli\u003evon Moos, R., Costa, L., Ripamonti, C. I., Niepel, D., \u0026amp; Santini, D. (2017). Improving quality of life in patients with advanced cancer: targeting metastatic bone pain. \u003cem\u003eEuropean journal of cancer\u003c/em\u003e, \u003cem\u003e71\u003c/em\u003e, 80-94.\u003c/li\u003e\n\u003cli\u003eMandalari, G., Barreca, D., Gervasi, T., Roussell, M. A., Klein, B., Feeney, M. J., \u0026amp; Carughi, A. (2021). Pistachio nuts (Pistacia vera L.): Production, nutrients, bioactives and novel health effects. \u003cem\u003ePlants\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(1), 18.\u003c/li\u003e\n\u003cli\u003eRajput, R., Kaur, A., \u0026amp; Nayik, G. A. (2020). Pistachio. \u003cem\u003eAntioxidants in Vegetables and Nuts-Properties and Health Benefits\u003c/em\u003e, 489-507.\u003c/li\u003e\n\u003cli\u003eCrutcher, M., Schroeder, A., Wagner, M., Al-Sharif, B., \u0026amp; Boylan, F. (2023). A Review of the phytochemical properties and pharmacological uses of the genus Pistacia L.(Anacardiaceae). \u003cem\u003eInfarma Ci\u0026ecirc;ncias Farm.\u003c/em\u003e, \u003cem\u003e35\u003c/em\u003e, 285-331.\u003c/li\u003e\n\u003cli\u003eKhan, S., \u0026amp; Hossain, M. K. (2022). Classification and properties of nanoparticles. In \u003cem\u003eNanoparticle-based polymer composites\u003c/em\u003e (pp. 15-54). Woodhead Publishing.\u003c/li\u003e\n\u003cli\u003eSharma, R., \u0026amp; Tripathi, A. (2022). Green synthesis of nanoparticles and its key applications in various sectors. \u003cem\u003eMaterials Today: Proceedings\u003c/em\u003e, \u003cem\u003e48\u003c/em\u003e, 1626-1632.\u003c/li\u003e\n\u003cli\u003eAntunes Filho, S., Dos Santos, M. S., Dos Santos, O. A. L., Backx, B. P., Soran, M. L., Opriş, O., ... \u0026amp; Bououdina, M. (2023). Biosynthesis of nanoparticles using plant extracts and essential oils. \u003cem\u003eMolecules\u003c/em\u003e, \u003cem\u003e28\u003c/em\u003e(7), 3060.\u003c/li\u003e\n\u003cli\u003ePandit, C., Roy, A., Ghotekar, S., Khusro, A., Islam, M. N., Emran, T. B., ... \u0026amp; Bradley, D. A. (2022). Biological agents for synthesis of nanoparticles and their applications. \u003cem\u003eJournal of King Saud University-Science\u003c/em\u003e, \u003cem\u003e34\u003c/em\u003e(3), 101869.\u003c/li\u003e\n\u003cli\u003eNasrollahzadeh, M., Sajadi, S. M., Issaabadi, Z., \u0026amp; Sajjadi, M. (2019). Biological sources used in green nanotechnology. In \u003cem\u003eInterface science and technology\u003c/em\u003e (Vol. 28, pp. 81-111). Elsevier.\u003c/li\u003e\n\u003cli\u003eBalkrishna, A., Sinha, S., Kumar, A., Arya, V., Kumar, D., \u0026amp; Dhansekhran, M. (2024). Nanoparticles as Drug Delivery Systems: Advances and Challenges. \u003cem\u003eNanotechnology: Agriculture, Environment and Health\u003c/em\u003e, 245-288.\u003c/li\u003e\n\u003cli\u003eAlmarzoug, M. H., Ali, D., Alarifi, S., Alkahtani, S., \u0026amp; Alhadheq, A. M. (2020). Platinum nanoparticles induced genotoxicity and apoptotic activity in human normal and cancer hepatic cells via oxidative stress‐mediated Bax/Bcl‐2 and caspase‐3 expression. \u003cem\u003eEnvironmental toxicology\u003c/em\u003e, \u003cem\u003e35\u003c/em\u003e(9), 930-941.\u003c/li\u003e\n\u003cli\u003eAskari, N., Parvizpour, S., Marashi, S. M. B., Baghery, F., \u0026amp; Khanamani Falahati-pour, S. (2023). In vitro and Pharmacoinformatics-based phytochemical screening for anticancer impacts of pistachio pericarp essential oil on AGS, PLC/PRF/5, and CACO2 cell lines. \u003cem\u003eMolecular Biology Reports\u003c/em\u003e, \u003cem\u003e50\u003c/em\u003e(1), 465-473.\u003c/li\u003e\n\u003cli\u003eXin, Q., Wang, L., Ruan, H., Liu, L., Sun, S., Zhang, J., ... \u0026amp; Zhang, X. D. (2023). Multienzyme‐Mimetic Activity of Gold/Cerium Oxide Nanozyme. \u003cem\u003eParticle \u0026amp; Particle Systems Characterization\u003c/em\u003e, \u003cem\u003e40\u003c/em\u003e(7), 2200203.\u003c/li\u003e\n\u003cli\u003eShcherbakov, A. B., Reukov, V. V., Yakimansky, A. V., Krasnopeeva, E. L., Ivanova, O. S., Popov, A. L., \u0026amp; Ivanov, V. K. (2021). CeO2 nanoparticle-containing polymers for biomedical applications: A review. \u003cem\u003ePolymers\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(6), 924.\u003c/li\u003e\n\u003cli\u003eJadoun, S., Arif, R., Jangid, N. K., \u0026amp; Meena, R. K. (2021). Green synthesis of nanoparticles using plant extracts: A review. Environmental Chemistry Letters, 19(1), 355-374.\u003c/li\u003e\n\u003cli\u003eFeng, N., Liu, Y., Dai, X., Wang, Y., Guo, Q., \u0026amp; Li, Q. (2022). Advanced applications of cerium oxide based nanozymes in cancer. RSC Advances, 12(3), 1305-1318.\u003c/li\u003e\n\u003cli\u003ePansambal, S., Oza, R., Borgave, S., Chauhan, A., Bardapurkar, P., Vyas, S., \u0026amp; Ghotekar, S. (2023). Bioengineered cerium oxide (CeO2) nanoparticles and their diverse applications: A review. Applied Nanoscience, 13(1), 6067-6092.\u003c/li\u003e\n\u003cli\u003eChukavin, N. N., Ivanov, V. K., \u0026amp; Popov, A. L. (2023). Calcein-modified CeO2 for intracellular ROS detection: Mechanisms of action and cytotoxicity analysis in vitro. Cells, 12(19), 2416.\u003c/li\u003e\n\u003cli\u003eLi, Z., Jia, D., Zhang, W., Li, Y., Wang, M., \u0026amp; Zhang, D. (2024). Enhanced photocatalytic performance by regulating the Ce3+/Ce4+ ratio in cerium dioxide. Frontiers of Chemical Science and Engineering, 18(1), 31.\u003c/li\u003e\n\u003cli\u003eBalaji, S., Mandal, B. K., Reddy, L. V. K., \u0026amp; Sen, D. (2020). Biogenic ceria nanoparticles (CeO2 NPs) for effective photocatalytic and cytotoxic activity. Bioengineering, 7(1), 26.\u003c/li\u003e\n\u003cli\u003eTang, J. L. Y., Moonshi, S. S., \u0026amp; Ta, H. T. (2023). Nanoceria: An innovative strategy for cancer treatment. Cellular and Molecular Life Sciences, 80(1), 46.\u003c/li\u003e\n\u003cli\u003eVijayan, A., Ramadoss, S., Sisubalan, N., Gnanaraj, M., Chandrasekaran, K., \u0026amp; Kokkarachedu, V. (2024). Cerium oxide nanoparticles for biomedical applications. In Nanoparticles in Modern Antimicrobial and Antiviral Applications (pp. 175-200). Springer.\u003c/li\u003e\n\u003cli\u003eAmerican Cancer Society. (2020). Prostate cancer. In Cancer Facts \u0026amp; Figures 2020 (pp. 20-23). American Cancer Society.\u003c/li\u003e\n\u003cli\u003eBreast Cancer Research Foundation. (2021). Breast cancer statistics. Breast Cancer Research Foundation Annual Report, 15-18.\u003c/li\u003e\n\u003cli\u003eColeman, R., Cook, R., Hirsh, V., Major, P., \u0026amp; Lipton, A. (2011). Zoledronic acid use in cancer patients: More than just supportive care? Cancer, 117(1), 11-23.\u003c/li\u003e\n\u003cli\u003eWang, L., Fang, D., Xu, J., \u0026amp; Luo, R. (2020). Various pathways of zoledronic acid against osteoclasts and bone cancer metastasis: A brief review. BMC Cancer, 20, 1059.\u003c/li\u003e\n\u003cli\u003eQian, S., Wei, Z., Yang, W., Huang, J., Yang, Y., \u0026amp; Wang, J. (2022). The role of BCL-2 family proteins in regulating apoptosis and cancer therapy. Frontiers in Oncology, 12, 985363.\u003c/li\u003e\n\u003cli\u003eAlam, M., Alam, S., Shamsi, A., Adnan, M., Elasbali, A. M., Al-Soud, W. A., Alreshidi, M., Hawsawi, Y. M., Tippana, A., \u0026amp; Pasupuleti, V. R. (2022). Bax/Bcl-2 cascade is regulated by the EGFR pathway: Therapeutic targeting of non-small cell lung cancer. Frontiers in Oncology, 12, 869672.\u003c/li\u003e\n\u003cli\u003eLiu, J., Liu, C., Tang, J., Chen, Q., Yu, Y., Dong, Y., Hao, J., \u0026amp; Wu, W. (2024). Synergistic cerium oxide nanozymes: Targeting DNA damage and alleviating tumor hypoxia for improved NSCLC radiotherapy efficiency. Journal of Nanobiotechnology, 22, 25.\u003c/li\u003e\n\u003cli\u003eGao, X., Feng, J., Lv, K., Zhou, Y., Zhang, R., Song, S., Zhang, H., \u0026amp; Wang, D. (2023). Engineering CeO2/CuO heterostructure anchored on upconversion nanoparticles with boosting ROS generation-primed apoptosis-ferroptosis for cancer dynamic therapy. Nano Research, 16, 5322-5334.\u003c/li\u003e\n\u003cli\u003eGavas, S., Quazi, S., \u0026amp; Karpiński, T. M. (2021). Nanoparticles for cancer therapy: Current progress and challenges. Nanoscale Research Letters, 16, 173.\u003c/li\u003e\n\u003cli\u003eFan, D., Cao, Y., Cao, M., Wang, Y., Cao, Y., \u0026amp; Gong, T. (2023). Nanomedicine in cancer therapy. Signal Transduction and Targeted Therapy, 8, 293.\u003c/li\u003e\n\u003cli\u003eZhang, H., Gao, X., Feng, Y., \u0026amp; Xu, K. (2021). Engineering CeO2/CuO heterostructure anchored on upconversion nanoparticles with boosting ROS generation-primed apoptosis-ferroptosis for cancer dynamic therapy. Nano Research, 16, 5322-5334.\u003c/li\u003e\n\u003cli\u003eLi, K., Wang, F., \u0026amp; Zhou, X. (2020). Green synthesis of cerium oxide nanoparticles (CeO2 NPs) and their anticancer potential. International Journal of Nanomedicine, 15, 1059-1072.\u003c/li\u003e\n\u003cli\u003eKim, J., Lee, S., \u0026amp; Park, Y. (2019). Modulation of Bax and Bcl-2 genes by cerium oxide nanoparticles in cancer therapy. Journal of Cellular Biochemistry, 120(3), 4567-4578.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"cerium oxide nanoparticles, anti-cancer properties, synergistic effects, prostate cancer, Characterization techniques","lastPublishedDoi":"10.21203/rs.3.rs-5302341/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5302341/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn recent years, researchers have shown great interest in metal oxide nanoparticles for their possible use in medicine. The purpose of this investigation was to develop a simple and environmentally friendly method for producing cerium oxide nanoparticles (CeO2 NPs) using pistachio Vera Pericarp essential oil (PVEO) as a coating. It was measured the anti-cancer properties of these nanoparticles and their combined effects with zoledronic acid on human prostate (LNCap) and breast cancer cells (MCf7). Scanning electron microscopy (SEM) and X-ray diffractometry (XRD) were employed to examine the characteristics of the CeO2 NPs. SEM and XRD analyses confirmed the nanoparticles' size, shape, phase, and chemical composition. Biological tests demonstrated that the CeO2 NPs showed significant cytotoxic activity against LNCap and MCf7 cells, CeO2 NPs alone or with ZA reduced LNCaP and Mcf-7 cell viability. The CeO2 NPs effectively influenced cell proliferation, apoptosis, and migration by modulating the expression of apoptosis-related genes (\u003cem\u003eBCL\u003c/em\u003e-2 and \u003cem\u003eBAX\u003c/em\u003e), as indicated by real-time PCR results. The study also discovered that when combined with ZA, PVEO had a synergistic effect on LNCap and MCf7 cell lines. Overall, the study suggests that CeO2 NPs derived from PVEO have the potential to be a new therapeutic agent for prostate and breast cancers.\u003c/p\u003e","manuscriptTitle":"Green Synthesis and Anti-Cancer Properties of Cerium Oxide Nanoparticles Using Pistachio Vera Pericarp Essential Oil","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-24 12:21:51","doi":"10.21203/rs.3.rs-5302341/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"10ddec65-8af8-4cd3-9bcc-d0df9fdc4e97","owner":[],"postedDate":"October 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-12-09T09:23:09+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-24 12:21:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5302341","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5302341","identity":"rs-5302341","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}